>Feature sequence001 1871 1026 gene locus_tag LOCUS_00010 1871 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2712 1882 gene locus_tag LOCUS_00020 2712 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3765 2809 gene locus_tag LOCUS_00030 3765 2809 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_00030 3910 4944 gene locus_tag LOCUS_00040 3910 4944 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5X0 protein_id gnl|my_center|LOCUS_00040 5008 5634 gene locus_tag LOCUS_00050 5008 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10460 5631 gene locus_tag LOCUS_00060 10460 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 14086 10460 gene locus_tag LOCUS_00070 14086 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 14220 15137 gene locus_tag LOCUS_00080 14220 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16172 15126 gene locus_tag LOCUS_00090 16172 15126 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_00090 16627 16214 gene locus_tag LOCUS_00100 16627 16214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17016 16642 gene locus_tag LOCUS_00110 17016 16642 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_00110 17650 16994 gene locus_tag LOCUS_00120 17650 16994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 19388 17691 gene locus_tag LOCUS_00130 19388 17691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21424 19394 gene locus_tag LOCUS_00140 21424 19394 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_00140 23595 21469 gene locus_tag LOCUS_00150 23595 21469 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_00150 23794 24567 gene locus_tag LOCUS_00160 23794 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 >Feature sequence002 1280 603 gene locus_tag LOCUS_00170 1280 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 1638 1354 gene locus_tag LOCUS_00180 1638 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 2542 1631 gene locus_tag LOCUS_00190 2542 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 3337 2552 gene locus_tag LOCUS_00200 3337 2552 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X264 protein_id gnl|my_center|LOCUS_00200 4713 3346 gene locus_tag LOCUS_00210 4713 3346 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_00210 4816 5799 gene locus_tag LOCUS_00220 4816 5799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002195333.1 protein_id gnl|my_center|LOCUS_00220 5842 7020 gene locus_tag LOCUS_00230 5842 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 7092 8282 gene locus_tag LOCUS_00240 7092 8282 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_00240 10027 8279 gene locus_tag LOCUS_00250 10027 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 10751 10083 gene locus_tag LOCUS_00260 10751 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 10883 11710 gene locus_tag LOCUS_00270 10883 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 13830 11719 gene locus_tag LOCUS_00280 13830 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 14713 13835 gene locus_tag LOCUS_00290 14713 13835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 14751 15845 gene locus_tag LOCUS_00300 14751 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 16054 16473 gene locus_tag LOCUS_00310 16054 16473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_00310 16950 16480 gene locus_tag LOCUS_00320 16950 16480 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_00320 17078 17557 gene locus_tag LOCUS_00330 17078 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 >Feature sequence003 451 1077 gene locus_tag LOCUS_00340 451 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 1611 1078 gene locus_tag LOCUS_00350 1611 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 2122 1616 gene locus_tag LOCUS_00360 2122 1616 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_00360 2253 3479 gene locus_tag LOCUS_00370 2253 3479 CDS product deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183315.1 protein_id gnl|my_center|LOCUS_00370 4736 3480 gene locus_tag LOCUS_00380 4736 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 7584 4807 gene locus_tag LOCUS_00390 gene gyrA 7584 4807 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TL9 protein_id gnl|my_center|LOCUS_00390 9523 7574 gene locus_tag LOCUS_00400 gene gyrB 9523 7574 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05652 protein_id gnl|my_center|LOCUS_00400 9805 10602 gene locus_tag LOCUS_00410 gene aroD 9805 10602 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24670 protein_id gnl|my_center|LOCUS_00410 11728 10610 gene locus_tag LOCUS_00420 11728 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 16002 11776 gene locus_tag LOCUS_00430 16002 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 16089 17315 gene locus_tag LOCUS_00440 16089 17315 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_00440 >Feature sequence004 2407 1481 gene locus_tag LOCUS_00450 gene tfb 2407 1481 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_00450 2566 4593 gene locus_tag LOCUS_00460 2566 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 4599 5297 gene locus_tag LOCUS_00470 4599 5297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5397 7487 gene locus_tag LOCUS_00480 5397 7487 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_00480 7487 8584 gene locus_tag LOCUS_00490 7487 8584 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_00490 8625 9650 gene locus_tag LOCUS_00500 8625 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 9659 10243 gene locus_tag LOCUS_00510 9659 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 10286 11032 gene locus_tag LOCUS_00520 10286 11032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 16203 11035 gene locus_tag LOCUS_00530 16203 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence005 960 1856 gene locus_tag LOCUS_00540 960 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 1957 3216 gene locus_tag LOCUS_00550 1957 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 3361 5676 gene locus_tag LOCUS_00560 3361 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 5681 6769 gene locus_tag LOCUS_00570 5681 6769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 6779 7894 gene locus_tag LOCUS_00580 6779 7894 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023817.1 protein_id gnl|my_center|LOCUS_00580 7887 8735 gene locus_tag LOCUS_00590 7887 8735 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023376.1 protein_id gnl|my_center|LOCUS_00590 8739 9188 gene locus_tag LOCUS_00600 8739 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 9202 10035 gene locus_tag LOCUS_00610 9202 10035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 10090 10758 gene locus_tag LOCUS_00620 gene phnC 10090 10758 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73P71 protein_id gnl|my_center|LOCUS_00620 10763 11662 gene locus_tag LOCUS_00630 10763 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 12895 11675 gene locus_tag LOCUS_00640 12895 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 14104 12899 gene locus_tag LOCUS_00650 14104 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 14428 14213 gene locus_tag LOCUS_00660 14428 14213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence006 2622 964 gene locus_tag LOCUS_00670 2622 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 3335 2628 gene locus_tag LOCUS_00680 3335 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 3624 3373 gene locus_tag LOCUS_00690 3624 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4405 3698 gene locus_tag LOCUS_00700 4405 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4904 4545 gene locus_tag LOCUS_00710 4904 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 5039 5527 gene locus_tag LOCUS_00720 5039 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 6646 5528 gene locus_tag LOCUS_00730 6646 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_00730 7969 6728 gene locus_tag LOCUS_00740 7969 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 8046 8777 gene locus_tag LOCUS_00750 8046 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 9850 8774 gene locus_tag LOCUS_00760 9850 8774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10796 9909 gene locus_tag LOCUS_00770 10796 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 12220 10817 gene locus_tag LOCUS_00780 12220 10817 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762823.1 protein_id gnl|my_center|LOCUS_00780 12245 12463 gene locus_tag LOCUS_00790 12245 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 >Feature sequence007 1109 750 gene locus_tag LOCUS_00800 1109 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 1193 2008 gene locus_tag LOCUS_00810 1193 2008 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_00810 3187 2003 gene locus_tag LOCUS_00820 3187 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 3276 4076 gene locus_tag LOCUS_00830 3276 4076 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496393.1 protein_id gnl|my_center|LOCUS_00830 4637 4059 gene locus_tag LOCUS_00840 4637 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 5701 4634 gene locus_tag LOCUS_00850 5701 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 8240 5694 gene locus_tag LOCUS_00860 8240 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 10425 8302 gene locus_tag LOCUS_00870 gene ligA 10425 8302 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CPN5 protein_id gnl|my_center|LOCUS_00870 10885 10457 gene locus_tag LOCUS_00880 10885 10457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 11465 10923 gene locus_tag LOCUS_00890 11465 10923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 >Feature sequence008 226 495 gene locus_tag LOCUS_00900 226 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 510 2693 gene locus_tag LOCUS_00910 510 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 2706 3989 gene locus_tag LOCUS_00920 gene ychF 2706 3989 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_00920 4372 3986 gene locus_tag LOCUS_00930 4372 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6665 4410 gene locus_tag LOCUS_00940 6665 4410 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529939.1 protein_id gnl|my_center|LOCUS_00940 7432 6647 gene locus_tag LOCUS_00950 7432 6647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence009 <1 852 gene locus_tag LOCUS_00960 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024425.1:DNA polymerase II 2445 853 gene locus_tag LOCUS_00970 gene fumC 2445 853 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CL8 protein_id gnl|my_center|LOCUS_00970 3454 2480 gene locus_tag LOCUS_00980 3454 2480 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065126.1 protein_id gnl|my_center|LOCUS_00980 3940 3458 gene locus_tag LOCUS_00990 3940 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 7498 3983 gene locus_tag LOCUS_01000 7498 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8666 7650 gene locus_tag LOCUS_01010 8666 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 10358 8754 gene locus_tag LOCUS_01020 gene pckA1 10358 8754 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I3 protein_id gnl|my_center|LOCUS_01020 >Feature sequence010 <1 1156 gene locus_tag LOCUS_01030 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439447.1:membrane protein 1249 4749 gene locus_tag LOCUS_01040 1249 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4763 6145 gene locus_tag LOCUS_01050 4763 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 6193 6858 gene locus_tag LOCUS_01060 6193 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 6922 7818 gene locus_tag LOCUS_01070 6922 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 12008 7896 gene locus_tag LOCUS_01080 12008 7896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 >Feature sequence011 2435 4759 gene locus_tag LOCUS_01090 2435 4759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5782 4832 gene locus_tag LOCUS_01100 5782 4832 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_01100 6263 5784 gene locus_tag LOCUS_01110 6263 5784 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_01110 6971 6300 gene locus_tag LOCUS_01120 6971 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8473 6974 gene locus_tag LOCUS_01130 gene gcvPB 8473 6974 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH49 protein_id gnl|my_center|LOCUS_01130 9846 8470 gene locus_tag LOCUS_01140 9846 8470 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_01140 11048 9936 gene locus_tag LOCUS_01150 11048 9936 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903168.1 protein_id gnl|my_center|LOCUS_01150 12510 11086 gene locus_tag LOCUS_01160 12510 11086 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence012 12195 9133 gene locus_tag LOCUS_01170 12195 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence013 43 918 gene locus_tag LOCUS_01180 gene hbd 43 918 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52041 protein_id gnl|my_center|LOCUS_01180 1697 900 gene locus_tag LOCUS_01190 1697 900 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_01190 3143 1707 gene locus_tag LOCUS_01200 gene dhaS 3143 1707 CDS product putative aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34660 protein_id gnl|my_center|LOCUS_01200 3260 3922 gene locus_tag LOCUS_01210 3260 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4349 3912 gene locus_tag LOCUS_01220 4349 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4723 4349 gene locus_tag LOCUS_01230 4723 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6411 4801 gene locus_tag LOCUS_01240 6411 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7332 6421 gene locus_tag LOCUS_01250 7332 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 8988 7456 gene locus_tag LOCUS_01260 8988 7456 CDS product secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_01260 9655 9086 gene locus_tag LOCUS_01270 9655 9086 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_01270 11425 9728 gene locus_tag LOCUS_01280 11425 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 <11994 11428 gene locus_tag LOCUS_01290 <11994 11428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022197.1:ABC transporter ATP-binding protein >Feature sequence014 2154 76 gene locus_tag LOCUS_01300 2154 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 2588 2238 gene locus_tag LOCUS_01310 