>Feature sequence01 2279 171 gene locus_tag LOCUS_0010 2279 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0010 4459 2321 gene locus_tag LOCUS_0020 4459 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021319.1 protein_id gnl|my_center|LOCUS_0020 6737 4461 gene locus_tag LOCUS_0030 6737 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 6846 7253 gene locus_tag LOCUS_0040 6846 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 7240 7911 gene locus_tag LOCUS_0050 7240 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 8448 7933 gene locus_tag LOCUS_0060 8448 7933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 9030 8452 gene locus_tag LOCUS_0070 9030 8452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 9637 9107 gene locus_tag LOCUS_0080 9637 9107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 9973 9671 gene locus_tag LOCUS_0090 9973 9671 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879029.1 protein_id gnl|my_center|LOCUS_0090 10042 10758 gene locus_tag LOCUS_0100 10042 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 10719 11465 gene locus_tag LOCUS_0110 10719 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 11737 11462 gene locus_tag LOCUS_0120 11737 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 11778 13271 gene locus_tag LOCUS_0130 11778 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0130 13268 13927 gene locus_tag LOCUS_0140 13268 13927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 13968 14231 gene locus_tag LOCUS_0150 13968 14231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 14927 14358 gene locus_tag LOCUS_0160 14927 14358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 15636 14929 gene locus_tag LOCUS_0170 gene iscU 15636 14929 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933650.1 protein_id gnl|my_center|LOCUS_0170 16816 15629 gene locus_tag LOCUS_0180 gene iscS 16816 15629 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_0180 17192 16818 gene locus_tag LOCUS_0190 17192 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 17300 18445 gene locus_tag LOCUS_0200 17300 18445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146499.1 protein_id gnl|my_center|LOCUS_0200 21903 18442 gene locus_tag LOCUS_0210 21903 18442 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496881.1 protein_id gnl|my_center|LOCUS_0210 23638 21893 gene locus_tag LOCUS_0220 23638 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 24864 23635 gene locus_tag LOCUS_0230 24864 23635 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_0230 25362 25625 gene locus_tag LOCUS_0240 25362 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 25653 27533 gene locus_tag LOCUS_0250 25653 27533 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250215.1 protein_id gnl|my_center|LOCUS_0250 27619 28077 gene locus_tag LOCUS_0260 27619 28077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 28142 28669 gene locus_tag LOCUS_0270 28142 28669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 28779 29438 gene locus_tag LOCUS_0280 28779 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 30118 30762 gene locus_tag LOCUS_0290 30118 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 31016 30816 gene locus_tag LOCUS_0300 31016 30816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 31206 31748 gene locus_tag LOCUS_0310 31206 31748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 31995 32255 gene locus_tag LOCUS_0320 31995 32255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 32954 32301 gene locus_tag LOCUS_0330 32954 32301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 33014 33883 gene locus_tag LOCUS_0340 33014 33883 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_0340 34059 34322 gene locus_tag LOCUS_0350 34059 34322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 34730 34329 gene locus_tag LOCUS_0360 34730 34329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 35463 34762 gene locus_tag LOCUS_0370 35463 34762 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024294.1 protein_id gnl|my_center|LOCUS_0370 35556 35631 gene locus_tag LOCUS_t0010 35556 35631 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 35641 35868 gene locus_tag LOCUS_0380 35641 35868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 36719 35865 gene locus_tag LOCUS_0390 36719 35865 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023085.1 protein_id gnl|my_center|LOCUS_0390 37666 36716 gene locus_tag LOCUS_0400 37666 36716 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023086.1 protein_id gnl|my_center|LOCUS_0400 38478 37717 gene locus_tag LOCUS_0410 38478 37717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 39032 38487 gene locus_tag LOCUS_0420 39032 38487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 41362 39056 gene locus_tag LOCUS_0430 41362 39056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 43049 41355 gene locus_tag LOCUS_0440 43049 41355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023084.1 protein_id gnl|my_center|LOCUS_0440 43501 43226 gene locus_tag LOCUS_0450 43501 43226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 43700 44977 gene locus_tag LOCUS_0460 43700 44977 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_0460 45028 47238 gene locus_tag LOCUS_0470 45028 47238 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_0470 47830 47225 gene locus_tag LOCUS_0480 47830 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 47920 48300 gene locus_tag LOCUS_0490 47920 48300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 48297 50588 gene locus_tag LOCUS_0500 48297 50588 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_0500 51106 50585 gene locus_tag LOCUS_0510 51106 50585 CDS product DNA topology modulation protein FlaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016073.1 protein_id gnl|my_center|LOCUS_0510 51979 51113 gene locus_tag LOCUS_0520 51979 51113 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_0520 54453 51979 gene locus_tag LOCUS_0530 54453 51979 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_0530 54573 55133 gene locus_tag LOCUS_0540 54573 55133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 55786 55130 gene locus_tag LOCUS_0550 55786 55130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 55866 56888 gene locus_tag LOCUS_0560 55866 56888 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_0560 56885 57784 gene locus_tag LOCUS_0570 56885 57784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 57786 58595 gene locus_tag LOCUS_0580 57786 58595 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_0580 59911 58598 gene locus_tag LOCUS_0590 59911 58598 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_0590 60006 60854 gene locus_tag LOCUS_0600 gene htpX 60006 60854 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74EV3 protein_id gnl|my_center|LOCUS_0600 62025 60856 gene locus_tag LOCUS_0610 62025 60856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 62981 62022 gene locus_tag LOCUS_0620 62981 62022 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_0620 63093 65897 gene locus_tag LOCUS_0630 gene ileS 63093 65897 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0W6 protein_id gnl|my_center|LOCUS_0630 65998 66588 gene locus_tag LOCUS_0640 65998 66588 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868091.1 protein_id gnl|my_center|LOCUS_0640 66707 68728 gene locus_tag LOCUS_0650 66707 68728 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061327.1 protein_id gnl|my_center|LOCUS_0650 68732 69427 gene locus_tag LOCUS_0660 68732 69427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 69465 69872 gene locus_tag LOCUS_0670 69465 69872 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869589.1 protein_id gnl|my_center|LOCUS_0670 69869 70165 gene locus_tag LOCUS_0680 69869 70165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_0680 70140 70496 gene locus_tag LOCUS_0690 70140 70496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 70509 72812 gene locus_tag LOCUS_0700 70509 72812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 72855 73220 gene locus_tag LOCUS_0710 72855 73220 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_0710 73230 73745 gene locus_tag LOCUS_0720 73230 73745 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_0720 73789 75375 gene locus_tag LOCUS_0730 73789 75375 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_0730 75372 76493 gene locus_tag LOCUS_0740 75372 76493 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869868.1 protein_id gnl|my_center|LOCUS_0740 76536 77234 gene locus_tag LOCUS_0750 76536 77234 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_0750 77297 78916 gene locus_tag LOCUS_0760 77297 78916 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_0760 78954 79478 gene locus_tag LOCUS_0770 78954 79478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 79536 79883 gene locus_tag LOCUS_0780 79536 79883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 79883 80887 gene locus_tag LOCUS_0790 79883 80887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 81867 80884 gene locus_tag LOCUS_0800 81867 80884 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_0800 82260 81874 gene locus_tag LOCUS_0810 82260 81874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 83472 82291 gene locus_tag LOCUS_0820 gene ychF 83472 82291 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_0820 83745 83820 gene locus_tag LOCUS_t0020 83745 83820 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 83922 84389 gene locus_tag LOCUS_0830 83922 84389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 84768 84394 gene locus_tag LOCUS_0840 84768 84394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 85019 85090 gene locus_tag LOCUS_t0030 85019 85090 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 85104 85176 gene locus_tag LOCUS_t0040 85104 85176 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 85287 85472 gene locus_tag LOCUS_0850 85287 85472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 85469 87451 gene locus_tag LOCUS_0860 85469 87451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 87448 92331 gene locus_tag LOCUS_0870 87448 92331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 92333 93142 gene locus_tag LOCUS_0880 92333 93142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 93228 93144 gene locus_tag LOCUS_t0050 93228 93144 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 