>Feature sequence01 <1 4743 gene locus_tag LOCUS_0010 <1 4743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011183344.1:lipoprotein 2265 2511 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcccaattcaacggtgacatctccaactgg 4791 5009 gene locus_tag LOCUS_0020 4791 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 4966 6336 gene locus_tag LOCUS_0030 4966 6336 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249626.1 protein_id gnl|my_center|LOCUS_0030 6333 7112 gene locus_tag LOCUS_0040 6333 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 7202 7774 gene locus_tag LOCUS_0050 gene cobC 7202 7774 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948519.1 protein_id gnl|my_center|LOCUS_0050 7871 8977 gene locus_tag LOCUS_0060 7871 8977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 9022 9588 gene locus_tag LOCUS_0070 9022 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 9605 10342 gene locus_tag LOCUS_0080 9605 10342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 10451 11710 gene locus_tag LOCUS_0090 10451 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 11710 12900 gene locus_tag LOCUS_0100 11710 12900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 12943 13725 gene locus_tag LOCUS_0110 12943 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 14526 13729 gene locus_tag LOCUS_0120 14526 13729 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_0120 14759 14683 gene locus_tag LOCUS_t0010 14759 14683 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14833 15237 gene locus_tag LOCUS_0130 14833 15237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 15607 15679 gene locus_tag LOCUS_t0020 15607 15679 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 16734 17633 gene locus_tag LOCUS_0140 16734 17633 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_0140 18051 17809 gene locus_tag LOCUS_0150 18051 17809 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_0150 18181 18108 gene locus_tag LOCUS_t0030 18181 18108 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 18328 18741 gene locus_tag LOCUS_0160 18328 18741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 18975 18742 gene locus_tag LOCUS_0170 18975 18742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 19228 19013 gene locus_tag LOCUS_0180 19228 19013 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_0180 20269 19274 gene locus_tag LOCUS_0190 20269 19274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 20359 21105 gene locus_tag LOCUS_0200 gene fabG 20359 21105 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_0200 21627 21118 gene locus_tag LOCUS_0210 21627 21118 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_0210 22021 21949 gene locus_tag LOCUS_t0040 22021 21949 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22106 22456 gene locus_tag LOCUS_0220 22106 22456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 22573 23922 gene locus_tag LOCUS_0230 22573 23922 CDS product single-stranded DNA endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146471.1 protein_id gnl|my_center|LOCUS_0230 24043 24960 gene locus_tag LOCUS_0240 24043 24960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 24946 25018 gene locus_tag LOCUS_t0050 24946 25018 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25066 25242 gene locus_tag LOCUS_0250 25066 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 25520 25939 gene locus_tag LOCUS_0260 25520 25939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 25973 26749 gene locus_tag LOCUS_0270 25973 26749 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107810.1 protein_id gnl|my_center|LOCUS_0270 27414 26746 gene locus_tag LOCUS_0280 27414 26746 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868707.1 protein_id gnl|my_center|LOCUS_0280 27979 27374 gene locus_tag LOCUS_0290 27979 27374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 29354 27981 gene locus_tag LOCUS_0300 29354 27981 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869593.1 protein_id gnl|my_center|LOCUS_0300 29459 29629 gene locus_tag LOCUS_0310 29459 29629 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_0310 29691 30083 gene locus_tag LOCUS_0320 29691 30083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 30146 30727 gene locus_tag LOCUS_0330 30146 30727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 30762 31478 gene locus_tag LOCUS_0340 30762 31478 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_0340 31530 31700 gene locus_tag LOCUS_0350 31530 31700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 32296 31697 gene locus_tag LOCUS_0360 32296 31697 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879766.1 protein_id gnl|my_center|LOCUS_0360 33504 32329 gene locus_tag LOCUS_0370 33504 32329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 34014 33679 gene locus_tag LOCUS_0380 34014 33679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 34131 35123 gene locus_tag LOCUS_0390 34131 35123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 35462 35151 gene locus_tag LOCUS_0400 35462 35151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 35830 35486 gene locus_tag LOCUS_0410 35830 35486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 36884 35832 gene locus_tag LOCUS_0420 36884 35832 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_0420 37203 36886 gene locus_tag LOCUS_0430 37203 36886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 37510 37205 gene locus_tag LOCUS_0440 37510 37205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 37940 37572 gene locus_tag LOCUS_0450 37940 37572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 39018 38074 gene locus_tag LOCUS_0460 39018 38074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 39209 39859 gene locus_tag LOCUS_0470 39209 39859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 39907 40551 gene locus_tag LOCUS_0480 39907 40551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 40583 40657 gene locus_tag LOCUS_t0060 40583 40657 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 40695 40913 gene locus_tag LOCUS_0490 40695 40913 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249566.1 protein_id gnl|my_center|LOCUS_0490 41078 41239 gene locus_tag LOCUS_0500 41078 41239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0500 41214 41639 gene locus_tag LOCUS_0510 41214 41639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 41765 42091 gene locus_tag LOCUS_0520 41765 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 42223 42633 gene locus_tag LOCUS_0530 42223 42633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 43099 42725 gene locus_tag LOCUS_0540 43099 42725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 43198 44754 gene locus_tag LOCUS_0550 43198 44754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 44891 45646 gene locus_tag LOCUS_0560 44891 45646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 45648 49511 gene locus_tag LOCUS_0570 45648 49511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 49590 50117 gene locus_tag LOCUS_0580 49590 50117 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_0580 50168 50356 gene locus_tag LOCUS_0590 50168 50356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 50450 51355 gene locus_tag LOCUS_0600 50450 51355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 51404 53092 gene locus_tag LOCUS_0610 51404 53092 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_0610 53379 53089 gene locus_tag LOCUS_0620 53379 53089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 53459 54106 gene locus_tag LOCUS_0630 53459 54106 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_0630 54141 54518 gene locus_tag LOCUS_0640 54141 54518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 55759 54521 gene locus_tag LOCUS_0650 55759 54521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 56727 55756 gene locus_tag LOCUS_0660 56727 55756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 56800 57051 gene locus_tag LOCUS_0670 56800 57051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 58086 57052 gene locus_tag LOCUS_0680 58086 57052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 67103 58083 gene locus_tag LOCUS_0690 67103 58083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 68602 67157 gene locus_tag LOCUS_0700 68602 67157 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_0700 68754 68599 gene locus_tag LOCUS_0710 68754 68599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 69068 70150 gene locus_tag LOCUS_0720 gene nptA 69068 70150 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_0720 70858 70154 gene locus_tag LOCUS_0730 70858 70154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 71190 70855 gene locus_tag LOCUS_0740 71190 70855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 >Feature sequence02 <1 1194 gene locus_tag LOCUS_0750 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023110.1:ABC transporter permease 1791 1198 gene locus_tag LOCUS_0760 1791 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 2700 1903 gene locus_tag LOCUS_0770 2700 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 2804 3463 gene locus_tag LOCUS_0780 2804 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 3411 4253 gene locus_tag LOCUS_0790 3411 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 5532 4573 gene locus_tag LOCUS_0800 5532 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0800 8938 5615 gene locus_tag LOCUS_0810 8938 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 9723 8935 gene locus_tag LOCUS_0820 9723 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 12933 9808 gene locus_tag LOCUS_0830 12933 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 13697 12930 gene locus_tag LOCUS_0840 13697 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 15123 13750 gene locus_tag LOCUS_0850 gene rtcB 15123 13750 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X178 protein_id gnl|my_center|LOCUS_0850 15494 15177 gene locus_tag LOCUS_0860 15494 15177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 15907 15494 gene locus_tag LOCUS_0870 15907 15494 CDS product protein archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228886.1 protein_id gnl|my_center|LOCUS_0870 15959 16726 gene locus_tag LOCUS_0880 gene tatD 15959 16726 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_0880 16766 17422 gene locus_tag LOCUS_0890 16766 17422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272839.1 protein_id gnl|my_center|LOCUS_0890 17468 18352 gene locus_tag LOCUS_0900 17468 18352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0900 19211 18354 gene locus_tag LOCUS_0910 19211 18354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 20105 19245 gene locus_tag LOCUS_0920 20105 19245 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965753.1 protein_id gnl|my_center|LOCUS_0920 20467 20102 gene locus_tag LOCUS_0930 20467 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 21987 20464 gene locus_tag LOCUS_0940 21987 20464 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584026.1 protein_id gnl|my_center|LOCUS_0940 23173 22052 gene locus_tag LOCUS_0950 gene aroB 23173 22052 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHI4 protein_id gnl|my_center|LOCUS_0950 25163 23229 gene locus_tag LOCUS_0960 gene acsA 25163 23229 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIW6 protein_id gnl|my_center|LOCUS_0960 25775 25164 gene locus_tag LOCUS_0970 25775 25164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 26724 25855 gene locus_tag LOCUS_0980 26724 25855 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435856.1 protein_id gnl|my_center|LOCUS_0980 26794 27693 gene locus_tag LOCUS_0990 26794 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 