2588 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3605 2598 gene locus_tag LOCUS_01320 3605 2598 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHR4 protein_id gnl|my_center|LOCUS_01320 3979 3626 gene locus_tag LOCUS_01330 3979 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 4120 4434 gene locus_tag LOCUS_01340 4120 4434 CDS product low molecular weight phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007781386.1 protein_id gnl|my_center|LOCUS_01340 4755 4435 gene locus_tag LOCUS_01350 4755 4435 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867516.1 protein_id gnl|my_center|LOCUS_01350 4890 4816 gene locus_tag LOCUS_t00010 4890 4816 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8040 4942 gene locus_tag LOCUS_01360 8040 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8216 10225 gene locus_tag LOCUS_01370 gene thrS 8216 10225 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT8 protein_id gnl|my_center|LOCUS_01370 >Feature sequence015 2851 131 gene locus_tag LOCUS_01380 2851 131 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776763.1 protein_id gnl|my_center|LOCUS_01380 3590 2856 gene locus_tag LOCUS_01390 3590 2856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_01390 4954 3587 gene locus_tag LOCUS_01400 4954 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5071 6261 gene locus_tag LOCUS_01410 5071 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 6273 8543 gene locus_tag LOCUS_01420 6273 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 8545 10236 gene locus_tag LOCUS_01430 8545 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 10386 10237 gene locus_tag LOCUS_01440 10386 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence016 1090 35 gene locus_tag LOCUS_01450 1090 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1189 2382 gene locus_tag LOCUS_01460 gene rimK 1189 2382 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_01460 2427 4700 gene locus_tag LOCUS_01470 2427 4700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 4811 5902 gene locus_tag LOCUS_01480 4811 5902 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_01480 6665 6123 gene locus_tag LOCUS_01490 6665 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 6747 7619 gene locus_tag LOCUS_01500 6747 7619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 7695 7886 gene locus_tag LOCUS_01510 7695 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 8244 7888 gene locus_tag LOCUS_01520 8244 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 9694 8351 gene locus_tag LOCUS_01530 9694 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 >Feature sequence017 241 1647 gene locus_tag LOCUS_01540 241 1647 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_01540 1644 2684 gene locus_tag LOCUS_01550 1644 2684 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181161.1 protein_id gnl|my_center|LOCUS_01550 2687 3874 gene locus_tag LOCUS_01560 gene sufS 2687 3874 CDS product cysteine desulfurase SufS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32164 protein_id gnl|my_center|LOCUS_01560 3871 4281 gene locus_tag LOCUS_01570 3871 4281 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_01570 4290 4607 gene locus_tag LOCUS_01580 gene paaD 4290 4607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395580.1 protein_id gnl|my_center|LOCUS_01580 5719 4604 gene locus_tag LOCUS_01590 5719 4604 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_01590 9050 5802 gene locus_tag LOCUS_01600 9050 5802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9196 9534 gene locus_tag LOCUS_01610 9196 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9592 10284 gene locus_tag LOCUS_01620 9592 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence018 1282 314 gene locus_tag LOCUS_01630 1282 314 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947357.1 protein_id gnl|my_center|LOCUS_01630 2914 1292 gene locus_tag LOCUS_01640 2914 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 3630 2917 gene locus_tag LOCUS_01650 3630 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 4670 3621 gene locus_tag LOCUS_01660 4670 3621 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729427.1 protein_id gnl|my_center|LOCUS_01660 4803 5552 gene locus_tag LOCUS_01670 4803 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_01670 6163 5555 gene locus_tag LOCUS_01680 6163 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6307 7503 gene locus_tag LOCUS_01690 6307 7503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 8048 7500 gene locus_tag LOCUS_01700 8048 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence019 764 549 gene locus_tag LOCUS_01710 764 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 2129 831 gene locus_tag LOCUS_01720 2129 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2213 2815 gene locus_tag LOCUS_01730 2213 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 5380 2804 gene locus_tag LOCUS_01740 5380 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 5531 5788 gene locus_tag LOCUS_01750 5531 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5800 7200 gene locus_tag LOCUS_01760 5800 7200 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_01760 7473 7201 gene locus_tag LOCUS_01770 7473 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 7653 7483 gene locus_tag LOCUS_01780 7653 7483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 8089 7745 gene locus_tag LOCUS_01790 8089 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 8857 8120 gene locus_tag LOCUS_01800 gene rlmE 8857 8120 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDL2 protein_id gnl|my_center|LOCUS_01800 8960 9898 gene locus_tag LOCUS_01810 8960 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 9993 10262 gene locus_tag LOCUS_01820 9993 10262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 >Feature sequence020 746 237 gene locus_tag LOCUS_01830 746 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878902.1 protein_id gnl|my_center|LOCUS_01830 824 1426 gene locus_tag LOCUS_01840 824 1426 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382082.1 protein_id gnl|my_center|LOCUS_01840 1482 1862 gene locus_tag LOCUS_01850 1482 1862 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_01850 1899 2360 gene locus_tag LOCUS_01860 1899 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 3380 2361 gene locus_tag LOCUS_01870 gene ilvE 3380 2361 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CN74 protein_id gnl|my_center|LOCUS_01870 3508 4191 gene locus_tag LOCUS_01880 3508 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4245 6926 gene locus_tag LOCUS_01890 4245 6926 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762712.1 protein_id gnl|my_center|LOCUS_01890 7019 8185 gene locus_tag LOCUS_01900 7019 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 8218 9693 gene locus_tag LOCUS_01910 gene pyk 8218 9693 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P2 protein_id gnl|my_center|LOCUS_01910 >Feature sequence021 <1 1112 gene locus_tag LOCUS_01920 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458890.1:ABC transporter substrate-binding protein 1164 2006 gene locus_tag LOCUS_01930 1164 2006 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904122.1 protein_id gnl|my_center|LOCUS_01930 2006 2923 gene locus_tag LOCUS_01940 gene mtsC 2006 2923 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268749.1 protein_id gnl|my_center|LOCUS_01940 3716 2937 gene locus_tag LOCUS_01950 3716 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4457 3729 gene locus_tag LOCUS_01960 gene cobB 4457 3729 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJL6 protein_id gnl|my_center|LOCUS_01960 4578 5591 gene locus_tag LOCUS_01970 4578 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 5639 7201 gene locus_tag LOCUS_01980 5639 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 7212 7967 gene locus_tag LOCUS_01990 7212 7967 CDS product nucleoside-diphosphate-sugar pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966337.1 protein_id gnl|my_center|LOCUS_01990 8759 7935 gene locus_tag LOCUS_02000 gene galK 8759 7935 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0M1 protein_id gnl|my_center|LOCUS_02000 9280 8801 gene locus_tag LOCUS_02010 9280 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence022 687 211 gene locus_tag LOCUS_02020 687 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 2771 702 gene locus_tag LOCUS_02030 2771 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3468 2776 gene locus_tag LOCUS_02040 3468 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 3558 6050 gene locus_tag LOCUS_02050 3558 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 6112 6768 gene locus_tag LOCUS_02060 6112 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 6820 8442 gene locus_tag LOCUS_02070 6820 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 >Feature sequence023 3397 2366 gene locus_tag LOCUS_02080 3397 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4384 3434 gene locus_tag LOCUS_02090 4384 3434 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_02090 4768 4394 gene locus_tag LOCUS_02100 4768 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5780 4794 gene locus_tag LOCUS_02110 5780 4794 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_02110 5946 6368 gene locus_tag LOCUS_02120 5946 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 6422 7822 gene locus_tag LOCUS_02130 6422 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence024 1321 80 gene locus_tag LOCUS_02140 1321 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_02140 1583 2017 gene locus_tag LOCUS_02150 1583 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 2014 2640 gene locus_tag LOCUS_02160 2014 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 2666 2875 gene locus_tag LOCUS_02170 2666 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2875 3405 gene locus_tag LOCUS_02180 2875 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 3916 3356 gene locus_tag LOCUS_02190 gene purN 3916 3356 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CZW4 protein_id gnl|my_center|LOCUS_02190 5682 4045 gene locus_tag LOCUS_02200 gene purH 5682 4045 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ9 protein_id gnl|my_center|LOCUS_02200 7339 5738 gene locus_tag LOCUS_02210 7339 5738 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_02210 >Feature sequence025 1598 603 gene locus_tag LOCUS_02220 1598 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 1674 1940 gene locus_tag LOCUS_02230 1674 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147166.1 protein_id gnl|my_center|LOCUS_02230 3284 1935 gene locus_tag LOCUS_02240 3284 1935 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_02240 5371 3347 gene locus_tag LOCUS_02250 5371 3347 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_02250 <8810 5432 gene locus_tag LOCUS_02260 <8810 5432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118098.1:surface-associated protein cshA precursor >Feature sequence026 370 1155 gene locus_tag LOCUS_02270 370 1155 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250279.1 protein_id gnl|my_center|LOCUS_02270 5187 1156 gene locus_tag LOCUS_02280 5187 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 6548 5298 gene locus_tag LOCUS_02290 gene metK 6548 5298 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F85 protein_id gnl|my_center|LOCUS_02290 6698 8104 gene locus_tag LOCUS_02300 6698 8104 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence027 <1 913 gene locus_tag LOCUS_02310 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459951.1:phosphatase 1702 902 gene locus_tag LOCUS_02320 gene tatC 1702 902 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CIR3 protein_id gnl|my_center|LOCUS_02320 3146 1737 gene locus_tag LOCUS_02330 3146 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 3294 4469 gene locus_tag LOCUS_02340 3294 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5618 4452 gene locus_tag LOCUS_02350 gene gltA 5618 4452 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_02350 6156 5698 gene locus_tag LOCUS_02360 6156 5698 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_02360 8177 6153 gene locus_tag LOCUS_02370 8177 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence028 1890 1579 gene locus_tag LOCUS_02380 1890 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 2732 1986 gene locus_tag LOCUS_02390 gene ubiE 2732 1986 CDS product ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9R7 protein_id gnl|my_center|LOCUS_02390 3580 2777 gene locus_tag LOCUS_02400 3580 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4177 3593 gene locus_tag LOCUS_02410 4177 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4946 4179 gene locus_tag LOCUS_02420 4946 4179 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_02420 6126 5038 gene locus_tag LOCUS_02430 6126 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence029 7694 8137 gene locus_tag LOCUS_02440 7694 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 >Feature sequence030 316 3447 gene locus_tag LOCUS_02450 316 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3462 5984 gene locus_tag LOCUS_02460 3462 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6455 5985 gene locus_tag LOCUS_02470 6455 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 >Feature sequence031 206 2137 gene locus_tag LOCUS_02480 206 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2228 5692 gene locus_tag LOCUS_02490 2228 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 7840 5693 gene locus_tag LOCUS_02500 7840 5693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 >Feature sequence032 1 264 gene locus_tag LOCUS_02510 1 264 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_02510 767 357 gene locus_tag LOCUS_02520 767 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1546 779 gene locus_tag LOCUS_02530 gene sdhB 1546 779 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_02530 3399 1546 gene locus_tag LOCUS_02540 gene sdhA 3399 1546 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_02540 4227 3409 gene locus_tag LOCUS_02550 4227 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_02550 4875 4312 gene locus_tag LOCUS_02560 4875 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 6514 4904 gene locus_tag LOCUS_02570 