>Feature sequence001 <1 523 gene locus_tag LOCUS_0010 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023255.1:excinuclease ABC subunit B 577 1362 gene locus_tag LOCUS_0020 gene dltE 577 1362 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167663.1 protein_id gnl|my_center|LOCUS_0020 1689 1363 gene locus_tag LOCUS_0030 1689 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 1794 2306 gene locus_tag LOCUS_0040 1794 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 2855 2283 gene locus_tag LOCUS_0050 2855 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0050 2949 3338 gene locus_tag LOCUS_0060 2949 3338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532413.1 protein_id gnl|my_center|LOCUS_0060 3983 3348 gene locus_tag LOCUS_0070 3983 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0070 8525 4179 gene locus_tag LOCUS_0080 8525 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 8970 8551 gene locus_tag LOCUS_0090 8970 8551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 9356 8967 gene locus_tag LOCUS_0100 9356 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 9451 10257 gene locus_tag LOCUS_0110 9451 10257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 10286 12163 gene locus_tag LOCUS_0120 10286 12163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0120 12160 14025 gene locus_tag LOCUS_0130 12160 14025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0130 14213 14653 gene locus_tag LOCUS_0140 14213 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 14679 15089 gene locus_tag LOCUS_0150 14679 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 15094 16836 gene locus_tag LOCUS_0160 15094 16836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 16902 17456 gene locus_tag LOCUS_0170 16902 17456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 17470 17874 gene locus_tag LOCUS_0180 17470 17874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 17871 20297 gene locus_tag LOCUS_0190 17871 20297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 20284 22950 gene locus_tag LOCUS_0200 20284 22950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 24085 22976 gene locus_tag LOCUS_0210 24085 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 24234 25127 gene locus_tag LOCUS_0220 24234 25127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 25124 26149 gene locus_tag LOCUS_0230 25124 26149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0230 26244 29156 gene locus_tag LOCUS_0240 26244 29156 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023257.1 protein_id gnl|my_center|LOCUS_0240 29348 31582 gene locus_tag LOCUS_0250 29348 31582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 31617 31901 gene locus_tag LOCUS_0260 31617 31901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 31898 32572 gene locus_tag LOCUS_0270 31898 32572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 32575 33747 gene locus_tag LOCUS_0280 32575 33747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 33810 34529 gene locus_tag LOCUS_0290 33810 34529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 34526 36319 gene locus_tag LOCUS_0300 34526 36319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 36394 37197 gene locus_tag LOCUS_0310 36394 37197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0310 37278 39554 gene locus_tag LOCUS_0320 37278 39554 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146523.1 protein_id gnl|my_center|LOCUS_0320 39687 40283 gene locus_tag LOCUS_0330 39687 40283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 40325 41392 gene locus_tag LOCUS_0340 40325 41392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 41453 41529 gene locus_tag LOCUS_t0010 41453 41529 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 41647 42594 gene locus_tag LOCUS_0350 gene yrbG 41647 42594 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_0350 42903 42679 gene locus_tag LOCUS_0360 gene csp 42903 42679 CDS product cold shock protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71478 protein_id gnl|my_center|LOCUS_0360 43294 44874 gene locus_tag LOCUS_0370 43294 44874 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_0370 >Feature sequence002 256 768 gene locus_tag LOCUS_0380 gene apt 256 768 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6E1 protein_id gnl|my_center|LOCUS_0380 1168 758 gene locus_tag LOCUS_0390 1168 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_0390 2846 1305 gene locus_tag LOCUS_0400 2846 1305 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 protein_id gnl|my_center|LOCUS_0400 2939 3193 gene locus_tag LOCUS_0410 2939 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 4804 3221 gene locus_tag LOCUS_0420 4804 3221 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_0420 4955 5320 gene locus_tag LOCUS_0430 4955 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 6539 5343 gene locus_tag LOCUS_0440 gene ychF 6539 5343 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496963.1 protein_id gnl|my_center|LOCUS_0440 6591 6929 gene locus_tag LOCUS_0450 6591 6929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 7021 8013 gene locus_tag LOCUS_0460 7021 8013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 8443 8111 gene locus_tag LOCUS_0470 8443 8111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 8909 8700 gene locus_tag LOCUS_0480 8909 8700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0480 8966 9250 gene locus_tag LOCUS_0490 8966 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 9322 10611 gene locus_tag LOCUS_0500 9322 10611 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496902.1 protein_id gnl|my_center|LOCUS_0500 10840 11364 gene locus_tag LOCUS_0510 10840 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0510 11489 12013 gene locus_tag LOCUS_0520 11489 12013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0520 12019 13257 gene locus_tag LOCUS_0530 12019 13257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 13354 13746 gene locus_tag LOCUS_0540 13354 13746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0540 13755 14192 gene locus_tag LOCUS_0550 13755 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 14249 14719 gene locus_tag LOCUS_0560 14249 14719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 14721 15215 gene locus_tag LOCUS_0570 14721 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 15212 15610 gene locus_tag LOCUS_0580 15212 15610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0580 15607 15993 gene locus_tag LOCUS_0590 15607 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 15995 18052 gene locus_tag LOCUS_0600 15995 18052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0600 18049 19074 gene locus_tag LOCUS_0610 18049 19074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0610 19078 19962 gene locus_tag LOCUS_0620 19078 19962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 20014 20090 gene locus_tag LOCUS_t0020 20014 20090 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20160 20375 gene locus_tag LOCUS_0630 20160 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 20437 21312 gene locus_tag LOCUS_0640 20437 21312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 21371 21997 gene locus_tag LOCUS_0650 21371 21997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 21999 23000 gene locus_tag LOCUS_0660 21999 23000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 23093 23626 gene locus_tag LOCUS_0670 23093 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 23667 24677 gene locus_tag LOCUS_0680 23667 24677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 25125 24706 gene locus_tag LOCUS_0690 25125 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 25133 25564 gene locus_tag LOCUS_0700 25133 25564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 25921 25565 gene locus_tag LOCUS_0710 25921 25565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 26200 25964 gene locus_tag LOCUS_0720 26200 25964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 27131 26202 gene locus_tag LOCUS_0730 27131 26202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0730 27993 27190 gene locus_tag LOCUS_0740 27993 27190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 29401 27995 gene locus_tag LOCUS_0750 29401 27995 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966563.1 protein_id gnl|my_center|LOCUS_0750 29784 30446 gene locus_tag LOCUS_0760 29784 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0760 30490 31086 gene locus_tag LOCUS_0770 30490 31086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 31149 32393 gene locus_tag LOCUS_0780 gene csdB 31149 32393 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0D5 protein_id gnl|my_center|LOCUS_0780 33071 32394 gene locus_tag LOCUS_0790 33071 32394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 >Feature sequence003 <1 509 gene locus_tag LOCUS_0800 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867981.1:50S ribosomal protein L15e 516 890 gene locus_tag LOCUS_0810 516 890 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250142.1 protein_id gnl|my_center|LOCUS_0810 954 1535 gene locus_tag LOCUS_0820 954 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 1972 1583 gene locus_tag LOCUS_0830 1972 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 2084 2338 gene locus_tag LOCUS_0840 2084 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 2380 4143 gene locus_tag LOCUS_0850 2380 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 4856 4146 gene locus_tag LOCUS_0860 4856 4146 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_0860 4959 6716 gene locus_tag LOCUS_0870 4959 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 6791 7387 gene locus_tag LOCUS_0880 6791 7387 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256529.1 protein_id gnl|my_center|LOCUS_0880 8139 7384 gene locus_tag LOCUS_0890 8139 7384 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_0890 8536 8216 gene locus_tag LOCUS_0900 gene trxA 8536 8216 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CKZ3 protein_id gnl|my_center|LOCUS_0900 9600 8605 gene locus_tag LOCUS_0910 9600 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 10120 9638 gene locus_tag LOCUS_0920 10120 9638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 10882 10139 gene locus_tag LOCUS_0930 10882 10139 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404464.1 protein_id gnl|my_center|LOCUS_0930 12071 10995 gene locus_tag LOCUS_0940 12071 10995 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_0940 12901 12305 gene locus_tag LOCUS_0950 gene scpB 12901 12305 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAK9 protein_id gnl|my_center|LOCUS_0950 13292 12966 gene locus_tag LOCUS_0960 13292 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 14082 13372 gene locus_tag LOCUS_0970 14082 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0970 14497 14135 gene locus_tag LOCUS_0980 14497 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 16443 14659 gene locus_tag LOCUS_0990 16443 14659 CDS product translation initiation factor aIF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_0990 17173 16532 gene locus_tag LOCUS_1000 17173 16532 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_1000 17837 17175 gene locus_tag LOCUS_1010 17837 17175 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_1010 18925 17900 gene locus_tag LOCUS_1020 18925 17900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 19766 18948 gene locus_tag LOCUS_1030 19766 18948 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461750.1 protein_id gnl|my_center|LOCUS_1030 19868 20332 gene locus_tag LOCUS_1040 19868 20332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 23396 20337 gene locus_tag LOCUS_1050 23396 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 25305 23488 gene locus_tag LOCUS_1060 25305 23488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 25581 25889 gene locus_tag LOCUS_1070 25581 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 >Feature sequence004 6111 4336 gene locus_tag LOCUS_1080 6111 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1080 6991 6218 gene locus_tag LOCUS_1090 6991 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1090 7350 6988 gene locus_tag LOCUS_1100 7350 6988 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583174.1 protein_id gnl|my_center|LOCUS_1100 8472 7519 gene locus_tag LOCUS_1110 8472 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 9156 8473 gene locus_tag LOCUS_1120 9156 8473 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_1120 9900 9220 gene locus_tag LOCUS_1130 9900 9220 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S5 protein_id gnl|my_center|LOCUS_1130 10376 9900 gene locus_tag LOCUS_1140 10376 9900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 11357 10518 gene locus_tag LOCUS_1150 11357 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1150 11580 12842 gene locus_tag LOCUS_1160 gene gdhA 11580 12842 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL64 protein_id gnl|my_center|LOCUS_1160 12896 14020 gene