>Feature sequence001 <1 1443 gene locus_tag LOCUS_00010 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929798.1:1-pyrroline-5-carboxylate dehydrogenase 1571 3100 gene locus_tag LOCUS_00020 1571 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3918 3103 gene locus_tag LOCUS_00030 3918 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4011 4790 gene locus_tag LOCUS_00040 4011 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6094 4748 gene locus_tag LOCUS_00050 6094 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7005 6106 gene locus_tag LOCUS_00060 7005 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7930 7007 gene locus_tag LOCUS_00070 7930 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8088 12401 gene locus_tag LOCUS_00080 8088 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 12406 13377 gene locus_tag LOCUS_00090 12406 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14159 13374 gene locus_tag LOCUS_00100 gene aroD 14159 13374 CDS product 3-dehydroquinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_00100 14353 16323 gene locus_tag LOCUS_00110 gene gyrB 14353 16323 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05652 protein_id gnl|my_center|LOCUS_00110 16313 19048 gene locus_tag LOCUS_00120 gene gyrA 16313 19048 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TL9 protein_id gnl|my_center|LOCUS_00120 19101 20357 gene locus_tag LOCUS_00130 19101 20357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21710 20361 gene locus_tag LOCUS_00140 21710 20361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21820 22290 gene locus_tag LOCUS_00150 21820 22290 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_00150 22309 22836 gene locus_tag LOCUS_00160 22309 22836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23526 22840 gene locus_tag LOCUS_00170 23526 22840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23654 26203 gene locus_tag LOCUS_00180 23654 26203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 26239 26790 gene locus_tag LOCUS_00190 26239 26790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26928 28577 gene locus_tag LOCUS_00200 26928 28577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28578 29498 gene locus_tag LOCUS_00210 28578 29498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29568 29909 gene locus_tag LOCUS_00220 29568 29909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 29922 30497 gene locus_tag LOCUS_00230 29922 30497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 30500 31228 gene locus_tag LOCUS_00240 30500 31228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 31246 32490 gene locus_tag LOCUS_00250 31246 32490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33282 32491 gene locus_tag LOCUS_00260 33282 32491 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_00260 35165 33279 gene locus_tag LOCUS_00270 35165 33279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 35307 35945 gene locus_tag LOCUS_00280 35307 35945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 36947 35940 gene locus_tag LOCUS_00290 36947 35940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 37101 38006 gene locus_tag LOCUS_00300 gene ispB 37101 38006 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_00300 38015 39112 gene locus_tag LOCUS_00310 38015 39112 CDS product bacteriochlorophyll synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_00310 39193 39507 gene locus_tag LOCUS_00320 39193 39507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 39548 41659 gene locus_tag LOCUS_00330 39548 41659 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024041.1 protein_id gnl|my_center|LOCUS_00330 41708 42013 gene locus_tag LOCUS_00340 41708 42013 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173338.1 protein_id gnl|my_center|LOCUS_00340 42046 42609 gene locus_tag LOCUS_00350 42046 42609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 42620 43687 gene locus_tag LOCUS_00360 42620 43687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 43697 43996 gene locus_tag LOCUS_00370 43697 43996 CDS product ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_00370 43987 45762 gene locus_tag LOCUS_00380 43987 45762 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_00380 45776 47155 gene locus_tag LOCUS_00390 45776 47155 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_00390 47174 47791 gene locus_tag LOCUS_00400 47174 47791 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065914.1 protein_id gnl|my_center|LOCUS_00400 47846 50344 gene locus_tag LOCUS_00410 47846 50344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50341 51303 gene locus_tag LOCUS_00420 50341 51303 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_00420 52954 51293 gene locus_tag LOCUS_00430 gene nadB 52954 51293 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEX1 protein_id gnl|my_center|LOCUS_00430 53035 53865 gene locus_tag LOCUS_00440 53035 53865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54001 57912 gene locus_tag LOCUS_00450 54001 57912 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_00450 57927 58946 gene locus_tag LOCUS_00460 57927 58946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58936 59529 gene locus_tag LOCUS_00470 58936 59529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 59578 60207 gene locus_tag LOCUS_00480 59578 60207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 61511 60210 gene locus_tag LOCUS_00490 61511 60210 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_00490 61755 63395 gene locus_tag LOCUS_00500 61755 63395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 63406 64401 gene locus_tag LOCUS_00510 63406 64401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 64394 64696 gene locus_tag LOCUS_00520 64394 64696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_00520 65057 64698 gene locus_tag LOCUS_00530 65057 64698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 66020 65079 gene locus_tag LOCUS_00540 66020 65079 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_00540 66825 66343 gene locus_tag LOCUS_00550 66825 66343 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_00550 68073 66886 gene locus_tag LOCUS_00560 68073 66886 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978448.1 protein_id gnl|my_center|LOCUS_00560 69254 68148 gene locus_tag LOCUS_00570 69254 68148 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_00570 69826 69263 gene locus_tag LOCUS_00580 69826 69263 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_00580 70387 69848 gene locus_tag LOCUS_00590 70387 69848 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_00590 70507 71781 gene locus_tag LOCUS_00600 70507 71781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 71851 74517 gene locus_tag LOCUS_00610 71851 74517 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020572.1 protein_id gnl|my_center|LOCUS_00610 74520 76439 gene locus_tag LOCUS_00620 74520 76439 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_00620 77779 76436 gene locus_tag LOCUS_00630 gene aroA 77779 76436 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81C45 protein_id gnl|my_center|LOCUS_00630 77956 78867 gene locus_tag LOCUS_00640 gene moaA 77956 78867 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNE6 protein_id gnl|my_center|LOCUS_00640 79401 78868 gene locus_tag LOCUS_00650 79401 78868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 80225 79416 gene locus_tag LOCUS_00660 80225 79416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 80822 80238 gene locus_tag LOCUS_00670 80822 80238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 81595 80834 gene locus_tag LOCUS_00680 81595 80834 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_00680 82675 81641 gene locus_tag LOCUS_00690 82675 81641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 82889 85987 gene locus_tag LOCUS_00700 82889 85987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 86950 86009 gene locus_tag LOCUS_00710 86950 86009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 89259 86968 gene locus_tag LOCUS_00720 89259 86968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 89404 89319 gene locus_tag LOCUS_t00010 89404 89319 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 90464 89460 gene locus_tag LOCUS_00730 gene ctaB 90464 89460 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5F9 protein_id gnl|my_center|LOCUS_00730 91537 90479 gene locus_tag LOCUS_00740 91537 90479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 91616 91894 gene locus_tag LOCUS_00750 91616 91894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 93003 91891 gene locus_tag LOCUS_00760 93003 91891 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_00760 93145 93789 gene locus_tag LOCUS_00770 93145 93789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence002 4673 3696 gene locus_tag LOCUS_00780 4673 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 5011 4715 gene locus_tag LOCUS_00790 5011 4715 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012981234.1 protein_id gnl|my_center|LOCUS_00790 6581 5025 gene locus_tag LOCUS_00800 6581 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 9817 6581 gene locus_tag LOCUS_00810 9817 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 13473 9814 gene locus_tag LOCUS_00820 13473 9814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14111 13491 gene locus_tag LOCUS_00830 14111 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 14235 14161 gene locus_tag LOCUS_t00020 14235 14161 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14346 15827 gene locus_tag LOCUS_00840 14346 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 16058 15816 gene locus_tag LOCUS_00850 16058 15816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 16394 16077 gene locus_tag LOCUS_00860 16394 16077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 16450 17604 gene locus_tag LOCUS_00870 16450 17604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 18519 17599 gene locus_tag LOCUS_00880 18519 17599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 18836 18534 gene locus_tag LOCUS_00890 18836 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 18979 19809 gene locus_tag LOCUS_00900 18979 19809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 19809 20270 gene locus_tag LOCUS_00910 19809 20270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 20279 21121 gene locus_tag LOCUS_00920 20279 21121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 21131 22003 gene locus_tag LOCUS_00930 21131 22003 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902392.1 protein_id gnl|my_center|LOCUS_00930 22016 24766 gene locus_tag LOCUS_00940 22016 24766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 24792 25124 gene locus_tag LOCUS_00950 24792 25124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 25130 25408 gene locus_tag LOCUS_00960 25130 25408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 26602 25418 gene locus_tag LOCUS_00970 26602 25418 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_00970 28452 26611 gene locus_tag LOCUS_00980 gene asnB 28452 26611 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942597.1 protein_id gnl|my_center|LOCUS_00980 29296 28661 gene locus_tag LOCUS_00990 29296 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769002.1 protein_id gnl|my_center|LOCUS_00990 30170 29298 gene locus_tag LOCUS_01000 30170 29298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 30632 30183 gene locus_tag LOCUS_01010 30632 30183 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_01010 30766 30611 gene locus_tag LOCUS_01020 30766 30611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 30726 32303 gene locus_tag LOCUS_01030 30726 32303 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_01030 32313 32498 gene locus_tag LOCUS_01040 32313 32498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 32539 32904 gene locus_tag LOCUS_01050 32539 32904 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_01050 32888 33181 gene locus_tag LOCUS_01060 32888 33181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 33202 33714 gene locus_tag LOCUS_01070 33202 33714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 35107 33755 gene locus_tag LOCUS_01080 gene gdhA 35107 33755 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVJ7 protein_id gnl|my_center|LOCUS_01080 35575 35174 gene locus_tag LOCUS_01090 35575 35174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 35869 36243 gene locus_tag LOCUS_01100 35869 36243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 36259 36450 gene locus_tag LOCUS_01110 36259 36450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 36512 38455 gene locus_tag LOCUS_01120 36512 38455 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930732.1 protein_id gnl|my_center|LOCUS_01120 38490 38963 gene locus_tag LOCUS_01130 38490 38963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 47932 38960 gene locus_tag LOCUS_01140 47932 38960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 50982 48019 gene locus_tag LOCUS_01150 50982 48019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 51110 51193 gene locus_tag LOCUS_t00030 51110 51193 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence003 323 718 gene locus_tag LOCUS_01160 323 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 1450 704 gene locus_tag LOCUS_01170 gene smuG1 1450 704 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_01170 1510 1950 gene locus_tag LOCUS_01180 1510 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3715 1979 gene locus_tag LOCUS_01190 3715 1979 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_01190 5073 3718 gene locus_tag LOCUS_01200 5073 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 5805 5107 gene locus_tag LOCUS_01210 5805 5107 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_01210 6052 5813 gene locus_tag LOCUS_01220 6052 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 6976 6101 gene locus_tag LOCUS_01230 6976 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 7081 7674 gene locus_tag LOCUS_01240 7081 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 8750 7671 gene locus_tag LOCUS_01250 8750 7671 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_01250 9847 8756 gene locus_tag LOCUS_01260 9847 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 9971 10990 gene locus_tag LOCUS_01270 9971 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 11051 15985 gene locus_tag LOCUS_01280 11051 15985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 15991 17205 gene locus_tag LOCUS_01290 15991 17205 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_01290 17207 19054 gene locus_tag LOCUS_01300 gene glmS 17207 19054 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MN6 protein_id gnl|my_center|LOCUS_01300 19765 19055 gene locus_tag LOCUS_01310 19765 19055 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877858.1 protein_id gnl|my_center|LOCUS_01310 19878 20579 gene locus_tag LOCUS_01320 19878 20579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 21089 20559 gene locus_tag LOCUS_01330 21089 20559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 24826 21188 gene locus_tag LOCUS_01340 24826 21188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 25593 24958 gene locus_tag LOCUS_01350 25593 24958 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903666.1 protein_id gnl|my_center|LOCUS_01350 26542 25661 gene locus_tag LOCUS_01360 26542 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 26742 28721 gene locus_tag LOCUS_01370 26742 28721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_01370 29896 28718 gene locus_tag LOCUS_01380 gene caiA 29896 28718 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_01380 32385 29893 gene locus_tag LOCUS_01390 32385 29893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 33015 32488 gene locus_tag LOCUS_01400 33015 32488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 34046 33066 gene locus_tag LOCUS_01410 34046 33066 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_01410 34177 35676 gene locus_tag LOCUS_01420 gene cysS 34177 35676 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72BQ5 protein_id gnl|my_center|LOCUS_01420 38503 35678 gene locus_tag LOCUS_01430 38503 35678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 39983 38559 gene locus_tag LOCUS_01440 39983 38559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 41544 40081 gene locus_tag LOCUS_01450 41544 40081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 41656 43437 gene locus_tag LOCUS_01460 gene pepX 41656 43437 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227798.1 protein_id gnl|my_center|LOCUS_01460 43459 44889 gene locus_tag LOCUS_01470 43459 44889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 45200 44949 gene locus_tag LOCUS_01480 45200 44949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 >Feature sequence004 1227 2510 gene locus_tag LOCUS_01490 1227 2510 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_01490 2520 2870 gene locus_tag LOCUS_01500 gene arsC 2520 2870 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_01500 2936 4336 gene locus_tag LOCUS_01510 2936 4336 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527142.1 protein_id gnl|my_center|LOCUS_01510 4371 5606 gene locus_tag LOCUS_01520 4371 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5672 6952 gene locus_tag LOCUS_01530 gene tuf 5672 6952 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_01530 6983 7312 gene locus_tag LOCUS_01540 6983 7312 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_01540 8184 7309 gene locus_tag LOCUS_01550 8184 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 8292 8375 gene locus_tag LOCUS_t00040 8292 8375 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8490 11504 gene locus_tag LOCUS_01560 8490 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 11551 12039 gene locus_tag LOCUS_01570 11551 12039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 12051 12464 gene locus_tag LOCUS_01580 12051 12464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 12574 15087 gene locus_tag LOCUS_01590 12574 15087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 15147 17555 gene locus_tag LOCUS_01600 15147 17555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 17813 17559 gene locus_tag LOCUS_01610 17813 17559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 18069 17824 gene locus_tag LOCUS_01620 18069 17824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 19114 18161 gene locus_tag LOCUS_01630 gene parA 19114 18161 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_01630 20146 19142 gene locus_tag LOCUS_01640 20146 19142 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_01640 22149 20230 gene locus_tag LOCUS_01650 22149 20230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 22629 22177 