gene crtI 6514 4904 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_02570 7837 6587 gene locus_tag LOCUS_02580 7837 6587 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence033 995 1252 gene locus_tag LOCUS_02590 995 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1265 2392 gene locus_tag LOCUS_02600 gene rnz 1265 2392 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5S8 protein_id gnl|my_center|LOCUS_02600 2466 4910 gene locus_tag LOCUS_02610 2466 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 >Feature sequence034 660 1673 gene locus_tag LOCUS_02620 660 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 1733 2245 gene locus_tag LOCUS_02630 1733 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2254 3168 gene locus_tag LOCUS_02640 2254 3168 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876473.1 protein_id gnl|my_center|LOCUS_02640 3681 3160 gene locus_tag LOCUS_02650 3681 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3725 4906 gene locus_tag LOCUS_02660 gene kbl 3725 4906 CDS product 8-amino-7-oxononanoate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31777 protein_id gnl|my_center|LOCUS_02660 5524 4907 gene locus_tag LOCUS_02670 5524 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6208 5579 gene locus_tag LOCUS_02680 6208 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence035 4512 1582 gene locus_tag LOCUS_02690 gene uvrA 4512 1582 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34863 protein_id gnl|my_center|LOCUS_02690 5456 4581 gene locus_tag LOCUS_02700 5456 4581 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T90 protein_id gnl|my_center|LOCUS_02700 6670 5465 gene locus_tag LOCUS_02710 gene moeA 6670 5465 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45210 protein_id gnl|my_center|LOCUS_02710 6737 7480 gene locus_tag LOCUS_02720 6737 7480 CDS product UPF0721 transmembrane protein y4hK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55478 protein_id gnl|my_center|LOCUS_02720 >Feature sequence036 588 1679 gene locus_tag LOCUS_02730 588 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1689 2021 gene locus_tag LOCUS_02740 1689 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2030 2197 gene locus_tag LOCUS_02750 2030 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2262 3593 gene locus_tag LOCUS_02760 gene xseA 2262 3593 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UTZ9 protein_id gnl|my_center|LOCUS_02760 3586 3795 gene locus_tag LOCUS_02770 3586 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 4626 3799 gene locus_tag LOCUS_02780 4626 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 5111 4650 gene locus_tag LOCUS_02790 5111 4650 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_02790 5959 5168 gene locus_tag LOCUS_02800 5959 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 >Feature sequence037 790 71 gene locus_tag LOCUS_02810 790 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 899 1432 gene locus_tag LOCUS_02820 899 1432 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868259.1 protein_id gnl|my_center|LOCUS_02820 1507 2211 gene locus_tag LOCUS_02830 1507 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2361 5522 gene locus_tag LOCUS_02840 2361 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5572 6732 gene locus_tag LOCUS_02850 5572 6732 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_02850 6743 7276 gene locus_tag LOCUS_02860 6743 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence038 <1 720 gene locus_tag LOCUS_02870 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EFU2:isocitrate dehydrogenase [NADP] 726 1385 gene locus_tag LOCUS_02880 726 1385 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226486.1 protein_id gnl|my_center|LOCUS_02880 4770 1387 gene locus_tag LOCUS_02890 4770 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4947 5366 gene locus_tag LOCUS_02900 4947 5366 CDS product diadenosine 5'5'''-P1,P4-tetraphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762427.1 protein_id gnl|my_center|LOCUS_02900 6043 5348 gene locus_tag LOCUS_02910 6043 5348 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_02910 6514 6071 gene locus_tag LOCUS_02920 6514 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 6976 6605 gene locus_tag LOCUS_02930 6976 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 7501 7007 gene locus_tag LOCUS_02940 7501 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence039 401 1018 gene locus_tag LOCUS_02950 gene maf 401 1018 CDS product maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA39 protein_id gnl|my_center|LOCUS_02950 2211 1000 gene locus_tag LOCUS_02960 2211 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2940 2350 gene locus_tag LOCUS_02970 2940 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6843 2950 gene locus_tag LOCUS_02980 6843 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence040 2922 1654 gene locus_tag LOCUS_02990 2922 1654 CDS product phosphatidylinositol glycan-class A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022158.1 protein_id gnl|my_center|LOCUS_02990 3031 3801 gene locus_tag LOCUS_03000 3031 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence041 143 1093 gene locus_tag LOCUS_03010 143 1093 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_03010 1093 1569 gene locus_tag LOCUS_03020 1093 1569 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_03020 1673 2716 gene locus_tag LOCUS_03030 1673 2716 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118010.1 protein_id gnl|my_center|LOCUS_03030 2792 3142 gene locus_tag LOCUS_03040 2792 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4155 3145 gene locus_tag LOCUS_03050 4155 3145 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_03050 4463 4804 gene locus_tag LOCUS_03060 4463 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence042 85 11 gene locus_tag LOCUS_t00020 85 11 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5616 133 gene locus_tag LOCUS_03070 5616 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5611 5760 gene locus_tag LOCUS_03080 5611 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence043 5820 6602 gene locus_tag LOCUS_03090 5820 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6934 6605 gene locus_tag LOCUS_03100 6934 6605 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence044 <1 4567 gene locus_tag LOCUS_03110 <1 4567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase 4579 5346 gene locus_tag LOCUS_03120 4579 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5775 5347 gene locus_tag LOCUS_03130 5775 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence045 3 674 gene locus_tag LOCUS_03140 3 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 723 1682 gene locus_tag LOCUS_03150 723 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478143.1 protein_id gnl|my_center|LOCUS_03150 2057 1683 gene locus_tag LOCUS_03160 2057 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2775 2044 gene locus_tag LOCUS_03170 2775 2044 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_03170 3414 2818 gene locus_tag LOCUS_03180 3414 2818 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_03180 3960 3424 gene locus_tag LOCUS_03190 3960 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4041 5384 gene locus_tag LOCUS_03200 4041 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6143 5385 gene locus_tag LOCUS_03210 6143 5385 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_03210 6268 6768 gene locus_tag LOCUS_03220 6268 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence046 <1 1244 gene locus_tag LOCUS_03230 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66878:chromosome partition protein Smc 1254 2426 gene locus_tag LOCUS_03240 1254 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2439 3044 gene locus_tag LOCUS_03250 2439 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4344 3046 gene locus_tag LOCUS_03260 4344 3046 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_03260 4562 6319 gene locus_tag LOCUS_03270 4562 6319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence047 1001 117 gene locus_tag LOCUS_03280 1001 117 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_03280 1090 3912 gene locus_tag LOCUS_03290 1090 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4036 5067 gene locus_tag LOCUS_03300 4036 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6036 5068 gene locus_tag LOCUS_03310 6036 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence048 <1 1049 gene locus_tag LOCUS_03320 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CP17:chaperone protein DnaK 1085 2665 gene locus_tag LOCUS_03330 1085 2665 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870512.1 protein_id gnl|my_center|LOCUS_03330 2734 4305 gene locus_tag LOCUS_03340 2734 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 5354 4302 gene locus_tag LOCUS_03350 gene tdh 5354 4302 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31776 protein_id gnl|my_center|LOCUS_03350 >Feature sequence049 4803 4288 gene locus_tag LOCUS_03360 4803 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence050 <1 2205 gene locus_tag LOCUS_03370 <1 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023138.1:extensin 2192 2779 gene locus_tag LOCUS_03380 2192 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2826 4268 gene locus_tag LOCUS_03390 2826 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_03390 4499 5674 gene locus_tag LOCUS_03400 4499 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence051 723 1988 gene locus_tag LOCUS_03410 gene ahcY 723 1988 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G6 protein_id gnl|my_center|LOCUS_03410 3047 1989 gene locus_tag LOCUS_03420 3047 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3727 3107 gene locus_tag LOCUS_03430 3727 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 6038 4029 gene locus_tag LOCUS_03440 6038 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence052 2672 1425 gene locus_tag LOCUS_03450 2672 1425 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181665.1 protein_id gnl|my_center|LOCUS_03450 4957 2675 gene locus_tag LOCUS_03460 4957 2675 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_03460 5782 5015 gene locus_tag LOCUS_03470 gene fdhD 5782 5015 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_03470 >Feature sequence053 <1 1003 gene locus_tag LOCUS_03480 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065053.1:potassium transporter TrkA 996 2168 gene locus_tag LOCUS_03490 996 2168 CDS product conjugal transfer protein TraB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877838.1 protein_id gnl|my_center|LOCUS_03490 2944 2165 gene locus_tag LOCUS_03500 2944 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3084 3728 gene locus_tag LOCUS_03510 3084 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3750 4295 gene locus_tag LOCUS_03520 3750 4295 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870902.1 protein_id gnl|my_center|LOCUS_03520 4413 5717 gene locus_tag LOCUS_03530 gene carA 4413 5717 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6R2 protein_id gnl|my_center|LOCUS_03530 >Feature sequence054 459 1190 gene locus_tag LOCUS_03540 gene fabG 459 1190 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_03540 1245 3677 gene locus_tag LOCUS_03550 gene uvrB 1245 3677 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJH7 protein_id gnl|my_center|LOCUS_03550 3712 4719 gene locus_tag LOCUS_03560 3712 4719 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_03560 4853 5629 gene locus_tag LOCUS_03570 4853 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence055 1466 1912 gene locus_tag LOCUS_03580 1466 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1969 4881 gene locus_tag LOCUS_03590 1969 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 4891 5529 gene locus_tag LOCUS_03600 4891 5529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5541 5780 gene locus_tag LOCUS_03610 5541 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence056 303 91 gene locus_tag LOCUS_03620 303 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2623 353 gene locus_tag LOCUS_03630 2623 353 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966917.1 protein_id gnl|my_center|LOCUS_03630 5182 2858 gene locus_tag LOCUS_03640 5182 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 6109 5192 gene locus_tag LOCUS_03650 6109 5192 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920613.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence057 1114 401 gene locus_tag LOCUS_03660 1114 401 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_03660 1205 1408 gene locus_tag LOCUS_03670 1205 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1409 3919 gene locus_tag LOCUS_03680 1409 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3972 4436 gene locus_tag LOCUS_03690 3972 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4445 4837 gene locus_tag LOCUS_03700 4445 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence058 1056 487 gene locus_tag LOCUS_03710 1056 487 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_03710 1472 1071 gene locus_tag LOCUS_03720 1472 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 1592 2761 gene locus_tag LOCUS_03730 1592 2761 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_03730 3865 2771 gene locus_tag LOCUS_03740 3865 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 5241 3904 gene locus_tag LOCUS_03750 5241 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5303 5710 gene locus_tag LOCUS_03760 5303 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706415.