93484 93239 gene locus_tag LOCUS_0890 93484 93239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 93710 93486 gene locus_tag LOCUS_0900 93710 93486 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_0900 93823 94203 gene locus_tag LOCUS_0910 93823 94203 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_0910 94356 95294 gene locus_tag LOCUS_0920 gene tfb 94356 95294 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_0920 95287 96057 gene locus_tag LOCUS_0930 95287 96057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 96965 96054 gene locus_tag LOCUS_0940 96965 96054 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061333.1 protein_id gnl|my_center|LOCUS_0940 97016 97546 gene locus_tag LOCUS_0950 97016 97546 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060780.1 protein_id gnl|my_center|LOCUS_0950 97597 98580 gene locus_tag LOCUS_0960 97597 98580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 98582 99493 gene locus_tag LOCUS_0970 98582 99493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 99694 99767 gene locus_tag LOCUS_t0060 99694 99767 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 99833 99908 gene locus_tag LOCUS_t0070 99833 99908 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 99917 100531 gene locus_tag LOCUS_0980 99917 100531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 100856 100665 gene locus_tag LOCUS_0990 100856 100665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0990 100934 101006 gene locus_tag LOCUS_t0080 100934 101006 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 101042 101117 gene locus_tag LOCUS_t0090 101042 101117 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 101147 101569 gene locus_tag LOCUS_1000 101147 101569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 101934 101566 gene locus_tag LOCUS_1010 101934 101566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 102203 101994 gene locus_tag LOCUS_1020 102203 101994 CDS product histone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_1020 102468 103427 gene locus_tag LOCUS_1030 102468 103427 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 protein_id gnl|my_center|LOCUS_1030 103429 104352 gene locus_tag LOCUS_1040 103429 104352 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_1040 104349 104612 gene locus_tag LOCUS_1050 104349 104612 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_1050 104614 105339 gene locus_tag LOCUS_1060 104614 105339 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_1060 105345 105749 gene locus_tag LOCUS_1070 105345 105749 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_1070 105755 106327 gene locus_tag LOCUS_1080 105755 106327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 >Feature sequence02 <1 854 gene locus_tag LOCUS_1090 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031049.1:ATP-binding protein 1042 851 gene locus_tag LOCUS_1100 1042 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 1912 1256 gene locus_tag LOCUS_1110 1912 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021974.1 protein_id gnl|my_center|LOCUS_1110 2162 2440 gene locus_tag LOCUS_1120 2162 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 2437 2763 gene locus_tag LOCUS_1130 2437 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020567.1 protein_id gnl|my_center|LOCUS_1130 3232 3008 gene locus_tag LOCUS_1140 3232 3008 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496745.1 protein_id gnl|my_center|LOCUS_1140 3400 3245 gene locus_tag LOCUS_1150 3400 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 3431 4378 gene locus_tag LOCUS_1160 3431 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 4409 4822 gene locus_tag LOCUS_1170 4409 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 5287 4967 gene locus_tag LOCUS_1180 5287 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 5471 6121 gene locus_tag LOCUS_1190 5471 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 6256 6531 gene locus_tag LOCUS_1200 6256 6531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 7977 6562 gene locus_tag LOCUS_1210 7977 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447105.1 protein_id gnl|my_center|LOCUS_1210 8240 8551 gene locus_tag LOCUS_1220 8240 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 8631 8957 gene locus_tag LOCUS_1230 8631 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 10083 8959 gene locus_tag LOCUS_1240 gene metK 10083 8959 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CL7 protein_id gnl|my_center|LOCUS_1240 10737 10249 gene locus_tag LOCUS_1250 10737 10249 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_1250 10895 11332 gene locus_tag LOCUS_1260 10895 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 11311 11619 gene locus_tag LOCUS_1270 11311 11619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 11621 12787 gene locus_tag LOCUS_1280 11621 12787 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496965.1 protein_id gnl|my_center|LOCUS_1280 13122 12784 gene locus_tag LOCUS_1290 13122 12784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 13514 13119 gene locus_tag LOCUS_1300 13514 13119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 13985 13566 gene locus_tag LOCUS_1310 13985 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 14338 13982 gene locus_tag LOCUS_1320 14338 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 14957 14376 gene locus_tag LOCUS_1330 14957 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 15939 14959 gene locus_tag LOCUS_1340 15939 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 16223 15939 gene locus_tag LOCUS_1350 16223 15939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 16715 16224 gene locus_tag LOCUS_1360 16715 16224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 16797 18041 gene locus_tag LOCUS_1370 16797 18041 CDS product CCA-adding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879645.1 protein_id gnl|my_center|LOCUS_1370 18728 18030 gene locus_tag LOCUS_1380 gene tdk 18728 18030 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q03221 protein_id gnl|my_center|LOCUS_1380 18853 19356 gene locus_tag LOCUS_1390 18853 19356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 19358 19744 gene locus_tag LOCUS_1400 gene lspA 19358 19744 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HES1 protein_id gnl|my_center|LOCUS_1400 20092 19745 gene locus_tag LOCUS_1410 20092 19745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 20171 21595 gene locus_tag LOCUS_1420 20171 21595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 21630 23450 gene locus_tag LOCUS_1430 21630 23450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 24149 23451 gene locus_tag LOCUS_1440 24149 23451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 24247 24750 gene locus_tag LOCUS_1450 24247 24750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 24900 25625 gene locus_tag LOCUS_1460 24900 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 25672 26217 gene locus_tag LOCUS_1470 25672 26217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 26258 27718 gene locus_tag LOCUS_1480 gene pepA 26258 27718 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB4 protein_id gnl|my_center|LOCUS_1480 27840 28565 gene locus_tag LOCUS_1490 27840 28565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 29011 28562 gene locus_tag LOCUS_1500 29011 28562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 29542 29087 gene locus_tag LOCUS_1510 29542 29087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 29716 30888 gene locus_tag LOCUS_1520 29716 30888 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_1520 31115 30885 gene locus_tag LOCUS_1530 31115 30885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 31250 31903 gene locus_tag LOCUS_1540 31250 31903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023108.1 protein_id gnl|my_center|LOCUS_1540 31884 32750 gene locus_tag LOCUS_1550 31884 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1550 32747 33967 gene locus_tag LOCUS_1560 32747 33967 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_1560 33964 35181 gene locus_tag LOCUS_1570 33964 35181 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022516.1 protein_id gnl|my_center|LOCUS_1570 35506 36934 gene locus_tag LOCUS_r0010 35506 36934 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 36998 37072 gene locus_tag LOCUS_t0100 36998 37072 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 37331 40212 gene locus_tag LOCUS_r0020 37331 40212 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 40728 40306 gene locus_tag LOCUS_1580 40728 40306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 41638 40820 gene locus_tag LOCUS_1590 41638 40820 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856159.1 protein_id gnl|my_center|LOCUS_1590 41730 42170 gene locus_tag LOCUS_1600 41730 42170 CDS product SET domain-containing protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929825.1 protein_id gnl|my_center|LOCUS_1600 42199 42894 gene locus_tag LOCUS_1610 42199 42894 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783729.1 protein_id gnl|my_center|LOCUS_1610 42930 43946 gene locus_tag LOCUS_1620 42930 43946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 44493 43948 gene locus_tag LOCUS_1630 44493 43948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 46250 44490 gene locus_tag LOCUS_1640 gene pepF 46250 44490 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_1640 46350 46652 gene locus_tag LOCUS_1650 46350 46652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 46937 46722 gene locus_tag LOCUS_1660 46937 46722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 48089 47028 gene locus_tag LOCUS_1670 48089 47028 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 protein_id gnl|my_center|LOCUS_1670 48996 48127 gene locus_tag LOCUS_1680 gene thyX 48996 48127 CDS product flavin-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDM6 protein_id gnl|my_center|LOCUS_1680 50098 49061 gene locus_tag LOCUS_1690 50098 49061 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_1690 50174 50941 gene locus_tag LOCUS_1700 50174 50941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1700 51324 51911 gene locus_tag LOCUS_1710 51324 51911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 51949 52104 gene locus_tag LOCUS_1720 51949 52104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 