gene locus_tag LOCUS_01660 gene ndk 22629 22177 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEG3 protein_id gnl|my_center|LOCUS_01660 22783 22652 gene locus_tag LOCUS_01670 22783 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 23066 22845 gene locus_tag LOCUS_01680 23066 22845 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_01680 23448 23077 gene locus_tag LOCUS_01690 23448 23077 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870715.1 protein_id gnl|my_center|LOCUS_01690 24448 23519 gene locus_tag LOCUS_01700 24448 23519 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_01700 24617 24543 gene locus_tag LOCUS_t00050 24617 24543 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 24700 25473 gene locus_tag LOCUS_01710 24700 25473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 26077 25475 gene locus_tag LOCUS_01720 26077 25475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 26461 27942 gene locus_tag LOCUS_01730 26461 27942 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_01730 28012 29388 gene locus_tag LOCUS_01740 28012 29388 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118348.1 protein_id gnl|my_center|LOCUS_01740 29390 29854 gene locus_tag LOCUS_01750 29390 29854 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_01750 29851 30564 gene locus_tag LOCUS_01760 29851 30564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 30622 30906 gene locus_tag LOCUS_01770 30622 30906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 31974 30907 gene locus_tag LOCUS_01780 31974 30907 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_01780 32644 32009 gene locus_tag LOCUS_01790 32644 32009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 32827 35541 gene locus_tag LOCUS_01800 32827 35541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 35592 36593 gene locus_tag LOCUS_01810 35592 36593 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_01810 37581 36586 gene locus_tag LOCUS_01820 37581 36586 CDS product manganese ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494347.1 protein_id gnl|my_center|LOCUS_01820 38420 37578 gene locus_tag LOCUS_01830 38420 37578 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_01830 <39807 38484 gene locus_tag LOCUS_01840 <39807 38484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458890.1:ABC transporter substrate-binding protein >Feature sequence005 380 1312 gene locus_tag LOCUS_01850 380 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 1384 1656 gene locus_tag LOCUS_01860 1384 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 2254 1661 gene locus_tag LOCUS_01870 2254 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 2976 2251 gene locus_tag LOCUS_01880 2976 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3931 2978 gene locus_tag LOCUS_01890 3931 2978 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_01890 4046 4972 gene locus_tag LOCUS_01900 4046 4972 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_01900 5025 7892 gene locus_tag LOCUS_01910 5025 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 13367 8256 gene locus_tag LOCUS_01920 13367 8256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 13465 14157 gene locus_tag LOCUS_01930 gene rpiA 13465 14157 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHU6 protein_id gnl|my_center|LOCUS_01930 14235 14160 gene locus_tag LOCUS_t00060 14235 14160 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 15220 14264 gene locus_tag LOCUS_01940 15220 14264 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGN0 protein_id gnl|my_center|LOCUS_01940 15353 16684 gene locus_tag LOCUS_01950 15353 16684 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_01950 17432 16686 gene locus_tag LOCUS_01960 17432 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 18212 17442 gene locus_tag LOCUS_01970 18212 17442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 18310 19305 gene locus_tag LOCUS_01980 18310 19305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 19369 19740 gene locus_tag LOCUS_01990 19369 19740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 20330 19758 gene locus_tag LOCUS_02000 20330 19758 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214821.1 protein_id gnl|my_center|LOCUS_02000 20669 20337 gene locus_tag LOCUS_02010 20669 20337 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_02010 21123 20671 gene locus_tag LOCUS_02020 21123 20671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 21235 22359 gene locus_tag LOCUS_02030 21235 22359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_02030 22895 22356 gene locus_tag LOCUS_02040 22895 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 23233 22913 gene locus_tag LOCUS_02050 23233 22913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 23946 23233 gene locus_tag LOCUS_02060 23946 23233 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_02060 24087 25334 gene locus_tag LOCUS_02070 24087 25334 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_02070 25340 27094 gene locus_tag LOCUS_02080 25340 27094 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878394.1 protein_id gnl|my_center|LOCUS_02080 27605 27087 gene locus_tag LOCUS_02090 27605 27087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 29323 27608 gene locus_tag LOCUS_02100 gene lap 29323 27608 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZQ8 protein_id gnl|my_center|LOCUS_02100 29961 29392 gene locus_tag LOCUS_02110 29961 29392 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_02110 30083 30373 gene locus_tag LOCUS_02120 30083 30373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 30455 30382 gene locus_tag LOCUS_t00070 30455 30382 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30931 30482 gene locus_tag LOCUS_02130 30931 30482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 31606 30941 gene locus_tag LOCUS_02140 31606 30941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 31788 31970 gene locus_tag LOCUS_02150 31788 31970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 33905 31971 gene locus_tag LOCUS_02160 33905 31971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_02160 34572 33943 gene locus_tag LOCUS_02170 34572 33943 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_02170 34729 35229 gene locus_tag LOCUS_02180 34729 35229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 35240 35797 gene locus_tag LOCUS_02190 35240 35797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870034.1 protein_id gnl|my_center|LOCUS_02190 36166 35789 gene locus_tag LOCUS_02200 36166 35789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 37117 36230 gene locus_tag LOCUS_02210 37117 36230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence006 2446 554 gene locus_tag LOCUS_02220 2446 554 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CB2 protein_id gnl|my_center|LOCUS_02220 3768 2491 gene locus_tag LOCUS_02230 3768 2491 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_02230 3862 4623 gene locus_tag LOCUS_02240 3862 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4702 7146 gene locus_tag LOCUS_02250 4702 7146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 7176 8066 gene locus_tag LOCUS_02260 7176 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 12859 8063 gene locus_tag LOCUS_02270 12859 8063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 15075 12919 gene locus_tag LOCUS_02280 15075 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 15152 16876 gene locus_tag LOCUS_02290 gene uvrC 15152 16876 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F479 protein_id gnl|my_center|LOCUS_02290 19917 16873 gene locus_tag LOCUS_02300 19917 16873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 19997 20926 gene locus_tag LOCUS_02310 19997 20926 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_02310 21587 20919 gene locus_tag LOCUS_02320 21587 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 21661 23508 gene locus_tag LOCUS_02330 gene pepX 21661 23508 CDS product Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HHN4 protein_id gnl|my_center|LOCUS_02330 23514 23870 gene locus_tag LOCUS_02340 23514 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 23936 24625 gene locus_tag LOCUS_02350 23936 24625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 25327 24626 gene locus_tag LOCUS_02360 25327 24626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 25403 26101 gene locus_tag LOCUS_02370 25403 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 26693 26085 gene locus_tag LOCUS_02380 gene gpmA 26693 26085 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92T25 protein_id gnl|my_center|LOCUS_02380 27520 26726 gene locus_tag LOCUS_02390 27520 26726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 27502 27957 gene locus_tag LOCUS_02400 27502 27957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 28826 27954 gene locus_tag LOCUS_02410 28826 27954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 29438 29019 gene locus_tag LOCUS_02420 29438 29019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_02420 29533 30555 gene locus_tag LOCUS_02430 29533 30555 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250622.1 protein_id gnl|my_center|LOCUS_02430 31915 30557 gene locus_tag LOCUS_02440 31915 30557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 33089 31926 gene locus_tag LOCUS_02450 33089 31926 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868366.1 protein_id gnl|my_center|LOCUS_02450 33326 33135 gene locus_tag LOCUS_02460 33326 33135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 33419 35479 gene locus_tag LOCUS_02470 33419 35479 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877531.1 protein_id gnl|my_center|LOCUS_02470 35539 35994 gene locus_tag LOCUS_02480 35539 35994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 36050 36751 gene locus_tag LOCUS_02490 36050 36751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 >Feature sequence007 1536 490 gene locus_tag LOCUS_02500 1536 490 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755922.1 protein_id gnl|my_center|LOCUS_02500 1619 3748 gene locus_tag LOCUS_02510 1619 3748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3769 4500 gene locus_tag LOCUS_02520 3769 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_02520 5472 4558 gene locus_tag LOCUS_02530 5472 4558 CDS product phosphonate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000761.1 protein_id gnl|my_center|LOCUS_02530 6305 5475 gene locus_tag LOCUS_02540 6305 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8456 6372 gene locus_tag LOCUS_02550 8456 6372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8585 9550 gene locus_tag LOCUS_02560 8585 9550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 9543 10505 gene locus_tag LOCUS_02570 9543 10505 CDS product glucosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533625.1 protein_id gnl|my_center|LOCUS_02570 11188 10511 gene locus_tag LOCUS_02580 11188 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 protein_id gnl|my_center|LOCUS_02580 12381 11185 gene locus_tag LOCUS_02590 12381 11185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 12435 13577 gene locus_tag LOCUS_02600 gene rffA 12435 13577 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z393 protein_id gnl|my_center|LOCUS_02600 14043 13543 gene locus_tag LOCUS_02610 14043 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 14100 14891 gene locus_tag LOCUS_02620 14100 14891 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022168.1 protein_id gnl|my_center|LOCUS_02620 14875 15918 gene locus_tag LOCUS_02630 gene rfbB 14875 15918 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CB9 protein_id gnl|my_center|LOCUS_02630 16196 15915 gene locus_tag LOCUS_02640 16196 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 17743 16295 gene locus_tag LOCUS_02650 17743 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 17890 19491 gene locus_tag LOCUS_02660 17890 19491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 20708 19488 gene locus_tag LOCUS_02670 20708 19488 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227717.1 protein_id gnl|my_center|LOCUS_02670 20774 21523 gene locus_tag LOCUS_02680 20774 21523 CDS product UPF0721 transmembrane protein y4hK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55478 protein_id gnl|my_center|LOCUS_02680 22249 21869 gene locus_tag LOCUS_02690 22249 21869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 22648 22433 gene locus_tag LOCUS_02700 22648 22433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 23768 22563 gene locus_tag LOCUS_02710 23768 22563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 24295 23771 gene locus_tag LOCUS_02720 24295 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 24420 26006 gene locus_tag LOCUS_02730 24420 26006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 27310 26003 gene locus_tag LOCUS_02740 27310 26003 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_02740 27566 27772 gene locus_tag LOCUS_02750 27566 27772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 27765 28481 gene locus_tag LOCUS_02760 27765 28481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 28711 29313 gene locus_tag LOCUS_02770 28711 29313 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_02770 29316 29552 gene locus_tag LOCUS_02780 29316 29552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 29811 29566 gene locus_tag LOCUS_02790 29811 29566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 31028 29817 gene locus_tag LOCUS_02800 31028 29817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 32829 31111 gene locus_tag LOCUS_02810 32829 31111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 33152 32874 gene locus_tag LOCUS_02820 33152 32874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 33233 33958 gene locus_tag LOCUS_02830 33233 33958 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000205380.1 protein_id gnl|my_center|LOCUS_02830 34008 34577 gene locus_tag LOCUS_02840 34008 34577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 34955 34578 gene locus_tag LOCUS_02850 34955 34578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 35393 36670 gene locus_tag LOCUS_02860 35393 36670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 36788 36663 gene locus_tag LOCUS_02870 36788 36663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 >Feature sequence008 310 1152 gene locus_tag LOCUS_02880 310 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1202 1402 gene locus_tag LOCUS_02890 1202 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 1777 1403 gene locus_tag LOCUS_02900 1777 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3090 1861 gene locus_tag LOCUS_02910 3090 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 3023 3289 gene locus_tag LOCUS_02920 3023 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3316 4959 gene locus_tag LOCUS_02930 3316 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 4956 6200 gene locus_tag LOCUS_02940 4956 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6274 6732 gene locus_tag LOCUS_02950 6274 6732 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_02950 7156 6722 gene locus_tag LOCUS_02960 7156 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876523.1 protein_id gnl|my_center|LOCUS_02960 7172 8008 gene locus_tag LOCUS_02970 gene coxII 7172 8008 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5G0 protein_id gnl|my_center|LOCUS_02970 8019 10328 gene locus_tag LOCUS_02980 8019 10328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 10325 11320 gene locus_tag LOCUS_02990 10325 11320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11333 11704 gene locus_tag LOCUS_03000 11333 11704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 11736 13256 gene locus_tag LOCUS_03010 11736 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 13303 14634 gene locus_tag LOCUS_03020 13303 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14654 15355 gene locus_tag LOCUS_03030 14654 15355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 15325 15552 gene locus_tag LOCUS_03040 15325 15552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 15554 16615 gene locus_tag LOCUS_03050 15554 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 16689 21818 gene locus_tag LOCUS_03060 16689 21818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 21871 24069 gene locus_tag LOCUS_03070 21871 24069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 24116 24475 gene locus_tag LOCUS_03080 24116 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113301.1 protein_id gnl|my_center|LOCUS_03080 24849 24487 gene locus_tag LOCUS_03090 24849 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_03090 24980 24898 gene locus_tag LOCUS_t00080 24980 24898 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25067 26578 gene locus_tag LOCUS_03100 25067 26578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 27600 26575 gene locus_tag LOCUS_03110 27600 26575 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729742.1 protein_id gnl|my_center|LOCUS_03110 27691 28812 gene locus_tag LOCUS_03120 gene ribD 27691 28812 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_03120 28863 29285 gene locus_tag LOCUS_03130 28863 29285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 29330 30028 gene locus_tag LOCUS_03140 29330 30028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 30074 31270 gene locus_tag LOCUS_03150 gene cefD 30074 31270 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_03150 31345 31271 gene locus_tag LOCUS_t00090 31345 31271 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32547 31405 gene locus_tag LOCUS_03160 32547 31405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 32623 34170 gene locus_tag LOCUS_03170 32623 34170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 34179 34424 gene locus_tag LOCUS_03180 34179 34424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence009 1014 142 gene locus_tag LOCUS_03190 1014 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 1444 1055 gene locus_tag LOCUS_03200 gene msrB 1444 1055 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B11 protein_id gnl|my_center|LOCUS_03200 2101 1457 gene locus_tag LOCUS_03210 2101 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 2175 2639 gene locus_tag LOCUS_03220 2175 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120443.1 protein_id gnl|my_center|LOCUS_03220 2642 3061 gene locus_tag LOCUS_03230 2642 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3100 3438 gene locus_tag LOCUS_03240 3100 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 3460 3696 gene locus_tag LOCUS_03250 3460 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 3711 4367 gene locus_tag LOCUS_03260 3711 4367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 4376 5902 gene locus_tag LOCUS_03270 4376 