28036 27719 gene locus_tag LOCUS_1000 28036 27719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 28300 29556 gene locus_tag LOCUS_1010 28300 29556 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022205.1 protein_id gnl|my_center|LOCUS_1010 30082 30225 gene locus_tag LOCUS_1020 30082 30225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 30218 30979 gene locus_tag LOCUS_1030 30218 30979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 30981 31781 gene locus_tag LOCUS_1040 30981 31781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 31771 32457 gene locus_tag LOCUS_1050 31771 32457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 32471 32908 gene locus_tag LOCUS_1060 32471 32908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 32909 33088 gene locus_tag LOCUS_1070 32909 33088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 33131 33913 gene locus_tag LOCUS_1080 33131 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 33910 34698 gene locus_tag LOCUS_1090 33910 34698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 34695 35495 gene locus_tag LOCUS_1100 34695 35495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 35492 36064 gene locus_tag LOCUS_1110 35492 36064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 36066 36500 gene locus_tag LOCUS_1120 36066 36500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 36497 37459 gene locus_tag LOCUS_1130 36497 37459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 37456 38262 gene locus_tag LOCUS_1140 37456 38262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 38232 38807 gene locus_tag LOCUS_1150 38232 38807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 38804 39766 gene locus_tag LOCUS_1160 38804 39766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 39763 40266 gene locus_tag LOCUS_1170 39763 40266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 40263 40544 gene locus_tag LOCUS_1180 40263 40544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 40541 41251 gene locus_tag LOCUS_1190 40541 41251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 41248 42066 gene locus_tag LOCUS_1200 41248 42066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 42063 43256 gene locus_tag LOCUS_1210 42063 43256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 43495 43413 gene locus_tag LOCUS_t0070 43495 43413 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43684 43998 gene locus_tag LOCUS_1220 43684 43998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 44045 44374 gene locus_tag LOCUS_1230 44045 44374 CDS product translation initiation factor 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146587.1 protein_id gnl|my_center|LOCUS_1230 44412 45695 gene locus_tag LOCUS_1240 44412 45695 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_1240 >Feature sequence03 438 232 gene locus_tag LOCUS_1250 438 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 1953 538 gene locus_tag LOCUS_1260 1953 538 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_1260 2254 2048 gene locus_tag LOCUS_1270 2254 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 2397 2468 gene locus_tag LOCUS_t0080 2397 2468 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2666 5719 gene locus_tag LOCUS_1280 2666 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1280 5716 6519 gene locus_tag LOCUS_1290 5716 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 6521 8065 gene locus_tag LOCUS_1300 6521 8065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 8034 8213 gene locus_tag LOCUS_1310 8034 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 9422 8451 gene locus_tag LOCUS_1320 9422 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 9519 10334 gene locus_tag LOCUS_1330 9519 10334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 10336 10920 gene locus_tag LOCUS_1340 10336 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 10979 11161 gene locus_tag LOCUS_1350 10979 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 11452 11616 gene locus_tag LOCUS_1360 11452 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 11812 11964 gene locus_tag LOCUS_1370 11812 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 11966 12241 gene locus_tag LOCUS_1380 11966 12241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 12238 13374 gene locus_tag LOCUS_1390 12238 13374 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942260.1 protein_id gnl|my_center|LOCUS_1390 14644 13571 gene locus_tag LOCUS_1400 14644 13571 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943079.1 protein_id gnl|my_center|LOCUS_1400 15495 15088 gene locus_tag LOCUS_1410 15495 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 15604 15897 gene locus_tag LOCUS_1420 15604 15897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 15973 16359 gene locus_tag LOCUS_1430 15973 16359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 16407 16769 gene locus_tag LOCUS_1440 16407 16769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 17149 16766 gene locus_tag LOCUS_1450 17149 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 17251 18393 gene locus_tag LOCUS_1460 17251 18393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 19770 18400 gene locus_tag LOCUS_1470 gene cysS 19770 18400 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E391 protein_id gnl|my_center|LOCUS_1470 19862 20806 gene locus_tag LOCUS_1480 19862 20806 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_1480 20848 21495 gene locus_tag LOCUS_1490 20848 21495 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_1490 21720 21496 gene locus_tag LOCUS_1500 21720 21496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 21779 22027 gene locus_tag LOCUS_1510 21779 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903691.1 protein_id gnl|my_center|LOCUS_1510 22088 22450 gene locus_tag LOCUS_1520 22088 22450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 22492 22650 gene locus_tag LOCUS_1530 22492 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 22689 23117 gene locus_tag LOCUS_1540 22689 23117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 24925 23123 gene locus_tag LOCUS_1550 24925 23123 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_1550 25023 25451 gene locus_tag LOCUS_1560 25023 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 25464 25748 gene locus_tag LOCUS_1570 25464 25748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 25792 26169 gene locus_tag LOCUS_1580 25792 26169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 27573 26179 gene locus_tag LOCUS_1590 27573 26179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 28589 27624 gene locus_tag LOCUS_1600 28589 27624 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022002.1 protein_id gnl|my_center|LOCUS_1600 28674 29207 gene locus_tag LOCUS_1610 28674 29207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 29289 29735 gene locus_tag LOCUS_1620 29289 29735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 31799 30018 gene locus_tag LOCUS_1630 gene yqhH 31799 30018 CDS product putative ATP-dependent helicase YqhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54509 protein_id gnl|my_center|LOCUS_1630 32923 31859 gene locus_tag LOCUS_1640 gene pilT 32923 31859 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964997.1 protein_id gnl|my_center|LOCUS_1640 33449 33069 gene locus_tag LOCUS_1650 33449 33069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 33551 34618 gene locus_tag LOCUS_1660 33551 34618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 34665 35243 gene locus_tag LOCUS_1670 34665 35243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 35240 35767 gene locus_tag LOCUS_1680 35240 35767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 36167 35775 gene locus_tag LOCUS_1690 36167 35775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 36466 36747 gene locus_tag LOCUS_1700 36466 36747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_1700 37402 36752 gene locus_tag LOCUS_1710 37402 36752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 38712 37444 gene locus_tag LOCUS_1720 38712 37444 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146483.1 protein_id gnl|my_center|LOCUS_1720 38804 38977 gene locus_tag LOCUS_1730 38804 38977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 39131 40384 gene locus_tag LOCUS_1740 39131 40384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289141.1 protein_id gnl|my_center|LOCUS_1740 40425 40697 gene locus_tag LOCUS_1750 40425 40697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 40694 41068 gene locus_tag LOCUS_1760 40694 41068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020567.1 protein_id gnl|my_center|LOCUS_1760 41700 41170 gene locus_tag LOCUS_1770 41700 41170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 42386 41754 gene locus_tag LOCUS_1780 42386 41754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 <42907 42383 gene locus_tag LOCUS_1790 <42907 42383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902221.1:rhomboid family intramembrane serine protease >Feature sequence04 525 818 gene locus_tag LOCUS_1800 525 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 945 1646 gene locus_tag LOCUS_1810 945 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_1810 2085 2765 gene locus_tag LOCUS_1820 2085 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 2825 3157 gene locus_tag LOCUS_1830 2825 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 3215 4408 gene locus_tag LOCUS_1840 gene prtC 3215 4408 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933548.1 protein_id gnl|my_center|LOCUS_1840 5027 4410 gene locus_tag LOCUS_1850 5027 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 5133 5606 gene locus_tag LOCUS_1860 5133 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 5835 5608 gene locus_tag LOCUS_1870 5835 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 6375 5869 gene locus_tag LOCUS_1880 6375 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1880 6466 6939 gene locus_tag LOCUS_1890 6466 6939 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263737.1 protein_id gnl|my_center|LOCUS_1890 7517 6936 gene locus_tag LOCUS_1900 7517 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 7695 8003 gene locus_tag LOCUS_1910 7695 8003 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249262.1 protein_id gnl|my_center|LOCUS_1910 8632 8045 gene locus_tag LOCUS_1920 8632 8045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 8708 9004 gene locus_tag LOCUS_1930 8708 9004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 9119 10414 gene locus_tag LOCUS_1940 9119 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 10571 10738 gene locus_tag LOCUS_1950 10571 10738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 10894 11160 gene locus_tag LOCUS_1960 10894 11160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 11213 12961 gene locus_tag LOCUS_1970 gene kefB 11213 12961 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_1970 13060 13911 gene locus_tag LOCUS_1980 13060 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 13983 15071 gene locus_tag LOCUS_1990 13983 15071 CDS product Fe-S protein, radical SAM family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_1990 15107 16633 gene locus_tag LOCUS_2000 15107 16633 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876381.1 protein_id gnl|my_center|LOCUS_2000 16633 16944 gene locus_tag LOCUS_2010 16633 16944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 16946 18637 gene locus_tag LOCUS_2020 16946 18637 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876408.1 protein_id gnl|my_center|LOCUS_2020 19123 18650 gene locus_tag LOCUS_2030 19123 