locus_tag LOCUS_1170 12896 14020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 14799 14017 gene locus_tag LOCUS_1180 14799 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 15769 14783 gene locus_tag LOCUS_1190 15769 14783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 17388 15781 gene locus_tag LOCUS_1200 17388 15781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 17608 17393 gene locus_tag LOCUS_1210 17608 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 18210 17761 gene locus_tag LOCUS_1220 18210 17761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 18623 18249 gene locus_tag LOCUS_1230 18623 18249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 18793 21228 gene locus_tag LOCUS_1240 18793 21228 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_1240 21751 21251 gene locus_tag LOCUS_1250 21751 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1250 22292 21807 gene locus_tag LOCUS_1260 22292 21807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 22411 23022 gene locus_tag LOCUS_1270 22411 23022 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KW5 protein_id gnl|my_center|LOCUS_1270 23102 23290 gene locus_tag LOCUS_1280 23102 23290 CDS product PspC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899876.1 protein_id gnl|my_center|LOCUS_1280 >Feature sequence005 96 31 gene locus_tag LOCUS_r0010 96 31 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 55 percent of the 5S ribosomal RNA 217 654 gene locus_tag LOCUS_1290 217 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 2739 646 gene locus_tag LOCUS_1300 2739 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 3134 2730 gene locus_tag LOCUS_1310 3134 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 6240 3208 gene locus_tag LOCUS_1320 6240 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 7000 6242 gene locus_tag LOCUS_1330 7000 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 7244 7702 gene locus_tag LOCUS_1340 gene yffD 7244 7702 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130814.1 protein_id gnl|my_center|LOCUS_1340 8356 7748 gene locus_tag LOCUS_1350 8356 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 8348 8782 gene locus_tag LOCUS_1360 8348 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 9117 8779 gene locus_tag LOCUS_1370 9117 8779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 9213 9740 gene locus_tag LOCUS_1380 9213 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 9727 10239 gene locus_tag LOCUS_1390 9727 10239 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251165.1 protein_id gnl|my_center|LOCUS_1390 10419 10805 gene locus_tag LOCUS_1400 10419 10805 CDS product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878267.1 protein_id gnl|my_center|LOCUS_1400 10841 11092 gene locus_tag LOCUS_1410 10841 11092 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 protein_id gnl|my_center|LOCUS_1410 11095 11286 gene locus_tag LOCUS_1420 11095 11286 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_1420 13787 11607 gene locus_tag LOCUS_1430 13787 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 14910 13843 gene locus_tag LOCUS_1440 gene ltrA 14910 13843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723101.1 protein_id gnl|my_center|LOCUS_1440 15931 14966 gene locus_tag LOCUS_1450 15931 14966 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_1450 15994 16290 gene locus_tag LOCUS_1460 15994 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 16297 16980 gene locus_tag LOCUS_1470 16297 16980 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_1470 17649 16981 gene locus_tag LOCUS_1480 17649 16981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 17863 17654 gene locus_tag LOCUS_1490 17863 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 18383 17856 gene locus_tag LOCUS_1500 18383 17856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 18313 18621 gene locus_tag LOCUS_1510 18313 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 19758 18703 gene locus_tag LOCUS_1520 19758 18703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 20660 19929 gene locus_tag LOCUS_1530 20660 19929 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 protein_id gnl|my_center|LOCUS_1530 20848 22392 gene locus_tag LOCUS_1540 20848 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 >Feature sequence006 566 3028 gene locus_tag LOCUS_1550 566 3028 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249620.1 protein_id gnl|my_center|LOCUS_1550 3177 3614 gene locus_tag LOCUS_1560 3177 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 3651 3809 gene locus_tag LOCUS_1570 3651 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 4927 3839 gene locus_tag LOCUS_1580 4927 3839 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146544.1 protein_id gnl|my_center|LOCUS_1580 5009 5096 gene locus_tag LOCUS_t0030 5009 5096 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5188 5481 gene locus_tag LOCUS_1590 5188 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 5553 5951 gene locus_tag LOCUS_1600 5553 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 5984 7507 gene locus_tag LOCUS_1610 5984 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 7557 8516 gene locus_tag LOCUS_1620 7557 8516 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020094.1 protein_id gnl|my_center|LOCUS_1620 8573 9112 gene locus_tag LOCUS_1630 8573 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 9135 10856 gene locus_tag LOCUS_1640 gene argS 9135 10856 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_1640 11199 10945 gene locus_tag LOCUS_1650 11199 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1650 11315 12871 gene locus_tag LOCUS_1660 11315 12871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 12940 13239 gene locus_tag LOCUS_1670 12940 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 13232 14983 gene locus_tag LOCUS_1680 13232 14983 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024041.1 protein_id gnl|my_center|LOCUS_1680 15071 15379 gene locus_tag LOCUS_1690 15071 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1690 16471 15455 gene locus_tag LOCUS_1700 16471 15455 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_1700 16642 17250 gene locus_tag LOCUS_1710 16642 17250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 17455 19209 gene locus_tag LOCUS_1720 17455 19209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 19268 19933 gene locus_tag LOCUS_1730 19268 19933 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870336.1 protein_id gnl|my_center|LOCUS_1730 20069 21166 gene locus_tag LOCUS_1740 20069 21166 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869869.1 protein_id gnl|my_center|LOCUS_1740 >Feature sequence007 367 651 gene locus_tag LOCUS_1750 367 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 1122 655 gene locus_tag LOCUS_1760 1122 655 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_1760 1260 2000 gene locus_tag LOCUS_1770 1260 2000 CDS product DNA polymerase III sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_1770 2110 2979 gene locus_tag LOCUS_1780 2110 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 3380 2982 gene locus_tag LOCUS_1790 3380 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 4590 3466 gene locus_tag LOCUS_1800 gene dnaJ 4590 3466 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182E7 protein_id gnl|my_center|LOCUS_1800 5190 4684 gene locus_tag LOCUS_1810 5190 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 5474 5238 gene locus_tag LOCUS_1820 5474 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 6602 5511 gene locus_tag LOCUS_1830 6602 5511 CDS product replication factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146527.1 protein_id gnl|my_center|LOCUS_1830 7226 6714 gene locus_tag LOCUS_1840 7226 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 7861 7223 gene locus_tag LOCUS_1850 7861 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 8228 7875 gene locus_tag LOCUS_1860 8228 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878679.1 protein_id gnl|my_center|LOCUS_1860 8338 9738 gene locus_tag LOCUS_1870 8338 9738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 10121 9819 gene locus_tag LOCUS_1880 10121 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496905.1 protein_id gnl|my_center|LOCUS_1880 10536 10123 gene locus_tag LOCUS_1890 10536 10123 CDS product translation initiation factor 2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763171.1 protein_id gnl|my_center|LOCUS_1890 10633 10944 gene locus_tag LOCUS_1900 10633 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 10968 12695 gene locus_tag LOCUS_1910 10968 12695 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870894.1 protein_id gnl|my_center|LOCUS_1910 12698 12934 gene locus_tag LOCUS_1920 12698 12934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 13770 13081 gene locus_tag LOCUS_1930 13770 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 14106 13819 gene locus_tag LOCUS_1940 14106 13819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 14830 14138 gene locus_tag LOCUS_1950 14830 14138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 17366 14883 gene locus_tag LOCUS_1960 gene mutS 17366 14883 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187T6 protein_id gnl|my_center|LOCUS_1960 17462 18025 gene locus_tag LOCUS_1970 17462 18025 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_1970 18036 19067 gene locus_tag LOCUS_1980 18036 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 19231 19156 gene locus_tag LOCUS_t0040 19231 19156 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 19871 19275 gene locus_tag LOCUS_1990 19871 19275 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_1990 20368 19946 gene locus_tag LOCUS_2000 20368 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 >Feature sequence008 611 1774 gene locus_tag LOCUS_2010 611 1774 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870689.1 protein_id gnl|my_center|LOCUS_2010 1781 2461 gene locus_tag LOCUS_2020 1781 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 2458 3747 gene locus_tag LOCUS_2030 2458 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 3840 4433 gene locus_tag LOCUS_2040 3840 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 4663 6006 gene locus_tag LOCUS_2050 4663 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 6269 7423 gene locus_tag LOCUS_2060 gene rtcB 6269 7423 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DS6 protein_id gnl|my_center|LOCUS_2060 7473 7835 gene locus_tag LOCUS_2070 7473 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 9047 7968 gene locus_tag LOCUS_2080 gene guaC 9047 7968 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FRU7 protein_id gnl|my_center|LOCUS_2080 11538 9256 gene locus_tag LOCUS_2090 11538 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 12613 11906 gene locus_tag LOCUS_2100 12613 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 12764 13453 gene locus_tag LOCUS_2110 12764 13453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 13730 14686 gene locus_tag LOCUS_2120 13730 14686 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_2120 17805 14767 gene locus_tag LOCUS_2130 17805 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 >Feature sequence009 <1 1002 gene locus_tag LOCUS_2140 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146615.1:glutamyl-tRNA(Gln) amidotransferase subunit E 1063 1812 gene locus_tag LOCUS_2150 1063 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2150 2324 1818 gene locus_tag LOCUS_2160 2324 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 2527 2453 gene locus_tag LOCUS_t0050 2527 2453 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2678 4069 gene locus_tag LOCUS_2170 2678 4069 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496482.1 protein_id gnl|my_center|LOCUS_2170 4238 5278 gene locus_tag LOCUS_2180 gene gapA 4238 5278 CDS product glyceraldehyde-3-phosphate dehydrogenase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P09124 protein_id gnl|my_center|LOCUS_2180 5353 5718 gene locus_tag LOCUS_2190 5353 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 6300 5728 gene locus_tag LOCUS_2200 6300 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 7143 6418 gene locus_tag LOCUS_2210 7143 6418 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875871.1 protein_id gnl|my_center|LOCUS_2210 7240 8274 gene locus_tag LOCUS_2220 7240 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 8393 9343 gene locus_tag LOCUS_2230 8393 9343 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_2230 9435 10076 gene locus_tag LOCUS_2240 9435 10076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 10364 10291 gene locus_tag LOCUS_t0060 10364 10291 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 10568 10801 gene locus_tag LOCUS_2250 10568 10801 CDS product histone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020717.1 protein_id gnl|my_center|LOCUS_2250 10803 11000 gene locus_tag LOCUS_2260 10803 11000 CDS product