5902 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_03270 5916 6377 gene locus_tag LOCUS_03280 5916 6377 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_03280 6386 6640 gene locus_tag LOCUS_03290 6386 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9034 6641 gene locus_tag LOCUS_03300 gene nrdA 9034 6641 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_03300 10264 9242 gene locus_tag LOCUS_03310 gene nrdB 10264 9242 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_03310 10425 11459 gene locus_tag LOCUS_03320 gene fadB5 10425 11459 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_03320 11880 11470 gene locus_tag LOCUS_03330 11880 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 11966 12565 gene locus_tag LOCUS_03340 11966 12565 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877893.1 protein_id gnl|my_center|LOCUS_03340 12566 14173 gene locus_tag LOCUS_03350 gene lysS 12566 14173 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E175 protein_id gnl|my_center|LOCUS_03350 14246 15493 gene locus_tag LOCUS_03360 14246 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 18906 15490 gene locus_tag LOCUS_03370 18906 15490 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_03370 20212 18890 gene locus_tag LOCUS_03380 gene carA 20212 18890 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FT2 protein_id gnl|my_center|LOCUS_03380 20849 20274 gene locus_tag LOCUS_03390 20849 20274 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_03390 21512 20865 gene locus_tag LOCUS_03400 21512 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 21606 22439 gene locus_tag LOCUS_03410 21606 22439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 22448 23617 gene locus_tag LOCUS_03420 22448 23617 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877838.1 protein_id gnl|my_center|LOCUS_03420 23668 24903 gene locus_tag LOCUS_03430 23668 24903 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459846.1 protein_id gnl|my_center|LOCUS_03430 26289 25660 gene locus_tag LOCUS_03440 gene lipB 26289 25660 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC91 protein_id gnl|my_center|LOCUS_03440 27732 26299 gene locus_tag LOCUS_03450 gene lpdA2 27732 26299 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3M924 protein_id gnl|my_center|LOCUS_03450 28974 27742 gene locus_tag LOCUS_03460 gene bkdB 28974 27742 CDS product lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M0 protein_id gnl|my_center|LOCUS_03460 29988 28978 gene locus_tag LOCUS_03470 29988 28978 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067042.1 protein_id gnl|my_center|LOCUS_03470 31228 29993 gene locus_tag LOCUS_03480 gene bkdA1 31228 29993 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 protein_id gnl|my_center|LOCUS_03480 32281 31244 gene locus_tag LOCUS_03490 gene lipA 32281 31244 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_03490 32382 33140 gene locus_tag LOCUS_03500 32382 33140 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_03500 33209 34384 gene locus_tag LOCUS_03510 33209 34384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 34509 34754 gene locus_tag LOCUS_03520 34509 34754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence010 824 2062 gene locus_tag LOCUS_03530 824 2062 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_03530 2099 2656 gene locus_tag LOCUS_03540 2099 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3699 2653 gene locus_tag LOCUS_03550 3699 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6658 4055 gene locus_tag LOCUS_03560 6658 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 6921 7232 gene locus_tag LOCUS_03570 6921 7232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 7691 7242 gene locus_tag LOCUS_03580 gene ykhA 7691 7242 CDS product putative acyl-CoA thioester hydrolase YkhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49851 protein_id gnl|my_center|LOCUS_03580 7772 8596 gene locus_tag LOCUS_03590 7772 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 8593 9147 gene locus_tag LOCUS_03600 8593 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 9151 10050 gene locus_tag LOCUS_03610 9151 10050 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250562.1 protein_id gnl|my_center|LOCUS_03610 10127 10930 gene locus_tag LOCUS_03620 10127 10930 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_03620 10930 19257 gene locus_tag LOCUS_03630 10930 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 19261 20061 gene locus_tag LOCUS_03640 19261 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 20056 19985 gene locus_tag LOCUS_t00100 20056 19985 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 25426 20102 gene locus_tag LOCUS_03650 25426 20102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 25535 27358 gene locus_tag LOCUS_03660 25535 27358 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_03660 27636 27355 gene locus_tag LOCUS_03670 27636 27355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 28736 27678 gene locus_tag LOCUS_03680 28736 27678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 29562 28822 gene locus_tag LOCUS_03690 29562 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 29990 29634 gene locus_tag LOCUS_03700 29990 29634 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_03700 30133 31140 gene locus_tag LOCUS_03710 30133 31140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 31145 31849 gene locus_tag LOCUS_03720 31145 31849 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_03720 32081 31926 gene locus_tag LOCUS_03730 32081 31926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 32269 33165 gene locus_tag LOCUS_03740 32269 33165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence011 2980 4653 gene locus_tag LOCUS_03750 2980 4653 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_03750 4700 6184 gene locus_tag LOCUS_03760 4700 6184 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870398.1 protein_id gnl|my_center|LOCUS_03760 7833 6181 gene locus_tag LOCUS_03770 7833 6181 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878342.1 protein_id gnl|my_center|LOCUS_03770 9245 7836 gene locus_tag LOCUS_03780 9245 7836 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545959.1 protein_id gnl|my_center|LOCUS_03780 10839 9265 gene locus_tag LOCUS_03790 10839 9265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11666 10881 gene locus_tag LOCUS_03800 11666 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 11755 12996 gene locus_tag LOCUS_03810 11755 12996 CDS product arsenic transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870653.1 protein_id gnl|my_center|LOCUS_03810 13010 14380 gene locus_tag LOCUS_03820 13010 14380 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_03820 14389 14976 gene locus_tag LOCUS_03830 14389 14976 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_03830 15836 14973 gene locus_tag LOCUS_03840 gene surE 15836 14973 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC6 protein_id gnl|my_center|LOCUS_03840 16818 15838 gene locus_tag LOCUS_03850 16818 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19192 16811 gene locus_tag LOCUS_03860 gene oliA 19192 16811 CDS product oligopeptide transporter, OPT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_03860 19742 19245 gene locus_tag LOCUS_03870 19742 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 20130 19777 gene locus_tag LOCUS_03880 20130 19777 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876502.1 protein_id gnl|my_center|LOCUS_03880 21301 20231 gene locus_tag LOCUS_03890 21301 20231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22161 21310 gene locus_tag LOCUS_03900 gene hbd 22161 21310 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_03900 22290 22218 gene locus_tag LOCUS_t00110 22290 22218 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22840 22307 gene locus_tag LOCUS_03910 22840 22307 CDS product oxetanocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147114.1 protein_id gnl|my_center|LOCUS_03910 23279 22854 gene locus_tag LOCUS_03920 23279 22854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 24590 23373 gene locus_tag LOCUS_03930 gene ivd 24590 23373 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_03930 25587 24619 gene locus_tag LOCUS_03940 25587 24619 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_03940 25666 26733 gene locus_tag LOCUS_03950 25666 26733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 26768 27193 gene locus_tag LOCUS_03960 26768 27193 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815126.1 protein_id gnl|my_center|LOCUS_03960 28803 27157 gene locus_tag LOCUS_03970 28803 27157 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_03970 29700 28840 gene locus_tag LOCUS_03980 29700 28840 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA23 protein_id gnl|my_center|LOCUS_03980 30242 29727 gene locus_tag LOCUS_03990 30242 29727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 30329 32218 gene locus_tag LOCUS_04000 30329 32218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 32291 32219 gene locus_tag LOCUS_t00120 32291 32219 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 748 434 gene locus_tag LOCUS_04010 gene paaD 748 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395580.1 protein_id gnl|my_center|LOCUS_04010 1169 753 gene locus_tag LOCUS_04020 1169 753 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256843.1 protein_id gnl|my_center|LOCUS_04020 2413 1178 gene locus_tag LOCUS_04030 gene sufS 2413 1178 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32164 protein_id gnl|my_center|LOCUS_04030 3521 2415 gene locus_tag LOCUS_04040 3521 2415 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181161.1 protein_id gnl|my_center|LOCUS_04040 4946 3534 gene locus_tag LOCUS_04050 4946 3534 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_04050 5695 4949 gene locus_tag LOCUS_04060 5695 4949 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783928.1 protein_id gnl|my_center|LOCUS_04060 5910 6377 gene locus_tag LOCUS_04070 5910 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 6405 8474 gene locus_tag LOCUS_04080 6405 8474 CDS product tRNA-guanine(15) transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_04080 8541 9554 gene locus_tag LOCUS_04090 8541 9554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_04090 9554 10588 gene locus_tag LOCUS_04100 9554 10588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 10585 11550 gene locus_tag LOCUS_04110 10585 11550 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_04110 11547 12884 gene locus_tag LOCUS_04120 11547 12884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 12894 14072 gene locus_tag LOCUS_04130 12894 14072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 14148 15125 gene locus_tag LOCUS_04140 14148 15125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 15157 16005 gene locus_tag LOCUS_04150 15157 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 16069 16587 gene locus_tag LOCUS_04160 16069 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 16600 17475 gene locus_tag LOCUS_04170 16600 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 17981 17505 gene locus_tag LOCUS_04180 17981 17505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 18078 19259 gene locus_tag LOCUS_04190 gene kbl 18078 19259 CDS product 8-amino-7-oxononanoate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31777 protein_id gnl|my_center|LOCUS_04190 19916 19245 gene locus_tag LOCUS_04200 19916 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 20584 19913 gene locus_tag LOCUS_04210 20584 19913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 20715 22247 gene locus_tag LOCUS_04220 20715 22247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 22244 23983 gene locus_tag LOCUS_04230 22244 23983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 24001 24477 gene locus_tag LOCUS_04240 24001 24477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 24537 25706 gene locus_tag LOCUS_04250 24537 25706 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_04250 26860 25703 gene locus_tag LOCUS_04260 26860 25703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 26964 28733 gene locus_tag LOCUS_04270 26964 28733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 29527 28736 gene locus_tag LOCUS_04280 29527 28736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 30407 29520 gene locus_tag LOCUS_04290 gene folD2 30407 29520 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MGJ1 protein_id gnl|my_center|LOCUS_04290 30497 30573 gene locus_tag LOCUS_t00130 30497 30573 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30988 30824 gene locus_tag LOCUS_04300 30988 30824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence013 5555 6967 gene locus_tag LOCUS_04310 gene ahcY 5555 6967 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PCH5 protein_id gnl|my_center|LOCUS_04310 7898 6972 gene locus_tag LOCUS_04320 7898 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 8783 7986 gene locus_tag LOCUS_04330 8783 7986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10919 8847 gene locus_tag LOCUS_04340 10919 8847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 11830 10979 gene locus_tag LOCUS_04350 11830 10979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 12855 11827 gene locus_tag LOCUS_04360 12855 11827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12939 13826 gene locus_tag LOCUS_04370 12939 13826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 14459 13800 gene locus_tag LOCUS_04380 14459 13800 CDS product iron repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875853.1 protein_id gnl|my_center|LOCUS_04380 14734 14510 gene locus_tag LOCUS_04390 14734 14510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 15772 14780 gene locus_tag LOCUS_04400 gene gpsA 15772 14780 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_04400 15886 15969 gene locus_tag LOCUS_t00140 15886 15969 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15996 16280 gene locus_tag LOCUS_04410 15996 16280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 17050 16277 gene locus_tag LOCUS_04420 17050 16277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 17249 19594 gene locus_tag LOCUS_04430 17249 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 20183 19602 gene locus_tag LOCUS_04440 gene mogA 20183 19602 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422732.1 protein_id gnl|my_center|LOCUS_04440 21328 20195 gene locus_tag LOCUS_04450 21328 20195 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_04450 21412 22452 gene locus_tag LOCUS_04460 gene pyrC 21412 22452 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87XM1 protein_id gnl|my_center|LOCUS_04460 22555 22857 gene locus_tag LOCUS_04470 22555 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 24388 22898 gene locus_tag LOCUS_04480 24388 22898 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_04480 24494 25561 gene locus_tag LOCUS_04490 24494 25561 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902019.1 protein_id gnl|my_center|LOCUS_04490 26818 25562 gene locus_tag LOCUS_04500 26818 25562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 26920 27558 gene locus_tag LOCUS_04510 26920 27558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 28894 27560 gene locus_tag LOCUS_04520 28894 27560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 <30944 28881 gene locus_tag LOCUS_04530 <30944 28881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA >Feature sequence014 <1 579 gene locus_tag LOCUS_04540 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878057.1:S-adenosylhomocysteine deaminase 1721 576 gene locus_tag LOCUS_04550 1721 576 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_04550 5612 1734 gene locus_tag LOCUS_04560 5612 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 6420 5716 gene locus_tag LOCUS_04570 6420 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 6994 6470 gene locus_tag LOCUS_04580 6994 6470 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_04580 7072 7857 gene locus_tag LOCUS_04590 7072 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 7938 7863 gene locus_tag LOCUS_t00150 7938 7863 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8090 8845 gene locus_tag LOCUS_04600 8090 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 8939 9961 gene locus_tag LOCUS_04610 8939 9961 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_04610 10048 11175 gene locus_tag LOCUS_04620 gene ftsZ 10048 11175 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_04620 11221 12132 gene locus_tag LOCUS_04630 11221 12132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 12129 12584 gene locus_tag LOCUS_04640 12129 12584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12969 12577 gene locus_tag LOCUS_04650 12969 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212298.1 protein_id gnl|my_center|LOCUS_04650 13043 14290 gene locus_tag LOCUS_04660 gene icdA 13043 14290 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X722 protein_id gnl|my_center|LOCUS_04660 15298 14300 gene locus_tag LOCUS_04670 15298 14300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 15387 15782 gene locus_tag LOCUS_04680 15387 15782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 16472 15783 gene locus_tag LOCUS_04690 16472 15783 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973170.1 protein_id gnl|my_center|LOCUS_04690 16767 16513 gene locus_tag LOCUS_04700 16767 16513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 17532 16828 gene locus_tag LOCUS_04710 17532 16828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 17932 17573 gene locus_tag LOCUS_04720 gene rlmH 17932 17573 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCH9 protein_id gnl|my_center|LOCUS_04720 18076 18396 gene locus_tag LOCUS_04730 18076 18396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 18397 19275 gene locus_tag LOCUS_04740 18397 19275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 21547 19238 gene locus_tag LOCUS_04750 gene maeB 21547 19238 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence015 135 1355 gene locus_tag LOCUS_04760 135 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1376 2131 gene locus_tag LOCUS_04770 1376 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 4460 2136 gene locus_tag LOCUS_04780 gene metG 4460 2136 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 protein_id gnl|my_center|LOCUS_04780 4591 5625 gene locus_tag LOCUS_04790 4591 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_04790 6165 5626 gene locus_tag LOCUS_04800 6165 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_04800 6647 6165 gene locus_tag LOCUS_04810 6647 6165 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902735.1 protein_id gnl|my_center|LOCUS_04810 6748 7983 gene locus_tag