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence059 675 28 gene locus_tag LOCUS_03770 675 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1540 677 gene locus_tag LOCUS_03780 1540 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2162 1590 gene locus_tag LOCUS_03790 2162 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2731 2159 gene locus_tag LOCUS_03800 2731 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4024 2792 gene locus_tag LOCUS_03810 4024 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence060 132 701 gene locus_tag LOCUS_03820 132 701 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_03820 755 1051 gene locus_tag LOCUS_03830 755 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 1188 1478 gene locus_tag LOCUS_03840 gene ppiC1 1188 1478 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2B3 protein_id gnl|my_center|LOCUS_03840 1478 1831 gene locus_tag LOCUS_03850 1478 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 1869 2378 gene locus_tag LOCUS_03860 1869 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 2646 2380 gene locus_tag LOCUS_03870 2646 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3355 2651 gene locus_tag LOCUS_03880 3355 2651 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496770.1 protein_id gnl|my_center|LOCUS_03880 3495 4742 gene locus_tag LOCUS_03890 3495 4742 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence061 1402 2169 gene locus_tag LOCUS_03900 1402 2169 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_03900 2188 4071 gene locus_tag LOCUS_03910 2188 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4535 4107 gene locus_tag LOCUS_03920 4535 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence062 <1 877 gene locus_tag LOCUS_03930 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903569.1:4-demethylwyosine synthase TYW1 1463 867 gene locus_tag LOCUS_03940 1463 867 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_03940 3569 1479 gene locus_tag LOCUS_03950 3569 1479 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877531.1 protein_id gnl|my_center|LOCUS_03950 3706 4218 gene locus_tag LOCUS_03960 3706 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 5361 4219 gene locus_tag LOCUS_03970 5361 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence063 <1 1211 gene locus_tag LOCUS_03980 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA 1272 2822 gene locus_tag LOCUS_03990 1272 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 3950 2823 gene locus_tag LOCUS_04000 3950 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 protein_id gnl|my_center|LOCUS_04000 3981 5543 gene locus_tag LOCUS_04010 3981 5543 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLM3 protein_id gnl|my_center|LOCUS_04010 5843 5544 gene locus_tag LOCUS_04020 5843 5544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 >Feature sequence064 1944 1402 gene locus_tag LOCUS_04030 1944 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2254 1982 gene locus_tag LOCUS_04040 2254 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 2373 5450 gene locus_tag LOCUS_04050 2373 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence065 5208 283 gene locus_tag LOCUS_04060 5208 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5302 6012 gene locus_tag LOCUS_04070 gene rpiA 5302 6012 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J101 protein_id gnl|my_center|LOCUS_04070 >Feature sequence066 623 3256 gene locus_tag LOCUS_04080 623 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3253 4500 gene locus_tag LOCUS_04090 3253 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 4505 5278 gene locus_tag LOCUS_04100 4505 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence067 597 1652 gene locus_tag LOCUS_04110 597 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 1681 2631 gene locus_tag LOCUS_04120 1681 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2698 3816 gene locus_tag LOCUS_04130 gene dnaJ 2698 3816 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEY1 protein_id gnl|my_center|LOCUS_04130 5973 3817 gene locus_tag LOCUS_04140 5973 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence068 170 3715 gene locus_tag LOCUS_04150 170 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 3807 4334 gene locus_tag LOCUS_04160 3807 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4344 4937 gene locus_tag LOCUS_04170 4344 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4937 5590 gene locus_tag LOCUS_04180 4937 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence069 14 709 gene locus_tag LOCUS_04190 14 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2420 711 gene locus_tag LOCUS_04200 2420 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2608 3405 gene locus_tag LOCUS_04210 2608 3405 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_04210 3416 4432 gene locus_tag LOCUS_04220 3416 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4435 5334 gene locus_tag LOCUS_04230 gene mvaK1 4435 5334 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_269075.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence070 1546 461 gene locus_tag LOCUS_04240 1546 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 1722 2462 gene locus_tag LOCUS_04250 1722 2462 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_04250 2816 2463 gene locus_tag LOCUS_04260 2816 2463 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_04260 2963 3976 gene locus_tag LOCUS_04270 2963 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867185.1 protein_id gnl|my_center|LOCUS_04270 4015 4701 gene locus_tag LOCUS_04280 4015 4701 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249138.1 protein_id gnl|my_center|LOCUS_04280 4705 5607 gene locus_tag LOCUS_04290 gene mutM 4705 5607 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89WC9 protein_id gnl|my_center|LOCUS_04290 >Feature sequence071 665 2467 gene locus_tag LOCUS_04300 665 2467 CDS product flagellar assembly protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_04300 2487 2960 gene locus_tag LOCUS_04310 2487 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3611 2961 gene locus_tag LOCUS_04320 gene nth 3611 2961 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_04320 3917 3612 gene locus_tag LOCUS_04330 3917 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4124 3927 gene locus_tag LOCUS_04340 4124 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 <5909 4161 gene locus_tag LOCUS_04350 <5909 4161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001830120.1:DNA polymerase/3'-5' exonuclease PolX >Feature sequence072 5423 444 gene locus_tag LOCUS_04360 5423 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 >Feature sequence073 <1 1411 gene locus_tag LOCUS_04370 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:methylmalonyl-CoA carboxyltransferase 4210 1412 gene locus_tag LOCUS_04380 4210 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 5281 4265 gene locus_tag LOCUS_04390 5281 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5373 5756 gene locus_tag LOCUS_04400 5373 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence074 475 2574 gene locus_tag LOCUS_04410 475 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2630 3178 gene locus_tag LOCUS_04420 2630 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3230 4375 gene locus_tag LOCUS_04430 3230 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 4413 5192 gene locus_tag LOCUS_04440 gene xthA 4413 5192 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002068111.1 protein_id gnl|my_center|LOCUS_04440 >Feature sequence075 <1 1239 gene locus_tag LOCUS_04450 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5ZVV0:flagellin 3566 1257 gene locus_tag LOCUS_04460 3566 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence076 <1 528 gene locus_tag LOCUS_04470 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879589.1:ATPase 596 835 gene locus_tag LOCUS_04480 596 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 929 2539 gene locus_tag LOCUS_04490 929 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 2544 3797 gene locus_tag LOCUS_04500 2544 3797 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_04500 3799 5031 gene locus_tag LOCUS_04510 3799 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 5276 5028 gene locus_tag LOCUS_04520 5276 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence077 573 1832 gene locus_tag LOCUS_04530 gene folC 573 1832 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072965.1 protein_id gnl|my_center|LOCUS_04530 1834 2280 gene locus_tag LOCUS_04540 1834 2280 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_04540 2252 3379 gene locus_tag LOCUS_04550 2252 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 <5755 3376 gene locus_tag LOCUS_04560 <5755 3376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878645.1:helicase >Feature sequence078 1259 225 gene locus_tag LOCUS_04570 1259 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2367 1318 gene locus_tag LOCUS_04580 2367 1318 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876434.1 protein_id gnl|my_center|LOCUS_04580 3120 2407 gene locus_tag LOCUS_04590 3120 2407 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875970.1 protein_id gnl|my_center|LOCUS_04590 5507 3189 gene locus_tag LOCUS_04600 5507 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence079 1270 827 gene locus_tag LOCUS_04610 1270 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2025 1270 gene locus_tag LOCUS_04620 2025 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2258 2563 gene locus_tag LOCUS_04630 2258 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 2603 3517 gene locus_tag LOCUS_04640 2603 3517 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_04640 4863 3514 gene locus_tag LOCUS_04650 4863 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 4943 5308 gene locus_tag LOCUS_04660 4943 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence080 193 672 gene locus_tag LOCUS_04670 193 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 669 2168 gene locus_tag LOCUS_04680 gene phr 669 2168 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_04680 2170 3558 gene locus_tag LOCUS_04690 2170 3558 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118348.1 protein_id gnl|my_center|LOCUS_04690 4562 3555 gene locus_tag LOCUS_04700 4562 3555 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_04700 <5611 4653 gene locus_tag LOCUS_04710 <5611 4653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228252.1:aldehyde dehydrogenase >Feature sequence081 924 310 gene locus_tag LOCUS_04720 924 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1886 933 gene locus_tag LOCUS_04730 1886 933 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_04730 2382 1933 gene locus_tag LOCUS_04740 2382 1933 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978449.1 protein_id gnl|my_center|LOCUS_04740 2833 2387 gene locus_tag LOCUS_04750 2833 2387 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_04750 2892 4118 gene locus_tag LOCUS_04760 2892 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4168 5025 gene locus_tag LOCUS_04770 4168 5025 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence082 220 1092 gene locus_tag LOCUS_04780 220 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1141 2298 gene locus_tag LOCUS_04790 1141 2298 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence083 3 2978 gene locus_tag LOCUS_04800 3 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2981 3958 gene locus_tag LOCUS_04810 2981 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3958 4245 gene locus_tag LOCUS_04820 gene ydzA 3958 4245 CDS product putative membrane protein YdzA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31485 protein_id gnl|my_center|LOCUS_04820 4590 4246 gene locus_tag LOCUS_04830 4590 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence084 2126 882 gene locus_tag LOCUS_04840 2126 882 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876673.1 protein_id gnl|my_center|LOCUS_04840 2222 3544 gene locus_tag LOCUS_04850 2222 3544 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933799.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence085 <1 1476 gene locus_tag LOCUS_04860 <1 1476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762768.1:valine--tRNA ligase 2589 1477 gene locus_tag LOCUS_04870 gene dinB 2589 1477 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U031 protein_id gnl|my_center|LOCUS_04870 3624 2641 gene locus_tag LOCUS_04880 3624 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3723 4874 gene locus_tag LOCUS_04890 3723 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 >Feature sequence086 470 1147 gene locus_tag LOCUS_04900 470 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_04900 1208 2944 gene locus_tag LOCUS_04910 1208 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 3273 2941 gene locus_tag LOCUS_04920 gene emrE 3273 2941 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941369.1 protein_id gnl|my_center|LOCUS_04920 4515 3283 gene locus_tag LOCUS_04930 4515 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence087 538 74 gene locus_tag LOCUS_04940 538 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2043 538 gene locus_tag LOCUS_04950 2043 538 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_04950 2910 2056 gene locus_tag LOCUS_04960 2910 2056 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_04960 4563 2953 gene locus_tag LOCUS_04970 4563 2953 CDS product acetyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence088 2215 1643 gene locus_tag LOCUS_04980 2215 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2864 2223 gene locus_tag LOCUS_04990 2864 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2933 4723 gene locus_tag LOCUS_05000 2933 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence089 2281 521 gene locus_tag LOCUS_05010 gene ansB 2281 521 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_05010 3134 2511 gene locus_tag LOCUS_05020 3134 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4039 3131 gene locus_tag LOCUS_05030 4039 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4495 4049 gene locus_tag LOCUS_05040 4495 4049 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence090 <1 1160 gene locus_tag LOCUS_05050 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074205.1:MFS transporter 1170 1559 gene locus_tag LOCUS_05060 1170 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1597 3144 gene locus_tag LOCUS_05070 1597 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3208 3292 gene locus_tag LOCUS_t00030 3208 3292 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3360 4925 gene locus_tag LOCUS_05080 3360 4925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence091 <1 752 gene locus_tag LOCUS_05090 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089046.1:glycosyl transferase 1834 731 gene locus_tag LOCUS_05100 1834 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2778 1831 gene locus_tag LOCUS_05110 2778 1831 CDS product UDP-glucose 4-epimerase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_05110 4180 2783 gene locus_tag LOCUS_05120 4180 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 <5253 4181 gene locus_tag LOCUS_05130 <5253 4181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871027.