histone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877844.1 protein_id gnl|my_center|LOCUS_2260 11164 12120 gene locus_tag LOCUS_2270 gene tfb 11164 12120 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_2270 12104 13597 gene locus_tag LOCUS_2280 12104 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 13679 14440 gene locus_tag LOCUS_2290 13679 14440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 15687 14443 gene locus_tag LOCUS_2300 15687 14443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 15786 16181 gene locus_tag LOCUS_2310 15786 16181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 16222 16569 gene locus_tag LOCUS_2320 16222 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 17957 16635 gene locus_tag LOCUS_2330 17957 16635 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_2330 >Feature sequence010 321 245 gene locus_tag LOCUS_t0070 321 245 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2484 442 gene locus_tag LOCUS_2340 2484 442 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061327.1 protein_id gnl|my_center|LOCUS_2340 3673 2564 gene locus_tag LOCUS_2350 3673 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 3836 5239 gene locus_tag LOCUS_2360 gene lpd 3836 5239 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_2360 5320 5493 gene locus_tag LOCUS_2370 5320 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 5552 5968 gene locus_tag LOCUS_2380 5552 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2380 6013 8055 gene locus_tag LOCUS_2390 6013 8055 CDS product transcription accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016116.1 protein_id gnl|my_center|LOCUS_2390 8115 9227 gene locus_tag LOCUS_2400 8115 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2400 9224 10387 gene locus_tag LOCUS_2410 9224 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 11515 10388 gene locus_tag LOCUS_2420 gene ywfO 11515 10388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39651 protein_id gnl|my_center|LOCUS_2420 12980 11556 gene locus_tag LOCUS_2430 12980 11556 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846342.1 protein_id gnl|my_center|LOCUS_2430 13082 13468 gene locus_tag LOCUS_2440 13082 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 14328 13498 gene locus_tag LOCUS_2450 14328 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 14774 14373 gene locus_tag LOCUS_2460 14774 14373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 14883 15134 gene locus_tag LOCUS_2470 14883 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 15136 17319 gene locus_tag LOCUS_2480 15136 17319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 17593 17324 gene locus_tag LOCUS_2490 17593 17324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 18054 17590 gene locus_tag LOCUS_2500 18054 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 >Feature sequence011 372 79 gene locus_tag LOCUS_2510 372 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 941 393 gene locus_tag LOCUS_2520 gene pabA 941 393 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891890.1 protein_id gnl|my_center|LOCUS_2520 1621 938 gene locus_tag LOCUS_2530 1621 938 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870074.1 protein_id gnl|my_center|LOCUS_2530 1743 2081 gene locus_tag LOCUS_2540 1743 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 2736 2323 gene locus_tag LOCUS_2550 2736 2323 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_2550 3022 3834 gene locus_tag LOCUS_2560 3022 3834 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_2560 3911 5425 gene locus_tag LOCUS_2570 3911 5425 CDS product putative thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZWR3 protein_id gnl|my_center|LOCUS_2570 5428 5748 gene locus_tag LOCUS_2580 5428 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 5816 6178 gene locus_tag LOCUS_2590 5816 6178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 6265 6783 gene locus_tag LOCUS_2600 6265 6783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 6796 7623 gene locus_tag LOCUS_2610 6796 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 7638 8195 gene locus_tag LOCUS_2620 7638 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 8246 9205 gene locus_tag LOCUS_2630 8246 9205 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDX2 protein_id gnl|my_center|LOCUS_2630 9252 9818 gene locus_tag LOCUS_2640 9252 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 9850 11814 gene locus_tag LOCUS_2650 gene thrS 9850 11814 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189B8 protein_id gnl|my_center|LOCUS_2650 11933 12664 gene locus_tag LOCUS_2660 11933 12664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020864.1 protein_id gnl|my_center|LOCUS_2660 12875 13576 gene locus_tag LOCUS_2670 12875 13576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 13622 15178 gene locus_tag LOCUS_2680 13622 15178 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021961.1 protein_id gnl|my_center|LOCUS_2680 15750 15175 gene locus_tag LOCUS_2690 15750 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 16692 15865 gene locus_tag LOCUS_2700 16692 15865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 >Feature sequence012 240 368 gene locus_tag LOCUS_2710 240 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 694 1071 gene locus_tag LOCUS_2720 694 1071 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_2720 1073 1477 gene locus_tag LOCUS_2730 gene rpl14p 1073 1477 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_2730 1479 1880 gene locus_tag LOCUS_2740 1479 1880 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_2740 1883 2584 gene locus_tag LOCUS_2750 1883 2584 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903246.1 protein_id gnl|my_center|LOCUS_2750 2587 3102 gene locus_tag LOCUS_2760 2587 3102 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978390.1 protein_id gnl|my_center|LOCUS_2760 3104 3355 gene locus_tag LOCUS_2770 3104 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 3366 3755 gene locus_tag LOCUS_2780 3366 3755 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250477.1 protein_id gnl|my_center|LOCUS_2780 3766 4326 gene locus_tag LOCUS_2790 3766 4326 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_2790 4337 4786 gene locus_tag LOCUS_2800 4337 4786 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_2800 4783 5259 gene locus_tag LOCUS_2810 4783 5259 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_2810 5279 5791 gene locus_tag LOCUS_2820 5279 5791 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_2820 5793 6641 gene locus_tag LOCUS_2830 5793 6641 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061173.1 protein_id gnl|my_center|LOCUS_2830 6698 7057 gene locus_tag LOCUS_2840 6698 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 7218 7682 gene locus_tag LOCUS_2850 7218 7682 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_2850 8272 7838 gene locus_tag LOCUS_2860 8272 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 8378 9469 gene locus_tag LOCUS_2870 8378 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2870 9474 11447 gene locus_tag LOCUS_2880 9474 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2880 11449 12603 gene locus_tag LOCUS_2890 11449 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 12677 13510 gene locus_tag LOCUS_2900 gene thyA 12677 13510 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_2900 13580 16201 gene locus_tag LOCUS_2910 13580 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 >Feature sequence013 473 1138 gene locus_tag LOCUS_2920 473 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 1417 1683 gene locus_tag LOCUS_2930 1417 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 2887 1667 gene locus_tag LOCUS_2940 2887 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_2940 2938 3090 gene locus_tag LOCUS_2950 2938 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 3151 3756 gene locus_tag LOCUS_2960 3151 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 3852 5990 gene locus_tag LOCUS_2970 3852 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_2970 6140 8023 gene locus_tag LOCUS_2980 gene dnaK 6140 8023 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RH05 protein_id gnl|my_center|LOCUS_2980 8274 11144 gene locus_tag LOCUS_2990 8274 11144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 11777 11169 gene locus_tag LOCUS_3000 11777 11169 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002467920.1 protein_id gnl|my_center|LOCUS_3000 14258 11808 gene locus_tag LOCUS_3010 14258 11808 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_3010 14576 14331 gene locus_tag LOCUS_3020 14576 14331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 >Feature sequence014 643 1569 gene locus_tag LOCUS_3030 643 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 1563 2501 gene locus_tag LOCUS_3040 1563 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 2891 2490 gene locus_tag LOCUS_3050 2891 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 3006 3752 gene locus_tag LOCUS_3060 3006 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 5019 3745 gene locus_tag LOCUS_3070 5019 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 5787 5062 gene locus_tag LOCUS_3080 5787 5062 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703693.1 protein_id gnl|my_center|LOCUS_3080 5853 6143 gene locus_tag LOCUS_3090 5853 6143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 6368 9631 gene locus_tag LOCUS_3100 6368 9631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 10939 9674 gene locus_tag LOCUS_3110 10939 9674 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_3110 13015 10982 gene locus_tag LOCUS_3120 13015 10982 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462892.1 protein_id gnl|my_center|LOCUS_3120 >Feature sequence015 <1 922 gene locus_tag LOCUS_3130 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PM9:lysine--tRNA ligase 2135 1098 gene locus_tag LOCUS_3140 2135 1098 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869888.1 protein_id gnl|my_center|LOCUS_3140 2265 2642 gene locus_tag LOCUS_3150 2265 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 2748 3512 gene locus_tag LOCUS_3160 2748 3512 CDS product TatD family deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066032.1 protein_id gnl|my_center|LOCUS_3160 3687 4619 gene locus_tag LOCUS_3170 3687 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 5076 4609 gene locus_tag LOCUS_3180 5076 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 5184 5255 gene locus_tag LOCUS_t0080 5184 5255 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5368 6378 gene locus_tag LOCUS_3190 5368 6378 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957893.1 protein_id gnl|my_center|LOCUS_3190 6757 7563 gene locus_tag LOCUS_3200 6757 7563 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932834.1 protein_id gnl|my_center|LOCUS_3200 7573 8178 gene locus_tag LOCUS_3210 7573 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3210 8215 9054 gene locus_tag LOCUS_3220 8215 9054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3220 9091 9678 gene locus_tag LOCUS_3230 9091 9678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 10735 9671 gene locus_tag LOCUS_3240 10735 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870925.1 protein_id gnl|my_center|LOCUS_3240 10912 11373 gene locus_tag LOCUS_3250 10912 11373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 11413 12288 gene locus_tag LOCUS_3260 11413 12288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3260 12346 12714 gene locus_tag LOCUS_3270 12346 12714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 >Feature sequence016 1957 824 gene locus_tag LOCUS_3280 1957 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 4003 2045 gene locus_tag LOCUS_3290 4003 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 4117 4734 gene locus_tag LOCUS_3300 4117 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 4731 5339 gene locus_tag LOCUS_3310 4731 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 5491 5336 gene locus_tag LOCUS_3320 5491 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 6435 5644 gene locus_tag LOCUS_3330 6435 5644 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870051.1 protein_id gnl|my_center|LOCUS_3330 6970 6515 gene locus_tag LOCUS_3340 6970 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3340 7343 7008 gene locus_tag LOCUS_3350 7343 7008 CDS product NagC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_3350 7516 7355 gene locus_tag LOCUS_3360 7516 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 8924 7659 gene locus_tag LOCUS_3370 8924 7659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544945.1 protein_id gnl|my_center|LOCUS_3370 10331 9030 gene locus_tag LOCUS_3380 10331 9030 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250771.1 protein_id gnl|my_center|LOCUS_3380 10912 10382 gene locus_tag LOCUS_3390 10912 10382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 11451 10963 gene locus_tag LOCUS_3400 11451 