LOCUS_04820 6748 7983 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_04820 8021 9049 gene locus_tag LOCUS_04830 8021 9049 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XR4 protein_id gnl|my_center|LOCUS_04830 9060 9680 gene locus_tag LOCUS_04840 9060 9680 CDS product methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203598.1 protein_id gnl|my_center|LOCUS_04840 10651 9689 gene locus_tag LOCUS_04850 10651 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 10730 11188 gene locus_tag LOCUS_04860 10730 11188 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_04860 11198 11530 gene locus_tag LOCUS_04870 11198 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 11586 12689 gene locus_tag LOCUS_04880 11586 12689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 13007 12693 gene locus_tag LOCUS_04890 13007 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 15414 13132 gene locus_tag LOCUS_04900 15414 13132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729998.1 protein_id gnl|my_center|LOCUS_04900 16263 15436 gene locus_tag LOCUS_04910 gene fdhD 16263 15436 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D7R9 protein_id gnl|my_center|LOCUS_04910 18311 16269 gene locus_tag LOCUS_04920 18311 16269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 18447 18992 gene locus_tag LOCUS_04930 18447 18992 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_04930 19515 18994 gene locus_tag LOCUS_04940 19515 18994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 19691 19518 gene locus_tag LOCUS_04950 19691 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 23276 19704 gene locus_tag LOCUS_04960 23276 19704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 24172 23354 gene locus_tag LOCUS_04970 24172 23354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 24314 24808 gene locus_tag LOCUS_04980 24314 24808 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870197.1 protein_id gnl|my_center|LOCUS_04980 24817 24972 gene locus_tag LOCUS_04990 24817 24972 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_04990 24977 25252 gene locus_tag LOCUS_05000 24977 25252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 25255 25446 gene locus_tag LOCUS_05010 25255 25446 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867951.1 protein_id gnl|my_center|LOCUS_05010 25443 25661 gene locus_tag LOCUS_05020 25443 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 25662 26486 gene locus_tag LOCUS_05030 25662 26486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 27567 26524 gene locus_tag LOCUS_05040 27567 26524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 27818 27997 gene locus_tag LOCUS_05050 27818 27997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 28930 28487 gene locus_tag LOCUS_05060 28930 28487 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124736.1 protein_id gnl|my_center|LOCUS_05060 29733 28927 gene locus_tag LOCUS_05070 gene queC 29733 28927 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UAM7 protein_id gnl|my_center|LOCUS_05070 >Feature sequence016 555 1433 gene locus_tag LOCUS_05080 555 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2950 1430 gene locus_tag LOCUS_05090 gene hutH1 2950 1430 CDS product histidine ammonia-lyase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFC2 protein_id gnl|my_center|LOCUS_05090 4692 2989 gene locus_tag LOCUS_05100 gene hutU 4692 2989 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81AC7 protein_id gnl|my_center|LOCUS_05100 7239 4750 gene locus_tag LOCUS_05110 7239 4750 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_05110 7375 10359 gene locus_tag LOCUS_05120 7375 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 10364 11566 gene locus_tag LOCUS_05130 10364 11566 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_05130 11598 14903 gene locus_tag LOCUS_05140 11598 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 16188 14821 gene locus_tag LOCUS_05150 gene pepP 16188 14821 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_05150 17835 16219 gene locus_tag LOCUS_05160 17835 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 21295 17894 gene locus_tag LOCUS_05170 21295 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 22499 21387 gene locus_tag LOCUS_05180 22499 21387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22572 23927 gene locus_tag LOCUS_05190 22572 23927 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061037.1 protein_id gnl|my_center|LOCUS_05190 27102 23932 gene locus_tag LOCUS_05200 27102 23932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 28380 27145 gene locus_tag LOCUS_05210 28380 27145 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_05210 28886 28419 gene locus_tag LOCUS_05220 28886 28419 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_05220 >Feature sequence017 680 1567 gene locus_tag LOCUS_05230 680 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1571 2677 gene locus_tag LOCUS_05240 1571 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2688 3176 gene locus_tag LOCUS_05250 2688 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3169 3864 gene locus_tag LOCUS_05260 3169 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 3874 5586 gene locus_tag LOCUS_05270 3874 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496653.1 protein_id gnl|my_center|LOCUS_05270 5599 7386 gene locus_tag LOCUS_05280 5599 7386 CDS product flagellar assembly protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_05280 8031 7366 gene locus_tag LOCUS_05290 gene nth 8031 7366 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_05290 8238 8041 gene locus_tag LOCUS_05300 8238 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 10270 8243 gene locus_tag LOCUS_05310 10270 8243 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_05310 10511 10230 gene locus_tag LOCUS_05320 10511 10230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10411 10602 gene locus_tag LOCUS_05330 10411 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 11664 10603 gene locus_tag LOCUS_05340 11664 10603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 11962 11654 gene locus_tag LOCUS_05350 11962 11654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 12105 12932 gene locus_tag LOCUS_05360 12105 12932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 13018 15195 gene locus_tag LOCUS_05370 gene hppA1 13018 15195 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_05370 15209 16192 gene locus_tag LOCUS_05380 15209 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 16180 16809 gene locus_tag LOCUS_05390 16180 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 17067 16795 gene locus_tag LOCUS_05400 gene grx 17067 16795 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114715.1 protein_id gnl|my_center|LOCUS_05400 17948 17076 gene locus_tag LOCUS_05410 17948 17076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 20533 17957 gene locus_tag LOCUS_05420 20533 17957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 21633 20566 gene locus_tag LOCUS_05430 21633 20566 CDS product mRNA surveillance protein Pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_05430 23358 21643 gene locus_tag LOCUS_05440 gene fhs 23358 21643 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM91 protein_id gnl|my_center|LOCUS_05440 23443 24267 gene locus_tag LOCUS_05450 23443 24267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 24319 25203 gene locus_tag LOCUS_05460 24319 25203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 26756 25200 gene locus_tag LOCUS_05470 26756 25200 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392670.1 protein_id gnl|my_center|LOCUS_05470 28181 26847 gene locus_tag LOCUS_05480 28181 26847 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence018 288 19 gene locus_tag LOCUS_05490 288 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 548 285 gene locus_tag LOCUS_05500 548 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1498 551 gene locus_tag LOCUS_05510 1498 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3078 1513 gene locus_tag LOCUS_05520 3078 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4228 3083 gene locus_tag LOCUS_05530 gene nuoD 4228 3083 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814W9 protein_id gnl|my_center|LOCUS_05530 4927 4238 gene locus_tag LOCUS_05540 4927 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5547 4942 gene locus_tag LOCUS_05550 5547 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5996 5544 gene locus_tag LOCUS_05560 5996 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 8969 6108 gene locus_tag LOCUS_05570 8969 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 13573 9038 gene locus_tag LOCUS_05580 13573 9038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 14208 13627 gene locus_tag LOCUS_05590 14208 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 18925 14219 gene locus_tag LOCUS_05600 18925 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 21312 18988 gene locus_tag LOCUS_05610 21312 18988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 21442 23583 gene locus_tag LOCUS_05620 21442 23583 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_05620 24690 23578 gene locus_tag LOCUS_05630 gene rnz 24690 23578 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I1K7 protein_id gnl|my_center|LOCUS_05630 24965 24705 gene locus_tag LOCUS_05640 24965 24705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 25628 25035 gene locus_tag LOCUS_05650 25628 25035 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_05650 26766 25687 gene locus_tag LOCUS_05660 26766 25687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence019 1024 1716 gene locus_tag LOCUS_05670 1024 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3050 1713 gene locus_tag LOCUS_05680 3050 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3186 3596 gene locus_tag LOCUS_05690 3186 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706415.1 protein_id gnl|my_center|LOCUS_05690 5430 3598 gene locus_tag LOCUS_05700 5430 3598 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_05700 6460 5480 gene locus_tag LOCUS_05710 6460 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 6590 6517 gene locus_tag LOCUS_t00160 6590 6517 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6714 7442 gene locus_tag LOCUS_05720 6714 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7530 9032 gene locus_tag LOCUS_05730 7530 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9691 9029 gene locus_tag LOCUS_05740 9691 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 17370 9796 gene locus_tag LOCUS_05750 17370 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 20706 17566 gene locus_tag LOCUS_05760 20706 17566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 25659 20800 gene locus_tag LOCUS_05770 25659 20800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 26376 25669 gene locus_tag LOCUS_05780 26376 25669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865188.1 protein_id gnl|my_center|LOCUS_05780 26425 26661 gene locus_tag LOCUS_05790 26425 26661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 26733 27023 gene locus_tag LOCUS_05800 26733 27023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence020 513 1694 gene locus_tag LOCUS_05810 513 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2503 1691 gene locus_tag LOCUS_05820 2503 1691 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403710.1 protein_id gnl|my_center|LOCUS_05820 2568 2915 gene locus_tag LOCUS_05830 2568 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 3059 4186 gene locus_tag LOCUS_05840 3059 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4532 4179 gene locus_tag LOCUS_05850 4532 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4615 5283 gene locus_tag LOCUS_05860 4615 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5331 5406 gene locus_tag LOCUS_t00170 5331 5406 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5523 6074 gene locus_tag LOCUS_05870 5523 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 6096 6509 gene locus_tag LOCUS_05880 6096 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 6535 7173 gene locus_tag LOCUS_05890 6535 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7570 7175 gene locus_tag LOCUS_05900 7570 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8092 7580 gene locus_tag LOCUS_05910 8092 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8297 12799 gene locus_tag LOCUS_05920 8297 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 12846 13610 gene locus_tag LOCUS_05930 12846 13610 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_05930 13666 14970 gene locus_tag LOCUS_05940 13666 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 16313 14967 gene locus_tag LOCUS_05950 16313 14967 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_05950 17451 16324 gene locus_tag LOCUS_05960 17451 16324 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_05960 17676 19805 gene locus_tag LOCUS_05970 17676 19805 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_05970 19859 21964 gene locus_tag LOCUS_05980 19859 21964 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 protein_id gnl|my_center|LOCUS_05980 21966 22580 gene locus_tag LOCUS_05990 21966 22580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 22634 23275 gene locus_tag LOCUS_06000 22634 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 23256 23627 gene locus_tag LOCUS_06010 23256 23627 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_06010 23652 24077 gene locus_tag LOCUS_06020 23652 24077 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869543.1 protein_id gnl|my_center|LOCUS_06020 24833 24162 gene locus_tag LOCUS_06030 24833 24162 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766769.1 protein_id gnl|my_center|LOCUS_06030 25053 26084 gene locus_tag LOCUS_06040 25053 26084 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence021 2568 1636 gene locus_tag LOCUS_06050 2568 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2665 3771 gene locus_tag LOCUS_06060 2665 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3823 5130 gene locus_tag LOCUS_06070 3823 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5132 6484 gene locus_tag LOCUS_06080 5132 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8505 6487 gene locus_tag LOCUS_06090 8505 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 9965 8604 gene locus_tag LOCUS_06100 9965 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 10948 9977 gene locus_tag LOCUS_06110 10948 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 12456 11011 gene locus_tag LOCUS_06120 gene pntB 12456 11011 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_06120 12779 12456 gene locus_tag LOCUS_06130 12779 12456 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_06130 13963 12776 gene locus_tag LOCUS_06140 gene pntAA 13963 12776 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112662.1 protein_id gnl|my_center|LOCUS_06140 14062 15012 gene locus_tag LOCUS_06150 gene mdh 14062 15012 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80040 protein_id gnl|my_center|LOCUS_06150 15111 15800 gene locus_tag LOCUS_06160 15111 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 18926 15789 gene locus_tag LOCUS_06170 gene alaS 18926 15789 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_06170 19517 18936 gene locus_tag LOCUS_06180 19517 18936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 19605 21071 gene locus_tag LOCUS_06190 19605 21071 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_06190 21186 21371 gene locus_tag LOCUS_06200 21186 21371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence022 2309 4657 gene locus_tag LOCUS_06210 2309 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4654 5730 gene locus_tag LOCUS_06220 4654 5730 CDS product iron(III) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021851.1 protein_id gnl|my_center|LOCUS_06220 5740 6861 gene locus_tag LOCUS_06230 5740 6861 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 protein_id gnl|my_center|LOCUS_06230 6861 7682 gene locus_tag LOCUS_06240 6861 7682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_06240 7685 8143 gene locus_tag LOCUS_06250 7685 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 8211 9083 gene locus_tag LOCUS_06260 8211 9083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 9652 9080 gene locus_tag LOCUS_06270 9652 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 11341 9716 gene locus_tag LOCUS_06280 11341 9716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 11937 11383 gene locus_tag LOCUS_06290 11937 11383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 12903 11953 gene locus_tag LOCUS_06300 12903 11953 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207863.1 protein_id gnl|my_center|LOCUS_06300 14068 12896 gene locus_tag LOCUS_06310 14068 12896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 14308 15807 gene locus_tag LOCUS_06320 14308 15807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15862 16407 gene locus_tag LOCUS_06330 15862 16407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 16450 17019 gene locus_tag LOCUS_06340 16450 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 17022 17270 gene locus_tag LOCUS_06350 17022 17270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 17910 17278 gene locus_tag LOCUS_06360 17910 17278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 18002 18439 gene locus_tag LOCUS_06370 18002 18439 CDS product inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ01 protein_id gnl|my_center|LOCUS_06370 19403 18405 gene locus_tag LOCUS_06380 gene hemH 19403 18405 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_06380 19595 19512 gene locus_tag LOCUS_t00180 19595 19512 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 20441 19632 gene locus_tag LOCUS_06390 20441 19632 CDS product dimethylargininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_06390 20526 22091 gene locus_tag LOCUS_06400 20526 22091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 22146 24170 gene locus_tag LOCUS_06410 22146 24170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence023 26 850 gene locus_tag LOCUS_06420 26 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4985 852 gene locus_tag LOCUS_06430 4985 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 5084 6397 gene locus_tag LOCUS_06440 5084 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 7094 6402 gene locus_tag LOCUS_06450 7094 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 8005 7145 gene locus_tag LOCUS_06460 8005 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8584 8018 gene locus_tag LOCUS_06470 8584 8018 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_06470 8888 9307 gene locus_tag LOCUS_06480 8888 9307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 