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence092 1376 741 gene locus_tag LOCUS_05140 1376 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2277 1441 gene locus_tag LOCUS_05150 gene ara1 2277 1441 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_05150 2963 2313 gene locus_tag LOCUS_05160 2963 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3238 2993 gene locus_tag LOCUS_05170 3238 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 3630 3250 gene locus_tag LOCUS_05180 3630 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3786 3995 gene locus_tag LOCUS_05190 3786 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence093 284 949 gene locus_tag LOCUS_05200 284 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 972 1943 gene locus_tag LOCUS_05210 972 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 2687 1944 gene locus_tag LOCUS_05220 2687 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 4886 2703 gene locus_tag LOCUS_05230 4886 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence094 3610 4581 gene locus_tag LOCUS_05240 3610 4581 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence095 <1 806 gene locus_tag LOCUS_05250 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762130.1:asparagine--tRNA ligase 817 1857 gene locus_tag LOCUS_05260 817 1857 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_05260 2751 1990 gene locus_tag LOCUS_05270 2751 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3611 2763 gene locus_tag LOCUS_05280 3611 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3736 4680 gene locus_tag LOCUS_05290 3736 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4667 4996 gene locus_tag LOCUS_05300 4667 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 5075 4998 gene locus_tag LOCUS_t00040 5075 4998 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence096 1174 1857 gene locus_tag LOCUS_05310 1174 1857 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_05310 2272 1859 gene locus_tag LOCUS_05320 2272 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 2741 2364 gene locus_tag LOCUS_05330 gene crcB 2741 2364 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLF8 protein_id gnl|my_center|LOCUS_05330 2849 3505 gene locus_tag LOCUS_05340 2849 3505 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_05340 3527 4441 gene locus_tag LOCUS_05350 3527 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 >Feature sequence097 >Feature sequence098 <1 749 gene locus_tag LOCUS_05360 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003537568.1:cobalamin biosynthesis protein CobW 784 1119 gene locus_tag LOCUS_05370 784 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2627 1140 gene locus_tag LOCUS_05380 gene cysS 2627 1140 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_05380 2704 3417 gene locus_tag LOCUS_05390 2704 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4041 3388 gene locus_tag LOCUS_05400 4041 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 <5052 4047 gene locus_tag LOCUS_05410 <5052 4047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001018338.1:Fe-S oxidoreductase >Feature sequence099 3087 1438 gene locus_tag LOCUS_05420 3087 1438 CDS product alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869295.1 protein_id gnl|my_center|LOCUS_05420 4417 3143 gene locus_tag LOCUS_05430 4417 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence100 429 1040 gene locus_tag LOCUS_05440 429 1040 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001191981.1 protein_id gnl|my_center|LOCUS_05440 1307 1032 gene locus_tag LOCUS_05450 1307 1032 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709171.1 protein_id gnl|my_center|LOCUS_05450 1414 2304 gene locus_tag LOCUS_05460 1414 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053466.1 protein_id gnl|my_center|LOCUS_05460 2375 3022 gene locus_tag LOCUS_05470 2375 3022 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482872.1 protein_id gnl|my_center|LOCUS_05470 3682 3023 gene locus_tag LOCUS_05480 3682 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence101 >Feature sequence102 <1 577 gene locus_tag LOCUS_05490 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876469.1:UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase 895 578 gene locus_tag LOCUS_05500 gene grxD 895 578 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFT8 protein_id gnl|my_center|LOCUS_05500 1218 901 gene locus_tag LOCUS_05510 1218 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1306 2772 gene locus_tag LOCUS_05520 1306 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3811 2729 gene locus_tag LOCUS_05530 3811 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4504 3830 gene locus_tag LOCUS_05540 gene rpe1 4504 3830 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182R3 protein_id gnl|my_center|LOCUS_05540 >Feature sequence103 691 497 gene locus_tag LOCUS_05550 691 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 784 1830 gene locus_tag LOCUS_05560 784 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2083 1805 gene locus_tag LOCUS_05570 2083 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4314 2137 gene locus_tag LOCUS_05580 4314 2137 CDS product fibronectin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871150.1 protein_id gnl|my_center|LOCUS_05580 <4905 4357 gene locus_tag LOCUS_05590 <4905 4357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816628.1:zinc-binding dehydrogenase >Feature sequence104 >Feature sequence105 1474 557 gene locus_tag LOCUS_05600 1474 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2159 1524 gene locus_tag LOCUS_05610 2159 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 2233 2952 gene locus_tag LOCUS_05620 2233 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4305 2953 gene locus_tag LOCUS_05630 4305 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence106 2388 1195 gene locus_tag LOCUS_05640 2388 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2548 3087 gene locus_tag LOCUS_05650 2548 3087 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence107 24 227 gene locus_tag LOCUS_05660 24 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 334 2376 gene locus_tag LOCUS_05670 334 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2425 2901 gene locus_tag LOCUS_05680 2425 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 4818 2902 gene locus_tag LOCUS_05690 4818 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence108 2336 1122 gene locus_tag LOCUS_05700 2336 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 4852 2387 gene locus_tag LOCUS_05710 4852 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence109 1563 52 gene locus_tag LOCUS_05720 1563 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 2395 1646 gene locus_tag LOCUS_05730 2395 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence110 438 1439 gene locus_tag LOCUS_05740 438 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05740 1478 2152 gene locus_tag LOCUS_05750 1478 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence111 2066 981 gene locus_tag LOCUS_05760 2066 981 CDS product Fe-S protein, radical SAM family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_05760 2804 2115 gene locus_tag LOCUS_05770 gene pdxT 2804 2115 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFU0 protein_id gnl|my_center|LOCUS_05770 2884 4074 gene locus_tag LOCUS_05780 2884 4074 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_05780 4079 4630 gene locus_tag LOCUS_05790 4079 4630 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence112 21 95 gene locus_tag LOCUS_t00050 21 95 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 165 1682 gene locus_tag LOCUS_05800 165 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1765 3384 gene locus_tag LOCUS_05810 gene frdA 1765 3384 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66855 protein_id gnl|my_center|LOCUS_05810 3416 3847 gene locus_tag LOCUS_05820 3416 3847 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_05820 >Feature sequence113 <1 1584 gene locus_tag LOCUS_05830 <1 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404195.1:NADH-quinone oxidoreductase subunit L 1584 3212 gene locus_tag LOCUS_05840 1584 3212 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence114 1578 229 gene locus_tag LOCUS_05850 1578 229 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879731.1 protein_id gnl|my_center|LOCUS_05850 1733 2191 gene locus_tag LOCUS_05860 1733 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2461 2168 gene locus_tag LOCUS_05870 2461 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2494 3087 gene locus_tag LOCUS_05880 2494 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3326 3084 gene locus_tag LOCUS_05890 3326 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 4569 3376 gene locus_tag LOCUS_05900 4569 3376 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879748.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence115 1648 311 gene locus_tag LOCUS_05910 1648 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 3447 1723 gene locus_tag LOCUS_05920 3447 1723 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_05920 3803 3507 gene locus_tag LOCUS_05930 3803 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 <4726 4115 gene locus_tag LOCUS_05940 <4726 4115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B5V4:adenylate kinase >Feature sequence116 484 2568 gene locus_tag LOCUS_05950 484 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3245 2571 gene locus_tag LOCUS_05960 3245 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3341 4540 gene locus_tag LOCUS_05970 3341 4540 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879141.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence117 2231 1257 gene locus_tag LOCUS_05980 gene hemB 2231 1257 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GV9 protein_id gnl|my_center|LOCUS_05980 3923 2232 gene locus_tag LOCUS_05990 3923 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence118 1244 1618 gene locus_tag LOCUS_06000 1244 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1674 2351 gene locus_tag LOCUS_06010 1674 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 2573 2334 gene locus_tag LOCUS_06020 2573 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3372 2578 gene locus_tag LOCUS_06030 gene pyrF 3372 2578 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43812 protein_id gnl|my_center|LOCUS_06030 >Feature sequence119 347 817 gene locus_tag LOCUS_06040 347 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 845 1657 gene locus_tag LOCUS_06050 845 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2609 1647 gene locus_tag LOCUS_06060 2609 1647 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338283.1 protein_id gnl|my_center|LOCUS_06060 4386 2614 gene locus_tag LOCUS_06070 4386 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence120 1199 2077 gene locus_tag LOCUS_06080 gene mqnD 1199 2077 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_06080 2080 2562 gene locus_tag LOCUS_06090 2080 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2608 2814 gene locus_tag LOCUS_06100 2608 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2834 4042 gene locus_tag LOCUS_06110 2834 4042 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence121 2283 1261 gene locus_tag LOCUS_06120 2283 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 2375 4216 gene locus_tag LOCUS_06130 2375 4216 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence122 1414 437 gene locus_tag LOCUS_06140 gene putA 1414 437 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_06140 2426 1446 gene locus_tag LOCUS_06150 2426 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_06150 2537 3430 gene locus_tag LOCUS_06160 2537 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3616 3434 gene locus_tag LOCUS_06170 3616 3434 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_06170 3990 3613 gene locus_tag LOCUS_06180 3990 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 4219 4001 gene locus_tag LOCUS_06190 4219 4001 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence123 <1 1187 gene locus_tag LOCUS_06200 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023772.1:cell division protein FtsZ 1251 2078 gene locus_tag LOCUS_06210 1251 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3414 2080 gene locus_tag LOCUS_06220 3414 2080 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_06220 <4466 3504 gene locus_tag LOCUS_06230 <4466 3504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403661.1:sodium-dependent transporter >Feature sequence124 134 1903 gene locus_tag LOCUS_06240 134 1903 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_06240 1972 2778 gene locus_tag LOCUS_06250 1972 2778 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_06250 3813 2779 gene locus_tag LOCUS_06260 3813 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 <4452 3819 gene locus_tag LOCUS_06270 <4452 3819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WG61:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence125 884 3238 gene locus_tag LOCUS_06280 884 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3493 3239 gene locus_tag LOCUS_06290 3493 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3752 3498 gene locus_tag LOCUS_06300 3752 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 <4444 3839 gene locus_tag LOCUS_06310 <4444 3839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P37522:sporulation initiation inhibitor protein Soj >Feature sequence126 870 3500 gene locus_tag LOCUS_06320 870 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 <4435 3511 gene locus_tag LOCUS_06330 <4435 3511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902898.1:amino acid transporter >Feature sequence127 1762 3462 gene locus_tag LOCUS_06340 gene uvrC 1762 3462 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MW45 protein_id gnl|my_center|LOCUS_06340 >Feature sequence128 <1 980 gene locus_tag LOCUS_06350 <1 980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871086.1:membrane protein 1012 2016 gene locus_tag LOCUS_06360 1012 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 2086 3822 gene locus_tag LOCUS_06370 2086 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3937 4227 gene locus_tag LOCUS_06380 3937 4227 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_06380 >Feature sequence129 1103 84 gene locus_tag LOCUS_06390 1103 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_06390 1568 1131 gene locus_tag LOCUS_06400 1568 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1683 2360 gene locus_tag LOCUS_06410 1683 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence130 1254 154 gene locus_tag LOCUS_06420 gene pyrD 1254 154 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_06420 1341 1769 gene locus_tag LOCUS_06430 1341 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1762 1881 gene locus_tag LOCUS_06440 1762 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence131 2065 848 gene locus_tag LOCUS_06450 2065 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2209 2925 gene locus_tag LOCUS_06460 2209 2925 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_06460 2968 3396 gene locus_tag LOCUS_06470 2968 3396 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868432.1 protein_id gnl|my_center|LOCUS_06470 3408 4019 gene locus_tag LOCUS_06480 3408 4019 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096933.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence132 2 127 gene locus_tag LOCUS_06490 2 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 182 886 gene locus_tag LOCUS_06500 gene gpmA 182 886 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z743 protein_id gnl|my_center|LOCUS_06500 924 1424 gene locus_tag LOCUS_06510 924 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2132 1410 gene locus_tag LOCUS_06520 2132 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2251 2946 gene locus_tag LOCUS_06530 2251 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence133 >Feature sequence134 83 736 gene locus_tag LOCUS_06540 83 736 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_06540 784 2244 gene locus_tag LOCUS_06550 784 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2269 4047 gene locus_tag LOCUS_06560 2269 4047 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence135 2093 780 gene locus_tag LOCUS_06570 2093 780 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence136 1739 1104 gene locus_tag LOCUS_06580 gene lipB 1739 1104 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ3 protein_id gnl|my_center|LOCUS_06580 3098 1770 gene locus_tag LOCUS_06590 3098 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 3593 3144 gene locus_tag LOCUS_06600 3593 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence137 1535 3580 gene locus_tag LOCUS_06610 1535 3580 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence138 <1 1520 gene locus_tag LOCUS_06620 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MP7:methionine--tRNA ligase 2149 1517 gene locus_tag LOCUS_06630 2149 1517 CDS product formiminotransferase-cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259121.1 protein_id gnl|my_center|LOCUS_06630 3192 2152 gene locus_tag LOCUS_06640 3192 2152 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XR4 protein_id gnl|my_center|LOCUS_06640 <4074 3229 gene locus_tag LOCUS_06650 <4074 3229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251202.1:proteasome-activating nucleotidase >Feature sequence139 850 1296 gene locus_tag LOCUS_06660 850 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1274 1624 gene locus_tag LOCUS_06670 1274 1624 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFI4 protein_id gnl|my_center|LOCUS_06670 1634 2206 gene locus_tag LOCUS_06680 1634 2206 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214810.1 protein_id gnl|my_center|LOCUS_06680 2623 2207 gene locus_tag LOCUS_06690 2623 2207 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_06690 2730 3314 gene locus_tag LOCUS_06700 2730 3314 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496888.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence140 1769 1185 gene locus_tag LOCUS_06710 gene mogA 1769 1185 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_06710 3894 1783 gene locus_tag LOCUS_06720 3894 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 4048 3973 gene locus_tag LOCUS_t00060 4048 3973 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 >Feature sequence142 2248 1787 gene locus_tag LOCUS_06730 2248 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933077.1 protein_id gnl|my_center|LOCUS_06730 3731 2295 gene locus_tag LOCUS_06740 3731 2295 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_06740 >Feature sequence143 2800 2078 gene locus_tag LOCUS_06750 2800 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 <3957 2812 gene locus_tag LOCUS_06760 <3957 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964893.1:MFS transporter >Feature sequence144 1076 201 gene locus_tag LOCUS_06770 1076 201 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_06770 1705 1115 gene locus_tag LOCUS_06780 1705 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2851 1727 gene locus_tag LOCUS_06790 gene caiA 2851 1727 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence145 596 105 gene locus_tag LOCUS_06800 596 105 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_06800 721 1539 gene locus_tag LOCUS_06810 721 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1706 1879 gene locus_tag LOCUS_06820 1706 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1888 2376 gene locus_tag LOCUS_06830 1888 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 3108 2377 gene locus_tag LOCUS_06840 3108 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021946.1 protein_id gnl|my_center|LOCUS_06840 3665 3120 gene locus_tag LOCUS_06850 3665 3120 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence146 328 1665 gene locus_tag LOCUS_06860 328 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1700 2725 gene locus_tag LOCUS_06870 1700 2725 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173900.1 protein_id gnl|my_center|LOCUS_06870 3754 2726 gene locus_tag LOCUS_06880 3754 2726 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence147 1015 134 gene locus_tag LOCUS_06890 1015 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1119 1691 gene locus_tag LOCUS_06900 1119 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1731 3095 gene locus_tag LOCUS_06910 1731 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence148 1487 336 gene locus_tag LOCUS_06920 1487 336 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_06920 2049 1498 gene locus_tag LOCUS_06930 2049 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 2137 3303 gene locus_tag LOCUS_06940 2137 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence149 <1 1122 gene locus_tag LOCUS_06950 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878342.1:potassium transporter 2644 1124 gene locus_tag LOCUS_06960 2644 1124 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_06960 <3856 2710 gene locus_tag LOCUS_06970 <3856 2710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878416.1:glycine--tRNA ligase >Feature sequence150 1262 702 gene locus_tag LOCUS_06980 1262 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1477 1262 gene locus_tag LOCUS_06990 1477 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1739 2749 gene locus_tag LOCUS_07000 gene glnII 1739 2749 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_07000 2877 3644 gene locus_tag LOCUS_07010 2877 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence151 3113 843 gene locus_tag LOCUS_07020 3113 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3710 3171 gene locus_tag LOCUS_07030 3710 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence152 <1 592 gene locus_tag LOCUS_07040 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083750460.1:secretion protein 2364 598 gene locus_tag LOCUS_07050 2364 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2522 3097 gene locus_tag LOCUS_07060 2522 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence153 1104 919 gene locus_tag LOCUS_07070 1104 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1803 1105 gene locus_tag LOCUS_07080 gene ccmC 1803 1105 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709716.1 protein_id gnl|my_center|LOCUS_07080 3057 1840 gene locus_tag LOCUS_07090 3057 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 >Feature sequence154 >Feature sequence155 <1 1430 gene locus_tag LOCUS_07100 <1 1430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064301.1:RNA-splicing ligase RtcB 1616 1431 gene locus_tag LOCUS_07110 1616 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1767 1841 gene locus_tag LOCUS_t00070 1767 1841 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence156 680 240 gene locus_tag LOCUS_07120 680 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 <3662 703 gene locus_tag LOCUS_07130 <3662 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence157 1980 1222 gene locus_tag LOCUS_07140 1980 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 3493 2063 gene locus_tag LOCUS_07150 3493 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 >Feature sequence158 941 780 gene locus_tag LOCUS_07160 941 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 1026 2354 gene locus_tag LOCUS_07170 1026 2354 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence159 16 93 gene locus_tag LOCUS_t00080 16 93 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 149 1213 gene locus_tag LOCUS_07180 149 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence160 448 1590 gene locus_tag LOCUS_07190 448 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2622 1693 gene locus_tag LOCUS_07200 2622 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 2879 3235 gene locus_tag LOCUS_07210 2879 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence161 <1 2029 gene locus_tag LOCUS_07220 <1 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879681.1:cytochrome C biogenesis protein E 2099 2929 gene locus_tag LOCUS_07230 2099 2929 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence162 <1 533 gene locus_tag LOCUS_07240 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KFC2:GTP cyclohydrolase-2 562 1035 gene locus_tag LOCUS_07250 562 1035 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_07250 1036 2418 gene locus_tag LOCUS_07260 1036 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence163 >Feature sequence164 >Feature sequence165 <3508 791 gene locus_tag LOCUS_07270 <3508 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HXZ6:isoleucine--tRNA ligase >Feature sequence166 2405 1068 gene locus_tag LOCUS_07280 2405 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence167 >Feature sequence168 <1 1290 gene locus_tag LOCUS_07290 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903183.1:NADP-dependent malic enzyme 2151 1297 gene locus_tag LOCUS_07300 2151 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2878 2159 gene locus_tag LOCUS_07310 2878 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 3210 2875 gene locus_tag LOCUS_07320 3210 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 >Feature sequence169 3 122 gene locus_tag LOCUS_07330 3 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 184 2352 gene locus_tag LOCUS_07340 184 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2379 3041 gene locus_tag LOCUS_07350 2379 3041 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence170 187 1209 gene locus_tag LOCUS_07360 187 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1206 2327 gene locus_tag LOCUS_07370 1206 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2885 2322 gene locus_tag LOCUS_07380 2885 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence171 1777 965 gene locus_tag LOCUS_07390 1777 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2946 1774 gene locus_tag LOCUS_07400 2946 1774 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence172 <1 645 gene locus_tag LOCUS_07410 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHE5:cyclic dehypoxanthine futalosine synthase 1800 646 gene locus_tag LOCUS_07420 1800 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3087 1810 gene locus_tag LOCUS_07430 3087 1810 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence173 692 1726 gene locus_tag LOCUS_07440 692 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_07440 2718 1699 gene locus_tag LOCUS_07450 2718 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence174 283 122 gene locus_tag LOCUS_07460 283 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 455 1915 gene locus_tag LOCUS_07470 455 1915 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_07470 3127 1910 gene locus_tag LOCUS_07480 3127 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence175 266 799 gene locus_tag LOCUS_07490 266 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 808 1692 gene locus_tag LOCUS_07500 808 1692 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250562.1 protein_id gnl|my_center|LOCUS_07500 1784 2845 gene locus_tag LOCUS_07510 1784 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence176 2015 2692 gene locus_tag LOCUS_07520 2015 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 <3315 2693 gene locus_tag LOCUS_07530 <3315 2693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879286.1:DNA polymerase II small subunit >Feature sequence177 1090 2097 gene locus_tag LOCUS_07540 1090 2097 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_07540 2137 2415 gene locus_tag LOCUS_07550 2137 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2478 3095 gene locus_tag LOCUS_07560 2478 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence178 458 1285 gene locus_tag LOCUS_07570 458 1285 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 protein_id gnl|my_center|LOCUS_07570 >Feature sequence179 2769 202 gene locus_tag LOCUS_07580 2769 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence180 457 618 gene locus_tag LOCUS_07590 457 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 618 737 gene locus_tag LOCUS_07600 618 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 857 1756 gene locus_tag LOCUS_07610 gene alkB 857 1756 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_07610 1806 2528 