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 <12417 11482 gene locus_tag LOCUS_3410 <12417 11482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876180.1:double-stranded DNA repair protein Mre11 >Feature sequence017 1405 878 gene locus_tag LOCUS_3420 1405 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 2500 1451 gene locus_tag LOCUS_3430 2500 1451 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932485.1 protein_id gnl|my_center|LOCUS_3430 3369 2497 gene locus_tag LOCUS_3440 gene tkt 3369 2497 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430704.1 protein_id gnl|my_center|LOCUS_3440 4236 3448 gene locus_tag LOCUS_3450 4236 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 6970 4406 gene locus_tag LOCUS_3460 6970 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 7653 7168 gene locus_tag LOCUS_3470 7653 7168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 10177 7778 gene locus_tag LOCUS_3480 10177 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 10653 10168 gene locus_tag LOCUS_3490 10653 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 11281 10898 gene locus_tag LOCUS_3500 11281 10898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 >Feature sequence018 2035 356 gene locus_tag LOCUS_3510 2035 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 2984 2037 gene locus_tag LOCUS_3520 2984 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 3128 3856 gene locus_tag LOCUS_3530 3128 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3530 4298 3903 gene locus_tag LOCUS_3540 4298 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 4386 4562 gene locus_tag LOCUS_3550 4386 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 4564 4875 gene locus_tag LOCUS_3560 4564 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3560 4877 5347 gene locus_tag LOCUS_3570 4877 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 5340 5465 gene locus_tag LOCUS_3580 5340 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580 5711 6067 gene locus_tag LOCUS_3590 5711 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3590 6859 6104 gene locus_tag LOCUS_3600 6859 6104 CDS product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870542.1 protein_id gnl|my_center|LOCUS_3600 6956 7543 gene locus_tag LOCUS_3610 6956 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 9192 7546 gene locus_tag LOCUS_3620 9192 7546 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_3620 9296 11542 gene locus_tag LOCUS_3630 9296 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 >Feature sequence019 1052 798 gene locus_tag LOCUS_3640 1052 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 1396 1184 gene locus_tag LOCUS_3650 1396 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3650 1516 2151 gene locus_tag LOCUS_3660 1516 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3660 2196 2759 gene locus_tag LOCUS_3670 2196 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 2819 3433 gene locus_tag LOCUS_3680 2819 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 4666 3443 gene locus_tag LOCUS_3690 4666 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3690 6814 4688 gene locus_tag LOCUS_3700 6814 4688 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868797.1 protein_id gnl|my_center|LOCUS_3700 7330 6914 gene locus_tag LOCUS_3710 7330 6914 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979770.1 protein_id gnl|my_center|LOCUS_3710 10438 7784 gene locus_tag LOCUS_3720 10438 7784 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU0 protein_id gnl|my_center|LOCUS_3720 11128 10508 gene locus_tag LOCUS_3730 gene acpD 11128 10508 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNL4 protein_id gnl|my_center|LOCUS_3730 <11703 11181 gene locus_tag LOCUS_3740 <11703 11181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061106.1:ATPase >Feature sequence020 516 1895 gene locus_tag LOCUS_3750 516 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 1964 2374 gene locus_tag LOCUS_3760 1964 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 2441 4270 gene locus_tag LOCUS_3770 gene aspS 2441 4270 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDC3 protein_id gnl|my_center|LOCUS_3770 4897 4289 gene locus_tag LOCUS_3780 4897 4289 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258312.1 protein_id gnl|my_center|LOCUS_3780 4948 5538 gene locus_tag LOCUS_3790 4948 5538 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939714.1 protein_id gnl|my_center|LOCUS_3790 6882 5665 gene locus_tag LOCUS_3800 6882 5665 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262779.1 protein_id gnl|my_center|LOCUS_3800 6986 7651 gene locus_tag LOCUS_3810 6986 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3810 8218 7643 gene locus_tag LOCUS_3820 8218 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3820 8490 8215 gene locus_tag LOCUS_3830 8490 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 8816 8535 gene locus_tag LOCUS_3840 8816 8535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3840 10788 8839 gene locus_tag LOCUS_3850 10788 8839 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868350.1 protein_id gnl|my_center|LOCUS_3850 >Feature sequence021 704 351 gene locus_tag LOCUS_3860 704 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 2544 781 gene locus_tag LOCUS_3870 2544 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3870 3484 2609 gene locus_tag LOCUS_3880 3484 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 3634 4698 gene locus_tag LOCUS_3890 3634 4698 CDS product S-layer domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065539.1 protein_id gnl|my_center|LOCUS_3890 4705 5901 gene locus_tag LOCUS_3900 4705 5901 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023495.1 protein_id gnl|my_center|LOCUS_3900 5903 6583 gene locus_tag LOCUS_3910 5903 6583 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984850.1 protein_id gnl|my_center|LOCUS_3910 >Feature sequence022 434 57 gene locus_tag LOCUS_3920 434 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 543 995 gene locus_tag LOCUS_3930 543 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3930 1078 4677 gene locus_tag LOCUS_3940 1078 4677 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053701.1 protein_id gnl|my_center|LOCUS_3940 4713 5561 gene locus_tag LOCUS_3950 4713 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 5620 6642 gene locus_tag LOCUS_3960 5620 6642 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933660.1 protein_id gnl|my_center|LOCUS_3960 6685 7026 gene locus_tag LOCUS_3970 6685 7026 CDS product translation initiation factor 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_3970 7427 7056 gene locus_tag LOCUS_3980 7427 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 7869 7796 gene locus_tag LOCUS_t0090 7869 7796 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence023 1229 3004 gene locus_tag LOCUS_3990 1229 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 3037 3780 gene locus_tag LOCUS_4000 3037 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 3777 5417 gene locus_tag LOCUS_4010 3777 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 6068 5475 gene locus_tag LOCUS_4020 6068 5475 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_4020 6109 6363 gene locus_tag LOCUS_4030 6109 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4030 6431 7282 gene locus_tag LOCUS_4040 6431 7282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4040 7287 7451 gene locus_tag LOCUS_4050 7287 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 7486 8301 gene locus_tag LOCUS_4060 7486 8301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 8301 8696 gene locus_tag LOCUS_4070 8301 8696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 9885 8827 gene locus_tag LOCUS_4080 9885 8827 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_4080 9945 10529 gene locus_tag LOCUS_4090 9945 10529 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_4090 >Feature sequence024 1754 1185 gene locus_tag LOCUS_4100 gene tag 1754 1185 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_4100 3303 1873 gene locus_tag LOCUS_4110 gene PdhD 3303 1873 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y862 protein_id gnl|my_center|LOCUS_4110 5187 3421 gene locus_tag LOCUS_4120 gene aceF 5187 3421 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XWN7 protein_id gnl|my_center|LOCUS_4120 5291 6121 gene locus_tag LOCUS_4130 5291 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4130 6847 6107 gene locus_tag LOCUS_4140 6847 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 7867 6896 gene locus_tag LOCUS_4150 7867 6896 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289463.1 protein_id gnl|my_center|LOCUS_4150 8969 7869 gene locus_tag LOCUS_4160 gene bkdA 8969 7869 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943293.1 protein_id gnl|my_center|LOCUS_4160 9401 9039 gene locus_tag LOCUS_4170 9401 9039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4170 10143 9403 gene locus_tag LOCUS_4180 10143 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4180 >Feature sequence025 4926 5393 gene locus_tag LOCUS_4190 4926 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4190 5467 5667 gene locus_tag LOCUS_4200 5467 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 5767 6483 gene locus_tag LOCUS_4210 5767 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 6461 7237 gene locus_tag LOCUS_4220 6461 7237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 7994 7314 gene locus_tag LOCUS_4230 7994 7314 CDS product DNA repair protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877300.1 protein_id gnl|my_center|LOCUS_4230 8478 8125 gene locus_tag LOCUS_4240 gene arsC 8478 8125 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ED91 protein_id gnl|my_center|LOCUS_4240 9521 8979 gene locus_tag LOCUS_4250 9521 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 >Feature sequence026 1228 2073 gene locus_tag LOCUS_4260 1228 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 3706 2048 gene locus_tag LOCUS_4270 3706 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 3808 4869 gene locus_tag LOCUS_4280 3808 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 6495 4870 gene locus_tag LOCUS_4290 6495 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4290 7312 6647 gene locus_tag LOCUS_4300 7312 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 7766 7353 gene locus_tag LOCUS_4310 7766 7353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4310 8134 7769 gene locus_tag LOCUS_4320 8134 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4320 9618 8218 gene locus_tag LOCUS_4330 9618 8218 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250469.1 protein_id gnl|my_center|LOCUS_4330 >Feature sequence027 2385 229 gene locus_tag LOCUS_4340 2385 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4340 2513 3844 gene locus_tag LOCUS_4350 2513 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4350 3846 4919 gene locus_tag LOCUS_4360 3846 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4360 5729 4932 gene locus_tag LOCUS_4370 5729 4932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 6557 5772 gene locus_tag LOCUS_4380 6557 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4380 7104 6589 gene locus_tag LOCUS_4390 7104 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4390 7313 7101 gene locus_tag LOCUS_4400 7313 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 8154 7315 gene locus_tag LOCUS_4410 8154 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4410 8602 8258 gene locus_tag LOCUS_4420 8602 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 8688 9224 gene locus_tag LOCUS_4430 8688 9224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 9706 9230 gene locus_tag LOCUS_4440 gene gpo 9706 9230 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CFV1 protein_id gnl|my_center|LOCUS_4440 >Feature sequence028 311 526 gene locus_tag LOCUS_4450 311 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4450 528 785 gene locus_tag LOCUS_4460 528 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4460 782 2152 gene locus_tag LOCUS_4470 782 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4470 2183 2572 gene locus_tag LOCUS_4480 2183 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 2769 2569 gene locus_tag LOCUS_4490 2769 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 4064 2772 gene locus_tag LOCUS_4500 4064 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 4878 4165 gene locus_tag LOCUS_4510 4878 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 4996 5466 gene locus_tag LOCUS_4520 4996 5466 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_4520 5474 6130 gene locus_tag LOCUS_4530 5474 6130 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_4530 6133 6591 gene locus_tag LOCUS_4540 6133 6591 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_4540 6618 7223 gene locus_tag LOCUS_4550 6618 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 7230 7688 gene locus_tag LOCUS_4560 7230 7688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 7691 