9822 9304 gene locus_tag LOCUS_06490 9822 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 10406 9855 gene locus_tag LOCUS_06500 gene msrA 10406 9855 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUF1 protein_id gnl|my_center|LOCUS_06500 11432 10428 gene locus_tag LOCUS_06510 11432 10428 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_06510 14900 11490 gene locus_tag LOCUS_06520 14900 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15014 15271 gene locus_tag LOCUS_06530 15014 15271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 15308 15805 gene locus_tag LOCUS_06540 15308 15805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 15815 17170 gene locus_tag LOCUS_06550 15815 17170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 17175 17600 gene locus_tag LOCUS_06560 17175 17600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 17629 17997 gene locus_tag LOCUS_06570 17629 17997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 18045 18755 gene locus_tag LOCUS_06580 18045 18755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 18998 18768 gene locus_tag LOCUS_06590 18998 18768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 19803 19000 gene locus_tag LOCUS_06600 19803 19000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 20689 19829 gene locus_tag LOCUS_06610 20689 19829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 20848 21870 gene locus_tag LOCUS_06620 20848 21870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 22576 21875 gene locus_tag LOCUS_06630 22576 21875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 22665 24461 gene locus_tag LOCUS_06640 22665 24461 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CB2 protein_id gnl|my_center|LOCUS_06640 24692 24465 gene locus_tag LOCUS_06650 24692 24465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence024 495 1649 gene locus_tag LOCUS_06660 495 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1776 2243 gene locus_tag LOCUS_06670 1776 2243 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_06670 2254 2835 gene locus_tag LOCUS_06680 2254 2835 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_06680 2832 3215 gene locus_tag LOCUS_06690 2832 3215 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_06690 3228 4145 gene locus_tag LOCUS_06700 3228 4145 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053732.1 protein_id gnl|my_center|LOCUS_06700 4183 5154 gene locus_tag LOCUS_06710 4183 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6155 5151 gene locus_tag LOCUS_06720 6155 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 6207 7289 gene locus_tag LOCUS_06730 6207 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 7286 9076 gene locus_tag LOCUS_06740 7286 9076 CDS product fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090652.1 protein_id gnl|my_center|LOCUS_06740 9097 9291 gene locus_tag LOCUS_06750 9097 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9312 9995 gene locus_tag LOCUS_06760 9312 9995 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946333.1 protein_id gnl|my_center|LOCUS_06760 12839 10002 gene locus_tag LOCUS_06770 gene leuS 12839 10002 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLA8 protein_id gnl|my_center|LOCUS_06770 12972 13730 gene locus_tag LOCUS_06780 12972 13730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 13735 15222 gene locus_tag LOCUS_06790 13735 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 15533 15219 gene locus_tag LOCUS_06800 gene trx 15533 15219 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEH0 protein_id gnl|my_center|LOCUS_06800 15638 16318 gene locus_tag LOCUS_06810 15638 16318 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QH5 protein_id gnl|my_center|LOCUS_06810 16328 17401 gene locus_tag LOCUS_06820 16328 17401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 17413 17760 gene locus_tag LOCUS_06830 17413 17760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 17763 18086 gene locus_tag LOCUS_06840 gene grxD 17763 18086 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_06840 19441 18248 gene locus_tag LOCUS_06850 19441 18248 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_06850 20382 19480 gene locus_tag LOCUS_06860 20382 19480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 20427 21491 gene locus_tag LOCUS_06870 20427 21491 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173900.1 protein_id gnl|my_center|LOCUS_06870 23650 21578 gene locus_tag LOCUS_06880 23650 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence025 451 1806 gene locus_tag LOCUS_06890 gene accC 451 1806 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064215.1 protein_id gnl|my_center|LOCUS_06890 1811 2770 gene locus_tag LOCUS_06900 1811 2770 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_06900 4450 2762 gene locus_tag LOCUS_06910 4450 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 5538 4540 gene locus_tag LOCUS_06920 5538 4540 CDS product translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980552.1 protein_id gnl|my_center|LOCUS_06920 6486 5554 gene locus_tag LOCUS_06930 6486 5554 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_06930 7501 6554 gene locus_tag LOCUS_06940 7501 6554 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_06940 7996 7538 gene locus_tag LOCUS_06950 7996 7538 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_06950 8419 7997 gene locus_tag LOCUS_06960 8419 7997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8528 9799 gene locus_tag LOCUS_06970 8528 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9827 10678 gene locus_tag LOCUS_06980 9827 10678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 10746 11909 gene locus_tag LOCUS_06990 10746 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11924 12490 gene locus_tag LOCUS_07000 11924 12490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 12504 13391 gene locus_tag LOCUS_07010 gene hbd 12504 13391 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52041 protein_id gnl|my_center|LOCUS_07010 13605 14777 gene locus_tag LOCUS_07020 gene oel1 13605 14777 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070593.1 protein_id gnl|my_center|LOCUS_07020 15553 14774 gene locus_tag LOCUS_07030 15553 14774 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_07030 15690 16316 gene locus_tag LOCUS_07040 15690 16316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 16745 16311 gene locus_tag LOCUS_07050 16745 16311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 17200 16742 gene locus_tag LOCUS_07060 17200 16742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 18812 17217 gene locus_tag LOCUS_07070 18812 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 19880 18825 gene locus_tag LOCUS_07080 19880 18825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 21423 19891 gene locus_tag LOCUS_07090 21423 19891 CDS product secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_07090 21605 21345 gene locus_tag LOCUS_07100 21605 21345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 <23629 21541 gene locus_tag LOCUS_07110 <23629 21541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence026 1924 4020 gene locus_tag LOCUS_07120 1924 4020 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_07120 4086 4934 gene locus_tag LOCUS_07130 4086 4934 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_07130 4931 5872 gene locus_tag LOCUS_07140 4931 5872 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_07140 5875 6537 gene locus_tag LOCUS_07150 gene tal 5875 6537 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66520 protein_id gnl|my_center|LOCUS_07150 6598 7173 gene locus_tag LOCUS_07160 6598 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8693 7170 gene locus_tag LOCUS_07170 8693 7170 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_07170 9917 8730 gene locus_tag LOCUS_07180 gene coaBC 9917 8730 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255007.1 protein_id gnl|my_center|LOCUS_07180 10016 10615 gene locus_tag LOCUS_07190 10016 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 11644 10616 gene locus_tag LOCUS_07200 11644 10616 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_07200 12654 11716 gene locus_tag LOCUS_07210 12654 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13899 12703 gene locus_tag LOCUS_07220 13899 12703 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_07220 14008 14610 gene locus_tag LOCUS_07230 14008 14610 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_07230 14950 14612 gene locus_tag LOCUS_07240 14950 14612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 15012 15800 gene locus_tag LOCUS_07250 15012 15800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869535.1 protein_id gnl|my_center|LOCUS_07250 15865 16539 gene locus_tag LOCUS_07260 gene idi 15865 16539 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_07260 16536 17534 gene locus_tag LOCUS_07270 16536 17534 CDS product serralysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_07270 19738 17531 gene locus_tag LOCUS_07280 19738 17531 CDS product translation elongation factor aEF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867400.1 protein_id gnl|my_center|LOCUS_07280 20461 19817 gene locus_tag LOCUS_07290 20461 19817 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_07290 20898 20470 gene locus_tag LOCUS_07300 20898 20470 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_07300 21033 22304 gene locus_tag LOCUS_07310 21033 22304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_07310 >Feature sequence027 207 1010 gene locus_tag LOCUS_07320 207 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1007 3241 gene locus_tag LOCUS_07330 1007 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3292 3678 gene locus_tag LOCUS_07340 3292 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4443 3679 gene locus_tag LOCUS_07350 4443 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 5762 4503 gene locus_tag LOCUS_07360 gene ychF 5762 4503 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496963.1 protein_id gnl|my_center|LOCUS_07360 7790 5811 gene locus_tag LOCUS_07370 7790 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 7672 7920 gene locus_tag LOCUS_07380 7672 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8167 7910 gene locus_tag LOCUS_07390 8167 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 9395 8262 gene locus_tag LOCUS_07400 9395 8262 CDS product TIGR01210 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_07400 9519 11534 gene locus_tag LOCUS_07410 9519 11534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 11552 12265 gene locus_tag LOCUS_07420 11552 12265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 12869 12270 gene locus_tag LOCUS_07430 12869 12270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 17815 12950 gene locus_tag LOCUS_07440 17815 12950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 21504 17836 gene locus_tag LOCUS_07450 21504 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence028 <1 713 gene locus_tag LOCUS_07460 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249171.1:pyridoxal 5'-phosphate synthase glutaminase subunit PdxT 724 1821 gene locus_tag LOCUS_07470 724 1821 CDS product Fe-S protein, radical SAM family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_07470 1879 3321 gene locus_tag LOCUS_07480 1879 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4115 3324 gene locus_tag LOCUS_07490 4115 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 4967 4122 gene locus_tag LOCUS_07500 4967 4122 CDS product phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251147.1 protein_id gnl|my_center|LOCUS_07500 5356 5027 gene locus_tag LOCUS_07510 gene panD 5356 5027 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EA4 protein_id gnl|my_center|LOCUS_07510 5442 6629 gene locus_tag LOCUS_07520 gene gcvT 5442 6629 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54378 protein_id gnl|my_center|LOCUS_07520 6670 8034 gene locus_tag LOCUS_07530 gene gcvPA 6670 8034 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2E7 protein_id gnl|my_center|LOCUS_07530 8031 9533 gene locus_tag LOCUS_07540 gene gcvPB 8031 9533 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH49 protein_id gnl|my_center|LOCUS_07540 10838 9534 gene locus_tag LOCUS_07550 10838 9534 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583823.1 protein_id gnl|my_center|LOCUS_07550 11790 10849 gene locus_tag LOCUS_07560 11790 10849 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_07560 16329 11839 gene locus_tag LOCUS_07570 16329 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 17907 16399 gene locus_tag LOCUS_07580 17907 16399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_07580 19845 17917 gene locus_tag LOCUS_07590 19845 17917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 20029 20103 gene locus_tag LOCUS_t00190 20029 20103 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 1558 1025 gene locus_tag LOCUS_07600 1558 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3598 1601 gene locus_tag LOCUS_07610 3598 1601 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865024.1 protein_id gnl|my_center|LOCUS_07610 3751 4758 gene locus_tag LOCUS_07620 3751 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4812 5357 gene locus_tag LOCUS_07630 4812 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 5362 6192 gene locus_tag LOCUS_07640 5362 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 6567 6193 gene locus_tag LOCUS_07650 6567 6193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 7164 6577 gene locus_tag LOCUS_07660 7164 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 7687 7259 gene locus_tag LOCUS_07670 7687 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 7765 8964 gene locus_tag LOCUS_07680 7765 8964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868272.1 protein_id gnl|my_center|LOCUS_07680 9574 8951 gene locus_tag LOCUS_07690 9574 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 9664 10836 gene locus_tag LOCUS_07700 9664 10836 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533145.1 protein_id gnl|my_center|LOCUS_07700 11628 10825 gene locus_tag LOCUS_07710 11628 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496422.1 protein_id gnl|my_center|LOCUS_07710 12565 11630 gene locus_tag LOCUS_07720 12565 11630 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_07720 13774 12614 gene locus_tag LOCUS_07730 13774 12614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 14292 13783 gene locus_tag LOCUS_07740 14292 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 15028 14333 gene locus_tag LOCUS_07750 15028 14333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_07750 16491 15061 gene locus_tag LOCUS_07760 16491 15061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 16883 16536 gene locus_tag LOCUS_07770 16883 16536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 17047 18306 gene locus_tag LOCUS_07780 17047 18306 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870637.1 protein_id gnl|my_center|LOCUS_07780 18303 19262 gene locus_tag LOCUS_07790 18303 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 19292 20386 gene locus_tag LOCUS_07800 19292 20386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 <21399 20387 gene locus_tag LOCUS_07810 <21399 20387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F9L0:fumarate hydratase class II >Feature sequence030 790 206 gene locus_tag LOCUS_07820 790 206 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230227.1 protein_id gnl|my_center|LOCUS_07820 8287 860 gene locus_tag LOCUS_07830 8287 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 8489 8405 gene locus_tag LOCUS_t00200 8489 8405 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8544 8744 gene locus_tag LOCUS_07840 8544 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 9507 8746 gene locus_tag LOCUS_07850 9507 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 9780 9574 gene locus_tag LOCUS_07860 9780 9574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 10590 9790 gene locus_tag LOCUS_07870 10590 9790 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_07870 11057 10773 gene locus_tag LOCUS_07880 11057 10773 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_07880 11614 11165 gene locus_tag LOCUS_07890 11614 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 11673 11933 gene locus_tag LOCUS_07900 11673 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 11935 12351 gene locus_tag LOCUS_07910 11935 12351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 12353 14041 gene locus_tag LOCUS_07920 12353 14041 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_07920 14112 14291 gene locus_tag LOCUS_07930 14112 14291 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867766.1 protein_id gnl|my_center|LOCUS_07930 14361 15887 gene locus_tag LOCUS_07940 gene purF 14361 15887 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_07940 15933 17489 gene locus_tag LOCUS_07950 15933 17489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 18158 17460 gene locus_tag LOCUS_07960 18158 17460 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_07960 19105 18170 gene locus_tag LOCUS_07970 gene etfA 19105 18170 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336943.1 protein_id gnl|my_center|LOCUS_07970 19855 19115 gene locus_tag LOCUS_07980 gene etfB 19855 19115 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence031 3030 2467 gene locus_tag LOCUS_07990 3030 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_07990 4771 3068 gene locus_tag LOCUS_08000 4771 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5526 4774 gene locus_tag LOCUS_08010 5526 4774 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022197.1 protein_id gnl|my_center|LOCUS_08010 6375 5527 gene locus_tag LOCUS_08020 6375 5527 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256011.1 protein_id gnl|my_center|LOCUS_08020 7339 6431 gene locus_tag LOCUS_08030 7339 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8002 7412 gene locus_tag LOCUS_08040 8002 7412 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_08040 8097 8480 gene locus_tag LOCUS_08050 gene crcB2 8097 8480 CDS product putative fluoride ion transporter CrcB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07591 protein_id gnl|my_center|LOCUS_08050 9154 8477 gene locus_tag LOCUS_08060 9154 8477 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868707.1 protein_id gnl|my_center|LOCUS_08060 9201 10385 gene locus_tag LOCUS_08070 gene nadA 9201 10385 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRI0 protein_id gnl|my_center|LOCUS_08070 10745 10386 gene locus_tag LOCUS_08080 10745 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 11792 10755 gene locus_tag LOCUS_08090 11792 10755 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_08090 12183 