gene locus_tag LOCUS_07620 1806 2528 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence181 1049 621 gene locus_tag LOCUS_07630 1049 621 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_07630 1282 2487 gene locus_tag LOCUS_07640 1282 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence182 <1 683 gene locus_tag LOCUS_07650 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PV5:thymidylate synthase 693 1169 gene locus_tag LOCUS_07660 gene dfrA 693 1169 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_07660 1534 1166 gene locus_tag LOCUS_07670 1534 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2370 1567 gene locus_tag LOCUS_07680 2370 1567 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence183 >Feature sequence184 1059 640 gene locus_tag LOCUS_07690 1059 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2816 1095 gene locus_tag LOCUS_07700 2816 1095 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence185 2598 1708 gene locus_tag LOCUS_07710 2598 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence186 >Feature sequence187 1987 2442 gene locus_tag LOCUS_07720 1987 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2491 2658 gene locus_tag LOCUS_07730 2491 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 2728 3030 gene locus_tag LOCUS_07740 2728 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence188 2274 1828 gene locus_tag LOCUS_07750 gene ndk 2274 1828 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEG3 protein_id gnl|my_center|LOCUS_07750 2531 2340 gene locus_tag LOCUS_07760 2531 2340 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_07760 2761 2537 gene locus_tag LOCUS_07770 2761 2537 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence189 1427 696 gene locus_tag LOCUS_07780 1427 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2010 1429 gene locus_tag LOCUS_07790 2010 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2373 2020 gene locus_tag LOCUS_07800 2373 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence190 1563 1177 gene locus_tag LOCUS_07810 gene trxC 1563 1177 CDS product putative thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RD25 protein_id gnl|my_center|LOCUS_07810 >Feature sequence191 <3090 2333 gene locus_tag LOCUS_07820 <3090 2333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902392.1:cytochrome b6 >Feature sequence192 800 438 gene locus_tag LOCUS_07830 800 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728346.1 protein_id gnl|my_center|LOCUS_07830 1668 826 gene locus_tag LOCUS_07840 gene hbd 1668 826 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVG1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence193 <3075 914 gene locus_tag LOCUS_07850 <3075 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022129.1:carbamoyl phosphate synthase large subunit >Feature sequence194 439 1785 gene locus_tag LOCUS_07860 439 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1857 2606 gene locus_tag LOCUS_07870 1857 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence195 9 84 gene locus_tag LOCUS_t00090 9 84 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 515 156 gene locus_tag LOCUS_07880 515 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2742 517 gene locus_tag LOCUS_07890 2742 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence196 <3044 1546 gene locus_tag LOCUS_07900 <3044 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020572.1:DNA mismatch repair protein MutS >Feature sequence197 15 671 gene locus_tag LOCUS_07910 15 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 785 1252 gene locus_tag LOCUS_07920 785 1252 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_07920 1262 1912 gene locus_tag LOCUS_07930 1262 1912 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_07930 1912 2295 gene locus_tag LOCUS_07940 1912 2295 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence198 100 17 gene locus_tag LOCUS_t00100 100 17 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 197 1324 gene locus_tag LOCUS_07950 197 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 1324 2541 gene locus_tag LOCUS_07960 1324 2541 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WR13 protein_id gnl|my_center|LOCUS_07960 >Feature sequence199 261 1415 gene locus_tag LOCUS_07970 261 1415 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_07970 1531 2628 gene locus_tag LOCUS_07980 1531 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence200 <1 500 gene locus_tag LOCUS_07990 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020599.1:chorismate synthase 493 1806 gene locus_tag LOCUS_08000 493 1806 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878203.1 protein_id gnl|my_center|LOCUS_08000 2732 1809 gene locus_tag LOCUS_08010 2732 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence201 280 684 gene locus_tag LOCUS_08020 280 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 1734 670 gene locus_tag LOCUS_08030 1734 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2744 1737 gene locus_tag LOCUS_08040 2744 1737 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence202 <1 1062 gene locus_tag LOCUS_08050 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA 1085 2371 gene locus_tag LOCUS_08060 1085 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence203 194 2716 gene locus_tag LOCUS_08070 194 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence204 1190 591 gene locus_tag LOCUS_08080 gene pyrE 1190 591 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BL4 protein_id gnl|my_center|LOCUS_08080 >Feature sequence205 >Feature sequence206 2804 831 gene locus_tag LOCUS_08090 2804 831 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence207 <1 581 gene locus_tag LOCUS_08100 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3EH86:NAD(P) transhydrogenase subunit alpha 578 889 gene locus_tag LOCUS_08110 578 889 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_08110 891 2318 gene locus_tag LOCUS_08120 gene pntB 891 2318 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_08120 >Feature sequence208 1540 536 gene locus_tag LOCUS_08130 1540 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence209 <1 927 gene locus_tag LOCUS_08140 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:alkaline serine protease 1078 2595 gene locus_tag LOCUS_08150 1078 2595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence210 1379 393 gene locus_tag LOCUS_08160 1379 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2377 1391 gene locus_tag LOCUS_08170 2377 1391 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence211 769 425 gene locus_tag LOCUS_08180 769 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1391 810 gene locus_tag LOCUS_08190 1391 810 CDS product nucleoside-triphosphatase THEP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXP3 protein_id gnl|my_center|LOCUS_08190 1970 1551 gene locus_tag LOCUS_08200 1970 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2434 1976 gene locus_tag LOCUS_08210 2434 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2803 2486 gene locus_tag LOCUS_08220 2803 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence212 2333 1323 gene locus_tag LOCUS_08230 2333 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence213 655 281 gene locus_tag LOCUS_08240 655 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 784 860 gene locus_tag LOCUS_t00110 784 860 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1537 866 gene locus_tag LOCUS_08250 1537 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143203.1 protein_id gnl|my_center|LOCUS_08250 1875 1588 gene locus_tag LOCUS_08260 1875 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2286 1933 gene locus_tag LOCUS_08270 2286 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence214 <1 1566 gene locus_tag LOCUS_08280 <1 1566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:dehydrogenase 1566 2543 gene locus_tag LOCUS_08290 1566 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence215 <1 744 gene locus_tag LOCUS_08300 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879447.1:phenylalanine--tRNA ligase subunit alpha 812 2260 gene locus_tag LOCUS_08310 812 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence216 178 996 gene locus_tag LOCUS_08320 178 996 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_08320 1040 2008 gene locus_tag LOCUS_08330 1040 2008 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_08330 <2770 2009 gene locus_tag LOCUS_08340 <2770 2009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250907.1:prenyltransferase >Feature sequence217 <1 538 gene locus_tag LOCUS_08350 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975932.1:4-aminobutyrate aminotransferase 700 1326 gene locus_tag LOCUS_08360 700 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2500 1421 gene locus_tag LOCUS_08370 2500 1421 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence218 1419 427 gene locus_tag LOCUS_08380 1419 427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_08380 2462 1416 gene locus_tag LOCUS_08390 2462 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence219 2107 1193 gene locus_tag LOCUS_08400 gene lpqC 2107 1193 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417210.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence220 36 1019 gene locus_tag LOCUS_08410 36 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 1023 1298 gene locus_tag LOCUS_08420 1023 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08420 1295 1564 gene locus_tag LOCUS_08430 1295 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1561 1863 gene locus_tag LOCUS_08440 1561 1863 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021517.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence221 >Feature sequence222 1539 514 gene locus_tag LOCUS_08450 gene lipA 1539 514 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWA4 protein_id gnl|my_center|LOCUS_08450 1658 2404 gene locus_tag LOCUS_08460 1658 2404 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_08460 2442 2528 gene locus_tag LOCUS_t00120 2442 2528 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence223 2239 1037 gene locus_tag LOCUS_08470 2239 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence224 <2587 1683 gene locus_tag LOCUS_08480 <2587 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876013.1:dolichyl-phosphate mannose synthase >Feature sequence225 >Feature sequence226 410 685 gene locus_tag LOCUS_08490 410 685 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868638.1 protein_id gnl|my_center|LOCUS_08490 691 882 gene locus_tag LOCUS_08500 691 882 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_08500 896 1108 gene locus_tag LOCUS_08510 896 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1110 1934 gene locus_tag LOCUS_08520 1110 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2385 1936 gene locus_tag LOCUS_08530 2385 1936 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810899.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence227 880 1818 gene locus_tag LOCUS_08540 gene mdh 880 1818 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80040 protein_id gnl|my_center|LOCUS_08540 2522 1812 gene locus_tag LOCUS_08550 2522 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence228 >Feature sequence229 1555 386 gene locus_tag LOCUS_08560 1555 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence230 229 504 gene locus_tag LOCUS_08570 229 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 515 1123 gene locus_tag LOCUS_08580 515 1123 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_08580 1102 2115 gene locus_tag LOCUS_08590 1102 2115 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence231 57 992 gene locus_tag LOCUS_08600 57 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1006 1542 gene locus_tag LOCUS_08610 1006 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1539 2462 gene locus_tag LOCUS_08620 1539 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393794.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence232 <1 693 gene locus_tag LOCUS_08630 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947573.1:glutamate--cysteine ligase 735 1409 gene locus_tag LOCUS_08640 735 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1406 1738 gene locus_tag LOCUS_08650 1406 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1743 2012 gene locus_tag LOCUS_08660 1743 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 <2536 2014 gene locus_tag LOCUS_08670 <2536 2014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878013.1:iron-sulfur-binding protein >Feature sequence233 <1 557 gene locus_tag LOCUS_08680 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWB2:glutamate dehydrogenase 1984 2336 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttgccattttgattgtcaccgtacccatc >Feature sequence234 306 22 gene locus_tag LOCUS_08690 306 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 491 946 gene locus_tag LOCUS_08700 491 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1562 957 gene locus_tag LOCUS_08710 1562 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1666 1998 gene locus_tag LOCUS_08720 gene cutA 1666 1998 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933271.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence235 >Feature sequence236 >Feature sequence237 1180 485 gene locus_tag LOCUS_08730 1180 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1936 1250 gene locus_tag LOCUS_08740 1936 1250 CDS product RNA-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_08740 <2507 1985 gene locus_tag LOCUS_08750 <2507 1985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065214.1:proteasome subunit alpha >Feature sequence238 <1 933 gene locus_tag LOCUS_08760 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496391.1:AAA family ATPase 971 1537 gene locus_tag LOCUS_08770 971 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence239 584 1159 gene locus_tag LOCUS_08780 584 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2286 1156 gene locus_tag LOCUS_08790 2286 1156 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence240 >Feature sequence241 323 1381 gene locus_tag LOCUS_08800 323 1381 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867600.1 protein_id gnl|my_center|LOCUS_08800 1418 1660 gene locus_tag LOCUS_08810 1418 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 <2482 1661 gene locus_tag LOCUS_08820 <2482 1661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867914.