8101 gene locus_tag LOCUS_4570 7691 8101 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_4570 8179 8346 gene locus_tag LOCUS_4580 8179 8346 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_4580 8449 9267 gene locus_tag LOCUS_4590 8449 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 >Feature sequence029 <1 692 gene locus_tag LOCUS_4600 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946026.1:multicopper oxidase 943 776 gene locus_tag LOCUS_4610 943 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4610 2426 936 gene locus_tag LOCUS_4620 2426 936 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_4620 2560 3522 gene locus_tag LOCUS_4630 2560 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4630 3599 5332 gene locus_tag LOCUS_4640 3599 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 5354 5809 gene locus_tag LOCUS_4650 5354 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4650 6612 5806 gene locus_tag LOCUS_4660 6612 5806 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530513.1 protein_id gnl|my_center|LOCUS_4660 6697 7212 gene locus_tag LOCUS_4670 6697 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4670 7481 7218 gene locus_tag LOCUS_4680 7481 7218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 7473 7991 gene locus_tag LOCUS_4690 7473 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4690 9218 8067 gene locus_tag LOCUS_4700 9218 8067 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_4700 9627 9310 gene locus_tag LOCUS_4710 9627 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 >Feature sequence030 1544 96 gene locus_tag LOCUS_4720 gene proS 1544 96 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E028 protein_id gnl|my_center|LOCUS_4720 1861 1580 gene locus_tag LOCUS_4730 1861 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 2632 1985 gene locus_tag LOCUS_4740 2632 1985 CDS product sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001203415.1 protein_id gnl|my_center|LOCUS_4740 3215 2625 gene locus_tag LOCUS_4750 3215 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 4083 3220 gene locus_tag LOCUS_4760 4083 3220 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873338.1 protein_id gnl|my_center|LOCUS_4760 4737 4099 gene locus_tag LOCUS_4770 gene adk 4737 4099 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F1X3 protein_id gnl|my_center|LOCUS_4770 6383 4884 gene locus_tag LOCUS_4780 6383 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4780 8071 6380 gene locus_tag LOCUS_4790 8071 6380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4790 9082 8417 gene locus_tag LOCUS_4800 9082 8417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4800 >Feature sequence031 771 337 gene locus_tag LOCUS_4810 771 337 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_4810 1014 1577 gene locus_tag LOCUS_4820 gene ahpC 1014 1577 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CMQ2 protein_id gnl|my_center|LOCUS_4820 1697 2122 gene locus_tag LOCUS_4830 1697 2122 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_4830 2788 2141 gene locus_tag LOCUS_4840 2788 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 2925 3215 gene locus_tag LOCUS_4850 2925 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 3535 3227 gene locus_tag LOCUS_4860 3535 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4860 4064 3537 gene locus_tag LOCUS_4870 4064 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 4282 4088 gene locus_tag LOCUS_4880 4282 4088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 4816 4286 gene locus_tag LOCUS_4890 4816 4286 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875903.1 protein_id gnl|my_center|LOCUS_4890 6119 4998 gene locus_tag LOCUS_4900 6119 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 6317 6392 gene locus_tag LOCUS_t0100 6317 6392 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 6560 6922 gene locus_tag LOCUS_4910 6560 6922 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870594.1 protein_id gnl|my_center|LOCUS_4910 7192 7884 gene locus_tag LOCUS_4920 7192 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 8131 7865 gene locus_tag LOCUS_4930 8131 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 8357 9403 gene locus_tag LOCUS_4940 8357 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228500.1 protein_id gnl|my_center|LOCUS_4940 >Feature sequence032 657 1940 gene locus_tag LOCUS_4950 657 1940 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207983.1 protein_id gnl|my_center|LOCUS_4950 1933 2940 gene locus_tag LOCUS_4960 1933 2940 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003537568.1 protein_id gnl|my_center|LOCUS_4960 3297 2941 gene locus_tag LOCUS_4970 3297 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 4120 3344 gene locus_tag LOCUS_4980 4120 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4980 4214 5269 gene locus_tag LOCUS_4990 4214 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 5269 6000 gene locus_tag LOCUS_5000 gene abcT2 5269 6000 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880369.1 protein_id gnl|my_center|LOCUS_5000 5997 6791 gene locus_tag LOCUS_5010 5997 6791 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966162.1 protein_id gnl|my_center|LOCUS_5010 6886 7506 gene locus_tag LOCUS_5020 gene yfkO 6886 7506 CDS product putative NAD(P)H nitroreductase YfkO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34475 protein_id gnl|my_center|LOCUS_5020 9199 7511 gene locus_tag LOCUS_5030 9199 7511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5030 >Feature sequence033 1721 822 gene locus_tag LOCUS_5040 1721 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5040 1843 2025 gene locus_tag LOCUS_5050 1843 2025 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964294.1 protein_id gnl|my_center|LOCUS_5050 2077 2694 gene locus_tag LOCUS_5060 2077 2694 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024041.1 protein_id gnl|my_center|LOCUS_5060 3008 2691 gene locus_tag LOCUS_5070 3008 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 3381 3073 gene locus_tag LOCUS_5080 3381 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 3511 4272 gene locus_tag LOCUS_5090 3511 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 4326 4460 gene locus_tag LOCUS_5100 4326 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5100 4517 5773 gene locus_tag LOCUS_5110 4517 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5110 5867 6418 gene locus_tag LOCUS_5120 5867 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 6415 7128 gene locus_tag LOCUS_5130 6415 7128 CDS product putative ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYI7 protein_id gnl|my_center|LOCUS_5130 7134 8363 gene locus_tag LOCUS_5140 7134 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023109.1 protein_id gnl|my_center|LOCUS_5140 >Feature sequence034 887 2173 gene locus_tag LOCUS_5150 887 2173 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_5150 2178 2600 gene locus_tag LOCUS_5160 2178 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 2691 2978 gene locus_tag LOCUS_5170 2691 2978 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_5170 3018 3356 gene locus_tag LOCUS_5180 3018 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 3438 4016 gene locus_tag LOCUS_5190 3438 4016 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_5190 4151 5428 gene locus_tag LOCUS_5200 4151 5428 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869821.1 protein_id gnl|my_center|LOCUS_5200 5465 5770 gene locus_tag LOCUS_5210 5465 5770 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249262.1 protein_id gnl|my_center|LOCUS_5210 6999 6037 gene locus_tag LOCUS_5220 6999 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5220 7078 7539 gene locus_tag LOCUS_5230 7078 7539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 >Feature sequence035 91 297 gene locus_tag LOCUS_5240 91 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 301 1104 gene locus_tag LOCUS_5250 301 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5250 1104 1841 gene locus_tag LOCUS_5260 1104 1841 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250160.1 protein_id gnl|my_center|LOCUS_5260 1967 2494 gene locus_tag LOCUS_5270 1967 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5270 2558 2830 gene locus_tag LOCUS_5280 2558 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5280 3048 2967 gene locus_tag LOCUS_t0110 3048 2967 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3520 3317 gene locus_tag LOCUS_5290 3520 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 3864 4076 gene locus_tag LOCUS_5300 3864 4076 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876320.1 protein_id gnl|my_center|LOCUS_5300 4230 4463 gene locus_tag LOCUS_5310 4230 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5310 4465 4710 gene locus_tag LOCUS_5320 4465 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 4911 5480 gene locus_tag LOCUS_5330 4911 5480 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_5330 5490 5843 gene locus_tag LOCUS_5340 5490 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5340 7903 5894 gene locus_tag LOCUS_5350 7903 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5350 8013 8654 gene locus_tag LOCUS_5360 8013 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 >Feature sequence036 390 1013 gene locus_tag LOCUS_5370 390 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 1356 1006 gene locus_tag LOCUS_5380 1356 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 2144 1362 gene locus_tag LOCUS_5390 2144 1362 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 protein_id gnl|my_center|LOCUS_5390 2648 2199 gene locus_tag LOCUS_5400 2648 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 5229 2707 gene locus_tag LOCUS_5410 5229 2707 CDS product double-stranded DNA repair protein Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_5410 6442 5261 gene locus_tag LOCUS_5420 6442 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5420 6992 6483 gene locus_tag LOCUS_5430 6992 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 8084 7062 gene locus_tag LOCUS_5440 8084 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5440 8580 8122 gene locus_tag LOCUS_5450 8580 8122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 >Feature sequence037 62 813 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atacttcttctgtgacaaatatg 1028 2473 gene locus_tag LOCUS_5460 1028 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 2586 2891 gene locus_tag LOCUS_5470 2586 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5470 3368 2919 gene locus_tag LOCUS_5480 3368 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 4617 3370 gene locus_tag LOCUS_5490 4617 3370 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759975.1 protein_id gnl|my_center|LOCUS_5490 4776 6443 gene locus_tag LOCUS_5500 4776 6443 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_5500 6540 8426 gene locus_tag LOCUS_5510 6540 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 >Feature sequence038 462 25 gene locus_tag LOCUS_5520 462 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5520 2421 1252 gene locus_tag LOCUS_5530 2421 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_5530 3019 2708 gene locus_tag LOCUS_5540 gene grlA 3019 2708 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IC8 protein_id gnl|my_center|LOCUS_5540 3276 3031 gene locus_tag LOCUS_5550 3276 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5550 3349 4077 gene locus_tag LOCUS_5560 3349 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5560 4132 4908 gene locus_tag LOCUS_5570 4132 4908 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_5570 4979 5347 gene locus_tag LOCUS_5580 gene mhqP 4979 5347 CDS product putative oxidoreductase MhqP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96694 protein_id gnl|my_center|LOCUS_5580 6041 5370 gene locus_tag LOCUS_5590 6041 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5590 6126 6635 gene locus_tag LOCUS_5600 6126 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5600 7368 6649 gene locus_tag LOCUS_5610 7368 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5610 7502 8146 gene locus_tag LOCUS_5620 7502 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 >Feature sequence039 1074 529 gene locus_tag LOCUS_5630 1074 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5630 2261 1203 gene locus_tag LOCUS_5640 2261 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5640 3097 2270 gene locus_tag LOCUS_5650 3097 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5650 4584 3094 gene locus_tag LOCUS_5660 4584 3094 CDS product secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_5660 4792 4571 gene locus_tag LOCUS_5670 4792 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 6236 4749 gene locus_tag LOCUS_5680 6236 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5680 6676 6239 gene locus_tag LOCUS_5690 6676 6239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5690 8090 6750 gene locus_tag LOCUS_5700 8090 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5700 