11818 gene locus_tag LOCUS_08100 12183 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 13540 12218 gene locus_tag LOCUS_08110 13540 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence032 79 2076 gene locus_tag LOCUS_08120 gene thrS 79 2076 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT8 protein_id gnl|my_center|LOCUS_08120 2459 2079 gene locus_tag LOCUS_08130 2459 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 3202 2465 gene locus_tag LOCUS_08140 3202 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3891 3217 gene locus_tag LOCUS_08150 3891 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3945 5762 gene locus_tag LOCUS_08160 3945 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5788 6465 gene locus_tag LOCUS_08170 5788 6465 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225030.1 protein_id gnl|my_center|LOCUS_08170 8198 6471 gene locus_tag LOCUS_08180 8198 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 10588 8219 gene locus_tag LOCUS_08190 10588 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 11562 10597 gene locus_tag LOCUS_08200 11562 10597 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_08200 11679 12620 gene locus_tag LOCUS_08210 11679 12620 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_08210 12620 13099 gene locus_tag LOCUS_08220 12620 13099 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251145.1 protein_id gnl|my_center|LOCUS_08220 13104 13874 gene locus_tag LOCUS_08230 gene exoA 13104 13874 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121736.1 protein_id gnl|my_center|LOCUS_08230 14873 13869 gene locus_tag LOCUS_08240 14873 13869 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_08240 15583 14915 gene locus_tag LOCUS_08250 15583 14915 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_08250 15801 16145 gene locus_tag LOCUS_08260 15801 16145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 16160 19312 gene locus_tag LOCUS_08270 16160 19312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 19324 19575 gene locus_tag LOCUS_08280 19324 19575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 20768 19572 gene locus_tag LOCUS_08290 20768 19572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence033 4315 2945 gene locus_tag LOCUS_08300 4315 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4499 5536 gene locus_tag LOCUS_08310 4499 5536 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_08310 6796 5528 gene locus_tag LOCUS_08320 6796 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 6884 7669 gene locus_tag LOCUS_08330 6884 7669 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411341.1 protein_id gnl|my_center|LOCUS_08330 7733 8506 gene locus_tag LOCUS_08340 gene thyA 7733 8506 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PV5 protein_id gnl|my_center|LOCUS_08340 8515 9009 gene locus_tag LOCUS_08350 gene folA 8515 9009 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NHY1 protein_id gnl|my_center|LOCUS_08350 9783 8998 gene locus_tag LOCUS_08360 9783 8998 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_08360 10763 9807 gene locus_tag LOCUS_08370 10763 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 10906 11376 gene locus_tag LOCUS_08380 10906 11376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 11450 11728 gene locus_tag LOCUS_08390 11450 11728 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771072.1 protein_id gnl|my_center|LOCUS_08390 11721 12734 gene locus_tag LOCUS_08400 11721 12734 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867914.1 protein_id gnl|my_center|LOCUS_08400 13770 12736 gene locus_tag LOCUS_08410 13770 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15291 13792 gene locus_tag LOCUS_08420 15291 13792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16768 15305 gene locus_tag LOCUS_08430 16768 15305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 16941 17291 gene locus_tag LOCUS_08440 16941 17291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 17288 18223 gene locus_tag LOCUS_08450 17288 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 18273 18617 gene locus_tag LOCUS_08460 18273 18617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 19297 18614 gene locus_tag LOCUS_08470 19297 18614 CDS product recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_08470 19448 20314 gene locus_tag LOCUS_08480 19448 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence034 <1 2249 gene locus_tag LOCUS_08490 <1 2249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871086.1:membrane protein 2337 3740 gene locus_tag LOCUS_08500 2337 3740 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_08500 3808 4098 gene locus_tag LOCUS_08510 3808 4098 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 protein_id gnl|my_center|LOCUS_08510 4110 4469 gene locus_tag LOCUS_08520 4110 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4475 5407 gene locus_tag LOCUS_08530 4475 5407 CDS product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249850.1 protein_id gnl|my_center|LOCUS_08530 5464 6552 gene locus_tag LOCUS_08540 5464 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 6562 6873 gene locus_tag LOCUS_08550 6562 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 6886 7077 gene locus_tag LOCUS_08560 6886 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 8058 7087 gene locus_tag LOCUS_08570 8058 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 9384 8068 gene locus_tag LOCUS_08580 9384 8068 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_08580 10542 9412 gene locus_tag LOCUS_08590 10542 9412 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_08590 12187 10562 gene locus_tag LOCUS_08600 12187 10562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 13260 12298 gene locus_tag LOCUS_08610 13260 12298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 14228 13257 gene locus_tag LOCUS_08620 14228 13257 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974722.1 protein_id gnl|my_center|LOCUS_08620 16999 14228 gene locus_tag LOCUS_08630 16999 14228 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_08630 17599 17009 gene locus_tag LOCUS_08640 17599 17009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 19371 17650 gene locus_tag LOCUS_08650 19371 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence035 2584 1355 gene locus_tag LOCUS_08660 gene metK 2584 1355 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54419 protein_id gnl|my_center|LOCUS_08660 2667 4082 gene locus_tag LOCUS_08670 2667 4082 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_08670 4181 4846 gene locus_tag LOCUS_08680 4181 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4856 5662 gene locus_tag LOCUS_08690 4856 5662 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249687.1 protein_id gnl|my_center|LOCUS_08690 5672 6907 gene locus_tag LOCUS_08700 5672 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 6918 8087 gene locus_tag LOCUS_08710 6918 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8084 9529 gene locus_tag LOCUS_08720 8084 9529 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_08720 9940 9524 gene locus_tag LOCUS_08730 9940 9524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9891 11006 gene locus_tag LOCUS_08740 9891 11006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 11006 12403 gene locus_tag LOCUS_08750 11006 12403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 12444 14120 gene locus_tag LOCUS_08760 12444 14120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 14175 14993 gene locus_tag LOCUS_08770 gene panB 14175 14993 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_08770 17182 14990 gene locus_tag LOCUS_08780 17182 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 17243 18232 gene locus_tag LOCUS_08790 17243 18232 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_08790 19114 18242 gene locus_tag LOCUS_08800 19114 18242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 19333 19181 gene locus_tag LOCUS_08810 19333 19181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 20064 19399 gene locus_tag LOCUS_08820 20064 19399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 20414 20136 gene locus_tag LOCUS_08830 20414 20136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 20714 20526 gene locus_tag LOCUS_08840 20714 20526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence036 1214 9250 gene locus_tag LOCUS_08850 1214 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 9687 9247 gene locus_tag LOCUS_08860 9687 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 9816 10181 gene locus_tag LOCUS_08870 9816 10181 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_08870 10174 10674 gene locus_tag LOCUS_08880 10174 10674 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_08880 10674 11108 gene locus_tag LOCUS_08890 10674 11108 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_08890 11116 11319 gene locus_tag LOCUS_08900 11116 11319 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_08900 11333 11408 gene locus_tag LOCUS_t00210 11333 11408 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11460 16061 gene locus_tag LOCUS_08910 11460 16061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 16064 16621 gene locus_tag LOCUS_08920 16064 16621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 16656 17084 gene locus_tag LOCUS_08930 16656 17084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 17116 19143 gene locus_tag LOCUS_08940 gene ligA 17116 19143 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87RJ4 protein_id gnl|my_center|LOCUS_08940 <20157 19144 gene locus_tag LOCUS_08950 <20157 19144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963428.1:UDP-N-acetyl-D-galactosamine dehydrogenase >Feature sequence037 1250 2473 gene locus_tag LOCUS_08960 gene folC 1250 2473 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_08960 2507 2968 gene locus_tag LOCUS_08970 2507 2968 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_08970 3035 3451 gene locus_tag LOCUS_08980 3035 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3467 4456 gene locus_tag LOCUS_08990 3467 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4996 4457 gene locus_tag LOCUS_09000 4996 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 5088 6674 gene locus_tag LOCUS_09010 5088 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 7215 6646 gene locus_tag LOCUS_09020 7215 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 7913 7296 gene locus_tag LOCUS_09030 7913 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 8107 8346 gene locus_tag LOCUS_09040 8107 8346 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_09040 9191 8433 gene locus_tag LOCUS_09050 gene sdhB 9191 8433 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_09050 11045 9192 gene locus_tag LOCUS_09060 11045 9192 CDS product putative succinate dehydrogenase, flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705146.1 protein_id gnl|my_center|LOCUS_09060 11867 11055 gene locus_tag LOCUS_09070 11867 11055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_09070 13572 11944 gene locus_tag LOCUS_09080 13572 11944 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228252.1 protein_id gnl|my_center|LOCUS_09080 13682 15934 gene locus_tag LOCUS_09090 13682 15934 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_09090 16263 17906 gene locus_tag LOCUS_09100 16263 17906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence038 1916 753 gene locus_tag LOCUS_09110 gene ftsZ 1916 753 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_09110 2235 4043 gene locus_tag LOCUS_09120 2235 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 8525 4044 gene locus_tag LOCUS_09130 8525 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 8617 9585 gene locus_tag LOCUS_09140 8617 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 9578 9895 gene locus_tag LOCUS_09150 9578 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 10656 9892 gene locus_tag LOCUS_09160 10656 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 11165 10674 gene locus_tag LOCUS_09170 11165 10674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 12808 11162 gene locus_tag LOCUS_09180 12808 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12976 14256 gene locus_tag LOCUS_09190 gene malQ 12976 14256 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DY3 protein_id gnl|my_center|LOCUS_09190 14303 15943 gene locus_tag LOCUS_09200 14303 15943 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_09200 18580 16022 gene locus_tag LOCUS_09210 18580 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence039 316 495 gene locus_tag LOCUS_09220 316 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1510 497 gene locus_tag LOCUS_09230 1510 497 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_09230 2824 1622 gene locus_tag LOCUS_09240 gene rimK 2824 1622 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_09240 2966 5116 gene locus_tag LOCUS_09250 2966 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 5121 5570 gene locus_tag LOCUS_09260 5121 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6148 5564 gene locus_tag LOCUS_09270 6148 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6243 7838 gene locus_tag LOCUS_09280 6243 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 8424 7915 gene locus_tag LOCUS_09290 8424 7915 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870950.1 protein_id gnl|my_center|LOCUS_09290 8527 8910 gene locus_tag LOCUS_09300 8527 8910 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_09300 8960 9421 gene locus_tag LOCUS_09310 8960 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 10459 9425 gene locus_tag LOCUS_09320 gene ilvE 10459 9425 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZE9 protein_id gnl|my_center|LOCUS_09320 10736 13129 gene locus_tag LOCUS_09330 10736 13129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 13227 14084 gene locus_tag LOCUS_09340 13227 14084 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119030.1 protein_id gnl|my_center|LOCUS_09340 14580 14086 gene locus_tag LOCUS_09350 14580 14086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 16127 14589 gene locus_tag LOCUS_09360 16127 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 16996 16130 gene locus_tag LOCUS_09370 16996 16130 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_09370 <18386 17001 gene locus_tag LOCUS_09380 <18386 17001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229661.1:acetyl-CoA carboxylase subunit beta >Feature sequence040 61 636 gene locus_tag LOCUS_09390 61 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 665 1666 gene locus_tag LOCUS_09400 665 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2275 1667 gene locus_tag LOCUS_09410 2275 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2401 3858 gene locus_tag LOCUS_09420 2401 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4464 3862 gene locus_tag LOCUS_09430 4464 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 7469 4629 gene locus_tag LOCUS_09440 7469 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 7589 9163 gene locus_tag LOCUS_09450 7589 9163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 9856 9164 gene locus_tag LOCUS_09460 9856 9164 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_09460 9985 11286 gene locus_tag LOCUS_09470 9985 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12214 11279 gene locus_tag LOCUS_09480 12214 11279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 12730 12224 gene locus_tag LOCUS_09490 12730 12224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 14516 12768 gene locus_tag LOCUS_09500 14516 12768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 16220 14517 gene locus_tag LOCUS_09510 16220 14517 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_09510 <18329 16220 gene locus_tag LOCUS_09520 <18329 16220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142593.1:NADH dehydrogenase subunit 5 >Feature sequence041 <1 2957 gene locus_tag LOCUS_09530 <1 2957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057713.1:ATPase AAA 30 104 gene locus_tag LOCUS_t00220 30 104 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3020 4498 gene locus_tag LOCUS_09540 3020 4498 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHC2 protein_id gnl|my_center|LOCUS_09540 4570 6036 gene locus_tag LOCUS_09550 4570 6036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 9216 6037 gene locus_tag LOCUS_09560 9216 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 9432 10928 gene locus_tag LOCUS_09570 9432 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 10956 11723 gene locus_tag LOCUS_09580 10956 11723 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877200.1 protein_id gnl|my_center|LOCUS_09580 11770 14166 gene locus_tag LOCUS_09590 11770 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 14855 14169 gene locus_tag LOCUS_09600 14855 14169 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_09600 15868 14876 gene locus_tag LOCUS_09610 15868 14876 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867600.1 protein_id gnl|my_center|LOCUS_09610 15992 17200 gene locus_tag LOCUS_09620 gene sucC 15992 17200 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEX9 protein_id gnl|my_center|LOCUS_09620 17200 18123 gene locus_tag LOCUS_09630 17200 18123 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F879 protein_id gnl|my_center|LOCUS_09630 >Feature sequence042 <1 569 gene locus_tag LOCUS_09640 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102173.1:glycerol uptake facilitator protein 1045 566 gene locus_tag LOCUS_09650 1045 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 2207 1092 gene locus_tag LOCUS_09660 2207 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_09660 3451 2273 gene locus_tag LOCUS_09670 3451 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3505 4227 gene locus_tag LOCUS_09680 3505 4227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_09680 4217 5101 gene locus_tag LOCUS_09690 4217 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 10102 5105 gene locus_tag LOCUS_09700 10102 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 10231 11544 gene locus_tag LOCUS_09710 10231 11544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11563 12291 gene locus_tag LOCUS_09720 11563 12291 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_09720 12281 12427 gene locus_tag LOCUS_09730 12281 12427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 13059 12424 gene locus_tag LOCUS_09740 13059 12424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 14725 13079 gene locus_tag LOCUS_09750 14725 13079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 15180 14725 gene locus_tag LOCUS_09760 15180 14725 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_09760 <16269 15231 gene locus_tag LOCUS_09770 <16269 