18650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 19431 19503 gene locus_tag LOCUS_t0090 19431 19503 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19831 20526 gene locus_tag LOCUS_2040 19831 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 20640 21032 gene locus_tag LOCUS_2050 20640 21032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 21125 22468 gene locus_tag LOCUS_2060 21125 22468 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870376.1 protein_id gnl|my_center|LOCUS_2060 22531 22824 gene locus_tag LOCUS_2070 22531 22824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 22857 23381 gene locus_tag LOCUS_2080 22857 23381 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870442.1 protein_id gnl|my_center|LOCUS_2080 23452 24771 gene locus_tag LOCUS_2090 gene serS 23452 24771 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_2090 24768 24980 gene locus_tag LOCUS_2100 24768 24980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 25028 25249 gene locus_tag LOCUS_2110 25028 25249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 25311 25721 gene locus_tag LOCUS_2120 25311 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 26439 25999 gene locus_tag LOCUS_2130 26439 25999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 27369 26884 gene locus_tag LOCUS_2140 27369 26884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 27420 28055 gene locus_tag LOCUS_2150 gene nth 27420 28055 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZN5 protein_id gnl|my_center|LOCUS_2150 28149 28679 gene locus_tag LOCUS_2160 28149 28679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 29655 28738 gene locus_tag LOCUS_2170 29655 28738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 29749 29904 gene locus_tag LOCUS_2180 29749 29904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 29906 30256 gene locus_tag LOCUS_2190 29906 30256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 30309 30524 gene locus_tag LOCUS_2200 30309 30524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 >Feature sequence05 1820 159 gene locus_tag LOCUS_2210 1820 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 1931 2665 gene locus_tag LOCUS_2220 1931 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 2990 2742 gene locus_tag LOCUS_2230 2990 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 3253 2984 gene locus_tag LOCUS_2240 3253 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 5773 3314 gene locus_tag LOCUS_2250 gene leuS 5773 3314 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY15 protein_id gnl|my_center|LOCUS_2250 6843 5806 gene locus_tag LOCUS_2260 6843 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 7281 7012 gene locus_tag LOCUS_2270 7281 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 7649 7723 gene locus_tag LOCUS_t0100 7649 7723 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8426 8974 gene locus_tag LOCUS_2280 8426 8974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 9099 9620 gene locus_tag LOCUS_2290 9099 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 9712 10212 gene locus_tag LOCUS_2300 9712 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 11146 11937 gene locus_tag LOCUS_2310 11146 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 13477 11963 gene locus_tag LOCUS_2320 13477 11963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 16709 13551 gene locus_tag LOCUS_2330 16709 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 16907 17317 gene locus_tag LOCUS_2340 16907 17317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 19068 17485 gene locus_tag LOCUS_2350 19068 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 19648 19196 gene locus_tag LOCUS_2360 19648 19196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 19757 20377 gene locus_tag LOCUS_2370 19757 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 22447 20393 gene locus_tag LOCUS_2380 22447 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 23649 22444 gene locus_tag LOCUS_2390 23649 22444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 24200 23712 gene locus_tag LOCUS_2400 24200 23712 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060740.1 protein_id gnl|my_center|LOCUS_2400 24319 25113 gene locus_tag LOCUS_2410 24319 25113 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876323.1 protein_id gnl|my_center|LOCUS_2410 25113 25835 gene locus_tag LOCUS_2420 25113 25835 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_2420 25828 26649 gene locus_tag LOCUS_2430 25828 26649 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_2430 26656 27057 gene locus_tag LOCUS_2440 26656 27057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 27114 27317 gene locus_tag LOCUS_2450 27114 27317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 27380 28594 gene locus_tag LOCUS_2460 27380 28594 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762845.1 protein_id gnl|my_center|LOCUS_2460 28929 28597 gene locus_tag LOCUS_2470 28929 28597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 29015 29779 gene locus_tag LOCUS_2480 29015 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 >Feature sequence06 132 350 gene locus_tag LOCUS_2490 132 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 484 792 gene locus_tag LOCUS_2500 484 792 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_2500 1692 877 gene locus_tag LOCUS_2510 1692 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 2104 1847 gene locus_tag LOCUS_2520 2104 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 2464 2168 gene locus_tag LOCUS_2530 2464 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 3378 3719 gene locus_tag LOCUS_2540 3378 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 3805 4335 gene locus_tag LOCUS_2550 3805 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 4387 4944 gene locus_tag LOCUS_2560 4387 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 5208 4981 gene locus_tag LOCUS_2570 5208 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 5442 5218 gene locus_tag LOCUS_2580 5442 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 6353 5616 gene locus_tag LOCUS_2590 6353 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 7713 6571 gene locus_tag LOCUS_2600 7713 6571 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978607.1 protein_id gnl|my_center|LOCUS_2600 7796 7868 gene locus_tag LOCUS_t0110 7796 7868 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8626 7955 gene locus_tag LOCUS_2610 8626 7955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 9117 8725 gene locus_tag LOCUS_2620 9117 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 9583 9314 gene locus_tag LOCUS_2630 9583 9314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 9679 11076 gene locus_tag LOCUS_2640 9679 11076 CDS product glutaminyl-tRNA synthase (glutamine-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496410.1 protein_id gnl|my_center|LOCUS_2640 11474 11962 gene locus_tag LOCUS_2650 11474 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 12040 12381 gene locus_tag LOCUS_2660 12040 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 12374 12619 gene locus_tag LOCUS_2670 12374 12619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 12621 12932 gene locus_tag LOCUS_2680 12621 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 13409 14347 gene locus_tag LOCUS_2690 gene fic 13409 14347 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166394.1 protein_id gnl|my_center|LOCUS_2690 14622 15104 gene locus_tag LOCUS_2700 14622 15104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 15155 15706 gene locus_tag LOCUS_2710 15155 15706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 15697 16191 gene locus_tag LOCUS_2720 15697 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 16188 16379 gene locus_tag LOCUS_2730 16188 16379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 17363 16383 gene locus_tag LOCUS_2740 17363 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 17477 17680 gene locus_tag LOCUS_2750 17477 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 17682 17906 gene locus_tag LOCUS_2760 17682 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 17908 18192 gene locus_tag LOCUS_2770 17908 18192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 18194 18460 gene locus_tag LOCUS_2780 18194 18460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 18462 19247 gene locus_tag LOCUS_2790 18462 19247 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249426.1 protein_id gnl|my_center|LOCUS_2790 19250 19561 gene locus_tag LOCUS_2800 19250 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 19564 20259 gene locus_tag LOCUS_2810 19564 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 20302 20919 gene locus_tag LOCUS_2820 20302 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 21390 20920 gene locus_tag LOCUS_2830 21390 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 21751 21377 gene locus_tag LOCUS_2840 21751 21377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 21755 22387 gene locus_tag LOCUS_2850 21755 22387 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_2850 22425 23870 gene locus_tag LOCUS_2860 gene proS2 22425 23870 CDS product proline--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNZ7 protein_id gnl|my_center|LOCUS_2860 23927 25648 gene locus_tag LOCUS_2870 gene glgA 23927 25648 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZZ7 protein_id gnl|my_center|LOCUS_2870 27369 25651 gene locus_tag LOCUS_2880 27369 25651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 27420 28127 gene locus_tag LOCUS_2890 27420 28127 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_2890 >Feature sequence07 205 1125 gene locus_tag LOCUS_2900 205 1125 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583008.1 protein_id gnl|my_center|LOCUS_2900 1195 2184 gene locus_tag LOCUS_2910 1195 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 2230 2529 gene locus_tag LOCUS_2920 2230 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 3377 2934 gene locus_tag LOCUS_2930 3377 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 4130 3756 gene locus_tag LOCUS_2940 4130 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 7356 4138 gene locus_tag LOCUS_2950 7356 4138 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814652.1 protein_id gnl|my_center|LOCUS_2950 9443 7467 gene locus_tag LOCUS_2960 9443 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 10049 9510 gene locus_tag LOCUS_2970 10049 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 13593 10087 gene locus_tag LOCUS_2980 13593 10087 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_2980 15215 13590 gene locus_tag LOCUS_2990 15215 13590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 16146 15499 gene locus_tag LOCUS_3000 16146 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 16351 16130 gene locus_tag LOCUS_3010 16351 16130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 17574 16360 gene locus_tag LOCUS_3020 17574 16360 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_3020 18067 18321 gene locus_tag LOCUS_3030 18067 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 18323 18502 gene locus_tag LOCUS_3040 18323 18502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 18565 18927 gene locus_tag LOCUS_3050 18565 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 18972 19382 gene locus_tag LOCUS_3060 18972 19382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 19414 20094 gene locus_tag LOCUS_3070 19414 20094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 20220 20393 gene locus_tag LOCUS_3080 20220 20393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 20437 20706 gene locus_tag LOCUS_3090 20437 20706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 