53927 52101 gene locus_tag LOCUS_1730 53927 52101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 54347 54790 gene locus_tag LOCUS_1740 54347 54790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1740 56424 54787 gene locus_tag LOCUS_1750 56424 54787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 56630 56421 gene locus_tag LOCUS_1760 56630 56421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1760 56737 57237 gene locus_tag LOCUS_1770 56737 57237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 57253 57921 gene locus_tag LOCUS_1780 57253 57921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 57987 58226 gene locus_tag LOCUS_1790 57987 58226 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_1790 60853 58229 gene locus_tag LOCUS_1800 60853 58229 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877404.1 protein_id gnl|my_center|LOCUS_1800 61112 61942 gene locus_tag LOCUS_1810 61112 61942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 62220 62552 gene locus_tag LOCUS_1820 62220 62552 CDS product NagC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867761.1 protein_id gnl|my_center|LOCUS_1820 62560 63228 gene locus_tag LOCUS_1830 62560 63228 CDS product phenol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402923.1 protein_id gnl|my_center|LOCUS_1830 63263 63748 gene locus_tag LOCUS_1840 63263 63748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 63729 64358 gene locus_tag LOCUS_1850 63729 64358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 64396 64887 gene locus_tag LOCUS_1860 64396 64887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 64884 65315 gene locus_tag LOCUS_1870 64884 65315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 65317 66030 gene locus_tag LOCUS_1880 65317 66030 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868125.1 protein_id gnl|my_center|LOCUS_1880 66043 66774 gene locus_tag LOCUS_1890 66043 66774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1890 66872 67366 gene locus_tag LOCUS_1900 66872 67366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 68206 67541 gene locus_tag LOCUS_1910 68206 67541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 68555 68295 gene locus_tag LOCUS_1920 68555 68295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 68844 68548 gene locus_tag LOCUS_1930 68844 68548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 69294 68845 gene locus_tag LOCUS_1940 69294 68845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 69815 70030 gene locus_tag LOCUS_1950 69815 70030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020107.1 protein_id gnl|my_center|LOCUS_1950 70031 70279 gene locus_tag LOCUS_1960 70031 70279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_1960 70322 72892 gene locus_tag LOCUS_1970 70322 72892 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_1970 73173 72871 gene locus_tag LOCUS_1980 73173 72871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 73224 74189 gene locus_tag LOCUS_1990 73224 74189 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001065417.1 protein_id gnl|my_center|LOCUS_1990 74276 74440 gene locus_tag LOCUS_2000 74276 74440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 75256 74504 gene locus_tag LOCUS_2010 75256 74504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 >Feature sequence03 1319 747 gene locus_tag LOCUS_2020 1319 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 1557 2675 gene locus_tag LOCUS_2030 1557 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 2683 2817 gene locus_tag LOCUS_2040 2683 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 2814 2954 gene locus_tag LOCUS_2050 2814 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 2991 4445 gene locus_tag LOCUS_2060 2991 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 4496 4888 gene locus_tag LOCUS_2070 4496 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 4965 5444 gene locus_tag LOCUS_2080 4965 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 5486 5872 gene locus_tag LOCUS_2090 5486 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 5872 6285 gene locus_tag LOCUS_2100 5872 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 6278 6814 gene locus_tag LOCUS_2110 6278 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 7125 6811 gene locus_tag LOCUS_2120 7125 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 7269 7802 gene locus_tag LOCUS_2130 7269 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 7811 8629 gene locus_tag LOCUS_2140 7811 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 8685 9683 gene locus_tag LOCUS_2150 8685 9683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 9701 10084 gene locus_tag LOCUS_2160 9701 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 10224 10523 gene locus_tag LOCUS_2170 10224 10523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 10533 11519 gene locus_tag LOCUS_2180 10533 11519 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_2180 11608 11535 gene locus_tag LOCUS_t0110 11608 11535 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11708 11884 gene locus_tag LOCUS_2190 11708 11884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 11896 12174 gene locus_tag LOCUS_2200 11896 12174 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869959.1 protein_id gnl|my_center|LOCUS_2200 12204 12743 gene locus_tag LOCUS_2210 12204 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 13618 12740 gene locus_tag LOCUS_2220 13618 12740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 13671 14771 gene locus_tag LOCUS_2230 13671 14771 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_2230 15453 14764 gene locus_tag LOCUS_2240 15453 14764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 15604 16251 gene locus_tag LOCUS_2250 15604 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2250 16312 17526 gene locus_tag LOCUS_2260 16312 17526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 17536 19014 gene locus_tag LOCUS_2270 17536 19014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 19004 19969 gene locus_tag LOCUS_2280 19004 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 20002 20958 gene locus_tag LOCUS_2290 20002 20958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 21091 21549 gene locus_tag LOCUS_2300 21091 21549 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_2300 22343 21546 gene locus_tag LOCUS_2310 22343 21546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 22510 22343 gene locus_tag LOCUS_2320 22510 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 23304 22507 gene locus_tag LOCUS_2330 23304 22507 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_2330 23492 23304 gene locus_tag LOCUS_2340 23492 23304 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_2340 23581 23817 gene locus_tag LOCUS_2350 23581 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 24134 23814 gene locus_tag LOCUS_2360 24134 23814 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_2360 24741 24121 gene locus_tag LOCUS_2370 24741 24121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878829.1 protein_id gnl|my_center|LOCUS_2370 24829 25746 gene locus_tag LOCUS_2380 gene truD 24829 25746 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SI49 protein_id gnl|my_center|LOCUS_2380 25783 27564 gene locus_tag LOCUS_2390 25783 27564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 27625 28716 gene locus_tag LOCUS_2400 27625 28716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 28764 29858 gene locus_tag LOCUS_2410 28764 29858 CDS product cell division protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869789.1 protein_id gnl|my_center|LOCUS_2410 29908 30945 gene locus_tag LOCUS_2420 29908 30945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 31007 31717 gene locus_tag LOCUS_2430 31007 31717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 31773 32429 gene locus_tag LOCUS_2440 31773 32429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 32444 33136 gene locus_tag LOCUS_2450 32444 33136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 33187 34545 gene locus_tag LOCUS_2460 33187 34545 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_2460 34744 35373 gene locus_tag LOCUS_2470 34744 35373 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_2470 35411 35485 gene locus_tag LOCUS_t0120 35411 35485 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 35607 36062 gene locus_tag LOCUS_2480 35607 36062 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_2480 36121 37539 gene locus_tag LOCUS_2490 36121 37539 CDS product single-stranded DNA endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146471.1 protein_id gnl|my_center|LOCUS_2490 37600 38178 gene locus_tag LOCUS_2500 37600 38178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 38221 38442 gene locus_tag LOCUS_2510 38221 38442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 39338 38427 gene locus_tag LOCUS_2520 39338 38427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 40319 39339 gene locus_tag LOCUS_2530 40319 39339 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_2530 41370 40372 gene locus_tag LOCUS_2540 41370 40372 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867646.1 protein_id gnl|my_center|LOCUS_2540 41454 46169 gene locus_tag LOCUS_2550 41454 46169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 46664 46188 gene locus_tag LOCUS_2560 46664 46188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 47251 46844 gene locus_tag LOCUS_2570 47251 46844 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_2570 48625 47291 gene locus_tag LOCUS_2580 48625 47291 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868520.1 protein_id gnl|my_center|LOCUS_2580 49213 48674 gene locus_tag LOCUS_2590 49213 48674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 49334 49966 gene locus_tag LOCUS_2600 49334 49966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 50092 52587 gene locus_tag LOCUS_2610 gene valS 50092 52587 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZCN6 protein_id gnl|my_center|LOCUS_2610 52630 53718 gene locus_tag LOCUS_2620 52630 53718 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146580.1 protein_id gnl|my_center|LOCUS_2620 53750 54463 gene locus_tag LOCUS_2630 53750 54463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 54516 55784 gene locus_tag LOCUS_2640 54516 55784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 55778 56470 gene locus_tag LOCUS_2650 55778 56470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 56484 56954 gene locus_tag LOCUS_2660 56484 56954 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876368.1 protein_id gnl|my_center|LOCUS_2660 56970 57602 gene locus_tag LOCUS_2670 56970 57602 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_2670 57649 57918 gene locus_tag LOCUS_2680 57649 57918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 57935 58504 gene locus_tag LOCUS_2690 57935 58504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 58506 58826 gene locus_tag LOCUS_2700 58506 58826 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762194.1 protein_id gnl|my_center|LOCUS_2700 58836 59156 gene locus_tag LOCUS_2710 58836 59156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 59222 59971 gene locus_tag LOCUS_2720 59222 59971 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_2720 60006 60452 gene locus_tag LOCUS_2730 60006 60452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2730 60510 63734 gene locus_tag LOCUS_2740 60510 63734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2740 63798 64589 gene locus_tag LOCUS_2750 63798 64589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 64603 68481 gene locus_tag LOCUS_2760 64603 68481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 68546 69073 gene locus_tag LOCUS_2770 68546 69073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 69073 69492 gene locus_tag LOCUS_2780 69073 69492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 69489 70010 gene locus_tag LOCUS_2790 69489 70010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2790 70030 71001 gene locus_tag LOCUS_2800 70030 71001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 71004 71537 gene locus_tag LOCUS_2810 71004 71537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 71518 71949 gene locus_tag LOCUS_2820 71518 71949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 >Feature sequence04 1625 813 gene locus_tag LOCUS_2830 1625 813 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7P7 protein_id gnl|my_center|LOCUS_2830 1791 2687 gene locus_tag LOCUS_2840 1791 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 4501 2813 gene locus_tag LOCUS_2850 4501 2813 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868104.1 protein_id gnl|my_center|LOCUS_2850 5338 4541 gene locus_tag LOCUS_2860 5338 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 5418 5501 gene locus_tag LOCUS_t0130 5418 5501 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5545 5627 gene locus_tag LOCUS_t0140 5545 5627 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5691 6548 gene locus_tag LOCUS_2870 5691 6548 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_2870 6766 6930 gene locus_tag LOCUS_2880 6766 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 7188 6931 gene locus_tag LOCUS_2890 7188 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 7471 7193 gene locus_tag LOCUS_2900 7471 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 7608 8309 gene locus_tag LOCUS_2910 7608 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 9310 8306 gene locus_tag LOCUS_2920 9310 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 11601 9547 gene locus_tag LOCUS_2930 11601 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 12016 11627 gene locus_tag LOCUS_2940 12016 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 12094 12588 gene locus_tag LOCUS_2950 12094 12588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 12595 14058 gene locus_tag LOCUS_2960 12595 14058 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867223.1 protein_id gnl|my_center|LOCUS_2960 14128 14751 gene locus_tag LOCUS_2970 14128 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 14810 15520 gene locus_tag LOCUS_2980 14810 15520 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_2980 15517 16764 gene locus_tag LOCUS_2990 15517 16764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 17056 16811 gene locus_tag LOCUS_3000 17056 16811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3000 17147 17362 gene locus_tag LOCUS_3010 17147 17362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 18002 17352 gene locus_tag LOCUS_3020 18002 17352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 18125 18766 gene locus_tag LOCUS_3030 gene nth 18125 18766 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJX0 protein_id gnl|my_center|LOCUS_3030 19332 18763 gene locus_tag LOCUS_3040 19332 18763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 21041 19329 gene locus_tag LOCUS_3050 gene thrS 21041 19329 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GK4 protein_id gnl|my_center|LOCUS_3050 21646 21062 gene locus_tag LOCUS_3060 21646 21062 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837350.1 protein_id gnl|my_center|LOCUS_3060 21830 22072 gene locus_tag LOCUS_3070 21830 22072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 22069 22392 gene locus_tag LOCUS_3080 22069 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 22466 22816 gene locus_tag LOCUS_3090 22466 22816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 23215 22817 gene locus_tag LOCUS_3100 23215 22817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 23883 23254 gene locus_tag LOCUS_3110 23883 23254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869353.1 protein_id gnl|my_center|LOCUS_3110 24314 23880 gene locus_tag LOCUS_3120 gene rlmH 24314 23880 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CU83 protein_id gnl|my_center|LOCUS_3120 25773 24346 gene locus_tag LOCUS_3130 gene guaB 25773 24346 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ0 protein_id gnl|my_center|LOCUS_3130 27178 25850 gene locus_tag LOCUS_3140 27178 25850 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993821.1 protein_id gnl|my_center|LOCUS_3140 27414 27175 gene locus_tag LOCUS_3150 27414 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 27491 27850 gene locus_tag LOCUS_3160 27491 27850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 29457 27847 gene locus_tag LOCUS_3170 29457 27847 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_3170 30949 29459 gene locus_tag LOCUS_3180 30949 29459 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869988.1 protein_id gnl|my_center|LOCUS_3180 31018 31599 gene locus_tag LOCUS_3190 31018 31599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 31662 32243 gene locus_tag LOCUS_3200 31662 32243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 32379 32597 gene locus_tag LOCUS_3210 32379 32597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 32633 34642 gene locus_tag LOCUS_3220 32633 34642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 34711 35619 gene locus_tag LOCUS_3230 34711 35619 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861471.1 protein_id gnl|my_center|LOCUS_3230 36473 35616 gene locus_tag LOCUS_3240 36473 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 38290 36506 gene locus_tag LOCUS_3250 38290 36506 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388875.1 protein_id gnl|my_center|LOCUS_3250 38994 38488 gene locus_tag LOCUS_3260 38994 38488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 39358 38984 gene locus_tag LOCUS_3270 39358 38984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 40301 39402 gene locus_tag LOCUS_3280 40301 39402 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_3280 40512 40303 gene locus_tag LOCUS_3290 40512 40303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 40574 41029 gene locus_tag LOCUS_3300 40574 41029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 41833 40994 gene locus_tag LOCUS_3310 41833 40994 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_3310 42858 41830 gene locus_tag LOCUS_3320 42858 41830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 43792 42851 gene locus_tag LOCUS_3330 43792 42851 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249622.1 protein_id gnl|my_center|LOCUS_3330 44520 43969 gene locus_tag LOCUS_3340 44520 43969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 45613 44507 gene locus_tag LOCUS_3350 45613 44507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 46176 45622 gene locus_tag LOCUS_3360 46176 45622 CDS product fructose 2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812049.1 protein_id gnl|my_center|LOCUS_3360 46296 46787 gene locus_tag LOCUS_3370 46296 46787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 46784 47305 gene locus_tag LOCUS_3380 46784 47305 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836701.1 protein_id gnl|my_center|LOCUS_3380 47331 47732 gene locus_tag LOCUS_3390 47331 47732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 47755 48237 gene locus_tag LOCUS_3400 47755 48237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 48234 48464 gene locus_tag LOCUS_3410 48234 48464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 48961 48461 gene locus_tag LOCUS_3420 48961 48461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 49345 49788 gene locus_tag LOCUS_3430 49345 49788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3430 49789 49965 gene locus_tag LOCUS_3440 49789 49965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3440 50064 50264 gene locus_tag LOCUS_3450 50064 50264 CDS product copper chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021355.1 protein_id gnl|my_center|LOCUS_3450 50261 51700 gene locus_tag LOCUS_3460 50261 51700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 51733 53913 gene locus_tag LOCUS_3470 51733 53913 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_3470 54144 55286 gene locus_tag LOCUS_3480 54144 55286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 >Feature sequence05 334 1461 gene locus_tag LOCUS_3490 334 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 1569 2081 gene locus_tag LOCUS_3500 1569 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 2078 2272 gene locus_tag LOCUS_3510 2078 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 2314 2898 gene locus_tag LOCUS_3520 2314 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 2895 3365 gene locus_tag LOCUS_3530 2895 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 4064 3447 gene locus_tag LOCUS_3540 4064 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 4297 4085 gene locus_tag LOCUS_3550 4297 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 5064 4279 gene locus_tag LOCUS_3560 5064 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 5781 5104 gene locus_tag LOCUS_3570 5781 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 6554 5778 gene locus_tag LOCUS_3580 6554 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 7701 6547 gene locus_tag LOCUS_3590 7701 6547 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_3590 7931 7704 gene locus_tag LOCUS_3600 7931 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3600 8203 9777 gene locus_tag LOCUS_3610 8203 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 9887 10129 gene locus_tag LOCUS_3620 9887 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 10271 10804 gene locus_tag LOCUS_3630 10271 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 10801 11214 gene locus_tag LOCUS_3640 10801 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 11832 11587 gene locus_tag LOCUS_3650 11832 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 11937 13034 gene locus_tag LOCUS_3660 11937 13034 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_3660 14251 13031 gene locus_tag LOCUS_3670 14251 13031 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_3670 14391 14849 gene locus_tag LOCUS_3680 14391 14849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 14888 15193 gene locus_tag LOCUS_3690 14888 15193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 15272 15682 gene locus_tag LOCUS_3700 15272 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3700 15679 16449 gene locus_tag LOCUS_3710 15679 16449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3710 16625 16437 gene locus_tag LOCUS_3720 16625 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 16895 17479 gene locus_tag LOCUS_3730 16895 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 17556 17485 gene locus_tag LOCUS_t0150 17556 17485 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17636 17564 gene locus_tag LOCUS_t0160 17636 17564 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17692 17835 gene locus_tag LOCUS_3740 17692 17835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3740 17864 18871 gene locus_tag LOCUS_3750 17864 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 18868 19770 gene locus_tag LOCUS_3760 18868 19770 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878356.1 protein_id gnl|my_center|LOCUS_3760 20759 19767 gene locus_tag LOCUS_3770 20759 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3770 21234 20791 gene locus_tag LOCUS_3780 21234 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 21988 21236 gene locus_tag LOCUS_3790 21988 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 22845 21985 gene locus_tag LOCUS_3800 22845 21985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3800 24112 22847 gene locus_tag LOCUS_3810 24112 22847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 24284 24102 gene locus_tag LOCUS_3820 24284 24102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 25879 24290 gene locus_tag LOCUS_3830 25879 24290 CDS product secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_3830 26400 25936 gene locus_tag LOCUS_3840 26400 25936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 26979 26515 gene locus_tag LOCUS_3850 26979 26515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3850 27486 27031 gene locus_tag LOCUS_3860 27486 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 27911 27480 gene locus_tag LOCUS_3870 27911 27480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 28546 27947 gene locus_tag LOCUS_3880 28546 27947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 29072 28584 gene locus_tag LOCUS_3890 29072 28584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 29137 29724 gene locus_tag LOCUS_3900 29137 29724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 30029 29736 gene locus_tag LOCUS_3910 30029 29736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 30379 30308 gene locus_tag LOCUS_t0170 30379 30308 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30562 30810 gene locus_tag LOCUS_3920 gene mazG 30562 30810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 protein_id gnl|my_center|LOCUS_3920 30900 30815 gene locus_tag LOCUS_t0180 30900 30815 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 32033 30942 gene locus_tag LOCUS_3930 32033 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 32731 32030 gene locus_tag LOCUS_3940 32731 32030 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147212.1 protein_id gnl|my_center|LOCUS_3940 32854 33306 gene locus_tag LOCUS_3950 32854 33306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 33489 33301 gene locus_tag LOCUS_3960 33489 33301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 33579 34124 gene locus_tag LOCUS_3970 33579 34124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 34108 34749 gene locus_tag LOCUS_3980 34108 34749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 34779 35180 gene locus_tag LOCUS_3990 34779 35180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 35252 35181 gene locus_tag LOCUS_t0190 35252 35181 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35410 35258 gene locus_tag LOCUS_4000 35410 35258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 35462 36292 gene locus_tag LOCUS_4010 35462 36292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583169.1 protein_id gnl|my_center|LOCUS_4010 36325 36696 gene locus_tag LOCUS_4020 36325 36696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4020 37128 36697 gene locus_tag LOCUS_4030 gene dut 37128 36697 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Y7 protein_id gnl|my_center|LOCUS_4030 39230 37125 gene locus_tag LOCUS_4040 gene rtpR 39230 37125 CDS product adenosylcobalamin-dependent ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMX8 protein_id gnl|my_center|LOCUS_4040 39686 39243 gene locus_tag LOCUS_4050 gene nrdR 39686 39243 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BT4 protein_id gnl|my_center|LOCUS_4050 41637 39832 gene locus_tag LOCUS_4060 41637 39832 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_4060 41742 42764 gene locus_tag LOCUS_4070 41742 42764 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867759.1 protein_id gnl|my_center|LOCUS_4070 42766 43035 gene locus_tag LOCUS_4080 42766 43035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4080 43267 43019 gene locus_tag LOCUS_4090 43267 43019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 44228 43704 gene locus_tag LOCUS_4100 44228 43704 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_4100 44492 44235 gene locus_tag LOCUS_4110 44492 44235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 46378 44534 gene locus_tag LOCUS_4120 46378 44534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4120 46464 47681 gene locus_tag LOCUS_4130 46464 47681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 47690 49342 gene locus_tag LOCUS_4140 47690 49342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 >Feature sequence06 1569 1039 gene locus_tag LOCUS_4150 1569 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4150 1676 3205 gene locus_tag LOCUS_4160 1676 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4160 3439 3981 gene locus_tag LOCUS_4170 3439 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 5345 3978 gene locus_tag LOCUS_4180 5345 3978 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496682.1 protein_id gnl|my_center|LOCUS_4180 5462 7033 gene locus_tag LOCUS_4190 5462 7033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 7105 8925 gene locus_tag LOCUS_4200 7105 8925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 9062 8990 gene locus_tag LOCUS_t0200 9062 8990 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 9141 9066 gene locus_tag LOCUS_t0210 9141 9066 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9899 9171 gene locus_tag LOCUS_4210 9899 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 9976 12402 gene locus_tag LOCUS_4220 gene leuS 9976 12402 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY15 protein_id gnl|my_center|LOCUS_4220 14916 12403 gene locus_tag LOCUS_4230 14916 12403 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_4230 15417 14956 gene locus_tag LOCUS_4240 15417 14956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4240 16096 15419 gene locus_tag LOCUS_4250 16096 15419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 17519 16128 gene locus_tag LOCUS_4260 17519 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 18379 17516 gene locus_tag LOCUS_4270 18379 17516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 18567 19037 gene locus_tag LOCUS_4280 18567 19037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 19728 19030 gene locus_tag LOCUS_4290 19728 19030 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_4290 20746 19772 gene locus_tag LOCUS_4300 20746 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 21633 20749 gene locus_tag LOCUS_4310 21633 20749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 23081 21636 gene locus_tag LOCUS_4320 23081 21636 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_4320 24136 23114 gene locus_tag LOCUS_4330 24136 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 25278 24202 gene locus_tag LOCUS_4340 25278 24202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 26042 25266 gene locus_tag LOCUS_4350 26042 25266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 26566 26039 gene locus_tag LOCUS_4360 26566 26039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 27269 26568 gene locus_tag LOCUS_4370 27269 26568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 27666 27259 gene locus_tag LOCUS_4380 27666 27259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 28088 27666 gene locus_tag LOCUS_4390 28088 27666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 28242 28397 gene locus_tag LOCUS_4400 28242 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 29140 28442 gene locus_tag LOCUS_4410 29140 28442 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877405.1 protein_id gnl|my_center|LOCUS_4410 30821 29148 gene locus_tag LOCUS_4420 gene argS 30821 29148 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I0R5 protein_id gnl|my_center|LOCUS_4420 31680 30862 gene locus_tag LOCUS_4430 31680 30862 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_4430 33489 31813 gene locus_tag LOCUS_4440 33489 31813 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867667.1 protein_id gnl|my_center|LOCUS_4440 33530 34189 gene locus_tag LOCUS_4450 33530 34189 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_4450 34614 34204 gene locus_tag LOCUS_4460 34614 34204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 35898 34801 gene locus_tag LOCUS_4470 35898 34801 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_4470 36277 37581 gene locus_tag LOCUS_4480 36277 37581 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869512.1 protein_id gnl|my_center|LOCUS_4480 37605 39026 gene locus_tag LOCUS_4490 37605 39026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 39061 40371 gene locus_tag LOCUS_4500 39061 40371 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_4500 40412 41710 gene locus_tag LOCUS_4510 40412 41710 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_4510 41707 42009 gene locus_tag LOCUS_4520 41707 42009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 42090 43043 gene locus_tag LOCUS_4530 42090 43043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 43180 43040 gene locus_tag LOCUS_4540 43180 43040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 43258 43333 gene locus_tag LOCUS_t0220 43258 43333 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 1261 506 gene locus_tag LOCUS_4550 1261 506 CDS product TatD family deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_4550 2641 1301 gene locus_tag LOCUS_4560 2641 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 2851 2675 gene locus_tag LOCUS_4570 2851 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4570 3248 2853 gene locus_tag LOCUS_4580 3248 2853 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_4580 3342 4016 gene locus_tag LOCUS_4590 3342 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 4089 5216 gene locus_tag LOCUS_4600 4089 5216 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869869.1 protein_id gnl|my_center|LOCUS_4600 5256 5426 gene locus_tag LOCUS_4610 5256 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 5436 6074 gene locus_tag LOCUS_4620 5436 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 6079 6738 gene locus_tag LOCUS_4630 6079 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 6744 6818 gene locus_tag LOCUS_t0230 6744 6818 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6836 7045 gene locus_tag LOCUS_4640 6836 7045 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_4640 7187 7531 gene locus_tag LOCUS_4650 7187 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 7586 7828 gene locus_tag LOCUS_4660 7586 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061044.1 protein_id gnl|my_center|LOCUS_4660 7889 8284 gene locus_tag LOCUS_4670 7889 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 8321 8854 gene locus_tag LOCUS_4680 8321 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870034.1 protein_id gnl|my_center|LOCUS_4680 8885 9316 gene locus_tag LOCUS_4690 8885 9316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 9411 9602 gene locus_tag LOCUS_4700 9411 9602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 9604 9945 gene locus_tag LOCUS_4710 9604 9945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 10933 9947 gene locus_tag LOCUS_4720 10933 9947 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_4720 11067 12533 gene locus_tag LOCUS_4730 11067 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 12534 12609 gene locus_tag LOCUS_t0240 12534 12609 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12656 12910 gene locus_tag LOCUS_4740 12656 12910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4740 12903 13331 gene locus_tag LOCUS_4750 12903 13331 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_4750 13379 13453 gene locus_tag LOCUS_t0250 13379 13453 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 15177 13453 gene locus_tag LOCUS_4760 gene kefB 15177 13453 CDS product potassium transporter Kef inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399950.1 protein_id gnl|my_center|LOCUS_4760 15535 15230 gene locus_tag LOCUS_4770 15535 15230 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869708.1 protein_id gnl|my_center|LOCUS_4770 15762 15568 gene locus_tag LOCUS_4780 15762 15568 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762842.1 protein_id gnl|my_center|LOCUS_4780 16902 15784 gene locus_tag LOCUS_4790 16902 15784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 18440 16899 gene locus_tag LOCUS_4800 gene lysS 18440 16899 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73JY6 protein_id gnl|my_center|LOCUS_4800 18631 18801 gene locus_tag LOCUS_4810 18631 18801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 18861 19253 gene locus_tag LOCUS_4820 18861 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_4820 19306 20316 gene locus_tag LOCUS_4830 19306 20316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 20318 20794 gene locus_tag LOCUS_4840 20318 20794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 22090 20795 gene locus_tag LOCUS_4850 22090 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 23904 22087 gene locus_tag LOCUS_4860 23904 22087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 23987 24559 gene locus_tag LOCUS_4870 23987 24559 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496757.1 protein_id gnl|my_center|LOCUS_4870 24941 24534 gene locus_tag LOCUS_4880 24941 24534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 25493 25131 gene locus_tag LOCUS_4890 25493 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 25988 25497 gene locus_tag LOCUS_4900 25988 25497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 27452 26025 gene locus_tag LOCUS_4910 27452 26025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 27953 27507 gene locus_tag LOCUS_4920 27953 27507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 30018 27991 gene locus_tag LOCUS_4930 30018 27991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 30442 30023 gene locus_tag LOCUS_4940 30442 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 30714 30439 gene locus_tag LOCUS_4950 30714 30439 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875671.1 protein_id gnl|my_center|LOCUS_4950 31240 30773 gene locus_tag LOCUS_4960 31240 30773 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_4960 32651 31245 gene locus_tag LOCUS_4970 32651 31245 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_4970 33111 32686 gene locus_tag LOCUS_4980 33111 32686 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250470.1 protein_id gnl|my_center|LOCUS_4980 33592 33113 gene locus_tag LOCUS_4990 33592 33113 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_4990 34370 33594 gene locus_tag LOCUS_5000 34370 33594 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869976.1 protein_id gnl|my_center|LOCUS_5000 34878 34372 gene locus_tag LOCUS_5010 34878 34372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5010 35324 34875 gene locus_tag LOCUS_5020 35324 34875 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064483.1 protein_id gnl|my_center|LOCUS_5020 35906 35331 gene locus_tag LOCUS_5030 35906 35331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 36457 35903 gene locus_tag LOCUS_5040 36457 35903 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_5040 36849 36460 gene locus_tag LOCUS_5050 36849 36460 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_5050 37088 36858 gene locus_tag LOCUS_5060 37088 36858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 37609 37085 gene locus_tag LOCUS_5070 37609 37085 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_5070 38286 37609 gene locus_tag LOCUS_5080 38286 37609 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_5080 38681 38283 gene locus_tag LOCUS_5090 38681 38283 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_5090 39084 38683 gene locus_tag LOCUS_5100 39084 38683 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_5100 39347 39081 gene locus_tag LOCUS_5110 39347 39081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 39627 39349 gene locus_tag LOCUS_5120 39627 39349 CDS product ribonuclease P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_5120 39932 39630 gene locus_tag LOCUS_5130 39932 39630 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_5130 40234 39932 gene locus_tag LOCUS_5140 40234 39932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5140 >Feature sequence08 <1 751 gene locus_tag LOCUS_5150 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870496.1:30S ribosomal protein S2 1295 753 gene locus_tag LOCUS_5160 1295 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 1569 1300 gene locus_tag LOCUS_5170 1569 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5170 1780 5088 gene locus_tag LOCUS_5180 1780 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 5081 5440 gene locus_tag LOCUS_5190 5081 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 5443 7983 gene locus_tag LOCUS_5200 5443 7983 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_5200 8375 7980 gene locus_tag LOCUS_5210 8375 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 9695 8439 gene locus_tag LOCUS_5220 9695 8439 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_5220 9789 10823 gene locus_tag LOCUS_5230 9789 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 11230 10826 gene locus_tag LOCUS_5240 11230 10826 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870773.1 protein_id gnl|my_center|LOCUS_5240 11310 12290 gene locus_tag LOCUS_5250 11310 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 14008 12287 gene locus_tag LOCUS_5260 14008 12287 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_5260 15042 14044 gene locus_tag LOCUS_5270 15042 14044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_5270 15183 15332 gene locus_tag LOCUS_5280 15183 15332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 15737 15336 gene locus_tag LOCUS_5290 15737 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 16247 15753 gene locus_tag LOCUS_5300 gene ndk 16247 15753 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51419 protein_id gnl|my_center|LOCUS_5300 16414 16244 gene locus_tag LOCUS_5310 16414 16244 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_5310 16700 16416 gene locus_tag LOCUS_5320 16700 16416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 17154 16705 gene locus_tag LOCUS_5330 17154 16705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 18984 17224 gene locus_tag LOCUS_5340 18984 17224 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875691.1 protein_id gnl|my_center|LOCUS_5340 19663 18953 gene locus_tag LOCUS_5350 19663 18953 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_5350 20744 19665 gene locus_tag LOCUS_5360 20744 19665 CDS product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022002.1 protein_id gnl|my_center|LOCUS_5360 20853 22040 gene locus_tag LOCUS_5370 20853 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 22037 22366 gene locus_tag LOCUS_5380 22037 22366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 22399 22971 gene locus_tag LOCUS_5390 22399 22971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 23083 23739 gene locus_tag LOCUS_5400 gene psmB 23083 23739 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_5400 23790 25691 gene locus_tag LOCUS_5410 23790 25691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_5410 25759 26241 gene locus_tag LOCUS_5420 25759 26241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 26243 27049 gene locus_tag LOCUS_5430 26243 27049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 27382 27092 gene locus_tag LOCUS_5440 27382 27092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 27720 28877 gene locus_tag LOCUS_5450 27720 28877 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867899.1 protein_id gnl|my_center|LOCUS_5450 28883 29125 gene locus_tag LOCUS_5460 28883 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 29181 29678 gene locus_tag LOCUS_5470 29181 29678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 29693 30586 gene locus_tag LOCUS_5480 29693 30586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 30642 31388 gene locus_tag LOCUS_5490 30642 31388 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_5490 31444 31821 gene locus_tag LOCUS_5500 31444 31821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5500 31881 32348 gene locus_tag LOCUS_5510 31881 32348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 32379 33215 gene locus_tag LOCUS_5520 32379 33215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_5520 33241 33489 gene locus_tag LOCUS_5530 33241 33489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5530 >Feature sequence09 <1 589 gene locus_tag LOCUS_5540 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870481.1:DJ-1 family protein 631 945 gene locus_tag LOCUS_5550 631 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 1008 1907 gene locus_tag LOCUS_5560 1008 1907 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_5560 1919 3022 gene locus_tag LOCUS_5570 1919 3022 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023106.1 protein_id gnl|my_center|LOCUS_5570 4380 3025 gene locus_tag LOCUS_5580 4380 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5580 5306 4377 gene locus_tag LOCUS_5590 gene arcB 5306 4377 CDS product ornithine carbamoyltransferase, catabolic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0P2 protein_id gnl|my_center|LOCUS_5590 6612 5308 gene locus_tag LOCUS_5600 6612 5308 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_5600 7595 6663 gene locus_tag LOCUS_5610 7595 6663 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_5610 7984 7637 gene locus_tag LOCUS_5620 7984 7637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 8862 8326 gene locus_tag LOCUS_5630 8862 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 8984 9613 gene locus_tag LOCUS_5640 8984 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 9732 10310 gene locus_tag LOCUS_5650 9732 10310 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810052.1 protein_id gnl|my_center|LOCUS_5650 10312 10893 gene locus_tag LOCUS_5660 10312 10893 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I446 protein_id gnl|my_center|LOCUS_5660 11316 10906 gene locus_tag LOCUS_5670 11316 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 11370 12827 gene locus_tag LOCUS_5680 gene rtcB 11370 12827 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CI9 protein_id gnl|my_center|LOCUS_5680 12824 13255 gene locus_tag LOCUS_5690 12824 13255 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_5690 13346 14158 gene locus_tag LOCUS_5700 13346 14158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 14174 14653 gene locus_tag LOCUS_5710 14174 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 14653 15036 gene locus_tag LOCUS_5720 14653 15036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5720 15109 16032 gene locus_tag LOCUS_5730 15109 16032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 16041 16658 gene locus_tag LOCUS_5740 16041 16658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 16986 18293 gene locus_tag LOCUS_5750 16986 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 >Feature sequence10 1020 349 gene locus_tag LOCUS_5760 1020 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 1944 1060 gene locus_tag LOCUS_5770 1944 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5770 2038 4671 gene locus_tag LOCUS_5780 2038 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 4767 5306 gene locus_tag LOCUS_5790 4767 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 7518 5788 gene locus_tag LOCUS_5800 7518 5788 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876482.1 protein_id gnl|my_center|LOCUS_5800 8362 7520 gene locus_tag LOCUS_5810 8362 7520 CDS product preprotein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868889.1 protein_id gnl|my_center|LOCUS_5810 8529 11114 gene locus_tag LOCUS_5820 8529 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 11111 12328 gene locus_tag LOCUS_5830 11111 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 12401 12329 gene locus_tag LOCUS_t0260 12401 12329 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13478 12546 gene locus_tag LOCUS_5840 13478 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 15339 13558 gene locus_tag LOCUS_5850 15339 13558 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146849.1 protein_id gnl|my_center|LOCUS_5850 16176 15463 gene locus_tag LOCUS_5860 gene trmI 16176 15463 CDS product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKN4 protein_id gnl|my_center|LOCUS_5860 17006 16173 gene locus_tag LOCUS_5870 17006 16173 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080508.1 protein_id gnl|my_center|LOCUS_5870 17100 17017 gene locus_tag LOCUS_t0270 17100 17017 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence11 2035 134 gene locus_tag LOCUS_5880 2035 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 2160 3599 gene locus_tag LOCUS_5890 2160 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 3905 3977 gene locus_tag LOCUS_t0280 3905 3977 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3994 4070 gene locus_tag LOCUS_t0290 3994 4070 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4087 4329 gene locus_tag LOCUS_5900 4087 4329 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879378.1 protein_id gnl|my_center|LOCUS_5900 4330 5826 gene locus_tag LOCUS_5910 4330 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_5910 5816 7627 gene locus_tag LOCUS_5920 5816 7627 CDS product DNA-directed RNA polymerase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876676.1 protein_id gnl|my_center|LOCUS_5920 7629 10202 gene locus_tag LOCUS_5930 7629 10202 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879381.1 protein_id gnl|my_center|LOCUS_5930 10195 11394 gene locus_tag LOCUS_5940 10195 11394 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846867.1 protein_id gnl|my_center|LOCUS_5940 11391 11645 gene locus_tag LOCUS_5950 11391 11645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 11652 12068 gene locus_tag LOCUS_5960 11652 12068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 12148 12585 gene locus_tag LOCUS_5970 12148 12585 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_5970 12582 13172 gene locus_tag LOCUS_5980 12582 13172 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867744.1 protein_id gnl|my_center|LOCUS_5980 13190 15391 gene locus_tag LOCUS_5990 13190 15391 CDS product translation elongation factor aEF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_5990 15460 16017 gene locus_tag LOCUS_6000 15460 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 16069 17064 gene locus_tag LOCUS_6010 16069 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 >Feature sequence12 3914 1857 gene locus_tag LOCUS_6020 3914 1857 CDS product double-stranded DNA repair protein Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_6020 5188 3911 gene locus_tag LOCUS_6030 5188 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6030 6616 5273 gene locus_tag LOCUS_6040 6616 5273 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870376.1 protein_id gnl|my_center|LOCUS_6040 8058 6613 gene locus_tag LOCUS_6050 8058 6613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 9074 8124 gene locus_tag LOCUS_6060 gene sagG 9074 8124 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948245.1 protein_id gnl|my_center|LOCUS_6060 9366 9094 gene locus_tag LOCUS_6070 9366 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 9778 9449 gene locus_tag LOCUS_6080 9778 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 10044 9775 gene locus_tag LOCUS_6090 10044 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 10876 10082 gene locus_tag LOCUS_6100 10876 10082 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXU2 protein_id gnl|my_center|LOCUS_6100 11434 10985 gene locus_tag LOCUS_6110 11434 10985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 11587 12372 gene locus_tag LOCUS_6120 11587 12372 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867687.1 protein_id gnl|my_center|LOCUS_6120 12520 12591 gene locus_tag LOCUS_t0300 12520 12591 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12614 13915 gene locus_tag LOCUS_6130 gene hisS-1 12614 13915 CDS product histidine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81B71 protein_id gnl|my_center|LOCUS_6130 14620 13904 gene locus_tag LOCUS_6140 14620 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 15410 15519 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attagtttcttcttgagaaa >Feature sequence13 1044 373 gene locus_tag LOCUS_6150 1044 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 1222 1689 gene locus_tag LOCUS_6160 1222 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 1897 1694 gene locus_tag LOCUS_6170 1897 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 2681 1899 gene locus_tag LOCUS_6180 2681 1899 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_6180 3387 2683 gene locus_tag LOCUS_6190 3387 2683 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_6190 4223 3384 gene locus_tag LOCUS_6200 4223 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 4938 4237 gene locus_tag LOCUS_6210 4938 4237 CDS product RNA-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867732.1 protein_id gnl|my_center|LOCUS_6210 5674 4955 gene locus_tag LOCUS_6220 5674 4955 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870095.1 protein_id gnl|my_center|LOCUS_6220 6044 5691 gene locus_tag LOCUS_6230 6044 5691 CDS product ribonuclease P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496513.1 protein_id gnl|my_center|LOCUS_6230 6186 6548 gene locus_tag LOCUS_6240 6186 6548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 7271 6549 gene locus_tag LOCUS_6250 7271 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 7840 7322 gene locus_tag LOCUS_6260 7840 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 8181 7837 gene locus_tag LOCUS_6270 8181 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6270 8405 8178 gene locus_tag LOCUS_6280 8405 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 8937 8431 gene locus_tag LOCUS_6290 8937 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6290 8971 9426 gene locus_tag LOCUS_6300 8971 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 10099 9416 gene locus_tag LOCUS_6310 10099 9416 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51518 protein_id gnl|my_center|LOCUS_6310 10556 10143 gene locus_tag LOCUS_6320 10556 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 10843 10556 gene locus_tag LOCUS_6330 10843 10556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_6330 11031 11369 gene locus_tag LOCUS_6340 11031 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 11329 11928 gene locus_tag LOCUS_6350 11329 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 13688 11940 gene locus_tag LOCUS_6360 13688 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6360 >Feature sequence14 <1 834 gene locus_tag LOCUS_6370 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942278.1:small-conductance mechanosensitive ion channel 866 2296 gene locus_tag LOCUS_6380 gene proS 866 2296 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E028 protein_id gnl|my_center|LOCUS_6380 4227 2293 gene locus_tag LOCUS_6390 4227 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 4324 4671 gene locus_tag LOCUS_6400 4324 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 5199 4681 gene locus_tag LOCUS_6410 5199 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 6156 5230 gene locus_tag LOCUS_6420 6156 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 7292 6213 gene locus_tag LOCUS_6430 7292 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 8385 7354 gene locus_tag LOCUS_6440 8385 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 8775 8398 gene locus_tag LOCUS_6450 8775 8398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 9314 8775 gene locus_tag LOCUS_6460 9314 8775 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_6460 10545 9412 gene locus_tag LOCUS_6470 10545 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 10674 10862 gene locus_tag LOCUS_6480 10674 10862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 12106 10859 gene locus_tag LOCUS_6490 12106 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_6490 12206 12775 gene locus_tag LOCUS_6500 12206 12775 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870115.1 protein_id gnl|my_center|LOCUS_6500 >Feature sequence15 690 73 gene locus_tag LOCUS_6510 690 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6510 1289 693 gene locus_tag LOCUS_6520 1289 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 1627 1298 gene locus_tag LOCUS_6530 1627 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 1708 2355 gene locus_tag LOCUS_6540 1708 2355 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_6540 3188 2352 gene locus_tag LOCUS_6550 3188 2352 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_6550 3327 8387 gene locus_tag LOCUS_6560 3327 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 9461 8388 gene locus_tag LOCUS_6570 9461 8388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 9909 9499 gene locus_tag LOCUS_6580 9909 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 11104 9911 gene locus_tag LOCUS_6590 11104 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 11819 11142 gene locus_tag LOCUS_6600 11819 11142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 >Feature sequence16 <1 1000 gene locus_tag LOCUS_6610 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496733.1:tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 4230 997 gene locus_tag LOCUS_6620 4230 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 4344 4631 gene locus_tag LOCUS_6630 4344 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 4701 4991 gene locus_tag LOCUS_6640 4701 4991 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868223.1 protein_id gnl|my_center|LOCUS_6640 4993 5334 gene locus_tag LOCUS_6650 4993 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 5354 5914 gene locus_tag LOCUS_6660 5354 5914 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_6660 5961 6410 gene locus_tag LOCUS_6670 5961 6410 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869684.1 protein_id gnl|my_center|LOCUS_6670 6412 7053 gene locus_tag LOCUS_6680 6412 7053 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_6680 7055 7453 gene locus_tag LOCUS_6690 7055 7453 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_6690 7456 8229 gene locus_tag LOCUS_6700 7456 8229 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053732.1 protein_id gnl|my_center|LOCUS_6700 8323 8694 gene locus_tag LOCUS_6710 8323 8694 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_6710 8696 9112 gene locus_tag LOCUS_6720 8696 9112 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_6720 9109 9516 gene locus_tag LOCUS_6730 9109 9516 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250451.1 protein_id gnl|my_center|LOCUS_6730 9530 9727 gene locus_tag LOCUS_6740 9530 9727 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_6740 >Feature sequence17 610 305 gene locus_tag LOCUS_6750 610 305 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_6750 1644 640 gene locus_tag LOCUS_6760 1644 640 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_6760 2306 1641 gene locus_tag LOCUS_6770 2306 1641 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496520.1 protein_id gnl|my_center|LOCUS_6770 2916 2398 gene locus_tag LOCUS_6780 2916 2398 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_6780 3392 2937 gene locus_tag LOCUS_6790 3392 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 3485 4345 gene locus_tag LOCUS_6800 3485 4345 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_6800 5146 4523 gene locus_tag LOCUS_6810 5146 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 5294 5746 gene locus_tag LOCUS_6820 5294 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6820 6196 5762 gene locus_tag LOCUS_6830 6196 5762 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868177.1 protein_id gnl|my_center|LOCUS_6830 6253 6621 gene locus_tag LOCUS_6840 6253 6621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 7530 6598 gene locus_tag LOCUS_6850 7530 6598 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q038Y6 protein_id gnl|my_center|LOCUS_6850 7599 8678 gene locus_tag LOCUS_6860 7599 8678 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_6860 8757 8942 gene locus_tag LOCUS_6870 8757 8942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 8982 9566 gene locus_tag LOCUS_6880 8982 9566 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680480.1 protein_id gnl|my_center|LOCUS_6880 >Feature sequence18 1183 2025 gene locus_tag LOCUS_6890 1183 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 2066 2575 gene locus_tag LOCUS_6900 2066 2575 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932611.1 protein_id gnl|my_center|LOCUS_6900 2624 3016 gene locus_tag LOCUS_6910 2624 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 3013 3357 gene locus_tag LOCUS_6920 3013 3357 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879586.1 protein_id gnl|my_center|LOCUS_6920 3480 3370 gene locus_tag LOCUS_r0030 3480 3370 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3587 4597 gene locus_tag LOCUS_6930 3587 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 4795 4598 gene locus_tag LOCUS_6940 4795 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 >Feature sequence19 116 1402 gene locus_tag LOCUS_6950 116 1402 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_6950 1485 1793 gene locus_tag LOCUS_6960 1485 1793 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021276.1 protein_id gnl|my_center|LOCUS_6960 2110 1898 gene locus_tag LOCUS_6970 2110 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 2325 2408 gene locus_tag LOCUS_t0310 2325 2408 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2694 3524 gene locus_tag LOCUS_6980 2694 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 3653 3925 gene locus_tag LOCUS_6990 3653 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 >Feature sequence20 1284 1 gene locus_tag LOCUS_7000 1284 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 1410 2525 gene locus_tag LOCUS_7010 1410 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 2646 3644 gene locus_tag LOCUS_7020 2646 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 4071 3766 gene locus_tag LOCUS_7030 4071 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7030 >Feature sequence21 1201 1650 gene locus_tag LOCUS_7040 1201 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 1662 2246 gene locus_tag LOCUS_7050 1662 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 >Feature sequence22 745 539 gene locus_tag LOCUS_7060 745 539 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_7060 1113 745 gene locus_tag LOCUS_7070 1113 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 1292 1110 gene locus_tag LOCUS_7080 1292 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 1861 1289 gene locus_tag LOCUS_7090 1861 1289 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_7090 2252 1887 gene locus_tag LOCUS_7100 2252 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100