8354 8100 gene locus_tag LOCUS_5710 8354 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 >Feature sequence040 300 2870 gene locus_tag LOCUS_5720 300 2870 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060895.1 protein_id gnl|my_center|LOCUS_5720 2872 3270 gene locus_tag LOCUS_5730 2872 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5730 3316 4107 gene locus_tag LOCUS_5740 3316 4107 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729112.1 protein_id gnl|my_center|LOCUS_5740 4170 4604 gene locus_tag LOCUS_5750 4170 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 4642 5046 gene locus_tag LOCUS_5760 4642 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5760 5928 5047 gene locus_tag LOCUS_5770 5928 5047 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060825.1 protein_id gnl|my_center|LOCUS_5770 7102 5930 gene locus_tag LOCUS_5780 7102 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5780 8066 7104 gene locus_tag LOCUS_5790 8066 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 >Feature sequence041 5507 1515 gene locus_tag LOCUS_5800 5507 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5800 6196 5504 gene locus_tag LOCUS_5810 6196 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 6288 6953 gene locus_tag LOCUS_5820 6288 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 >Feature sequence042 341 568 gene locus_tag LOCUS_5830 341 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 618 785 gene locus_tag LOCUS_5840 618 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 844 1506 gene locus_tag LOCUS_5850 844 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 1713 2219 gene locus_tag LOCUS_5860 1713 2219 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_5860 2350 2778 gene locus_tag LOCUS_5870 2350 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 2822 3907 gene locus_tag LOCUS_5880 2822 3907 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761845.1 protein_id gnl|my_center|LOCUS_5880 4068 5327 gene locus_tag LOCUS_5890 4068 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 5372 5740 gene locus_tag LOCUS_5900 5372 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 6073 5726 gene locus_tag LOCUS_5910 6073 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 >Feature sequence043 587 919 gene locus_tag LOCUS_5920 587 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 912 1499 gene locus_tag LOCUS_5930 912 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 2784 1465 gene locus_tag LOCUS_5940 2784 1465 CDS product tRNA CCA-pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870623.1 protein_id gnl|my_center|LOCUS_5940 3465 2788 gene locus_tag LOCUS_5950 3465 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 6454 3506 gene locus_tag LOCUS_5960 6454 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5960 7268 6579 gene locus_tag LOCUS_5970 7268 6579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 >Feature sequence044 571 1566 gene locus_tag LOCUS_5980 571 1566 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869671.1 protein_id gnl|my_center|LOCUS_5980 1571 2368 gene locus_tag LOCUS_5990 1571 2368 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_5990 2370 2678 gene locus_tag LOCUS_6000 2370 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 2680 3411 gene locus_tag LOCUS_6010 2680 3411 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_6010 3414 3764 gene locus_tag LOCUS_6020 3414 3764 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_6020 3774 4238 gene locus_tag LOCUS_6030 3774 4238 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_6030 4235 4936 gene locus_tag LOCUS_6040 4235 4936 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250487.1 protein_id gnl|my_center|LOCUS_6040 4979 5167 gene locus_tag LOCUS_6050 4979 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6050 5470 5297 gene locus_tag LOCUS_6060 5470 5297 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868015.1 protein_id gnl|my_center|LOCUS_6060 6482 5472 gene locus_tag LOCUS_6070 6482 5472 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324798.1 protein_id gnl|my_center|LOCUS_6070 6609 6929 gene locus_tag LOCUS_6080 6609 6929 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_6080 6983 7273 gene locus_tag LOCUS_6090 6983 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6090 >Feature sequence045 1729 995 gene locus_tag LOCUS_6100 1729 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 2409 1732 gene locus_tag LOCUS_6110 2409 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6110 2619 4790 gene locus_tag LOCUS_6120 2619 4790 CDS product translation elongation factor aEF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_6120 5884 4907 gene locus_tag LOCUS_6130 5884 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6130 >Feature sequence046 1998 1834 gene locus_tag LOCUS_6140 1998 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 2112 2369 gene locus_tag LOCUS_6150 2112 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 2563 4326 gene locus_tag LOCUS_6160 2563 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 4837 4334 gene locus_tag LOCUS_6170 4837 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 5099 4869 gene locus_tag LOCUS_6180 5099 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 6259 5096 gene locus_tag LOCUS_6190 6259 5096 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290820.1 protein_id gnl|my_center|LOCUS_6190 6315 6839 gene locus_tag LOCUS_6200 6315 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 >Feature sequence047 <1 2244 gene locus_tag LOCUS_6210 <1 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879381.1:DNA-directed RNA polymerase subunit A' 2252 3394 gene locus_tag LOCUS_6220 2252 3394 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846867.1 protein_id gnl|my_center|LOCUS_6220 3574 3990 gene locus_tag LOCUS_6230 3574 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 4263 4018 gene locus_tag LOCUS_6240 4263 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 4478 4849 gene locus_tag LOCUS_6250 4478 4849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 4852 5274 gene locus_tag LOCUS_6260 4852 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6260 5284 5898 gene locus_tag LOCUS_6270 5284 5898 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_6270 5956 6585 gene locus_tag LOCUS_6280 5956 6585 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870749.1 protein_id gnl|my_center|LOCUS_6280 >Feature sequence048 <1 1510 gene locus_tag LOCUS_6290 <1 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869988.1:phenylalanine--tRNA ligase subunit alpha 1512 1913 gene locus_tag LOCUS_6300 1512 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6300 1915 3588 gene locus_tag LOCUS_6310 1915 3588 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_6310 3639 4331 gene locus_tag LOCUS_6320 3639 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6320 4352 4645 gene locus_tag LOCUS_6330 4352 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6330 6087 4627 gene locus_tag LOCUS_6340 6087 4627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 >Feature sequence049 3111 1942 gene locus_tag LOCUS_6350 3111 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 3207 3623 gene locus_tag LOCUS_6360 gene lspA 3207 3623 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DUQ0 protein_id gnl|my_center|LOCUS_6360 3708 6119 gene locus_tag LOCUS_6370 3708 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 >Feature sequence050 797 459 gene locus_tag LOCUS_6380 797 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6380 898 2997 gene locus_tag LOCUS_6390 898 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 3032 3496 gene locus_tag LOCUS_6400 3032 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 3535 4161 gene locus_tag LOCUS_6410 3535 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6410 4516 4148 gene locus_tag LOCUS_6420 4516 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 5786 4518 gene locus_tag LOCUS_6430 5786 4518 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_6430 >Feature sequence051 670 56 gene locus_tag LOCUS_6440 gene grpE 670 56 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDK6 protein_id gnl|my_center|LOCUS_6440 1720 752 gene locus_tag LOCUS_6450 1720 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6450 1891 2475 gene locus_tag LOCUS_6460 1891 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6460 2556 3116 gene locus_tag LOCUS_6470 2556 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6470 3669 3121 gene locus_tag LOCUS_6480 3669 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 5550 3799 gene locus_tag LOCUS_6490 5550 3799 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249982.1 protein_id gnl|my_center|LOCUS_6490 5669 5986 gene locus_tag LOCUS_6500 5669 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 >Feature sequence052 1440 172 gene locus_tag LOCUS_6510 1440 172 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_6510 3322 1541 gene locus_tag LOCUS_6520 3322 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6520 3904 3332 gene locus_tag LOCUS_6530 3904 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 5738 3906 gene locus_tag LOCUS_6540 5738 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 >Feature sequence053 2046 1045 gene locus_tag LOCUS_6550 gene ldhA 2046 1045 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880437.1 protein_id gnl|my_center|LOCUS_6550 3468 2125 gene locus_tag LOCUS_6560 3468 2125 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146740.1 protein_id gnl|my_center|LOCUS_6560 3717 3789 gene locus_tag LOCUS_t0120 3717 3789 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4005 4478 gene locus_tag LOCUS_6570 4005 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6570 4471 4845 gene locus_tag LOCUS_6580 4471 4845 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_6580 4847 5107 gene locus_tag LOCUS_6590 4847 5107 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_6590 5110 5637 gene locus_tag LOCUS_6600 5110 5637 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_6600 5728 5803 gene locus_tag LOCUS_t0130 5728 5803 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5888 5964 gene locus_tag LOCUS_t0140 5888 5964 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence054 474 3179 gene locus_tag LOCUS_6610 474 3179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 3218 3832 gene locus_tag LOCUS_6620 3218 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 >Feature sequence055 1188 961 gene locus_tag LOCUS_6630 1188 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6630 1284 1209 gene locus_tag LOCUS_t0150 1284 1209 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1432 1358 gene locus_tag LOCUS_t0160 1432 1358 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2161 1745 gene locus_tag LOCUS_6640 2161 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 2454 2200 gene locus_tag LOCUS_6650 2454 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 3128 2553 gene locus_tag LOCUS_6660 3128 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 3556 3131 gene locus_tag LOCUS_6670 3556 3131 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_6670 3824 3749 gene locus_tag LOCUS_t0170 3824 3749 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5027 3999 gene locus_tag LOCUS_6680 5027 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 >Feature sequence056 911 387 gene locus_tag LOCUS_6690 911 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6690 887 1054 gene locus_tag LOCUS_6700 887 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6700 1929 3233 gene locus_tag LOCUS_6710 1929 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6710 3985 3239 gene locus_tag LOCUS_6720 gene lgt 3985 3239 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHX0 protein_id gnl|my_center|LOCUS_6720 4539 3988 gene locus_tag LOCUS_6730 4539 3988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6730 5124 4558 gene locus_tag LOCUS_6740 5124 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6740 5257 5173 gene locus_tag LOCUS_t0180 5257 5173 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5451 5813 gene locus_tag LOCUS_6750 5451 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6750 >Feature sequence057 1763 3823 gene locus_tag LOCUS_6760 1763 3823 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_6760 4192 3983 gene locus_tag LOCUS_6770 4192 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6770 5654 4272 gene locus_tag LOCUS_6780 5654 4272 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061065.1 protein_id gnl|my_center|LOCUS_6780 >Feature sequence058 2413 3114 gene locus_tag LOCUS_6790 2413 3114 CDS product flagellar accessory protein FlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_6790 3406 5046 gene locus_tag LOCUS_6800 3406 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868605.1 protein_id gnl|my_center|LOCUS_6800 >Feature sequence059 151 624 gene locus_tag LOCUS_6810 151 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6810 