20791 21489 gene locus_tag LOCUS_3100 20791 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 22404 21733 gene locus_tag LOCUS_3110 22404 21733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 24639 25466 gene locus_tag LOCUS_3120 24639 25466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3120 25515 26435 gene locus_tag LOCUS_3130 25515 26435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 26363 26749 gene locus_tag LOCUS_3140 26363 26749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 26780 27289 gene locus_tag LOCUS_3150 26780 27289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 >Feature sequence08 547 738 gene locus_tag LOCUS_3160 547 738 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816072.1 protein_id gnl|my_center|LOCUS_3160 740 925 gene locus_tag LOCUS_3170 740 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 1924 962 gene locus_tag LOCUS_3180 gene egtD 1924 962 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WN47 protein_id gnl|my_center|LOCUS_3180 2655 3827 gene locus_tag LOCUS_3190 2655 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 3817 4869 gene locus_tag LOCUS_3200 3817 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 5103 5258 gene locus_tag LOCUS_3210 5103 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 5290 5544 gene locus_tag LOCUS_3220 5290 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 5825 5562 gene locus_tag LOCUS_3230 5825 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878956.1 protein_id gnl|my_center|LOCUS_3230 6645 7097 gene locus_tag LOCUS_3240 6645 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 7199 7786 gene locus_tag LOCUS_3250 7199 7786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 8097 9281 gene locus_tag LOCUS_3260 8097 9281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 9808 9449 gene locus_tag LOCUS_3270 9808 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 10025 10504 gene locus_tag LOCUS_3280 10025 10504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 10494 10567 gene locus_tag LOCUS_t0120 10494 10567 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10680 11018 gene locus_tag LOCUS_3290 10680 11018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 11331 11792 gene locus_tag LOCUS_3300 11331 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 13299 12142 gene locus_tag LOCUS_3310 13299 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 14066 13812 gene locus_tag LOCUS_3320 14066 13812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_3320 14628 14170 gene locus_tag LOCUS_3330 14628 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 14880 15560 gene locus_tag LOCUS_3340 14880 15560 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_3340 16055 15600 gene locus_tag LOCUS_3350 16055 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 16920 16150 gene locus_tag LOCUS_3360 16920 16150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 17698 16967 gene locus_tag LOCUS_3370 17698 16967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 18282 17749 gene locus_tag LOCUS_3380 18282 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 18379 18837 gene locus_tag LOCUS_3390 18379 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 18830 20575 gene locus_tag LOCUS_3400 gene dnaK 18830 20575 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_3400 21153 20596 gene locus_tag LOCUS_3410 21153 20596 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8F1 protein_id gnl|my_center|LOCUS_3410 >Feature sequence09 75 902 gene locus_tag LOCUS_3420 75 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 952 2229 gene locus_tag LOCUS_3430 952 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 2269 2778 gene locus_tag LOCUS_3440 2269 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 3309 2860 gene locus_tag LOCUS_3450 3309 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 3742 3293 gene locus_tag LOCUS_3460 3742 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 4103 3759 gene locus_tag LOCUS_3470 4103 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 4635 4234 gene locus_tag LOCUS_3480 4635 4234 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869690.1 protein_id gnl|my_center|LOCUS_3480 5100 4687 gene locus_tag LOCUS_3490 5100 4687 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_3490 5464 5102 gene locus_tag LOCUS_3500 5464 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 5581 5497 gene locus_tag LOCUS_t0130 5581 5497 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6292 5585 gene locus_tag LOCUS_3510 6292 5585 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867654.1 protein_id gnl|my_center|LOCUS_3510 6714 6325 gene locus_tag LOCUS_3520 6714 6325 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902814.1 protein_id gnl|my_center|LOCUS_3520 7268 6714 gene locus_tag LOCUS_3530 7268 6714 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_3530 7734 7270 gene locus_tag LOCUS_3540 7734 7270 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867651.1 protein_id gnl|my_center|LOCUS_3540 8272 7736 gene locus_tag LOCUS_3550 8272 7736 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_3550 8583 8281 gene locus_tag LOCUS_3560 8583 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 8832 8584 gene locus_tag LOCUS_3570 8832 8584 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249853.1 protein_id gnl|my_center|LOCUS_3570 9283 8963 gene locus_tag LOCUS_3580 9283 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 9444 10127 gene locus_tag LOCUS_3590 9444 10127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 10168 10250 gene locus_tag LOCUS_t0140 10168 10250 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10322 10858 gene locus_tag LOCUS_3600 gene adk 10322 10858 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MI55 protein_id gnl|my_center|LOCUS_3600 12109 10859 gene locus_tag LOCUS_3610 12109 10859 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249307.1 protein_id gnl|my_center|LOCUS_3610 13134 12106 gene locus_tag LOCUS_3620 13134 12106 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083484.1 protein_id gnl|my_center|LOCUS_3620 13502 14203 gene locus_tag LOCUS_3630 13502 14203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 14392 15336 gene locus_tag LOCUS_3640 14392 15336 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867464.1 protein_id gnl|my_center|LOCUS_3640 15333 16115 gene locus_tag LOCUS_3650 15333 16115 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846313.1 protein_id gnl|my_center|LOCUS_3650 16117 16371 gene locus_tag LOCUS_3660 16117 16371 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_3660 16371 17069 gene locus_tag LOCUS_3670 16371 17069 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_3670 17072 17461 gene locus_tag LOCUS_3680 17072 17461 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_3680 17464 18006 gene locus_tag LOCUS_3690 17464 18006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 18008 18733 gene locus_tag LOCUS_3700 18008 18733 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250487.1 protein_id gnl|my_center|LOCUS_3700 18733 18987 gene locus_tag LOCUS_3710 18733 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 18989 19285 gene locus_tag LOCUS_3720 18989 19285 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_3720 19287 19637 gene locus_tag LOCUS_3730 19287 19637 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 protein_id gnl|my_center|LOCUS_3730 19634 20035 gene locus_tag LOCUS_3740 19634 20035 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250482.1 protein_id gnl|my_center|LOCUS_3740 20037 20462 gene locus_tag LOCUS_3750 20037 20462 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_3750 20464 21120 gene locus_tag LOCUS_3760 20464 21120 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762314.1 protein_id gnl|my_center|LOCUS_3760 21128 21661 gene locus_tag LOCUS_3770 21128 21661 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_3770 21648 21878 gene locus_tag LOCUS_3780 21648 21878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 21888 22265 gene locus_tag LOCUS_3790 21888 22265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 22267 22809 gene locus_tag LOCUS_3800 22267 22809 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_3800 >Feature sequence10 1359 202 gene locus_tag LOCUS_3810 gene hisS-1 1359 202 CDS product histidine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81B71 protein_id gnl|my_center|LOCUS_3810 1943 1386 gene locus_tag LOCUS_3820 1943 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 2038 2478 gene locus_tag LOCUS_3830 2038 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 2636 3127 gene locus_tag LOCUS_3840 2636 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 3946 3134 gene locus_tag LOCUS_3850 3946 3134 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868784.1 protein_id gnl|my_center|LOCUS_3850 4434 3997 gene locus_tag LOCUS_3860 4434 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 5977 4472 gene locus_tag LOCUS_3870 5977 4472 CDS product phospholipase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207627.1 protein_id gnl|my_center|LOCUS_3870 6873 5977 gene locus_tag LOCUS_3880 6873 5977 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_3880 6961 7530 gene locus_tag LOCUS_3890 6961 7530 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978687.1 protein_id gnl|my_center|LOCUS_3890 7679 9097 gene locus_tag LOCUS_3900 gene thrC 7679 9097 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P23669 protein_id gnl|my_center|LOCUS_3900 9188 10573 gene locus_tag LOCUS_3910 9188 10573 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948757.1 protein_id gnl|my_center|LOCUS_3910 11149 10613 gene locus_tag LOCUS_3920 11149 10613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 12364 11282 gene locus_tag LOCUS_3930 gene ftsZ 12364 11282 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_3930 13475 12462 gene locus_tag LOCUS_3940 13475 12462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3940 13526 14188 gene locus_tag LOCUS_3950 13526 14188 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_3950 14625 14197 gene locus_tag LOCUS_3960 14625 14197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 14746 17586 gene locus_tag LOCUS_3970 gene smc 14746 17586 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73ML2 protein_id gnl|my_center|LOCUS_3970 18424 17600 gene locus_tag LOCUS_3980 18424 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 18687 20147 gene locus_tag LOCUS_3990 18687 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 20200 20421 gene locus_tag LOCUS_4000 20200 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 20705 20520 gene locus_tag LOCUS_4010 20705 20520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 20777 21928 gene locus_tag LOCUS_4020 20777 21928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 >Feature sequence11 1313 990 gene locus_tag LOCUS_4030 1313 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 2338 1355 gene locus_tag LOCUS_4040 2338 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 2418 2909 gene locus_tag LOCUS_4050 2418 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 3145 3405 gene locus_tag LOCUS_4060 3145 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 3926 3522 gene locus_tag LOCUS_4070 3926 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 5991 4099 gene locus_tag LOCUS_4080 5991 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_4080 6692 6048 gene locus_tag LOCUS_4090 6692 6048 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867872.1 protein_id gnl|my_center|LOCUS_4090 7047 6781 gene locus_tag LOCUS_4100 7047 6781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 