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS >Feature sequence242 2354 1461 gene locus_tag LOCUS_08830 2354 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence243 >Feature sequence244 >Feature sequence245 729 1205 gene locus_tag LOCUS_08840 729 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1280 1366 gene locus_tag LOCUS_t00130 1280 1366 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2208 1390 gene locus_tag LOCUS_08850 gene nei 2208 1390 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9V3 protein_id gnl|my_center|LOCUS_08850 >Feature sequence246 797 2386 gene locus_tag LOCUS_08860 797 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence247 <2404 1887 gene locus_tag LOCUS_08870 <2404 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404917.1:macrolide ABC transporter ATP-binding protein >Feature sequence248 144 875 gene locus_tag LOCUS_08880 144 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence249 742 1344 gene locus_tag LOCUS_08890 742 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 1360 1671 gene locus_tag LOCUS_08900 1360 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1681 2325 gene locus_tag LOCUS_08910 1681 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence250 1082 549 gene locus_tag LOCUS_08920 gene msrA 1082 549 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WP0 protein_id gnl|my_center|LOCUS_08920 >Feature sequence251 >Feature sequence252 <2318 424 gene locus_tag LOCUS_08930 <2318 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877720.1:menaquinone biosynthesis decarboxylase >Feature sequence253 974 18 gene locus_tag LOCUS_08940 974 18 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_08940 2000 1062 gene locus_tag LOCUS_08950 2000 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence254 >Feature sequence255 822 10 gene locus_tag LOCUS_08960 822 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1699 827 gene locus_tag LOCUS_08970 gene folD 1699 827 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_08970 2191 1739 gene locus_tag LOCUS_08980 2191 1739 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence256 >Feature sequence257 363 1292 gene locus_tag LOCUS_08990 363 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence258 <1 783 gene locus_tag LOCUS_09000 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein 1840 785 gene locus_tag LOCUS_09010 1840 785 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022056.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence259 <1 951 gene locus_tag LOCUS_09020 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249716.1:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence260 1399 77 gene locus_tag LOCUS_09030 1399 77 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_09030 <2252 1408 gene locus_tag LOCUS_09040 <2252 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037668.1:oxidoreductase >Feature sequence261 857 33 gene locus_tag LOCUS_09050 857 33 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence262 <2251 1106 gene locus_tag LOCUS_09060 <2251 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262972.1:haloacid dehalogenase >Feature sequence263 417 1070 gene locus_tag LOCUS_09070 gene queE 417 1070 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45097 protein_id gnl|my_center|LOCUS_09070 1070 2212 gene locus_tag LOCUS_09080 1070 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence264 1929 556 gene locus_tag LOCUS_09090 gene pepP 1929 556 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038361.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence265 >Feature sequence266 115 720 gene locus_tag LOCUS_09100 115 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 768 1019 gene locus_tag LOCUS_09110 768 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 <2219 1020 gene locus_tag LOCUS_09120 <2219 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533145.1:3-isopropylmalate dehydrogenase >Feature sequence267 >Feature sequence268 >Feature sequence269 1957 1130 gene locus_tag LOCUS_09130 gene mqnA 1957 1130 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SK49 protein_id gnl|my_center|LOCUS_09130 >Feature sequence270 807 109 gene locus_tag LOCUS_09140 807 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence271 >Feature sequence272 114 1367 gene locus_tag LOCUS_09150 gene hutI 114 1367 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42084 protein_id gnl|my_center|LOCUS_09150 1430 1747 gene locus_tag LOCUS_09160 1430 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1863 2153 gene locus_tag LOCUS_09170 1863 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence273 2087 975 gene locus_tag LOCUS_09180 2087 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence274 1962 598 gene locus_tag LOCUS_09190 1962 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence275 <1 1692 gene locus_tag LOCUS_09200 <1 1692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083081.1:cytosine deaminase >Feature sequence276 <2119 1284 gene locus_tag LOCUS_09210 <2119 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903788.1:thiamine ABC transporter substrate-binding protein >Feature sequence277 >Feature sequence278 222 473 gene locus_tag LOCUS_09220 222 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 546 860 gene locus_tag LOCUS_09230 546 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1353 862 gene locus_tag LOCUS_09240 1353 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1434 2048 gene locus_tag LOCUS_09250 1434 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence279 >Feature sequence280 683 1069 gene locus_tag LOCUS_09260 683 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1079 2077 gene locus_tag LOCUS_09270 1079 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence281 >Feature sequence282 >Feature sequence283 >Feature sequence284 <2077 636 gene locus_tag LOCUS_09280 <2077 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81AC6:histidine ammonia-lyase >Feature sequence285 <1 505 gene locus_tag LOCUS_09290 <1 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q03AH0:spermidine/putrescine import ATP-binding protein PotA 513 1061 gene locus_tag LOCUS_09300 513 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence286 1800 514 gene locus_tag LOCUS_09310 gene bkdB 1800 514 CDS product lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M0 protein_id gnl|my_center|LOCUS_09310 >Feature sequence287 >Feature sequence288 1983 871 gene locus_tag LOCUS_09320 1983 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence289 >Feature sequence290 1760 699 gene locus_tag LOCUS_09330 1760 699 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946160.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence291 221 955 gene locus_tag LOCUS_09340 221 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence292 1293 1763 gene locus_tag LOCUS_09350 1293 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence293 <1 971 gene locus_tag LOCUS_09360 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879527.1:serine--tRNA ligase >Feature sequence294 >Feature sequence295 >Feature sequence296 128 316 gene locus_tag LOCUS_09370 gene cspLB 128 316 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_09370 1009 416 gene locus_tag LOCUS_09380 1009 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1193 1011 gene locus_tag LOCUS_09390 1193 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 <2015 1187 gene locus_tag LOCUS_09400 <2015 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124033.1:monooxygenase >Feature sequence297 >Feature sequence298 >Feature sequence299 549 1724 gene locus_tag LOCUS_09410 549 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence300 >Feature sequence301 <1 1385 gene locus_tag LOCUS_09420 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868364.1:endoribonuclease >Feature sequence302 179 1417 gene locus_tag LOCUS_09430 179 1417 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_09430 1480 1935 gene locus_tag LOCUS_09440 1480 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence303 461 1507 gene locus_tag LOCUS_09450 461 1507 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_09450 1839 1510 gene locus_tag LOCUS_09460 1839 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence304 2 820 gene locus_tag LOCUS_09470 2 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1741 821 gene locus_tag LOCUS_09480 1741 821 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence305 779 96 gene locus_tag LOCUS_09490 779 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 >Feature sequence306 >Feature sequence307 96 821 gene locus_tag LOCUS_09500 96 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 <1950 814 gene locus_tag LOCUS_09510 <1950 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903698.1:alanine--tRNA ligase >Feature sequence308 1 663 gene locus_tag LOCUS_09520 1 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 742 999 gene locus_tag LOCUS_09530 742 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 <1945 996 gene locus_tag LOCUS_09540 <1945 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBB3:tryptophan 2,3-dioxygenase-like protein >Feature sequence309 <1 918 gene locus_tag LOCUS_09550 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272339.1:RNA helicase 1891 920 gene locus_tag LOCUS_09560 1891 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence310 946 173 gene locus_tag LOCUS_09570 946 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 <1930 998 gene locus_tag LOCUS_09580 <1930 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89GL1:dihydrolipoyl dehydrogenase >Feature sequence311 1463 564 gene locus_tag LOCUS_09590 1463 564 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147293.1 protein_id gnl|my_center|LOCUS_09590 1482 1904 gene locus_tag LOCUS_09600 1482 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence312 <1 858 gene locus_tag LOCUS_09610 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065995.1:UDP-glucose 4-epimerase 863 1495 gene locus_tag LOCUS_09620 863 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence313 >Feature sequence314 984 1817 gene locus_tag LOCUS_09630 984 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence315 >Feature sequence316 >Feature sequence317 930 589 gene locus_tag LOCUS_09640 930 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence318 2 77 gene locus_tag LOCUS_t00140 2 77 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1030 83 gene locus_tag LOCUS_09650 1030 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 <1814 1080 gene locus_tag LOCUS_09660 <1814 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256159.1:2-oxoglutarate ferredoxin oxidoreductase subunit beta >Feature sequence319 957 1463 gene locus_tag LOCUS_09670 957 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence320 >Feature sequence321 524 1318 gene locus_tag LOCUS_09680 524 1318 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLA3 protein_id gnl|my_center|LOCUS_09680 >Feature sequence322 <1797 114 gene locus_tag LOCUS_09690 <1797 114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949162.1:TPP-dependent acetoin dehydrogenase complex, E1 protein subunit beta >Feature sequence323 >Feature sequence324 >Feature sequence325 <1738 376 gene locus_tag LOCUS_09700 <1738 376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9L065:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence326 >Feature sequence327 1521 247 gene locus_tag LOCUS_09710 1521 247 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_09710 1630 1705 gene locus_tag LOCUS_t00150 1630 1705 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence328 1337 228 gene locus_tag LOCUS_09720 1337 228 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence329 >Feature sequence330 263 613 gene locus_tag LOCUS_09730 263 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence331 685 918 gene locus_tag LOCUS_09740 685 918 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_09740 928 1161 gene locus_tag LOCUS_09750 928 1161 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_09750 1697 1158 gene locus_tag LOCUS_09760 1697 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence332 1432 599 gene locus_tag LOCUS_09770 1432 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence333 <1 872 gene locus_tag LOCUS_09780 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:methylmalonyl-CoA carboxyltransferase 884 1072 gene locus_tag LOCUS_09790 884 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1077 1472 gene locus_tag LOCUS_09800 1077 1472 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868008.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence334 >Feature sequence335 >Feature sequence336 >Feature sequence337 >Feature sequence338 111 37 gene locus_tag LOCUS_t00160 111 37 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1204 146 gene locus_tag LOCUS_09810 1204 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1477 1328 gene locus_tag LOCUS_09820 1477 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence339 768 1547 gene locus_tag LOCUS_09830 768 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence340 >Feature sequence341 157 1191 gene locus_tag LOCUS_09840 157 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence342 593 75 gene locus_tag LOCUS_09850 593 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 970 701 gene locus_tag LOCUS_09860 970 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1024 1197 gene locus_tag LOCUS_09870 1024 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence343 1395 946 gene locus_tag LOCUS_09880 1395 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence344 <1539 960 gene locus_tag LOCUS_09890 <1539 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q46366:putative arsenical pump-driving ATPase >Feature sequence345 >Feature sequence346 >Feature sequence347 147 1442 gene locus_tag LOCUS_09900 147 1442 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence348 <1 768 gene locus_tag LOCUS_09910 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089071.1:3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha >Feature sequence349 1 567 gene locus_tag LOCUS_09920 1 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920