1190 621 gene locus_tag LOCUS_6820 1190 621 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_6820 2722 1187 gene locus_tag LOCUS_6830 gene phrB2 2722 1187 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_6830 2822 3181 gene locus_tag LOCUS_6840 2822 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 3185 4576 gene locus_tag LOCUS_6850 3185 4576 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978886.1 protein_id gnl|my_center|LOCUS_6850 4997 4689 gene locus_tag LOCUS_6860 4997 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6860 5544 5059 gene locus_tag LOCUS_6870 5544 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6870 >Feature sequence060 930 2696 gene locus_tag LOCUS_6880 930 2696 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000662799.1 protein_id gnl|my_center|LOCUS_6880 4067 2679 gene locus_tag LOCUS_6890 4067 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 5456 4068 gene locus_tag LOCUS_6900 5456 4068 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963552.1 protein_id gnl|my_center|LOCUS_6900 >Feature sequence061 419 652 gene locus_tag LOCUS_6910 419 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 702 1202 gene locus_tag LOCUS_6920 702 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 1316 3121 gene locus_tag LOCUS_6930 1316 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 3231 3434 gene locus_tag LOCUS_6940 3231 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 3707 3426 gene locus_tag LOCUS_6950 3707 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878956.1 protein_id gnl|my_center|LOCUS_6950 4042 3704 gene locus_tag LOCUS_6960 4042 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6960 4457 5155 gene locus_tag LOCUS_6970 4457 5155 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022254.1 protein_id gnl|my_center|LOCUS_6970 >Feature sequence062 80 1366 gene locus_tag LOCUS_6980 80 1366 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_6980 2276 1368 gene locus_tag LOCUS_6990 2276 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 2314 5208 gene locus_tag LOCUS_7000 2314 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 >Feature sequence063 577 335 gene locus_tag LOCUS_7010 577 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7010 1630 704 gene locus_tag LOCUS_7020 1630 704 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_7020 2030 1860 gene locus_tag LOCUS_7030 2030 1860 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_7030 2521 2033 gene locus_tag LOCUS_7040 2521 2033 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877286.1 protein_id gnl|my_center|LOCUS_7040 4415 2628 gene locus_tag LOCUS_7050 4415 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 >Feature sequence064 557 1555 gene locus_tag LOCUS_7060 557 1555 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868783.1 protein_id gnl|my_center|LOCUS_7060 1586 1900 gene locus_tag LOCUS_7070 1586 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 2738 1887 gene locus_tag LOCUS_7080 2738 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 2843 3421 gene locus_tag LOCUS_7090 2843 3421 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249022.1 protein_id gnl|my_center|LOCUS_7090 3487 4032 gene locus_tag LOCUS_7100 3487 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 4034 4351 gene locus_tag LOCUS_7110 4034 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 4392 4886 gene locus_tag LOCUS_7120 4392 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 >Feature sequence065 343 966 gene locus_tag LOCUS_7130 343 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 2869 980 gene locus_tag LOCUS_7140 gene gyrB 2869 980 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ2 protein_id gnl|my_center|LOCUS_7140 3040 3396 gene locus_tag LOCUS_7150 3040 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 4201 3674 gene locus_tag LOCUS_7160 4201 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7160 >Feature sequence066 1541 318 gene locus_tag LOCUS_7170 1541 318 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249727.1 protein_id gnl|my_center|LOCUS_7170 2292 1738 gene locus_tag LOCUS_7180 2292 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7180 3464 2340 gene locus_tag LOCUS_7190 3464 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 3678 3605 gene locus_tag LOCUS_t0190 3678 3605 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5087 3783 gene locus_tag LOCUS_7200 5087 3783 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870376.1 protein_id gnl|my_center|LOCUS_7200 >Feature sequence067 2286 94 gene locus_tag LOCUS_7210 2286 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7210 2377 4089 gene locus_tag LOCUS_7220 2377 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7220 4145 4681 gene locus_tag LOCUS_7230 4145 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7230 >Feature sequence068 2665 1028 gene locus_tag LOCUS_7240 2665 1028 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_7240 3397 2732 gene locus_tag LOCUS_7250 gene gpmA 3397 2732 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z743 protein_id gnl|my_center|LOCUS_7250 3487 3915 gene locus_tag LOCUS_7260 3487 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7260 4331 3912 gene locus_tag LOCUS_7270 4331 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 >Feature sequence069 <1 743 gene locus_tag LOCUS_7280 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868935.1:ribonuclease H 745 1527 gene locus_tag LOCUS_7290 745 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 1919 1530 gene locus_tag LOCUS_7300 1919 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 2124 2209 gene locus_tag LOCUS_t0200 2124 2209 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2309 3322 gene locus_tag LOCUS_7310 2309 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7310 3429 4346 gene locus_tag LOCUS_7320 gene rnz 3429 4346 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q818V3 protein_id gnl|my_center|LOCUS_7320 >Feature sequence070 750 1241 gene locus_tag LOCUS_7330 750 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 1243 1527 gene locus_tag LOCUS_7340 1243 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 2072 1590 gene locus_tag LOCUS_7350 gene ndk 2072 1590 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_7350 2488 4059 gene locus_tag LOCUS_7360 2488 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 >Feature sequence071 1359 190 gene locus_tag LOCUS_7370 1359 190 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_7370 1470 1841 gene locus_tag LOCUS_7380 1470 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7380 2146 1904 gene locus_tag LOCUS_7390 2146 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 2689 2198 gene locus_tag LOCUS_7400 2689 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 3038 2679 gene locus_tag LOCUS_7410 3038 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 3591 3031 gene locus_tag LOCUS_7420 3591 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868040.1 protein_id gnl|my_center|LOCUS_7420 3860 3654 gene locus_tag LOCUS_7430 3860 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7430 <4602 3922 gene locus_tag LOCUS_7440 <4602 3922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948368.1:ATP-dependent RNA helicase RhlE >Feature sequence072 3867 649 gene locus_tag LOCUS_7450 3867 649 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978404.1 protein_id gnl|my_center|LOCUS_7450 4497 3916 gene locus_tag LOCUS_7460 4497 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7460 >Feature sequence073 363 103 gene locus_tag LOCUS_7470 363 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 454 1038 gene locus_tag LOCUS_7480 454 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 1139 1447 gene locus_tag LOCUS_7490 1139 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7490 1508 2281 gene locus_tag LOCUS_7500 1508 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7500 2615 2328 gene locus_tag LOCUS_7510 2615 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7510 2698 3096 gene locus_tag LOCUS_7520 2698 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 <4469 3097 gene locus_tag LOCUS_7530 <4469 3097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869593.1:signal recognition particle protein >Feature sequence074 257 3130 gene locus_tag LOCUS_7540 257 3130 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_7540 3132 3494 gene locus_tag LOCUS_7550 3132 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 3844 3521 gene locus_tag LOCUS_7560 3844 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 >Feature sequence075 1619 198 gene locus_tag LOCUS_7570 1619 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 1670 1993 gene locus_tag LOCUS_7580 1670 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 2052 3236 gene locus_tag LOCUS_7590 2052 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7590 3514 4083 gene locus_tag LOCUS_7600 3514 4083 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N4 protein_id gnl|my_center|LOCUS_7600 >Feature sequence076 <1 538 gene locus_tag LOCUS_7610 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986882.1:O-methyltransferase 2478 535 gene locus_tag LOCUS_7620 2478 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 2800 2471 gene locus_tag LOCUS_7630 2800 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7630 2938 3177 gene locus_tag LOCUS_7640 2938 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7640 3221 3784 gene locus_tag LOCUS_7650 3221 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7650 >Feature sequence077 641 2032 gene locus_tag LOCUS_7660 641 2032 CDS product glutaminyl-tRNA synthase (glutamine-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496410.1 protein_id gnl|my_center|LOCUS_7660 2467 2033 gene locus_tag LOCUS_7670 2467 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7670 2918 2460 gene locus_tag LOCUS_7680 2918 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 3551 2934 gene locus_tag LOCUS_7690 3551 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 >Feature sequence078 304 1158 gene locus_tag LOCUS_7700 gene htpX 304 1158 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBM2 protein_id gnl|my_center|LOCUS_7700 1635 1300 gene locus_tag LOCUS_7710 1635 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 2029 1637 gene locus_tag LOCUS_7720 2029 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 2876 2034 gene locus_tag LOCUS_7730 gene parA 2876 2034 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_7730 3268 3777 gene locus_tag LOCUS_7740 3268 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7740 >Feature sequence079 662 988 gene locus_tag LOCUS_7750 662 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7750 1053 2276 gene locus_tag LOCUS_7760 1053 2276 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496965.1 protein_id gnl|my_center|LOCUS_7760 2299 3006 gene locus_tag LOCUS_7770 2299 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496955.1 protein_id gnl|my_center|LOCUS_7770 3048 3383 gene locus_tag LOCUS_7780 3048 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 >Feature sequence080 771 1499 gene locus_tag LOCUS_7790 771 1499 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022244.1 protein_id gnl|my_center|LOCUS_7790 1576 2112 gene locus_tag LOCUS_7800 1576 2112 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730499.1 protein_id gnl|my_center|LOCUS_7800 2112 2858 gene locus_tag LOCUS_7810 2112 2858 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_7810 3220 2855 gene locus_tag LOCUS_7820 3220 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 3272 3715 gene locus_tag LOCUS_7830 gene rlmH 3272 3715 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45601 protein_id gnl|my_center|LOCUS_7830 >Feature sequence081 924 88 gene locus_tag LOCUS_7840 924 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 1962 937 gene locus_tag LOCUS_7850 1962 937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843645.1 protein_id gnl|my_center|LOCUS_7850 2087 3175 gene locus_tag LOCUS_7860 2087 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7860 3168 3656 gene locus_tag LOCUS_7870 3168 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7870 >Feature sequence082 628 1593 gene locus_tag LOCUS_7880 628 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7880 2494 1577 gene locus_tag LOCUS_7890 2494 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877979.1 protein_id gnl|my_center|LOCUS_7890 >Feature sequence083 692 102 gene locus_tag LOCUS_7900 692 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7900 1349 756 gene locus_tag LOCUS_7910 1349 756 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902719.1 protein_id gnl|my_center|LOCUS_7910 2026 1427 gene locus_tag LOCUS_7920 2026 1427 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902719.1 protein_id gnl|my_center|LOCUS_7920 2363 2866 gene locus_tag LOCUS_7930 2363 2866 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 protein_id gnl|my_center|LOCUS_7930 3552 2908 gene locus_tag LOCUS_7940 3552 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 >Feature sequence084 340 729 gene locus_tag LOCUS_7950 340 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7950 1460 726 gene locus_tag LOCUS_7960 1460 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7960 1617 1690 gene locus_tag LOCUS_t0210 1617 1690 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1739 1813 gene locus_tag LOCUS_t0220 1739 1813 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1935 2870 gene locus_tag LOCUS_7970 1935 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 <3741 2908 gene locus_tag LOCUS_7980 <3741 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024383.1:DNA helicase RecQ >Feature sequence085 703 1416 gene locus_tag LOCUS_7990 703 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 1409 3175 gene locus_tag LOCUS_8000 1409 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8000 3645 3268 gene locus_tag LOCUS_8010 3645 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 >Feature sequence086 <1 714 gene locus_tag LOCUS_8020 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876482.1:preprotein translocase subunit SecD 711 1409 gene locus_tag LOCUS_8030 711 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8030 1490 1574 gene locus_tag LOCUS_t0230 1490 1574 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence087 700 993 gene locus_tag LOCUS_8040 700 993 CDS product ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878661.1 protein_id gnl|my_center|LOCUS_8040 1128 2873 gene locus_tag LOCUS_8050 1128 2873 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_8050 >Feature sequence088 2215 794 gene locus_tag LOCUS_8060 gene cysS 2215 794 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E391 protein_id gnl|my_center|LOCUS_8060 2903 2328 gene locus_tag LOCUS_8070 2903 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 >Feature sequence089 148 570 gene locus_tag LOCUS_8080 148 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8080 885 1973 gene locus_tag LOCUS_8090 885 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8090 >Feature sequence090 766 1038 gene locus_tag LOCUS_8100 766 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8100 1102 1656 gene locus_tag LOCUS_8110 1102 1656 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048202361.1 protein_id gnl|my_center|LOCUS_8110 1995 2501 gene locus_tag LOCUS_8120 1995 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8120 >Feature sequence091 1125 178 gene locus_tag LOCUS_8130 1125 178 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020094.1 protein_id gnl|my_center|LOCUS_8130 2120 1176 gene locus_tag LOCUS_8140 2120 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8140 2216 2947 gene locus_tag LOCUS_8150 2216 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8150 >Feature sequence092 1030 503 gene locus_tag LOCUS_8160 1030 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8160 1968 1105 gene locus_tag LOCUS_8170 1968 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8170 2162 2722 gene locus_tag LOCUS_8180 2162 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8180 3219 2785 gene locus_tag LOCUS_8190 3219 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8190 >Feature sequence093 494 252 gene locus_tag LOCUS_8200 494 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8200 601 942 gene locus_tag LOCUS_8210 601 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8210 2086 932 gene locus_tag LOCUS_8220 2086 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8220 >Feature sequence094 2279 150 gene locus_tag LOCUS_8230 2279 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8230 2940 2377 gene locus_tag LOCUS_8240 2940 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 >Feature sequence095 <1 1335 gene locus_tag LOCUS_8250 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482405.1:membrane protein 2037 1375 gene locus_tag LOCUS_8260 2037 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8260 >Feature sequence096 876 415 gene locus_tag LOCUS_8270 876 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8270 2053 977 gene locus_tag LOCUS_8280 2053 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8280 2571 2879 gene locus_tag LOCUS_8290 2571 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8290 >Feature sequence097 1196 144 gene locus_tag LOCUS_8300 1196 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8300 2546 1254 gene locus_tag LOCUS_8310 2546 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8310 >Feature sequence098 925 104 gene locus_tag LOCUS_8320 925 104 CDS product 8-oxoguanine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_8320 1515 907 gene locus_tag LOCUS_8330 1515 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8330 1963 1499 gene locus_tag LOCUS_8340 1963 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8340 >Feature sequence099 88 1071 gene locus_tag LOCUS_8350 88 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8350 2532 1174 gene locus_tag LOCUS_8360 2532 1174 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869538.1 protein_id gnl|my_center|LOCUS_8360 >Feature sequence100 2249 822 gene locus_tag LOCUS_8370 2249 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8370 >Feature sequence101 512 216 gene locus_tag LOCUS_8380 512 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8380 574 921 gene locus_tag LOCUS_8390 574 921 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_8390 971 1044 gene locus_tag LOCUS_t0240 971 1044 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1447 1166 gene locus_tag LOCUS_8400 1447 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8400 2027 1467 gene locus_tag LOCUS_8410 2027 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8410 2585 2193 gene locus_tag LOCUS_8420 2585 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8420 >Feature sequence102 1608 508 gene locus_tag LOCUS_8430 1608 508 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250190.1 protein_id gnl|my_center|LOCUS_8430 >Feature sequence103 857 186 gene locus_tag LOCUS_8440 857 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8440 1058 1531 gene locus_tag LOCUS_8450 1058 1531 CDS product TIGR00270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496550.1 protein_id gnl|my_center|LOCUS_8450 1534 2619 gene locus_tag LOCUS_8460 1534 2619 CDS product mechanosensitive ion channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_8460 >Feature sequence104 567 13 gene locus_tag LOCUS_8470 567 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8470 1472 570 gene locus_tag LOCUS_8480 1472 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8480 <2702 1544 gene locus_tag LOCUS_8490 <2702 1544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81B71:histidine--tRNA ligase 1 >Feature sequence105 <1 531 gene locus_tag LOCUS_8500 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976897.1:ABC transporter ATP-binding protein 562 915 gene locus_tag LOCUS_8510 562 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8510 954 1235 gene locus_tag LOCUS_8520 954 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8520 1245 2651 gene locus_tag LOCUS_8530 1245 2651 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I133 protein_id gnl|my_center|LOCUS_8530 >Feature sequence106 1945 749 gene locus_tag LOCUS_8540 gene yknZ 1945 749 CDS product putative ABC transporter permease YknZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31712 protein_id gnl|my_center|LOCUS_8540 <2534 1980 gene locus_tag LOCUS_8550 <2534 1980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496851.1:ABC transporter permease >Feature sequence107 902 1312 gene locus_tag LOCUS_8560 902 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8560 1315 2355 gene locus_tag LOCUS_8570 1315 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8570 >Feature sequence108 169 288 gene locus_tag LOCUS_8580 169 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8580 294 1079 gene locus_tag LOCUS_8590 294 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8590 1489 1073 gene locus_tag LOCUS_8600 1489 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8600 2423 1617 gene locus_tag LOCUS_8610 2423 1617 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902472.1 protein_id gnl|my_center|LOCUS_8610 >Feature sequence109 >Feature sequence110 550 272 gene locus_tag LOCUS_8620 550 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8620 1165 638 gene locus_tag LOCUS_8630 1165 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8630 1436 1170 gene locus_tag LOCUS_8640 1436 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8640 1964 1503 gene locus_tag LOCUS_8650 1964 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8650 2042 2314 gene locus_tag LOCUS_8660 2042 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8660 >Feature sequence111 193 996 gene locus_tag LOCUS_8670 193 996 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_8670 1637 1221 gene locus_tag LOCUS_8680 1637 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8680 2159 1692 gene locus_tag LOCUS_8690 2159 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8690 >Feature sequence112 <1 1007 gene locus_tag LOCUS_8700 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763529.1:UDP-glucose 4-epimerase >Feature sequence113 <1 699 gene locus_tag LOCUS_8710 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496710.1:DNA-directed RNA polymerase subunit B'' >Feature sequence114 237 725 gene locus_tag LOCUS_8720 237 725 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_8720 722 934 gene locus_tag LOCUS_8730 722 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8730 979 2001 gene locus_tag LOCUS_8740 979 2001 CDS product mRNA surveillance protein Pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061107.1 protein_id gnl|my_center|LOCUS_8740 2049 2306 gene locus_tag LOCUS_8750 2049 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8750 >Feature sequence115 606 1316 gene locus_tag LOCUS_8760 gene psmA 606 1316 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_8760 1383 1949 gene locus_tag LOCUS_8770 1383 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8770 >Feature sequence116 1010 375 gene locus_tag LOCUS_8780 1010 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8780 >Feature sequence117 >Feature sequence118 463 83 gene locus_tag LOCUS_8790 463 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8790 949 473 gene locus_tag LOCUS_8800 949 473 CDS product ribonuclease VapC4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870837.1 protein_id gnl|my_center|LOCUS_8800 >Feature sequence119 >Feature sequence120 1196 174 gene locus_tag LOCUS_8810 1196 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8810 1456 1193 gene locus_tag LOCUS_8820 1456 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8820 >Feature sequence121 1813 599 gene locus_tag LOCUS_8830 1813 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8830 >Feature sequence122 448 918 gene locus_tag LOCUS_8840 448 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8840 980 1630 gene locus_tag LOCUS_8850 980 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8850 >Feature sequence123 <1 515 gene locus_tag LOCUS_8860 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868855.1:triose-phosphate isomerase 576 1025 gene locus_tag LOCUS_8870 576 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8870 >Feature sequence124 <1846 1132 gene locus_tag LOCUS_8880 <1846 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2T0:transport permease protein >Feature sequence125 <1 965 gene locus_tag LOCUS_8890 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064680.1:V-type ATP synthase subunit B 973 1605 gene locus_tag LOCUS_8900 973 1605 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065914.1 protein_id gnl|my_center|LOCUS_8900 >Feature sequence126 >Feature sequence127 841 1509 gene locus_tag LOCUS_8910 gene nth 841 1509 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG97 protein_id gnl|my_center|LOCUS_8910 >Feature sequence128 387 1139 gene locus_tag LOCUS_8920 387 1139 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_8920 >Feature sequence129 276 76 gene locus_tag LOCUS_8930 276 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8930 >Feature sequence130 >Feature sequence131 56 232 gene locus_tag LOCUS_8940 56 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8940 1172 333 gene locus_tag LOCUS_8950 1172 333 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_8950 >Feature sequence132 672 1004 gene locus_tag LOCUS_8960 672 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8960 1579 1010 gene locus_tag LOCUS_8970 1579 1010 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871100.1 protein_id gnl|my_center|LOCUS_8970 >Feature sequence133 1135 338 gene locus_tag LOCUS_8980 gene cysQ 1135 338 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070587.1 protein_id gnl|my_center|LOCUS_8980 >Feature sequence134 733 554 gene locus_tag LOCUS_8990 733 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8990 >Feature sequence135 >Feature sequence136