15231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KN48:fumarate reductase flavoprotein subunit >Feature sequence043 733 1122 gene locus_tag LOCUS_09780 733 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2017 1115 gene locus_tag LOCUS_09790 2017 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2353 2036 gene locus_tag LOCUS_09800 2353 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2564 2355 gene locus_tag LOCUS_09810 2564 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 2919 2551 gene locus_tag LOCUS_09820 2919 2551 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870097.1 protein_id gnl|my_center|LOCUS_09820 3701 2919 gene locus_tag LOCUS_09830 3701 2919 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_09830 4432 3701 gene locus_tag LOCUS_09840 4432 3701 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_09840 5115 4429 gene locus_tag LOCUS_09850 5115 4429 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_09850 5853 5167 gene locus_tag LOCUS_09860 5853 5167 CDS product RNA-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_09860 6594 5866 gene locus_tag LOCUS_09870 6594 5866 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876325.1 protein_id gnl|my_center|LOCUS_09870 6710 7366 gene locus_tag LOCUS_09880 6710 7366 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_09880 7430 8779 gene locus_tag LOCUS_09890 7430 8779 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_09890 9015 8776 gene locus_tag LOCUS_09900 9015 8776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 9097 9690 gene locus_tag LOCUS_09910 9097 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 9938 9687 gene locus_tag LOCUS_09920 9938 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 11235 9976 gene locus_tag LOCUS_09930 11235 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_09930 11897 11238 gene locus_tag LOCUS_09940 11897 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 12489 11908 gene locus_tag LOCUS_09950 gene gmhA 12489 11908 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125472.1 protein_id gnl|my_center|LOCUS_09950 12676 13503 gene locus_tag LOCUS_09960 12676 13503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence044 2872 977 gene locus_tag LOCUS_09970 2872 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4753 2885 gene locus_tag LOCUS_09980 4753 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4974 6395 gene locus_tag LOCUS_09990 4974 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 6450 6524 gene locus_tag LOCUS_t00230 6450 6524 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6680 10954 gene locus_tag LOCUS_10000 6680 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 11800 10988 gene locus_tag LOCUS_10010 gene rph 11800 10988 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_10010 13771 11819 gene locus_tag LOCUS_10020 13771 11819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 13889 14602 gene locus_tag LOCUS_10030 13889 14602 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_10030 14607 15053 gene locus_tag LOCUS_10040 14607 15053 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_10040 15046 15657 gene locus_tag LOCUS_10050 gene ribE 15046 15657 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_274271.2 protein_id gnl|my_center|LOCUS_10050 15659 16102 gene locus_tag LOCUS_10060 15659 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence045 3983 3177 gene locus_tag LOCUS_10070 3983 3177 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583949.1 protein_id gnl|my_center|LOCUS_10070 4138 7482 gene locus_tag LOCUS_10080 4138 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 7515 9497 gene locus_tag LOCUS_10090 7515 9497 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_10090 9530 10867 gene locus_tag LOCUS_10100 9530 10867 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_10100 11849 10860 gene locus_tag LOCUS_10110 11849 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 11927 12193 gene locus_tag LOCUS_10120 11927 12193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147166.1 protein_id gnl|my_center|LOCUS_10120 12453 13193 gene locus_tag LOCUS_10130 12453 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870402.1 protein_id gnl|my_center|LOCUS_10130 13465 13190 gene locus_tag LOCUS_10140 13465 13190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 14816 13515 gene locus_tag LOCUS_10150 gene purA 14816 13515 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7Y9 protein_id gnl|my_center|LOCUS_10150 14964 15926 gene locus_tag LOCUS_10160 14964 15926 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_10160 15978 16054 gene locus_tag LOCUS_t00240 15978 16054 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence046 615 454 gene locus_tag LOCUS_10170 615 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1476 625 gene locus_tag LOCUS_10180 gene ara1 1476 625 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_10180 1617 3056 gene locus_tag LOCUS_10190 1617 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5280 3136 gene locus_tag LOCUS_10200 gene katG 5280 3136 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 protein_id gnl|my_center|LOCUS_10200 6188 5400 gene locus_tag LOCUS_10210 6188 5400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7449 6193 gene locus_tag LOCUS_10220 7449 6193 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933799.1 protein_id gnl|my_center|LOCUS_10220 7503 8390 gene locus_tag LOCUS_10230 gene pqqB 7503 8390 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6N0 protein_id gnl|my_center|LOCUS_10230 8773 8387 gene locus_tag LOCUS_10240 8773 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 9727 8816 gene locus_tag LOCUS_10250 9727 8816 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG3 protein_id gnl|my_center|LOCUS_10250 9869 11137 gene locus_tag LOCUS_10260 9869 11137 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878642.1 protein_id gnl|my_center|LOCUS_10260 11193 11429 gene locus_tag LOCUS_10270 11193 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11527 12882 gene locus_tag LOCUS_10280 11527 12882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 12907 14865 gene locus_tag LOCUS_10290 12907 14865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence047 2 709 gene locus_tag LOCUS_10300 2 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1424 711 gene locus_tag LOCUS_10310 1424 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1829 1455 gene locus_tag LOCUS_10320 1829 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 4302 1876 gene locus_tag LOCUS_10330 4302 1876 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272774.1 protein_id gnl|my_center|LOCUS_10330 4996 4319 gene locus_tag LOCUS_10340 4996 4319 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_10340 7190 4998 gene locus_tag LOCUS_10350 7190 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7285 8025 gene locus_tag LOCUS_10360 7285 8025 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_10360 8040 9059 gene locus_tag LOCUS_10370 8040 9059 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_10370 9097 9981 gene locus_tag LOCUS_10380 9097 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 10000 11064 gene locus_tag LOCUS_10390 10000 11064 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_10390 11132 13267 gene locus_tag LOCUS_10400 11132 13267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence048 1385 1020 gene locus_tag LOCUS_10410 1385 1020 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_10410 1543 2838 gene locus_tag LOCUS_10420 1543 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 2975 2841 gene locus_tag LOCUS_10430 2975 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 3065 4000 gene locus_tag LOCUS_10440 3065 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4038 4724 gene locus_tag LOCUS_10450 4038 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4734 5888 gene locus_tag LOCUS_10460 4734 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 6671 5889 gene locus_tag LOCUS_10470 6671 5889 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_10470 7957 6731 gene locus_tag LOCUS_10480 7957 6731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 8042 10249 gene locus_tag LOCUS_10490 8042 10249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 10254 11948 gene locus_tag LOCUS_10500 10254 11948 CDS product sodium:calcium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869470.1 protein_id gnl|my_center|LOCUS_10500 12064 13275 gene locus_tag LOCUS_10510 gene hisS 12064 13275 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWM3 protein_id gnl|my_center|LOCUS_10510 >Feature sequence049 1098 1024 gene locus_tag LOCUS_t00250 1098 1024 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1303 2313 gene locus_tag LOCUS_10520 gene glnII 1303 2313 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_10520 2330 3643 gene locus_tag LOCUS_10530 2330 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 6702 3640 gene locus_tag LOCUS_10540 6702 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 7175 6756 gene locus_tag LOCUS_10550 7175 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 7328 8224 gene locus_tag LOCUS_10560 7328 8224 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_10560 8230 9534 gene locus_tag LOCUS_10570 8230 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 9627 10445 gene locus_tag LOCUS_10580 9627 10445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808871.1 protein_id gnl|my_center|LOCUS_10580 11742 10450 gene locus_tag LOCUS_10590 11742 10450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 12316 11774 gene locus_tag LOCUS_10600 12316 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence050 856 242 gene locus_tag LOCUS_10610 856 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 993 3569 gene locus_tag LOCUS_10620 993 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3623 3991 gene locus_tag LOCUS_10630 3623 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 4028 5602 gene locus_tag LOCUS_10640 4028 5602 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_10640 5957 5589 gene locus_tag LOCUS_10650 5957 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6056 7684 gene locus_tag LOCUS_10660 gene purH 6056 7684 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLE5 protein_id gnl|my_center|LOCUS_10660 7711 8364 gene locus_tag LOCUS_10670 gene purN 7711 8364 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CJJ9 protein_id gnl|my_center|LOCUS_10670 8965 8348 gene locus_tag LOCUS_10680 gene mobA 8965 8348 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44899 protein_id gnl|my_center|LOCUS_10680 9185 8976 gene locus_tag LOCUS_10690 9185 8976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 9855 9223 gene locus_tag LOCUS_10700 9855 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 10266 9865 gene locus_tag LOCUS_10710 10266 9865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 10538 11701 gene locus_tag LOCUS_10720 10538 11701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence051 2524 701 gene locus_tag LOCUS_10730 2524 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4296 2530 gene locus_tag LOCUS_10740 4296 2530 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_10740 7212 4336 gene locus_tag LOCUS_10750 7212 4336 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_10750 8513 7284 gene locus_tag LOCUS_10760 8513 7284 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_10760 9516 8545 gene locus_tag LOCUS_10770 9516 8545 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_10770 10959 9526 gene locus_tag LOCUS_10780 10959 9526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence052 <1 993 gene locus_tag LOCUS_10790 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q795M6:putative aminotransferase YugH 2129 1005 gene locus_tag LOCUS_10800 2129 1005 CDS product L-sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142438.1 protein_id gnl|my_center|LOCUS_10800 3381 2107 gene locus_tag LOCUS_10810 gene eno 3381 2107 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYC3 protein_id gnl|my_center|LOCUS_10810 4450 3419 gene locus_tag LOCUS_10820 4450 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 5301 4462 gene locus_tag LOCUS_10830 5301 4462 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIN3 protein_id gnl|my_center|LOCUS_10830 5834 5289 gene locus_tag LOCUS_10840 5834 5289 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_10840 8185 5879 gene locus_tag LOCUS_10850 8185 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 8803 8279 gene locus_tag LOCUS_10860 8803 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 8988 11600 gene locus_tag LOCUS_10870 8988 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 11882 11601 gene locus_tag LOCUS_10880 11882 11601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence053 3398 204 gene locus_tag LOCUS_10890 gene ileS 3398 204 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ES0 protein_id gnl|my_center|LOCUS_10890 3606 8816 gene locus_tag LOCUS_10900 3606 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 8860 9651 gene locus_tag LOCUS_10910 gene nadE 8860 9651 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_10910 >Feature sequence054 2820 2179 gene locus_tag LOCUS_10920 2820 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 5448 2863 gene locus_tag LOCUS_10930 gene citB 5448 2863 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_10930 6618 5584 gene locus_tag LOCUS_10940 6618 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 6779 8566 gene locus_tag LOCUS_10950 6779 8566 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_10950 8563 9618 gene locus_tag LOCUS_10960 8563 9618 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_10960 9676 10581 gene locus_tag LOCUS_10970 9676 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence055 <1 1119 gene locus_tag LOCUS_10980 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870516.1:3-isopropylmalate dehydratase large subunit 1248 3323 gene locus_tag LOCUS_10990 1248 3323 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_10990 3320 4417 gene locus_tag LOCUS_11000 3320 4417 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_11000 4442 5317 gene locus_tag LOCUS_11010 4442 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 5374 6126 gene locus_tag LOCUS_11020 5374 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 6341 6141 gene locus_tag LOCUS_11030 6341 6141 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082425.1 protein_id gnl|my_center|LOCUS_11030 10561 6434 gene locus_tag LOCUS_11040 10561 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence056 <1 3936 gene locus_tag LOCUS_11050 <1 3936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CMP4:serine-aspartate repeat-containing protein F 4420 3956 gene locus_tag LOCUS_11060 4420 3956 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_11060 5088 4444 gene locus_tag LOCUS_11070 5088 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124032.1 protein_id gnl|my_center|LOCUS_11070 5329 5090 gene locus_tag LOCUS_11080 5329 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 6492 5323 gene locus_tag LOCUS_11090 6492 5323 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_11090 7081 6593 gene locus_tag LOCUS_11100 7081 6593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 8159 7092 gene locus_tag LOCUS_11110 8159 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 10929 8161 gene locus_tag LOCUS_11120 10929 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence057 3131 1545 gene locus_tag LOCUS_11130 gene gltB2 3131 1545 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_11130 5101 3224 gene locus_tag LOCUS_11140 gene dnaK 5101 3224 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_11140 5730 5104 gene locus_tag LOCUS_11150 5730 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5879 7504 gene locus_tag LOCUS_11160 5879 7504 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_11160 8456 7506 gene locus_tag LOCUS_11170 8456 7506 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403161.1 protein_id gnl|my_center|LOCUS_11170 8559 10238 gene locus_tag LOCUS_11180 gene pyrG 8559 10238 CDS product CTP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_11180 >Feature sequence058 205 1134 gene locus_tag LOCUS_11190 gene trxB 205 1134 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_11190 1144 2199 gene locus_tag LOCUS_11200 1144 2199 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_11200 2279 3289 gene locus_tag LOCUS_11210 2279 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4618 3290 gene locus_tag LOCUS_11220 4618 3290 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146536.1 protein_id gnl|my_center|LOCUS_11220 4724 5341 gene locus_tag LOCUS_11230 gene udk 4724 5341 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_11230 8392 5345 gene locus_tag LOCUS_11240 8392 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 >Feature sequence059 2487 1252 gene locus_tag LOCUS_11250 2487 1252 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_11250 2582 3319 gene locus_tag LOCUS_11260 2582 3319 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_11260 3331 5640 gene locus_tag LOCUS_11270 gene uvrB 3331 5640 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229241.1 protein_id gnl|my_center|LOCUS_11270 5642 6247 gene locus_tag LOCUS_11280 5642 6247 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022648.1 protein_id gnl|my_center|LOCUS_11280 6305 8608 gene locus_tag LOCUS_11290 6305 8608 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886756.1 protein_id gnl|my_center|LOCUS_11290 9049 8624 gene locus_tag LOCUS_11300 9049 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence060 940 170 gene locus_tag LOCUS_11310 940 170 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK20 protein_id gnl|my_center|LOCUS_11310 1432 965 gene locus_tag LOCUS_11320 1432 965 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_11320 2091 1450 gene locus_tag LOCUS_11330 2091 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2160 4901 gene locus_tag LOCUS_11340 2160 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4928 7525 gene locus_tag LOCUS_11350 4928 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 7522 8769 gene locus_tag LOCUS_11360 7522 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence061 1600 428 gene locus_tag LOCUS_11370 1600 428 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_11370 1715 2125 gene locus_tag LOCUS_11380 gene gcvH 1715 2125 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZZ94 protein_id gnl|my_center|LOCUS_11380 3291 2122 gene locus_tag LOCUS_11390 3291 2122 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_11390 3849 3313 gene locus_tag LOCUS_11400 3849 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 4001 5182 gene locus_tag LOCUS_11410 4001 