7163 7567 gene locus_tag LOCUS_4110 7163 7567 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879815.1 protein_id gnl|my_center|LOCUS_4110 7639 7854 gene locus_tag LOCUS_4120 7639 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 7977 8693 gene locus_tag LOCUS_4130 7977 8693 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJH7 protein_id gnl|my_center|LOCUS_4130 8756 9388 gene locus_tag LOCUS_4140 gene tmk 8756 9388 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF8 protein_id gnl|my_center|LOCUS_4140 9741 10187 gene locus_tag LOCUS_4150 9741 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 10278 10706 gene locus_tag LOCUS_4160 10278 10706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 10703 11692 gene locus_tag LOCUS_4170 10703 11692 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250622.1 protein_id gnl|my_center|LOCUS_4170 12002 11694 gene locus_tag LOCUS_4180 12002 11694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 12454 12146 gene locus_tag LOCUS_4190 12454 12146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 12824 12456 gene locus_tag LOCUS_4200 12824 12456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 13275 12826 gene locus_tag LOCUS_4210 13275 12826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 13734 13330 gene locus_tag LOCUS_4220 13734 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 14437 13805 gene locus_tag LOCUS_4230 14437 13805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4230 14591 15223 gene locus_tag LOCUS_4240 14591 15223 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_4240 15223 16104 gene locus_tag LOCUS_4250 15223 16104 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868902.1 protein_id gnl|my_center|LOCUS_4250 16126 16422 gene locus_tag LOCUS_4260 16126 16422 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870009.1 protein_id gnl|my_center|LOCUS_4260 16595 16942 gene locus_tag LOCUS_4270 16595 16942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 16944 17315 gene locus_tag LOCUS_4280 16944 17315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 17315 17953 gene locus_tag LOCUS_4290 17315 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 18260 18340 gene locus_tag LOCUS_t0150 18260 18340 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18492 18647 gene locus_tag LOCUS_4300 18492 18647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 18725 18807 gene locus_tag LOCUS_t0160 18725 18807 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18808 18999 gene locus_tag LOCUS_4310 18808 18999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 19046 19489 gene locus_tag LOCUS_4320 19046 19489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 19532 19610 gene locus_tag LOCUS_t0170 19532 19610 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20390 19845 gene locus_tag LOCUS_4330 20390 19845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 >Feature sequence12 883 1821 gene locus_tag LOCUS_4340 883 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 1818 3509 gene locus_tag LOCUS_4350 1818 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 3839 3525 gene locus_tag LOCUS_4360 3839 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 4063 3866 gene locus_tag LOCUS_4370 4063 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 4250 5452 gene locus_tag LOCUS_4380 4250 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 5592 5993 gene locus_tag LOCUS_4390 5592 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 6087 6542 gene locus_tag LOCUS_4400 6087 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 6686 7618 gene locus_tag LOCUS_4410 6686 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 7612 8136 gene locus_tag LOCUS_4420 7612 8136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 8167 9966 gene locus_tag LOCUS_4430 gene metG 8167 9966 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ14 protein_id gnl|my_center|LOCUS_4430 10312 10539 gene locus_tag LOCUS_4440 10312 10539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4440 10599 10889 gene locus_tag LOCUS_4450 10599 10889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 11683 10934 gene locus_tag LOCUS_4460 11683 10934 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_4460 11803 12339 gene locus_tag LOCUS_4470 11803 12339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 12471 12665 gene locus_tag LOCUS_4480 12471 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 12665 15922 gene locus_tag LOCUS_4490 12665 15922 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_4490 15924 19358 gene locus_tag LOCUS_4500 15924 19358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 19355 19594 gene locus_tag LOCUS_4510 19355 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 >Feature sequence13 2575 1220 gene locus_tag LOCUS_4520 2575 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 3109 2630 gene locus_tag LOCUS_4530 3109 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 3504 3157 gene locus_tag LOCUS_4540 3504 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 3820 3506 gene locus_tag LOCUS_4550 3820 3506 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EM7 protein_id gnl|my_center|LOCUS_4550 3972 4046 gene locus_tag LOCUS_t0180 3972 4046 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4364 4083 gene locus_tag LOCUS_4560 4364 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 6972 4324 gene locus_tag LOCUS_4570 6972 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 7435 7064 gene locus_tag LOCUS_4580 7435 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 7496 8080 gene locus_tag LOCUS_4590 gene gpmA 7496 8080 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TFP0 protein_id gnl|my_center|LOCUS_4590 8657 8091 gene locus_tag LOCUS_4600 8657 8091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 8747 9442 gene locus_tag LOCUS_4610 8747 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 10069 9449 gene locus_tag LOCUS_4620 10069 9449 CDS product N-glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496597.1 protein_id gnl|my_center|LOCUS_4620 10469 10101 gene locus_tag LOCUS_4630 10469 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 10908 10546 gene locus_tag LOCUS_4640 10908 10546 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048271.1 protein_id gnl|my_center|LOCUS_4640 11045 11962 gene locus_tag LOCUS_4650 11045 11962 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_4650 12020 12181 gene locus_tag LOCUS_4660 12020 12181 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 protein_id gnl|my_center|LOCUS_4660 12217 12525 gene locus_tag LOCUS_4670 12217 12525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 12513 13688 gene locus_tag LOCUS_4680 gene iscS 12513 13688 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_4680 13681 13887 gene locus_tag LOCUS_4690 13681 13887 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393973.1 protein_id gnl|my_center|LOCUS_4690 13884 14264 gene locus_tag LOCUS_4700 13884 14264 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877697.1 protein_id gnl|my_center|LOCUS_4700 14631 14410 gene locus_tag LOCUS_4710 14631 14410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 15004 14708 gene locus_tag LOCUS_4720 15004 14708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 15390 14995 gene locus_tag LOCUS_4730 15390 14995 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978917.1 protein_id gnl|my_center|LOCUS_4730 15595 15380 gene locus_tag LOCUS_4740 15595 15380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 15629 16057 gene locus_tag LOCUS_4750 15629 16057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945922.1 protein_id gnl|my_center|LOCUS_4750 16057 16323 gene locus_tag LOCUS_4760 16057 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 16839 16306 gene locus_tag LOCUS_4770 16839 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4770 18061 16880 gene locus_tag LOCUS_4780 gene ychF 18061 16880 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_4780 18556 18128 gene locus_tag LOCUS_4790 18556 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 19111 18557 gene locus_tag LOCUS_4800 19111 18557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_4800 19397 19113 gene locus_tag LOCUS_4810 19397 19113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 >Feature sequence14 1451 462 gene locus_tag LOCUS_4820 1451 462 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_4820 1560 2282 gene locus_tag LOCUS_4830 1560 2282 CDS product DNA polymerase III sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_4830 2407 3231 gene locus_tag LOCUS_4840 2407 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 3586 3278 gene locus_tag LOCUS_4850 3586 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 3729 7109 gene locus_tag LOCUS_4860 3729 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 7373 7122 gene locus_tag LOCUS_4870 7373 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 7475 8101 gene locus_tag LOCUS_4880 7475 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 8139 8678 gene locus_tag LOCUS_4890 8139 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 9608 8778 gene locus_tag LOCUS_4900 9608 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 9988 11598 gene locus_tag LOCUS_4910 gene yidJ 9988 11598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828492.1 protein_id gnl|my_center|LOCUS_4910 12248 11595 gene locus_tag LOCUS_4920 12248 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 13520 12294 gene locus_tag LOCUS_4930 gene icaA 13520 12294 CDS product poly-beta-1,6 N-acetyl-D-glucosamine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159430.1 protein_id gnl|my_center|LOCUS_4930 13729 14352 gene locus_tag LOCUS_4940 13729 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 14691 14404 gene locus_tag LOCUS_4950 14691 14404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4950 14805 15095 gene locus_tag LOCUS_4960 14805 15095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 15526 15209 gene locus_tag LOCUS_4970 15526 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 16225 15557 gene locus_tag LOCUS_4980 16225 15557 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867410.1 protein_id gnl|my_center|LOCUS_4980 16720 16277 gene locus_tag LOCUS_4990 16720 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_4990 17573 16791 gene locus_tag LOCUS_5000 17573 16791 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_5000 >Feature sequence15 163 1206 gene locus_tag LOCUS_5010 gene disA 163 1206 CDS product DNA integrity scanning protein DisA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RGW9 protein_id gnl|my_center|LOCUS_5010 1206 2237 gene locus_tag LOCUS_5020 1206 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5020 2262 2468 gene locus_tag LOCUS_5030 2262 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 2909 2460 gene locus_tag LOCUS_5040 2909 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 3118 4083 gene locus_tag LOCUS_5050 3118 4083 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903042.1 protein_id gnl|my_center|LOCUS_5050 4073 5107 gene locus_tag LOCUS_5060 4073 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 5104 5826 gene locus_tag LOCUS_5070 5104 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 5834 6142 gene locus_tag LOCUS_5080 5834 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 6230 7516 gene locus_tag LOCUS_5090 6230 7516 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_5090 7640 7948 gene locus_tag LOCUS_5100 7640 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 7995 8558 gene locus_tag LOCUS_5110 7995 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 9158 8904 gene locus_tag LOCUS_5120 9158 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 9307 9756 gene locus_tag LOCUS_5130 9307 9756 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_5130 9816 10670 gene locus_tag LOCUS_5140 9816 10670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_5140 10710 11237 gene locus_tag LOCUS_5150 10710 11237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5150 11239 11793 gene locus_tag LOCUS_5160 11239 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 12433 11777 gene locus_tag LOCUS_5170 gene gph 12433 11777 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181645.1 protein_id gnl|my_center|LOCUS_5170 14516 12435 gene locus_tag LOCUS_5180 14516 12435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 14585 15709 gene locus_tag LOCUS_5190 14585 15709 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 protein_id gnl|my_center|LOCUS_5190 16414 15740 gene locus_tag LOCUS_5200 16414 15740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 16746 16417 gene locus_tag LOCUS_5210 16746 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 16841 17323 gene locus_tag LOCUS_5220 16841 17323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 >Feature sequence16 220 801 gene locus_tag LOCUS_5230 220 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 840 1148 gene locus_tag LOCUS_5240 840 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 1203 1874 gene locus_tag LOCUS_5250 1203 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 1917 3368 gene locus_tag LOCUS_5260 gene cbbM 1917 3368 CDS product ribulose bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IX55 protein_id gnl|my_center|LOCUS_5260 3449 3799 gene locus_tag LOCUS_5270 3449 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 3801 4154 gene locus_tag LOCUS_5280 3801 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 4157 4681 gene locus_tag LOCUS_5290 4157 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 4709 5044 gene locus_tag LOCUS_5300 4709 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5300 5115 8504 gene locus_tag LOCUS_5310 5115 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 8510 8797 gene locus_tag LOCUS_5320 8510 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 8787 9134 gene locus_tag LOCUS_5330 8787 9134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 9136 10968 gene locus_tag LOCUS_5340 9136 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 10965 11354 gene locus_tag LOCUS_5350 10965 11354 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941070.1 protein_id gnl|my_center|LOCUS_5350 11341 12819 gene locus_tag LOCUS_5360 11341 12819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 12887 16879 gene locus_tag LOCUS_5370 12887 16879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 >Feature sequence17 719 147 gene locus_tag LOCUS_5380 719 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 775 1515 gene locus_tag LOCUS_5390 775 1515 CDS product DNA repair protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_5390 1550 1921 gene locus_tag LOCUS_5400 1550 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 1986 2567 gene locus_tag LOCUS_5410 1986 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 4808 2577 gene locus_tag LOCUS_5420 4808 2577 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496891.1 protein_id gnl|my_center|LOCUS_5420 4891 5250 gene locus_tag LOCUS_5430 4891 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 5842 5258 gene locus_tag LOCUS_5440 5842 5258 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_5440 5891 8284 gene locus_tag LOCUS_5450 5891 8284 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_5450 8335 8634 gene locus_tag LOCUS_5460 8335 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 8775 9878 gene locus_tag LOCUS_5470 8775 9878 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250190.1 protein_id gnl|my_center|LOCUS_5470 10745 9996 gene locus_tag LOCUS_5480 10745 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 11381 11028 gene locus_tag LOCUS_5490 11381 11028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 11422 11616 gene locus_tag LOCUS_5500 11422 11616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_5500 12333 11743 gene locus_tag LOCUS_5510 12333 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 12458 13441 gene locus_tag LOCUS_5520 12458 13441 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_5520 13808 13957 gene locus_tag LOCUS_5530 13808 13957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 14500 14183 gene locus_tag LOCUS_5540 14500 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 >Feature sequence18 <1 629 gene locus_tag LOCUS_5550 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966859.1:CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase 652 855 gene locus_tag LOCUS_5560 652 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 890 1105 gene locus_tag LOCUS_5570 890 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5570 1471 1115 gene locus_tag LOCUS_5580 1471 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 1603 3339 gene locus_tag LOCUS_5590 1603 3339 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_5590 3703 3356 gene locus_tag LOCUS_5600 3703 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 3872 4237 gene locus_tag LOCUS_5610 3872 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 4588 4337 gene locus_tag LOCUS_5620 4588 4337 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_5620 4884 6554 gene locus_tag LOCUS_5630 gene argS 4884 6554 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R5 protein_id gnl|my_center|LOCUS_5630 7219 6557 gene locus_tag LOCUS_5640 7219 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 7579 7283 gene locus_tag LOCUS_5650 7579 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 8428 7625 gene locus_tag LOCUS_5660 8428 7625 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_5660 11323 8495 gene locus_tag LOCUS_5670 gene ileS 11323 8495 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JB2 protein_id gnl|my_center|LOCUS_5670 11393 12922 gene locus_tag LOCUS_5680 11393 12922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 >Feature sequence19 583 1125 gene locus_tag LOCUS_5690 583 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 1109 1585 gene locus_tag LOCUS_5700 1109 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 1590 1940 gene locus_tag LOCUS_5710 1590 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 2469 2125 gene locus_tag LOCUS_5720 gene pemK 2469 2125 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XWD3 protein_id gnl|my_center|LOCUS_5720 2702 2469 gene locus_tag LOCUS_5730 2702 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 2842 3300 gene locus_tag LOCUS_5740 2842 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 3297 3647 gene locus_tag LOCUS_5750 3297 3647 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_5750 4224 3634 gene locus_tag LOCUS_5760 4224 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 4305 5867 gene locus_tag LOCUS_5770 4305 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 5986 6864 gene locus_tag LOCUS_5780 5986 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 6895 7440 gene locus_tag LOCUS_5790 6895 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 8486 7467 gene locus_tag LOCUS_5800 8486 7467 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_5800 8753 8680 gene locus_tag LOCUS_t0190 8753 8680 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8830 9462 gene locus_tag LOCUS_5810 8830 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 9729 10520 gene locus_tag LOCUS_5820 9729 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 10737 10561 gene locus_tag LOCUS_5830 10737 10561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 11089 10769 gene locus_tag LOCUS_5840 11089 10769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 11401 11114 gene locus_tag LOCUS_5850 11401 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 <12518 11454 gene locus_tag LOCUS_5860 <12518 11454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867400.1:translation elongation factor aEF-2 >Feature sequence20 4500 3658 gene locus_tag LOCUS_5870 4500 3658 CDS product phage antirepressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_5870 4634 4497 gene locus_tag LOCUS_5880 4634 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 5290 4733 gene locus_tag LOCUS_5890 5290 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 5389 6561 gene locus_tag LOCUS_5900 5389 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 6643 6825 gene locus_tag LOCUS_5910 6643 6825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 6826 7536 gene locus_tag LOCUS_5920 6826 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 9185 7533 gene locus_tag LOCUS_5930 9185 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 9265 9831 gene locus_tag LOCUS_5940 9265 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5940 9818 9937 gene locus_tag LOCUS_5950 9818 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 9940 10767 gene locus_tag LOCUS_5960 9940 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 11429 10770 gene locus_tag LOCUS_5970 11429 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 11458 11814 gene locus_tag LOCUS_5980 11458 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 >Feature sequence21 655 1203 gene locus_tag LOCUS_5990 655 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 1200 2267 gene locus_tag LOCUS_6000 1200 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 2269 2889 gene locus_tag LOCUS_6010 2269 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 2886 3818 gene locus_tag LOCUS_6020 2886 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6020 3815 4702 gene locus_tag LOCUS_6030 3815 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 5927 4707 gene locus_tag LOCUS_6040 gene rfbH 5927 4707 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_6040 6861 5920 gene locus_tag LOCUS_6050 6861 5920 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257103.1 protein_id gnl|my_center|LOCUS_6050 8328 6901 gene locus_tag LOCUS_6060 8328 6901 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_6060 8726 8328 gene locus_tag LOCUS_6070 8726 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 9256 8723 gene locus_tag LOCUS_6080 9256 8723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 9809 9351 gene locus_tag LOCUS_6090 9809 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 11359 9812 gene locus_tag LOCUS_6100 gene secD 11359 9812 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869603.1 protein_id gnl|my_center|LOCUS_6100 <12084 11356 gene locus_tag LOCUS_6110 <12084 11356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870766.1:preprotein translocase subunit SecF >Feature sequence22 639 995 gene locus_tag LOCUS_6120 639 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 992 1480 gene locus_tag LOCUS_6130 992 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 1473 2084 gene locus_tag LOCUS_6140 1473 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 2078 2668 gene locus_tag LOCUS_6150 2078 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2828 3652 gene locus_tag LOCUS_6160 2828 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 4272 3649 gene locus_tag LOCUS_6170 4272 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 4639 4325 gene locus_tag LOCUS_6180 4639 4325 CDS product effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_6180 4884 5990 gene locus_tag LOCUS_6190 4884 5990 CDS product 2-hydroxy-acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438093.1 protein_id gnl|my_center|LOCUS_6190 5987 6409 gene locus_tag LOCUS_6200 5987 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 8111 6423 gene locus_tag LOCUS_6210 8111 6423 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_6210 10527 8149 gene locus_tag LOCUS_6220 10527 8149 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KSP4 protein_id gnl|my_center|LOCUS_6220 11235 10663 gene locus_tag LOCUS_6230 11235 10663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 >Feature sequence23 663 307 gene locus_tag LOCUS_6240 663 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 850 778 gene locus_tag LOCUS_t0200 850 778 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1453 938 gene locus_tag LOCUS_6250 1453 938 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146967.1 protein_id gnl|my_center|LOCUS_6250 1689 1453 gene locus_tag LOCUS_6260 1689 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 2443 1673 gene locus_tag LOCUS_6270 2443 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 2747 2445 gene locus_tag LOCUS_6280 2747 2445 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878830.1 protein_id gnl|my_center|LOCUS_6280 2837 3142 gene locus_tag LOCUS_6290 2837 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 3287 4435 gene locus_tag LOCUS_6300 3287 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 4536 5066 gene locus_tag LOCUS_6310 4536 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 5846 5067 gene locus_tag LOCUS_6320 5846 5067 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_6320 5927 6463 gene locus_tag LOCUS_6330 gene rbr 5927 6463 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418513.1 protein_id gnl|my_center|LOCUS_6330 6479 7249 gene locus_tag LOCUS_6340 6479 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 7289 8089 gene locus_tag LOCUS_6350 7289 8089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 8220 8292 gene locus_tag LOCUS_t0210 8220 8292 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8358 10082 gene locus_tag LOCUS_6360 8358 10082 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249633.1 protein_id gnl|my_center|LOCUS_6360 10417 10079 gene locus_tag LOCUS_6370 10417 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 >Feature sequence24 850 1359 gene locus_tag LOCUS_6380 850 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 4045 1400 gene locus_tag LOCUS_6390 4045 1400 CDS product ribonucleotide-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_6390 4721 4194 gene locus_tag LOCUS_6400 4721 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 5119 4787 gene locus_tag LOCUS_6410 5119 4787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 5201 5815 gene locus_tag LOCUS_6420 5201 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 5946 6500 gene locus_tag LOCUS_6430 5946 6500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 7281 6589 gene locus_tag LOCUS_6440 7281 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 7501 8271 gene locus_tag LOCUS_6450 7501 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 8268 8453 gene locus_tag LOCUS_6460 8268 8453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 8493 9353 gene locus_tag LOCUS_6470 8493 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 10386 9355 gene locus_tag LOCUS_6480 10386 9355 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_6480 >Feature sequence25 558 13 gene locus_tag LOCUS_6490 558 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 683 1210 gene locus_tag LOCUS_6500 683 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 2853 1207 gene locus_tag LOCUS_6510 2853 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 2926 3684 gene locus_tag LOCUS_6520 2926 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 4894 3692 gene locus_tag LOCUS_6530 4894 3692 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016846.1 protein_id gnl|my_center|LOCUS_6530 5680 4931 gene locus_tag LOCUS_6540 5680 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 5750 5935 gene locus_tag LOCUS_6550 5750 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 6547 5987 gene locus_tag LOCUS_6560 6547 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 7212 6544 gene locus_tag LOCUS_6570 7212 6544 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870074.1 protein_id gnl|my_center|LOCUS_6570 >Feature sequence26 794 288 gene locus_tag LOCUS_6580 794 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 2391 832 gene locus_tag LOCUS_6590 2391 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 2635 2787 gene locus_tag LOCUS_6600 2635 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 3145 2900 gene locus_tag LOCUS_6610 3145 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 3417 3142 gene locus_tag LOCUS_6620 3417 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 4519 3485 gene locus_tag LOCUS_6630 4519 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_6630 5553 4792 gene locus_tag LOCUS_6640 5553 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 6473 5631 gene locus_tag LOCUS_6650 6473 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 6817 6530 gene locus_tag LOCUS_6660 6817 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 7019 6819 gene locus_tag LOCUS_6670 7019 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 8912 7086 gene locus_tag LOCUS_6680 8912 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 >Feature sequence27 1804 365 gene locus_tag LOCUS_6690 gene gspE 1804 365 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_6690 2214 1816 gene locus_tag LOCUS_6700 2214 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 3062 2298 gene locus_tag LOCUS_6710 3062 2298 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_6710 3132 4682 gene locus_tag LOCUS_6720 3132 4682 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_6720 5086 4694 gene locus_tag LOCUS_6730 5086 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 5184 7142 gene locus_tag LOCUS_6740 5184 7142 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_6740 7427 8047 gene locus_tag LOCUS_6750 7427 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 8084 8803 gene locus_tag LOCUS_6760 8084 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 9024 8809 gene locus_tag LOCUS_6770 9024 8809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 >Feature sequence28 248 724 gene locus_tag LOCUS_6780 248 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 767 1606 gene locus_tag LOCUS_6790 767 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 1747 3252 gene locus_tag LOCUS_6800 1747 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 3254 3634 gene locus_tag LOCUS_6810 3254 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 3631 5772 gene locus_tag LOCUS_6820 3631 5772 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_6820 5774 6148 gene locus_tag LOCUS_6830 5774 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6830 6395 6311 gene locus_tag LOCUS_t0220 6395 6311 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7431 6460 gene locus_tag LOCUS_6840 gene tfb 7431 6460 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_6840 >Feature sequence29 243 1193 gene locus_tag LOCUS_6850 243 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6850 2717 1200 gene locus_tag LOCUS_6860 gene lysS 2717 1200 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQV5 protein_id gnl|my_center|LOCUS_6860 3039 2761 gene locus_tag LOCUS_6870 3039 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 3596 3066 gene locus_tag LOCUS_6880 3596 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6880 4406 3684 gene locus_tag LOCUS_6890 4406 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 5035 4457 gene locus_tag LOCUS_6900 5035 4457 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_6900 5198 5782 gene locus_tag LOCUS_6910 5198 5782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 5772 5987 gene locus_tag LOCUS_6920 5772 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 6043 6855 gene locus_tag LOCUS_6930 6043 6855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 7553 7071 gene locus_tag LOCUS_6940 7553 7071 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948482.1 protein_id gnl|my_center|LOCUS_6940 >Feature sequence30 1103 264 gene locus_tag LOCUS_6950 gene dusB 1103 264 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_6950 1499 1128 gene locus_tag LOCUS_6960 1499 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 1640 2125 gene locus_tag LOCUS_6970 1640 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 2679 2308 gene locus_tag LOCUS_6980 2679 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 3072 2809 gene locus_tag LOCUS_6990 3072 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 3265 3195 gene locus_tag LOCUS_t0230 3265 3195 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3352 5205 gene locus_tag LOCUS_7000 3352 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 5773 5243 gene locus_tag LOCUS_7010 5773 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 5988 6329 gene locus_tag LOCUS_7020 5988 6329 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_7020 6331 6861 gene locus_tag LOCUS_7030 6331 6861 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_7030 >Feature sequence31 126 2846 gene locus_tag LOCUS_7040 126 2846 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878213.1 protein_id gnl|my_center|LOCUS_7040 2919 3641 gene locus_tag LOCUS_7050 2919 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 4629 3655 gene locus_tag LOCUS_7060 4629 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 6711 4735 gene locus_tag LOCUS_7070 6711 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 7481 6873 gene locus_tag LOCUS_7080 7481 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 >Feature sequence32 350 2680 gene locus_tag LOCUS_7090 350 2680 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_7090 2682 3089 gene locus_tag LOCUS_7100 2682 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 3086 5506 gene locus_tag LOCUS_7110 3086 5506 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250108.1 protein_id gnl|my_center|LOCUS_7110 5597 6661 gene locus_tag LOCUS_7120 5597 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 >Feature sequence33 163 582 gene locus_tag LOCUS_7130 163 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 658 1692 gene locus_tag LOCUS_7140 658 1692 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183240.1 protein_id gnl|my_center|LOCUS_7140 1742 2146 gene locus_tag LOCUS_7150 1742 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 2136 2726 gene locus_tag LOCUS_7160 2136 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 4508 2745 gene locus_tag LOCUS_7170 gene alaS 4508 2745 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61708 protein_id gnl|my_center|LOCUS_7170 4906 4553 gene locus_tag LOCUS_7180 4906 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 5381 4908 gene locus_tag LOCUS_7190 5381 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 5537 5719 gene locus_tag LOCUS_7200 5537 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 5772 6638 gene locus_tag LOCUS_7210 5772 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 >Feature sequence34 806 3076 gene locus_tag LOCUS_7220 806 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 3139 5367 gene locus_tag LOCUS_7230 3139 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 5368 6423 gene locus_tag LOCUS_7240 5368 6423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 >Feature sequence35 471 112 gene locus_tag LOCUS_7250 471 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 1682 774 gene locus_tag LOCUS_7260 1682 774 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_7260 2710 1832 gene locus_tag LOCUS_7270 2710 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 2812 3618 gene locus_tag LOCUS_7280 2812 3618 CDS product translation initiation factor IF-2B subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496898.1 protein_id gnl|my_center|LOCUS_7280 4000 3608 gene locus_tag LOCUS_7290 4000 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 5835 4468 gene locus_tag LOCUS_7300 5835 4468 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_7300 6262 5897 gene locus_tag LOCUS_7310 6262 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 >Feature sequence36 825 1091 gene locus_tag LOCUS_7320 825 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7320 1088 1462 gene locus_tag LOCUS_7330 1088 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 1613 2395 gene locus_tag LOCUS_7340 1613 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 2550 2822 gene locus_tag LOCUS_7350 2550 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 2824 3072 gene locus_tag LOCUS_7360 2824 3072 CDS product RelE/StbE family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679713.1 protein_id gnl|my_center|LOCUS_7360 3180 3728 gene locus_tag LOCUS_7370 3180 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 3742 4467 gene locus_tag LOCUS_7380 3742 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 4634 4948 gene locus_tag LOCUS_7390 4634 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 5764 5456 gene locus_tag LOCUS_7400 5764 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 >Feature sequence37 807 1541 gene locus_tag LOCUS_7410 807 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 2578 2075 gene locus_tag LOCUS_7420 2578 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 3210 2575 gene locus_tag LOCUS_7430 3210 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 3698 3207 gene locus_tag LOCUS_7440 3698 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7440 4072 3695 gene locus_tag LOCUS_7450 4072 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7450 4518 4069 gene locus_tag LOCUS_7460 4518 4069 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621142.1 protein_id gnl|my_center|LOCUS_7460 4928 4515 gene locus_tag LOCUS_7470 4928 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 5461 4925 gene locus_tag LOCUS_7480 5461 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 >Feature sequence38 3 143 gene locus_tag LOCUS_7490 3 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 637 158 gene locus_tag LOCUS_7500 637 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7500 1118 612 gene locus_tag LOCUS_7510 1118 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 1190 1819 gene locus_tag LOCUS_7520 1190 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 1850 3064 gene locus_tag LOCUS_7530 1850 3064 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023597.1 protein_id gnl|my_center|LOCUS_7530 3112 3855 gene locus_tag LOCUS_7540 3112 3855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_7540 3923 4102 gene locus_tag LOCUS_7550 3923 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 <5760 4165 gene locus_tag LOCUS_7560 <5760 4165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HQ09:DNA gyrase subunit A >Feature sequence39 825 1826 gene locus_tag LOCUS_7570 825 1826 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868890.1 protein_id gnl|my_center|LOCUS_7570 1858 2280 gene locus_tag LOCUS_7580 1858 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 2586 2981 gene locus_tag LOCUS_7590 2586 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 3015 3725 gene locus_tag LOCUS_7600 3015 3725 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_7600 3770 4339 gene locus_tag LOCUS_7610 3770 4339 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259225.1 protein_id gnl|my_center|LOCUS_7610 5253 4363 gene locus_tag LOCUS_7620 5253 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 >Feature sequence40 1707 2081 gene locus_tag LOCUS_7630 1707 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 2508 2095 gene locus_tag LOCUS_7640 2508 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 2598 3293 gene locus_tag LOCUS_7650 2598 3293 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_7650 3394 4065 gene locus_tag LOCUS_7660 3394 4065 CDS product RNA-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 protein_id gnl|my_center|LOCUS_7660 4203 5150 gene locus_tag LOCUS_7670 4203 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7670 >Feature sequence41 208 1401 gene locus_tag LOCUS_7680 208 1401 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870092.1 protein_id gnl|my_center|LOCUS_7680 1486 4083 gene locus_tag LOCUS_7690 1486 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 4080 4721 gene locus_tag LOCUS_7700 4080 4721 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_7700 4726 4914 gene locus_tag LOCUS_7710 4726 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 >Feature sequence42 211 285 gene locus_tag LOCUS_t0240 211 285 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 404 1447 gene locus_tag LOCUS_7720 404 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 1433 1503 gene locus_tag LOCUS_t0250 1433 1503 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2094 1591 gene locus_tag LOCUS_7730 2094 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 2672 2091 gene locus_tag LOCUS_7740 2672 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 3685 2669 gene locus_tag LOCUS_7750 3685 2669 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_7750 4445 3732 gene locus_tag LOCUS_7760 4445 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 >Feature sequence43 257 739 gene locus_tag LOCUS_7770 257 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7770 736 1419 gene locus_tag LOCUS_7780 736 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 2114 1506 gene locus_tag LOCUS_7790 2114 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7790 2903 2259 gene locus_tag LOCUS_7800 2903 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7800 3140 2913 gene locus_tag LOCUS_7810 3140 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 3700 3137 gene locus_tag LOCUS_7820 3700 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 3832 4143 gene locus_tag LOCUS_7830 3832 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 4353 4835 gene locus_tag LOCUS_7840 4353 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 >Feature sequence44 1880 2620 gene locus_tag LOCUS_7850 1880 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7850 2645 3241 gene locus_tag LOCUS_7860 2645 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7860 3298 3534 gene locus_tag LOCUS_7870 3298 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 3940 3563 gene locus_tag LOCUS_7880 3940 3563 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980456.1 protein_id gnl|my_center|LOCUS_7880 4287 3937 gene locus_tag LOCUS_7890 4287 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 >Feature sequence45 <1 1204 gene locus_tag LOCUS_7900 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868079.1:aspartate--tRNA(Asn) ligase 1335 1796 gene locus_tag LOCUS_7910 1335 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7910 1821 2108 gene locus_tag LOCUS_7920 1821 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 2148 2411 gene locus_tag LOCUS_7930 2148 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7930 2408 2791 gene locus_tag LOCUS_7940 2408 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 2788 4107 gene locus_tag LOCUS_7950 2788 4107 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_7950 >Feature sequence46 1103 507 gene locus_tag LOCUS_7960 1103 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7960 1726 1175 gene locus_tag LOCUS_7970 1726 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 2060 1719 gene locus_tag LOCUS_7980 2060 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980 2598 2053 gene locus_tag LOCUS_7990 2598 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 2639 3868 gene locus_tag LOCUS_8000 2639 3868 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_8000 4215 3865 gene locus_tag LOCUS_8010 4215 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 4373 4212 gene locus_tag LOCUS_8020 4373 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8020 >Feature sequence47 3269 567 gene locus_tag LOCUS_8030 3269 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8030 3638 3877 gene locus_tag LOCUS_8040 3638 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8040 >Feature sequence48 1001 1357 gene locus_tag LOCUS_8050 1001 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8050 1409 2080 gene locus_tag LOCUS_8060 1409 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8060 2263 2081 gene locus_tag LOCUS_8070 2263 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 2765 2265 gene locus_tag LOCUS_8080 2765 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8080 3258 2767 gene locus_tag LOCUS_8090 3258 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8090 3346 3882 gene locus_tag LOCUS_8100 3346 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8100 >Feature sequence49 300 1016 gene locus_tag LOCUS_8110 300 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8110 1010 1405 gene locus_tag LOCUS_8120 1010 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 1410 1577 gene locus_tag LOCUS_8130 1410 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 1570 2712 gene locus_tag LOCUS_8140 1570 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8140 2712 3542 gene locus_tag LOCUS_8150 2712 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 >Feature sequence50 >Feature sequence51 <1 657 gene locus_tag LOCUS_8160 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879398.1:30S ribosomal protein S5 659 1006 gene locus_tag LOCUS_8170 659 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8170 1006 1497 gene locus_tag LOCUS_8180 1006 1497 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250470.1 protein_id gnl|my_center|LOCUS_8180 1859 2854 gene locus_tag LOCUS_8190 1859 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8190 >Feature sequence52 <1 544 gene locus_tag LOCUS_8200 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250650.1:DNA-directed RNA polymerase 544 741 gene locus_tag LOCUS_8210 544 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8210 738 1178 gene locus_tag LOCUS_8220 738 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8220 1178 1408 gene locus_tag LOCUS_8230 1178 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8230 1686 2057 gene locus_tag LOCUS_8240 1686 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 >Feature sequence53 39 221 gene locus_tag LOCUS_8250 39 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8250 222 956 gene locus_tag LOCUS_8260 222 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8260 2600 963 gene locus_tag LOCUS_8270 2600 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8270 >Feature sequence54 >Feature sequence55 >Feature sequence56 74 499 gene locus_tag LOCUS_8280 74 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8280 591 1013 gene locus_tag LOCUS_8290 591 1013 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_8290 1013 1609 gene locus_tag LOCUS_8300 1013 1609 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876682.1 protein_id gnl|my_center|LOCUS_8300 1745 2071 gene locus_tag LOCUS_8310 1745 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8310 >Feature sequence57 663 2147 gene locus_tag LOCUS_8320 663 2147 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532547.1 protein_id gnl|my_center|LOCUS_8320 >Feature sequence58 1471 1163 gene locus_tag LOCUS_8330 1471 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8330 >Feature sequence59 383 979 gene locus_tag LOCUS_8340 383 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8340