5182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 5245 6417 gene locus_tag LOCUS_11420 gene gcdH 5245 6417 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence062 1334 912 gene locus_tag LOCUS_11430 1334 912 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_11430 2956 1343 gene locus_tag LOCUS_11440 2956 1343 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_11440 3554 3024 gene locus_tag LOCUS_11450 3554 3024 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_11450 4444 3560 gene locus_tag LOCUS_11460 4444 3560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5536 4499 gene locus_tag LOCUS_11470 5536 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5588 6907 gene locus_tag LOCUS_11480 gene hutI 5588 6907 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ7 protein_id gnl|my_center|LOCUS_11480 6975 7274 gene locus_tag LOCUS_11490 6975 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 7745 7818 gene locus_tag LOCUS_t00260 7745 7818 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8210 7869 gene locus_tag LOCUS_11500 8210 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence063 <1 2846 gene locus_tag LOCUS_11510 <1 2846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CPY9:UvrABC system protein A 2941 5982 gene locus_tag LOCUS_11520 gene purSL 2941 5982 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN9 protein_id gnl|my_center|LOCUS_11520 5984 6805 gene locus_tag LOCUS_11530 gene purQ 5984 6805 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG61 protein_id gnl|my_center|LOCUS_11530 6819 8099 gene locus_tag LOCUS_11540 6819 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence064 1151 936 gene locus_tag LOCUS_11550 1151 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2400 1213 gene locus_tag LOCUS_11560 2400 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2475 3026 gene locus_tag LOCUS_11570 2475 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3023 3562 gene locus_tag LOCUS_11580 3023 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 6090 3559 gene locus_tag LOCUS_11590 6090 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 6210 6473 gene locus_tag LOCUS_11600 6210 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 6478 7881 gene locus_tag LOCUS_11610 6478 7881 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_11610 8157 7885 gene locus_tag LOCUS_11620 8157 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence065 1341 154 gene locus_tag LOCUS_11630 1341 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 1280 2095 gene locus_tag LOCUS_11640 1280 2095 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877476.1 protein_id gnl|my_center|LOCUS_11640 2097 3794 gene locus_tag LOCUS_11650 2097 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4980 3802 gene locus_tag LOCUS_11660 4980 3802 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_11660 5128 6510 gene locus_tag LOCUS_11670 5128 6510 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_11670 6520 7305 gene locus_tag LOCUS_11680 6520 7305 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X264 protein_id gnl|my_center|LOCUS_11680 8133 7285 gene locus_tag LOCUS_11690 8133 7285 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 protein_id gnl|my_center|LOCUS_11690 8266 8191 gene locus_tag LOCUS_t00270 8266 8191 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8516 8625 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tcctagtggcggtccaccaa >Feature sequence066 1507 920 gene locus_tag LOCUS_11700 1507 920 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_11700 1600 1752 gene locus_tag LOCUS_11710 1600 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1925 6259 gene locus_tag LOCUS_11720 1925 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 6370 7500 gene locus_tag LOCUS_11730 6370 7500 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020715.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence067 711 181 gene locus_tag LOCUS_11740 711 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1686 808 gene locus_tag LOCUS_11750 1686 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 2152 1739 gene locus_tag LOCUS_11760 2152 1739 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479871.1 protein_id gnl|my_center|LOCUS_11760 2278 2739 gene locus_tag LOCUS_11770 2278 2739 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_11770 2745 4121 gene locus_tag LOCUS_11780 2745 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 4966 4106 gene locus_tag LOCUS_11790 4966 4106 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940877.1 protein_id gnl|my_center|LOCUS_11790 5584 5012 gene locus_tag LOCUS_11800 5584 5012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 5659 6807 gene locus_tag LOCUS_11810 gene caiA 5659 6807 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_11810 7997 6810 gene locus_tag LOCUS_11820 gene yrbG 7997 6810 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence068 689 417 gene locus_tag LOCUS_11830 689 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1197 706 gene locus_tag LOCUS_11840 gene bcp 1197 706 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_11840 1369 1764 gene locus_tag LOCUS_11850 1369 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1757 6550 gene locus_tag LOCUS_11860 1757 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6534 7730 gene locus_tag LOCUS_11870 6534 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence069 413 1327 gene locus_tag LOCUS_11880 413 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 1269 1868 gene locus_tag LOCUS_11890 1269 1868 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_11890 1871 2785 gene locus_tag LOCUS_11900 1871 2785 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_11900 5062 2975 gene locus_tag LOCUS_11910 5062 2975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 5224 5298 gene locus_tag LOCUS_t00280 5224 5298 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 6183 5320 gene locus_tag LOCUS_11920 6183 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6311 6982 gene locus_tag LOCUS_11930 6311 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 <7653 6983 gene locus_tag LOCUS_11940 <7653 6983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97FI9:ATP-dependent RNA helicase DbpA >Feature sequence070 418 1398 gene locus_tag LOCUS_11950 gene putA 418 1398 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_11950 2077 1400 gene locus_tag LOCUS_11960 2077 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2157 2876 gene locus_tag LOCUS_11970 2157 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 4056 2869 gene locus_tag LOCUS_11980 4056 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5258 4107 gene locus_tag LOCUS_11990 5258 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 5429 5357 gene locus_tag LOCUS_t00290 5429 5357 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5523 5605 gene locus_tag LOCUS_t00300 5523 5605 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence071 976 1791 gene locus_tag LOCUS_12000 976 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1782 2552 gene locus_tag LOCUS_12010 1782 2552 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812647.1 protein_id gnl|my_center|LOCUS_12010 2557 4218 gene locus_tag LOCUS_12020 2557 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4275 5588 gene locus_tag LOCUS_12030 4275 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7017 5575 gene locus_tag LOCUS_12040 7017 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence072 414 489 gene locus_tag LOCUS_t00310 414 489 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 545 1261 gene locus_tag LOCUS_12050 545 1261 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194759.1 protein_id gnl|my_center|LOCUS_12050 1258 4881 gene locus_tag LOCUS_12060 1258 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4884 5897 gene locus_tag LOCUS_12070 4884 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 5899 6450 gene locus_tag LOCUS_12080 5899 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 6472 6768 gene locus_tag LOCUS_12090 6472 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence073 924 1853 gene locus_tag LOCUS_12100 gene tfb 924 1853 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_12100 1879 3270 gene locus_tag LOCUS_12110 1879 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4133 3252 gene locus_tag LOCUS_12120 gene galF 4133 3252 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67602 protein_id gnl|my_center|LOCUS_12120 4188 4619 gene locus_tag LOCUS_12130 4188 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 5073 4633 gene locus_tag LOCUS_12140 5073 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 5189 5662 gene locus_tag LOCUS_12150 5189 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 6577 5663 gene locus_tag LOCUS_12160 6577 5663 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence074 1030 221 gene locus_tag LOCUS_12170 1030 221 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_12170 1844 1080 gene locus_tag LOCUS_12180 1844 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2052 1849 gene locus_tag LOCUS_12190 2052 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2431 3744 gene locus_tag LOCUS_12200 2431 3744 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_12200 4268 3873 gene locus_tag LOCUS_12210 4268 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5355 6152 gene locus_tag LOCUS_12220 5355 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence075 5247 5816 gene locus_tag LOCUS_12230 5247 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence076 2874 3422 gene locus_tag LOCUS_12240 2874 3422 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_12240 3423 3638 gene locus_tag LOCUS_12250 3423 3638 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903509.1 protein_id gnl|my_center|LOCUS_12250 3643 3969 gene locus_tag LOCUS_12260 3643 3969 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868806.1 protein_id gnl|my_center|LOCUS_12260 3969 4163 gene locus_tag LOCUS_12270 3969 4163 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_12270 5081 4164 gene locus_tag LOCUS_12280 5081 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 >Feature sequence077 149 877 gene locus_tag LOCUS_12290 149 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1028 1432 gene locus_tag LOCUS_12300 1028 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1494 3005 gene locus_tag LOCUS_12310 1494 3005 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_12310 3010 3663 gene locus_tag LOCUS_12320 3010 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3693 4028 gene locus_tag LOCUS_12330 3693 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_12330 4037 4540 gene locus_tag LOCUS_12340 4037 4540 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_12340 4537 4956 gene locus_tag LOCUS_12350 4537 4956 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249794.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence078 110 1105 gene locus_tag LOCUS_12360 110 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1092 1568 gene locus_tag LOCUS_12370 1092 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1923 1573 gene locus_tag LOCUS_12380 1923 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 2786 1974 gene locus_tag LOCUS_12390 2786 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3286 2807 gene locus_tag LOCUS_12400 3286 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_12400 4067 3330 gene locus_tag LOCUS_12410 4067 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 4819 4082 gene locus_tag LOCUS_12420 4819 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 <5617 4856 gene locus_tag LOCUS_12430 <5617 4856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144121.1:ABC transporter >Feature sequence079 1103 345 gene locus_tag LOCUS_12440 1103 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1278 2495 gene locus_tag LOCUS_12450 1278 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 2538 4097 gene locus_tag LOCUS_12460 gene crtI 2538 4097 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_12460 4098 4541 gene locus_tag LOCUS_12470 4098 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5539 4523 gene locus_tag LOCUS_12480 5539 4523 CDS product squalene synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688576.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence080 512 6 gene locus_tag LOCUS_12490 512 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 952 647 gene locus_tag LOCUS_12500 952 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1993 980 gene locus_tag LOCUS_12510 1993 980 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_12510 2637 1993 gene locus_tag LOCUS_12520 2637 1993 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_12520 2968 2693 gene locus_tag LOCUS_12530 2968 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 3971 3030 gene locus_tag LOCUS_12540 3971 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4251 3982 gene locus_tag LOCUS_12550 4251 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence081 352 1029 gene locus_tag LOCUS_12560 352 1029 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_12560 2078 1047 gene locus_tag LOCUS_12570 gene lpqC 2078 1047 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_12570 2523 2143 gene locus_tag LOCUS_12580 2523 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 3699 2623 gene locus_tag LOCUS_12590 3699 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4633 3692 gene locus_tag LOCUS_12600 4633 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583118.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence082 626 12 gene locus_tag LOCUS_12610 gene folE 626 12 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYB4 protein_id gnl|my_center|LOCUS_12610 759 586 gene locus_tag LOCUS_12620 759 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 2050 815 gene locus_tag LOCUS_12630 2050 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2885 2052 gene locus_tag LOCUS_12640 2885 2052 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398469.1 protein_id gnl|my_center|LOCUS_12640 3915 2938 gene locus_tag LOCUS_12650 3915 2938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181919.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence083 1794 493 gene locus_tag LOCUS_12660 1794 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2520 1825 gene locus_tag LOCUS_12670 2520 1825 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762843.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence084 <1 1131 gene locus_tag LOCUS_12680 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023974.1:calcium-translocating P-type ATPase, SERCA-type 3559 1133 gene locus_tag LOCUS_12690 3559 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence085 73 1 gene locus_tag LOCUS_t00320 73 1 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 229 504 gene locus_tag LOCUS_12700 229 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 501 761 gene locus_tag LOCUS_12710 501 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 807 1712 gene locus_tag LOCUS_12720 807 1712 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_12720 2662 1709 gene locus_tag LOCUS_12730 2662 1709 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_12730 3515 2712 gene locus_tag LOCUS_12740 3515 2712 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence086 676 431 gene locus_tag LOCUS_12750 676 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 811 1233 gene locus_tag LOCUS_12760 811 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1279 2103 gene locus_tag LOCUS_12770 gene galK 1279 2103 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEY0 protein_id gnl|my_center|LOCUS_12770 <3539 2071 gene locus_tag LOCUS_12780 <3539 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582847.1:beta-glucosidase >Feature sequence087 3432 3506 gene locus_tag LOCUS_t00330 3432 3506 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence088 >Feature sequence089 2756 1077 gene locus_tag LOCUS_12790 gene glmM 2756 1077 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FL35 protein_id gnl|my_center|LOCUS_12790 <3323 2767 gene locus_tag LOCUS_12800 <3323 2767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583981.1:glucose-1-phosphate thymidylyltransferase >Feature sequence090 406 939 gene locus_tag LOCUS_12810 gene grpE 406 939 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q835R8 protein_id gnl|my_center|LOCUS_12810 1554 940 gene locus_tag LOCUS_12820 1554 940 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_12820 2837 1551 gene locus_tag LOCUS_12830 2837 1551 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence091 101 2800 gene locus_tag LOCUS_12840 101 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence092 357 282 gene locus_tag LOCUS_t00340 357 282 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 487 1932 gene locus_tag LOCUS_12850 487 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence093 186 776 gene locus_tag LOCUS_12860 186 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869554.1 protein_id gnl|my_center|LOCUS_12860 755 1768 gene locus_tag LOCUS_12870 755 1768 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_12870 2048 2563 gene locus_tag LOCUS_12880 2048 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence094 580 1497 gene locus_tag LOCUS_12890 580 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1578 2669 gene locus_tag LOCUS_12900 1578 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence095 >Feature sequence096 284 586 gene locus_tag LOCUS_12910 284 586 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583590.1 protein_id gnl|my_center|LOCUS_12910 595 1947 gene locus_tag LOCUS_12920 595 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence097 1885 1082 gene locus_tag LOCUS_12930 gene fabG 1885 1082 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 protein_id gnl|my_center|LOCUS_12930 1937 2269 gene locus_tag LOCUS_12940 1937 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence098 >Feature sequence099 1089 2090 gene locus_tag LOCUS_12950 1089 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence100 >Feature sequence101 566 1681 gene locus_tag LOCUS_12960 566 1681 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence102 521 141 gene locus_tag LOCUS_12970 521 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024037.1 protein_id gnl|my_center|LOCUS_12970 1666 560 gene locus_tag LOCUS_12980 gene pyrD 1666 560 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_12980 >Feature sequence103 728 417 gene locus_tag LOCUS_12990 728 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1797 844 gene locus_tag LOCUS_13000 1797 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1987 1913 gene locus_tag LOCUS_t00350 1987 1913 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence104