>Feature sequence001 1214 396 gene locus_tag LOCUS_00010 1214 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1306 2244 gene locus_tag LOCUS_00020 1306 2244 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459306.1 protein_id gnl|my_center|LOCUS_00020 2254 2478 gene locus_tag LOCUS_00030 2254 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2498 2641 gene locus_tag LOCUS_00040 2498 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2643 2912 gene locus_tag LOCUS_00050 2643 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4321 2921 gene locus_tag LOCUS_00060 gene fum 4321 2921 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZRE5 protein_id gnl|my_center|LOCUS_00060 5051 4539 gene locus_tag LOCUS_00070 gene ppiB 5051 4539 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PC26 protein_id gnl|my_center|LOCUS_00070 8865 5074 gene locus_tag LOCUS_00080 8865 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9794 8862 gene locus_tag LOCUS_00090 9794 8862 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867654.1 protein_id gnl|my_center|LOCUS_00090 10194 9811 gene locus_tag LOCUS_00100 10194 9811 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_00100 10856 10194 gene locus_tag LOCUS_00110 10856 10194 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_00110 11340 10873 gene locus_tag LOCUS_00120 11340 10873 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_00120 >Feature sequence002 1343 339 gene locus_tag LOCUS_00130 1343 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 1777 1340 gene locus_tag LOCUS_00140 1777 1340 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_00140 3063 1813 gene locus_tag LOCUS_00150 gene folC 3063 1813 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_00150 3211 5445 gene locus_tag LOCUS_00160 3211 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 5456 6748 gene locus_tag LOCUS_00170 5456 6748 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_00170 6789 7670 gene locus_tag LOCUS_00180 6789 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 8137 7667 gene locus_tag LOCUS_00190 8137 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 9648 8137 gene locus_tag LOCUS_00200 9648 8137 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_00200 10515 9658 gene locus_tag LOCUS_00210 10515 9658 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201022.1 protein_id gnl|my_center|LOCUS_00210 <11443 10559 gene locus_tag LOCUS_00220 <11443 10559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257900.1:propionyl-CoA carboxylase >Feature sequence003 1721 756 gene locus_tag LOCUS_00230 1721 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 4703 1722 gene locus_tag LOCUS_00240 4703 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 5386 4796 gene locus_tag LOCUS_00250 5386 4796 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878817.1 protein_id gnl|my_center|LOCUS_00250 5489 6625 gene locus_tag LOCUS_00260 5489 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 6658 7437 gene locus_tag LOCUS_00270 6658 7437 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_00270 7655 7434 gene locus_tag LOCUS_00280 7655 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7680 9113 gene locus_tag LOCUS_00290 7680 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 9134 10057 gene locus_tag LOCUS_00300 9134 10057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 >Feature sequence004 3054 3326 gene locus_tag LOCUS_00310 3054 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3403 3936 gene locus_tag LOCUS_00320 3403 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 3945 5396 gene locus_tag LOCUS_00330 3945 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5440 5817 gene locus_tag LOCUS_00340 5440 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 5872 6552 gene locus_tag LOCUS_00350 5872 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 6779 6522 gene locus_tag LOCUS_00360 6779 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 7589 6789 gene locus_tag LOCUS_00370 7589 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 8627 7614 gene locus_tag LOCUS_00380 8627 7614 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_00380 >Feature sequence005 1693 6663 gene locus_tag LOCUS_00390 1693 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 7283 6666 gene locus_tag LOCUS_00400 7283 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 7361 8323 gene locus_tag LOCUS_00410 7361 8323 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKP2 protein_id gnl|my_center|LOCUS_00410 8393 9223 gene locus_tag LOCUS_00420 8393 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 9233 10084 gene locus_tag LOCUS_00430 9233 10084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence006 518 3781 gene locus_tag LOCUS_00440 518 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 3832 4992 gene locus_tag LOCUS_00450 3832 4992 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_00450 5002 5550 gene locus_tag LOCUS_00460 5002 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6810 5551 gene locus_tag LOCUS_00470 6810 5551 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_00470 6889 6962 gene locus_tag LOCUS_t00010 6889 6962 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7928 6963 gene locus_tag LOCUS_00480 7928 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 8363 9319 gene locus_tag LOCUS_00490 8363 9319 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG3 protein_id gnl|my_center|LOCUS_00490 >Feature sequence007 <1 929 gene locus_tag LOCUS_00500 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NC99:dihydroorotate dehydrogenase (quinone) 941 1333 gene locus_tag LOCUS_00510 941 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 1704 1982 gene locus_tag LOCUS_00520 1704 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 2440 1940 gene locus_tag LOCUS_00530 2440 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 3511 2450 gene locus_tag LOCUS_00540 3511 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4504 3545 gene locus_tag LOCUS_00550 4504 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4591 5703 gene locus_tag LOCUS_00560 4591 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7810 5705 gene locus_tag LOCUS_00570 7810 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 >Feature sequence008 4207 3542 gene locus_tag LOCUS_00580 4207 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 8657 4212 gene locus_tag LOCUS_00590 8657 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 >Feature sequence009 545 189 gene locus_tag LOCUS_00600 545 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 752 1135 gene locus_tag LOCUS_00610 gene gcvH 752 1135 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKW9 protein_id gnl|my_center|LOCUS_00610 1141 1677 gene locus_tag LOCUS_00620 1141 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 2540 1674 gene locus_tag LOCUS_00630 2540 1674 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147293.1 protein_id gnl|my_center|LOCUS_00630 2593 3015 gene locus_tag LOCUS_00640 2593 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 4502 3018 gene locus_tag LOCUS_00650 4502 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 5462 4536 gene locus_tag LOCUS_00660 gene tfb 5462 4536 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_00660 5685 7673 gene locus_tag LOCUS_00670 5685 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 >Feature sequence010 6031 998 gene locus_tag LOCUS_00680 6031 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 7186 6149 gene locus_tag LOCUS_00690 7186 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 7281 7646 gene locus_tag LOCUS_00700 7281 7646 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 protein_id gnl|my_center|LOCUS_00700 >Feature sequence011 1953 1099 gene locus_tag LOCUS_00710 1953 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2053 2982 gene locus_tag LOCUS_00720 2053 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403621.1 protein_id gnl|my_center|LOCUS_00720 2983 3801 gene locus_tag LOCUS_00730 2983 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3798 4874 gene locus_tag LOCUS_00740 3798 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4864 6330 gene locus_tag LOCUS_00750 4864 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 6380 7357 gene locus_tag LOCUS_00760 6380 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence012 <1 2926 gene locus_tag LOCUS_00770 <1 2926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022129.1:carbamoyl phosphate synthase large subunit 4195 2927 gene locus_tag LOCUS_00780 4195 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 5891 4284 gene locus_tag LOCUS_00790 gene lysS 5891 4284 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E175 protein_id gnl|my_center|LOCUS_00790 6485 5901 gene locus_tag LOCUS_00800 6485 5901 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876509.1 protein_id gnl|my_center|LOCUS_00800 6604 7014 gene locus_tag LOCUS_00810 6604 7014 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_00810 7366 7016 gene locus_tag LOCUS_00820 7366 7016 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_00820 7619 7371 gene locus_tag LOCUS_00830 gene phhB 7619 7371 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGD3 protein_id gnl|my_center|LOCUS_00830 >Feature sequence013 884 1183 gene locus_tag LOCUS_00840 884 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867957.1 protein_id gnl|my_center|LOCUS_00840 1589 1206 gene locus_tag LOCUS_00850 1589 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 2855 1617 gene locus_tag LOCUS_00860 2855 1617 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875900.1 protein_id gnl|my_center|LOCUS_00860 3385 2894 gene locus_tag LOCUS_00870 3385 2894 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_00870 4697 3462 gene locus_tag LOCUS_00880 4697 3462 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_00880 5859 4750 gene locus_tag LOCUS_00890 gene dph2 5859 4750 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_00890 6485 5919 gene locus_tag LOCUS_00900 6485 5919 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_00900 6935 6534 gene locus_tag LOCUS_00910 gene gcvH 6935 6534 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2E6 protein_id gnl|my_center|LOCUS_00910 >Feature sequence014 658 1089 gene locus_tag LOCUS_00920 658 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 1112 6160 gene locus_tag LOCUS_00930 1112 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6153 7199 gene locus_tag LOCUS_00940 6153 7199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 7249 7797 gene locus_tag LOCUS_00950 7249 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 >Feature sequence015 917 51 gene locus_tag LOCUS_00960 917 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 1019 1567 gene locus_tag LOCUS_00970 1019 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 2848 1808 gene locus_tag LOCUS_00980 2848 1808 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_00980 4251 3046 gene locus_tag LOCUS_00990 gene rimK 4251 3046 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_00990 4342 5358 gene locus_tag LOCUS_01000 4342 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 5453 7654 gene locus_tag LOCUS_01010 5453 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence016 1 690 gene locus_tag LOCUS_01020 1 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 753 1988 gene locus_tag LOCUS_01030 753 1988 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000100874.1 protein_id gnl|my_center|LOCUS_01030 2065 4602 gene locus_tag LOCUS_01040 2065 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 4604 5725 gene locus_tag LOCUS_01050 4604 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 5722 6297 gene locus_tag LOCUS_01060 5722 6297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 7080 6283 gene locus_tag LOCUS_01070 7080 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 >Feature sequence017 246 776 gene locus_tag LOCUS_01080 246 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1684 860 gene locus_tag LOCUS_01090 1684 860 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 protein_id gnl|my_center|LOCUS_01090 1775 2152 gene locus_tag LOCUS_01100 1775 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2241 3425 gene locus_tag LOCUS_01110 2241 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3673 3837 gene locus_tag LOCUS_01120 3673 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3830 4192 gene locus_tag LOCUS_01130 3830 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 4248 4919 gene locus_tag LOCUS_01140 4248 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 5022 4948 gene locus_tag LOCUS_t00020 5022 4948 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5132 5554 gene locus_tag LOCUS_01150 5132 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 5551 6255 gene locus_tag LOCUS_01160 5551 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 6700 6257 gene locus_tag LOCUS_01170 6700 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 7210 6710 gene locus_tag LOCUS_01180 7210 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence018 2247 223 gene locus_tag LOCUS_01190 2247 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3146 2316 gene locus_tag LOCUS_01200 3146 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 4168 3143 gene locus_tag LOCUS_01210 4168 3143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4269 5168 gene locus_tag LOCUS_01220 4269 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5377 7728 gene locus_tag LOCUS_01230 5377 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 >Feature sequence019 <1 1347 gene locus_tag LOCUS_01240 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812211.1:membrane protein 2877 1339 gene locus_tag LOCUS_01250 2877 1339 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_01250 4619 2949 gene locus_tag LOCUS_01260 4619 2949 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence020 2097 526 gene locus_tag LOCUS_01270 2097 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2165 3886 gene locus_tag LOCUS_01280 2165 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4339 3890 gene locus_tag LOCUS_01290 4339 3890 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_01290 4802 4353 gene locus_tag LOCUS_01300 4802 4353 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_01300 4832 6088 gene locus_tag LOCUS_01310 4832 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6126 6992 gene locus_tag LOCUS_01320 6126 6992 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence021 5 3025 gene locus_tag LOCUS_01330 5 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 3092 5704 gene locus_tag LOCUS_01340 3092 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 6575 5688 gene locus_tag LOCUS_01350 6575 5688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence022 80 1678 gene locus_tag LOCUS_01360 80 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2902 1679 gene locus_tag LOCUS_01370 2902 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4188 2944 gene locus_tag LOCUS_01380 4188 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_01380 4460 4897 gene locus_tag LOCUS_01390 4460 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4878 5516 gene locus_tag LOCUS_01400 4878 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5522 5752 gene locus_tag LOCUS_01410 5522 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5762 6253 gene locus_tag LOCUS_01420 5762 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 <6925 6257 gene locus_tag LOCUS_01430 <6925 6257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9A7M0:phosphoribosylglycinamide formyltransferase >Feature sequence023 5168 249 gene locus_tag LOCUS_01440 5168 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6759 5248 gene locus_tag LOCUS_01450 6759 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence024 978 373 gene locus_tag LOCUS_01460 978 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 1086 1391 gene locus_tag LOCUS_01470 1086 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 3296 1392 gene locus_tag LOCUS_01480 3296 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_01480 4004 3384 gene locus_tag LOCUS_01490 4004 3384 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_01490 4162 4815 gene locus_tag LOCUS_01500 4162 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4815 5435 gene locus_tag LOCUS_01510 4815 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146800.1 protein_id gnl|my_center|LOCUS_01510 6830 5436 gene locus_tag LOCUS_01520 6830 5436 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_01520 >Feature sequence025 3067 236 gene locus_tag LOCUS_01530 3067 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 3314 5041 gene locus_tag LOCUS_01540 3314 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 5061 5813 gene locus_tag LOCUS_01550 5061 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 <6833 5814 gene locus_tag LOCUS_01560 <6833 5814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289466.1:serine/threonine protein kinase >Feature sequence026 1517 183 gene locus_tag LOCUS_01570 1517 183 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_01570 1959 2165 gene locus_tag LOCUS_01580 1959 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 2166 2894 gene locus_tag LOCUS_01590 2166 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 2972 4048 gene locus_tag LOCUS_01600 2972 4048 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804775.1 protein_id gnl|my_center|LOCUS_01600 4082 4846 gene locus_tag LOCUS_01610 4082 4846 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403895.1 protein_id gnl|my_center|LOCUS_01610 5491 4922 gene locus_tag LOCUS_01620 5491 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence027 430 1704 gene locus_tag LOCUS_01630 gene purD 430 1704 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMH3 protein_id gnl|my_center|LOCUS_01630 >Feature sequence028 >Feature sequence029 120 599 gene locus_tag LOCUS_01640 120 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 596 1999 gene locus_tag LOCUS_01650 596 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2024 3241 gene locus_tag LOCUS_01660 2024 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3251 4498 gene locus_tag LOCUS_01670 3251 4498 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_01670 4603 5373 gene locus_tag LOCUS_01680 4603 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 >Feature sequence030 <1 1976 gene locus_tag LOCUS_01690 <1 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056626.1:integral membrane signal transducer protein 2141 2067 gene locus_tag LOCUS_t00030 2141 2067 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2257 2601 gene locus_tag LOCUS_01700 2257 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 3757 2567 gene locus_tag LOCUS_01710 3757 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 3782 4810 gene locus_tag LOCUS_01720 3782 4810 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_01720 5839 4793 gene locus_tag LOCUS_01730 5839 4793 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173900.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence031 1081 278 gene locus_tag LOCUS_01740 1081 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1659 1078 gene locus_tag LOCUS_01750 1659 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2827 1670 gene locus_tag LOCUS_01760 2827 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2970 4958 gene locus_tag LOCUS_01770 2970 4958 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249133.1 protein_id gnl|my_center|LOCUS_01770 5004 5570 gene locus_tag LOCUS_01780 5004 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 >Feature sequence032 185 1006 gene locus_tag LOCUS_01790 185 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1186 2223 gene locus_tag LOCUS_01800 1186 2223 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_01800 2302 3441 gene locus_tag LOCUS_01810 2302 3441 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_01810 4020 3442 gene locus_tag LOCUS_01820 4020 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4218 4859 gene locus_tag LOCUS_01830 4218 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5200 4856 gene locus_tag LOCUS_01840 5200 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 >Feature sequence033 4688 3645 gene locus_tag LOCUS_01850 4688 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4778 5992 gene locus_tag LOCUS_01860 4778 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence034 <1 1820 gene locus_tag LOCUS_01870 <1 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:alkaline serine protease 1924 3525 gene locus_tag LOCUS_01880 1924 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 3526 4212 gene locus_tag LOCUS_01890 3526 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence035 >Feature sequence036 831 1316 gene locus_tag LOCUS_01900 831 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 1327 1917 gene locus_tag LOCUS_01910 1327 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1919 2572 gene locus_tag LOCUS_01920 1919 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2582 3721 gene locus_tag LOCUS_01930 gene nuoD1 2582 3721 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEX8 protein_id gnl|my_center|LOCUS_01930 3732 5240 gene locus_tag LOCUS_01940 3732 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 >Feature sequence037 >Feature sequence038 875 489 gene locus_tag LOCUS_01950 875 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1216 1404 gene locus_tag LOCUS_01960 1216 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1720 2022 gene locus_tag LOCUS_01970 1720 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 2394 2104 gene locus_tag LOCUS_01980 2394 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2867 2568 gene locus_tag LOCUS_01990 2867 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 2981 4504 gene locus_tag LOCUS_02000 2981 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 5231 4518 gene locus_tag LOCUS_02010 5231 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 5282 5653 gene locus_tag LOCUS_02020 5282 5653 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957355.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence039 >Feature sequence040 57 554 gene locus_tag LOCUS_02030 57 554 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_02030 551 1396 gene locus_tag LOCUS_02040 551 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197352.1 protein_id gnl|my_center|LOCUS_02040 1575 1498 gene locus_tag LOCUS_t00040 1575 1498 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2264 1641 gene locus_tag LOCUS_02050 2264 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2345 2836 gene locus_tag LOCUS_02060 2345 2836 CDS product ribonuclease VapC2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877464.1 protein_id gnl|my_center|LOCUS_02060 3140 2838 gene locus_tag LOCUS_02070 3140 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3464 3213 gene locus_tag LOCUS_02080 3464 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 3516 4214 gene locus_tag LOCUS_02090 3516 4214 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_02090 >Feature sequence041 2665 761 gene locus_tag LOCUS_02100 2665 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 2916 3293 gene locus_tag LOCUS_02110 2916 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 3361 4587 gene locus_tag LOCUS_02120 3361 4587 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence042 297 1301 gene locus_tag LOCUS_02130 297 1301 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876655.1 protein_id gnl|my_center|LOCUS_02130 1396 2661 gene locus_tag LOCUS_02140 1396 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2663 3256 gene locus_tag LOCUS_02150 2663 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_02150 4065 3253 gene locus_tag LOCUS_02160 4065 3253 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence043 1017 1334 gene locus_tag LOCUS_02170 1017 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 1331 1660 gene locus_tag LOCUS_02180 1331 1660 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63QE8 protein_id gnl|my_center|LOCUS_02180 1699 2928 gene locus_tag LOCUS_02190 1699 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4856 2964 gene locus_tag LOCUS_02200 4856 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5044 4871 gene locus_tag LOCUS_02210 5044 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 <5882 5166 gene locus_tag LOCUS_02220 <5882 5166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963428.1:UDP-N-acetyl-D-galactosamine dehydrogenase >Feature sequence044 1497 496 gene locus_tag LOCUS_02230 gene corA 1497 496 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU6 protein_id gnl|my_center|LOCUS_02230 1722 1531 gene locus_tag LOCUS_02240 1722 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 2072 1734 gene locus_tag LOCUS_02250 2072 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 3173 2082 gene locus_tag LOCUS_02260 3173 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4128 3271 gene locus_tag LOCUS_02270 4128 3271 CDS product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879279.1 protein_id gnl|my_center|LOCUS_02270 4937 4143 gene locus_tag LOCUS_02280 4937 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 5332 4967 gene locus_tag LOCUS_02290 5332 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5632 5342 gene locus_tag LOCUS_02300 5632 5342 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence045 1333 2112 gene locus_tag LOCUS_02310 1333 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence046 1040 1309 gene locus_tag LOCUS_02320 1040 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence047 <1 508 gene locus_tag LOCUS_02330 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971547.1:acetyl-CoA carboxylase biotin carboxylase subunit 517 1479 gene locus_tag LOCUS_02340 517 1479 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_02340 3161 1482 gene locus_tag LOCUS_02350 3161 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4278 3256 gene locus_tag LOCUS_02360 4278 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_02360 4783 4322 gene locus_tag LOCUS_02370 4783 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 4874 5545 gene locus_tag LOCUS_02380 4874 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence048 <1 1746 gene locus_tag LOCUS_02390 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878155.1:DNA topoisomerase VI subunit B 1746 2843 gene locus_tag LOCUS_02400 1746 2843 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_02400 2886 3926 gene locus_tag LOCUS_02410 2886 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 3937 4554 gene locus_tag LOCUS_02420 3937 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4663 5418 gene locus_tag LOCUS_02430 4663 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence049 802 203 gene locus_tag LOCUS_02440 802 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 902 1579 gene locus_tag LOCUS_02450 902 1579 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_02450 1624 2022 gene locus_tag LOCUS_02460 1624 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2832 2023 gene locus_tag LOCUS_02470 2832 2023 CDS product dimethylargininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_02470 2969 3523 gene locus_tag LOCUS_02480 2969 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 4296 3646 gene locus_tag LOCUS_02490 4296 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 >Feature sequence050 >Feature sequence051 <1 4025 gene locus_tag LOCUS_02500 <1 4025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021767.1:cell surface protein 4053 5207 gene locus_tag LOCUS_02510 4053 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence052 <1 1094 gene locus_tag LOCUS_02520 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I4U3:DNA recombination protein RmuC 1265 1095 gene locus_tag LOCUS_02530 1265 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1451 1711 gene locus_tag LOCUS_02540 1451 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1721 2851 gene locus_tag LOCUS_02550 gene rnz 1721 2851 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ23 protein_id gnl|my_center|LOCUS_02550 2936 5353 gene locus_tag LOCUS_02560 2936 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence053 1076 2296 gene locus_tag LOCUS_02570 1076 2296 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459846.1 protein_id gnl|my_center|LOCUS_02570 2381 2863 gene locus_tag LOCUS_02580 2381 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_02580 2883 3656 gene locus_tag LOCUS_02590 2883 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903274.1 protein_id gnl|my_center|LOCUS_02590 3653 4045 gene locus_tag LOCUS_02600 3653 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 >Feature sequence054 2005 548 gene locus_tag LOCUS_02610 2005 548 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173038.1 protein_id gnl|my_center|LOCUS_02610 3123 2008 gene locus_tag LOCUS_02620 3123 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4401 3130 gene locus_tag LOCUS_02630 4401 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5289 4441 gene locus_tag LOCUS_02640 5289 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 >Feature sequence055 <1 4532 gene locus_tag LOCUS_02650 <1 4532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:peptidase S8 4577 5206 gene locus_tag LOCUS_02660 gene adk 4577 5206 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRI0 protein_id gnl|my_center|LOCUS_02660 >Feature sequence056 3 4184 gene locus_tag LOCUS_02670 3 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5503 4181 gene locus_tag LOCUS_02680 5503 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence057 170 1567 gene locus_tag LOCUS_02690 170 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3572 1569 gene locus_tag LOCUS_02700 3572 1569 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_02700 <5500 3565 gene locus_tag LOCUS_02710 <5500 3565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020572.1:DNA mismatch repair protein MutS >Feature sequence058 100 798 gene locus_tag LOCUS_02720 100 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 837 1592 gene locus_tag LOCUS_02730 837 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 1624 2448 gene locus_tag LOCUS_02740 1624 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2459 2884 gene locus_tag LOCUS_02750 2459 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 3248 2886 gene locus_tag LOCUS_02760 3248 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125357.1 protein_id gnl|my_center|LOCUS_02760 3399 3830 gene locus_tag LOCUS_02770 3399 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 3827 4261 gene locus_tag LOCUS_02780 3827 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence059 934 1566 gene locus_tag LOCUS_02790 934 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1575 2270 gene locus_tag LOCUS_02800 1575 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2330 3124 gene locus_tag LOCUS_02810 gene thyA 2330 3124 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KG32 protein_id gnl|my_center|LOCUS_02810 3134 3601 gene locus_tag LOCUS_02820 gene folA 3134 3601 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEC3 protein_id gnl|my_center|LOCUS_02820 3976 3602 gene locus_tag LOCUS_02830 3976 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4082 4756 gene locus_tag LOCUS_02840 4082 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 <5381 4774 gene locus_tag LOCUS_02850 <5381 4774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877204.1:5'-methylthioadenosine phosphorylase >Feature sequence060 1885 1361 gene locus_tag LOCUS_02860 1885 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2023 2199 gene locus_tag LOCUS_02870 2023 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 2989 2240 gene locus_tag LOCUS_02880 2989 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_02880 3103 3939 gene locus_tag LOCUS_02890 gene ara1 3103 3939 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_02890 4003 4881 gene locus_tag LOCUS_02900 4003 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence061 1498 3099 gene locus_tag LOCUS_02910 gene pckA1 1498 3099 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I3 protein_id gnl|my_center|LOCUS_02910 3377 3838 gene locus_tag LOCUS_02920 3377 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 3829 4839 gene locus_tag LOCUS_02930 3829 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence062 101 766 gene locus_tag LOCUS_02940 101 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 1719 769 gene locus_tag LOCUS_02950 1719 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2891 1686 gene locus_tag LOCUS_02960 2891 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence063 1313 3529 gene locus_tag LOCUS_02970 1313 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence064 1154 198 gene locus_tag LOCUS_02980 1154 198 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228996.1 protein_id gnl|my_center|LOCUS_02980 3220 1175 gene locus_tag LOCUS_02990 3220 1175 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_02990 3366 4565 gene locus_tag LOCUS_03000 3366 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence065 313 38 gene locus_tag LOCUS_03010 313 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 431 1501 gene locus_tag LOCUS_03020 gene ilvE 431 1501 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DZE9 protein_id gnl|my_center|LOCUS_03020 1963 1502 gene locus_tag LOCUS_03030 1963 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2400 2020 gene locus_tag LOCUS_03040 2400 2020 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_03040 3198 2455 gene locus_tag LOCUS_03050 gene ycgM 3198 2455 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261691.1 protein_id gnl|my_center|LOCUS_03050 3159 3650 gene locus_tag LOCUS_03060 3159 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 3701 4276 gene locus_tag LOCUS_03070 3701 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 4682 4260 gene locus_tag LOCUS_03080 4682 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence066 1055 282 gene locus_tag LOCUS_03090 1055 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1211 4504 gene locus_tag LOCUS_03100 gene ileS 1211 4504 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXZ6 protein_id gnl|my_center|LOCUS_03100 >Feature sequence067 575 2125 gene locus_tag LOCUS_03110 575 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2455 2126 gene locus_tag LOCUS_03120 gene trx 2455 2126 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y6A2 protein_id gnl|my_center|LOCUS_03120 2558 3244 gene locus_tag LOCUS_03130 gene rpe1 2558 3244 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182R3 protein_id gnl|my_center|LOCUS_03130 3259 4347 gene locus_tag LOCUS_03140 3259 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence068 2575 878 gene locus_tag LOCUS_03150 2575 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3957 2572 gene locus_tag LOCUS_03160 3957 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 <4950 4025 gene locus_tag LOCUS_03170 <4950 4025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002304146.1:NADH-dependent flavin oxidoreductase >Feature sequence069 150 2282 gene locus_tag LOCUS_03180 150 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 2298 2882 gene locus_tag LOCUS_03190 gene mogA 2298 2882 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_03190 2929 4350 gene locus_tag LOCUS_03200 2929 4350 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 protein_id gnl|my_center|LOCUS_03200 4418 4705 gene locus_tag LOCUS_03210 4418 4705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence070 <1 684 gene locus_tag LOCUS_03220 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MCY7:formamidopyrimidine-DNA glycosylase 1332 685 gene locus_tag LOCUS_03230 1332 685 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_03230 1582 1391 gene locus_tag LOCUS_03240 1582 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2031 1780 gene locus_tag LOCUS_03250 2031 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2007 2080 gene locus_tag LOCUS_t00050 2007 2080 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2094 2168 gene locus_tag LOCUS_t00060 2094 2168 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2214 3002 gene locus_tag LOCUS_03260 2214 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3012 3212 gene locus_tag LOCUS_03270 3012 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3212 3757 gene locus_tag LOCUS_03280 3212 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence071 102 31 gene locus_tag LOCUS_t00070 102 31 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 244 2334 gene locus_tag LOCUS_03290 244 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 3146 3664 gene locus_tag LOCUS_03300 3146 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 3833 4567 gene locus_tag LOCUS_03310 3833 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence072 2020 653 gene locus_tag LOCUS_03320 gene cca 2020 653 CDS product CCA-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WU19 protein_id gnl|my_center|LOCUS_03320 1968 2522 gene locus_tag LOCUS_03330 1968 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 4351 2516 gene locus_tag LOCUS_03340 4351 2516 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259046.1 protein_id gnl|my_center|LOCUS_03340 >Feature sequence073 1801 1094 gene locus_tag LOCUS_03350 1801 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2852 2178 gene locus_tag LOCUS_03360 2852 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3417 3025 gene locus_tag LOCUS_03370 3417 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3481 4059 gene locus_tag LOCUS_03380 3481 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence074 1249 650 gene locus_tag LOCUS_03390 gene pyrE 1249 650 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BL4 protein_id gnl|my_center|LOCUS_03390 >Feature sequence075 1317 304 gene locus_tag LOCUS_03400 1317 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 3087 1366 gene locus_tag LOCUS_03410 3087 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 3218 4651 gene locus_tag LOCUS_03420 3218 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence076 2035 1571 gene locus_tag LOCUS_03430 gene msrA 2035 1571 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WI73 protein_id gnl|my_center|LOCUS_03430 2202 4565 gene locus_tag LOCUS_03440 2202 4565 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856405.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence077 827 75 gene locus_tag LOCUS_03450 827 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2820 895 gene locus_tag LOCUS_03460 2820 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3321 2866 gene locus_tag LOCUS_03470 3321 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 3377 4354 gene locus_tag LOCUS_03480 3377 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence078 985 1566 gene locus_tag LOCUS_03490 985 1566 CDS product nucleoside-triphosphatase THEP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXP3 protein_id gnl|my_center|LOCUS_03490 1611 1958 gene locus_tag LOCUS_03500 1611 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 3343 1964 gene locus_tag LOCUS_03510 3343 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence079 29 304 gene locus_tag LOCUS_03520 29 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 310 501 gene locus_tag LOCUS_03530 310 501 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_03530 515 745 gene locus_tag LOCUS_03540 515 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 748 1587 gene locus_tag LOCUS_03550 748 1587 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250920.1 protein_id gnl|my_center|LOCUS_03550 2037 1588 gene locus_tag LOCUS_03560 2037 1588 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810899.1 protein_id gnl|my_center|LOCUS_03560 3185 2034 gene locus_tag LOCUS_03570 3185 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3844 3185 gene locus_tag LOCUS_03580 gene queE 3844 3185 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZC3 protein_id gnl|my_center|LOCUS_03580 4432 3854 gene locus_tag LOCUS_03590 gene folE 4432 3854 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXR9 protein_id gnl|my_center|LOCUS_03590 4593 4429 gene locus_tag LOCUS_03600 4593 4429 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903684.1 protein_id gnl|my_center|LOCUS_03600 >Feature sequence080 464 21 gene locus_tag LOCUS_03610 464 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 908 603 gene locus_tag LOCUS_03620 908 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 1765 995 gene locus_tag LOCUS_03630 1765 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 2248 1814 gene locus_tag LOCUS_03640 gene rlmH 2248 1814 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DE2 protein_id gnl|my_center|LOCUS_03640 2333 2668 gene locus_tag LOCUS_03650 2333 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2696 3385 gene locus_tag LOCUS_03660 2696 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 3400 4245 gene locus_tag LOCUS_03670 3400 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4638 4219 gene locus_tag LOCUS_03680 4638 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence081 705 238 gene locus_tag LOCUS_03690 705 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 851 4252 gene locus_tag LOCUS_03700 851 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4618 4256 gene locus_tag LOCUS_03710 4618 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence082 1557 1129 gene locus_tag LOCUS_03720 1557 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 1826 2179 gene locus_tag LOCUS_03730 1826 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2181 2675 gene locus_tag LOCUS_03740 2181 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 2878 2696 gene locus_tag LOCUS_03750 2878 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3262 2897 gene locus_tag LOCUS_03760 3262 2897 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015949.1 protein_id gnl|my_center|LOCUS_03760 3360 4352 gene locus_tag LOCUS_03770 3360 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4545 4342 gene locus_tag LOCUS_03780 4545 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 >Feature sequence083 409 110 gene locus_tag LOCUS_03790 409 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 928 473 gene locus_tag LOCUS_03800 928 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 2001 1081 gene locus_tag LOCUS_03810 2001 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 2786 1998 gene locus_tag LOCUS_03820 2786 1998 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X264 protein_id gnl|my_center|LOCUS_03820 4175 2796 gene locus_tag LOCUS_03830 4175 2796 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence084 186 2969 gene locus_tag LOCUS_03840 186 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4031 2970 gene locus_tag LOCUS_03850 4031 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4543 4181 gene locus_tag LOCUS_03860 4543 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence085 105 728 gene locus_tag LOCUS_03870 105 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 738 1598 gene locus_tag LOCUS_03880 738 1598 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_03880 4259 1599 gene locus_tag LOCUS_03890 4259 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 >Feature sequence086 635 1243 gene locus_tag LOCUS_03900 635 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2584 1247 gene locus_tag LOCUS_03910 2584 1247 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_03910 >Feature sequence087 108 449 gene locus_tag LOCUS_03920 108 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1429 443 gene locus_tag LOCUS_03930 1429 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2505 1450 gene locus_tag LOCUS_03940 2505 1450 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_03940 4322 2502 gene locus_tag LOCUS_03950 4322 2502 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence088 450 1658 gene locus_tag LOCUS_03960 450 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2336 1659 gene locus_tag LOCUS_03970 2336 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2517 3203 gene locus_tag LOCUS_03980 2517 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249621.1 protein_id gnl|my_center|LOCUS_03980 4211 3204 gene locus_tag LOCUS_03990 4211 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence089 <1 2528 gene locus_tag LOCUS_04000 <1 2528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256298.1:CSLREA domain-containing protein 3317 2529 gene locus_tag LOCUS_04010 3317 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence090 3549 2593 gene locus_tag LOCUS_04020 3549 2593 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_04020 3940 3551 gene locus_tag LOCUS_04030 gene speD 3940 3551 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HB76 protein_id gnl|my_center|LOCUS_04030 <4474 3940 gene locus_tag LOCUS_04040 <4474 3940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005771798.1:agmatinase >Feature sequence091 2012 2896 gene locus_tag LOCUS_04050 gene mqnD 2012 2896 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_04050 2902 3390 gene locus_tag LOCUS_04060 2902 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 3448 3654 gene locus_tag LOCUS_04070 3448 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 >Feature sequence092 <1 1245 gene locus_tag LOCUS_04080 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878420.1:aspartate--tRNA(Asn) ligase 1298 1981 gene locus_tag LOCUS_04090 1298 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 2422 1967 gene locus_tag LOCUS_04100 2422 1967 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CZU1 protein_id gnl|my_center|LOCUS_04100 2512 3258 gene locus_tag LOCUS_04110 2512 3258 CDS product putative lipase/esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704177.1 protein_id gnl|my_center|LOCUS_04110 3299 4114 gene locus_tag LOCUS_04120 3299 4114 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence093 2 349 gene locus_tag LOCUS_04130 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 1268 327 gene locus_tag LOCUS_04140 gene panE 1268 327 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPQ9 protein_id gnl|my_center|LOCUS_04140 3824 1272 gene locus_tag LOCUS_04150 3824 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4414 3902 gene locus_tag LOCUS_04160 4414 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence094 1865 1308 gene locus_tag LOCUS_04170 1865 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 2341 1874 gene locus_tag LOCUS_04180 2341 1874 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_04180 2433 3758 gene locus_tag LOCUS_04190 2433 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 <4382 3765 gene locus_tag LOCUS_04200 <4382 3765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66682:(R)-citramalate synthase >Feature sequence095 834 145 gene locus_tag LOCUS_04210 834 145 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_04210 1283 1005 gene locus_tag LOCUS_04220 1283 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1614 1288 gene locus_tag LOCUS_04230 1614 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2188 1673 gene locus_tag LOCUS_04240 2188 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2472 2278 gene locus_tag LOCUS_04250 2472 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2538 2789 gene locus_tag LOCUS_04260 2538 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2834 3169 gene locus_tag LOCUS_04270 gene cutA 2834 3169 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199838.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence096 2107 719 gene locus_tag LOCUS_04280 2107 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3024 2194 gene locus_tag LOCUS_04290 3024 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence097 >Feature sequence098 1367 381 gene locus_tag LOCUS_04300 1367 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2315 1458 gene locus_tag LOCUS_04310 2315 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 3032 2400 gene locus_tag LOCUS_04320 3032 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3130 3879 gene locus_tag LOCUS_04330 3130 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence099 >Feature sequence100 <1 756 gene locus_tag LOCUS_04340 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868460.1:DNA repair helicase 787 1287 gene locus_tag LOCUS_04350 787 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 <4230 1292 gene locus_tag LOCUS_04360 <4230 1292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000052484.1:adhesin >Feature sequence101 933 1901 gene locus_tag LOCUS_04370 933 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2102 3682 gene locus_tag LOCUS_04380 2102 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3928 3641 gene locus_tag LOCUS_04390 3928 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence102 2676 4 gene locus_tag LOCUS_04400 2676 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence103 1461 373 gene locus_tag LOCUS_04410 1461 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2769 1564 gene locus_tag LOCUS_04420 2769 1564 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404770.1 protein_id gnl|my_center|LOCUS_04420 3711 2785 gene locus_tag LOCUS_04430 gene trxB 3711 2785 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R7I9 protein_id gnl|my_center|LOCUS_04430 >Feature sequence104 2566 140 gene locus_tag LOCUS_04440 2566 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence105 >Feature sequence106 <1 1320 gene locus_tag LOCUS_04450 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MP7:methionine--tRNA ligase 1950 1321 gene locus_tag LOCUS_04460 1950 1321 CDS product methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869660.1 protein_id gnl|my_center|LOCUS_04460 2993 1947 gene locus_tag LOCUS_04470 2993 1947 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q99XR4 protein_id gnl|my_center|LOCUS_04470 <4078 3047 gene locus_tag LOCUS_04480 <4078 3047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879468.1:proteasome-activating nucleotidase >Feature sequence107 3086 1866 gene locus_tag LOCUS_04490 3086 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence108 2350 89 gene locus_tag LOCUS_04500 2350 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2624 3340 gene locus_tag LOCUS_04510 2624 3340 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_04510 3340 4005 gene locus_tag LOCUS_04520 3340 4005 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_04520 >Feature sequence109 <1 526 gene locus_tag LOCUS_04530 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CT98:ubiquinone/menaquinone biosynthesis C-methyltransferase UbiE 620 931 gene locus_tag LOCUS_04540 620 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 942 3287 gene locus_tag LOCUS_04550 942 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3319 3630 gene locus_tag LOCUS_04560 3319 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence110 2226 1477 gene locus_tag LOCUS_04570 2226 1477 CDS product methyltransferase, TIGR04290 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533206.1 protein_id gnl|my_center|LOCUS_04570 3434 2265 gene locus_tag LOCUS_04580 3434 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 >Feature sequence111 167 769 gene locus_tag LOCUS_04590 167 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 826 2262 gene locus_tag LOCUS_04600 826 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876489.1 protein_id gnl|my_center|LOCUS_04600 2259 3668 gene locus_tag LOCUS_04610 2259 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876694.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence112 365 1444 gene locus_tag LOCUS_04620 365 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2479 1445 gene locus_tag LOCUS_04630 2479 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3190 2510 gene locus_tag LOCUS_04640 3190 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 3267 3806 gene locus_tag LOCUS_04650 3267 3806 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 protein_id gnl|my_center|LOCUS_04650 3817 3945 gene locus_tag LOCUS_04660 3817 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence113 560 69 gene locus_tag LOCUS_04670 560 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1319 675 gene locus_tag LOCUS_04680 1319 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 2917 1319 gene locus_tag LOCUS_04690 2917 1319 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_04690 3896 3111 gene locus_tag LOCUS_04700 3896 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence114 >Feature sequence115 <1 1203 gene locus_tag LOCUS_04710 <1 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121881.1:deoxyribodipyrimidine photo-lyase 1216 2589 gene locus_tag LOCUS_04720 1216 2589 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118348.1 protein_id gnl|my_center|LOCUS_04720 3648 2641 gene locus_tag LOCUS_04730 3648 2641 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence116 263 1804 gene locus_tag LOCUS_04740 gene purF 263 1804 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MP6 protein_id gnl|my_center|LOCUS_04740 1814 2743 gene locus_tag LOCUS_04750 1814 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 >Feature sequence117 2264 1809 gene locus_tag LOCUS_04760 gene ndk 2264 1809 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_04760 2559 2371 gene locus_tag LOCUS_04770 2559 2371 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_04770 2789 2565 gene locus_tag LOCUS_04780 2789 2565 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867791.1 protein_id gnl|my_center|LOCUS_04780 3193 2813 gene locus_tag LOCUS_04790 3193 2813 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870715.1 protein_id gnl|my_center|LOCUS_04790 <3898 3329 gene locus_tag LOCUS_04800 <3898 3329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251185.1:ribose-phosphate pyrophosphokinase >Feature sequence118 778 2133 gene locus_tag LOCUS_04810 778 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3047 2130 gene locus_tag LOCUS_04820 3047 2130 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289116.1 protein_id gnl|my_center|LOCUS_04820 3390 3097 gene locus_tag LOCUS_04830 3390 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence119 1335 592 gene locus_tag LOCUS_04840 1335 592 CDS product flagellar accessory protein FlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868606.1 protein_id gnl|my_center|LOCUS_04840 1843 1325 gene locus_tag LOCUS_04850 1843 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2506 1853 gene locus_tag LOCUS_04860 2506 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3344 2508 gene locus_tag LOCUS_04870 3344 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence120 144 69 gene locus_tag LOCUS_t00080 144 69 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 285 1136 gene locus_tag LOCUS_04880 285 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence121 >Feature sequence122 2734 1541 gene locus_tag LOCUS_04890 2734 1541 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_04890 2831 3655 gene locus_tag LOCUS_04900 gene rph 2831 3655 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_04900 3730 3804 gene locus_tag LOCUS_t00090 3730 3804 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence123 343 960 gene locus_tag LOCUS_04910 343 960 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_04910 3578 951 gene locus_tag LOCUS_04920 3578 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence124 <3814 250 gene locus_tag LOCUS_04930 <3814 250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964024.1:flagellar motor protein MotB >Feature sequence125 1669 71 gene locus_tag LOCUS_04940 1669 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2423 1734 gene locus_tag LOCUS_04950 2423 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2506 2579 gene locus_tag LOCUS_t00100 2506 2579 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2887 2579 gene locus_tag LOCUS_04960 2887 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <3812 2897 gene locus_tag LOCUS_04970 <3812 2897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020699.1:mRNA surveillance protein Pelota >Feature sequence126 132 1154 gene locus_tag LOCUS_04980 gene ribD 132 1154 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_04980 1646 1155 gene locus_tag LOCUS_04990 1646 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1740 2513 gene locus_tag LOCUS_05000 gene rsuA 1740 2513 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WUT0 protein_id gnl|my_center|LOCUS_05000 >Feature sequence127 206 2026 gene locus_tag LOCUS_05010 gene glmS 206 2026 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L065 protein_id gnl|my_center|LOCUS_05010 2751 2032 gene locus_tag LOCUS_05020 2751 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2877 3440 gene locus_tag LOCUS_05030 gene maf 2877 3440 CDS product maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA39 protein_id gnl|my_center|LOCUS_05030 >Feature sequence128 907 1242 gene locus_tag LOCUS_05040 907 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 1572 1243 gene locus_tag LOCUS_05050 1572 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 1665 3602 gene locus_tag LOCUS_05060 1665 3602 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830120.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence129 952 236 gene locus_tag LOCUS_05070 952 236 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249138.1 protein_id gnl|my_center|LOCUS_05070 1976 963 gene locus_tag LOCUS_05080 1976 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2115 2468 gene locus_tag LOCUS_05090 2115 2468 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_05090 3237 2497 gene locus_tag LOCUS_05100 3237 2497 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_05100 >Feature sequence130 1408 107 gene locus_tag LOCUS_05110 gene purA 1408 107 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EAD5 protein_id gnl|my_center|LOCUS_05110 1678 2691 gene locus_tag LOCUS_05120 1678 2691 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902144.1 protein_id gnl|my_center|LOCUS_05120 2716 3024 gene locus_tag LOCUS_05130 2716 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3123 3713 gene locus_tag LOCUS_05140 3123 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence131 1664 990 gene locus_tag LOCUS_05150 1664 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 <3736 1721 gene locus_tag LOCUS_05160 <3736 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SMF6:aconitate hydratase A >Feature sequence132 >Feature sequence133 2627 3583 gene locus_tag LOCUS_05170 2627 3583 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence134 <1 567 gene locus_tag LOCUS_05180 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250190.1:peptide chain release factor 1 577 2358 gene locus_tag LOCUS_05190 577 2358 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869735.1 protein_id gnl|my_center|LOCUS_05190 3474 2359 gene locus_tag LOCUS_05200 3474 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence135 2545 1757 gene locus_tag LOCUS_05210 gene fabG 2545 1757 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167269.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence136 2698 173 gene locus_tag LOCUS_05220 2698 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence137 2827 1187 gene locus_tag LOCUS_05230 2827 1187 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531101.1 protein_id gnl|my_center|LOCUS_05230 <3644 2828 gene locus_tag LOCUS_05240 <3644 2828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142593.1:NADH dehydrogenase subunit 5 >Feature sequence138 1304 3334 gene locus_tag LOCUS_05250 1304 3334 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 protein_id gnl|my_center|LOCUS_05250 >Feature sequence139 <1 1568 gene locus_tag LOCUS_05260 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_012391.2:phosphoribosylformylglycinamidine synthase II 1568 2422 gene locus_tag LOCUS_05270 gene pfaS 1568 2422 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_05270 2427 3464 gene locus_tag LOCUS_05280 2427 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence140 2 77 gene locus_tag LOCUS_t00110 2 77 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence141 1268 228 gene locus_tag LOCUS_05290 1268 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2671 1265 gene locus_tag LOCUS_05300 2671 1265 CDS product putative FeS assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703482.1 protein_id gnl|my_center|LOCUS_05300 3438 2683 gene locus_tag LOCUS_05310 3438 2683 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722442.1 protein_id gnl|my_center|LOCUS_05310 >Feature sequence142 <1 1291 gene locus_tag LOCUS_05320 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460037.1:tetracycline resistance MFS efflux pump 1331 2755 gene locus_tag LOCUS_05330 1331 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 3023 2757 gene locus_tag LOCUS_05340 3023 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147166.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence143 345 1319 gene locus_tag LOCUS_05350 345 1319 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_05350 1329 2075 gene locus_tag LOCUS_05360 1329 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496422.1 protein_id gnl|my_center|LOCUS_05360 2158 2778 gene locus_tag LOCUS_05370 2158 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 <3602 2775 gene locus_tag LOCUS_05380 <3602 2775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533145.1:3-isopropylmalate dehydrogenase >Feature sequence144 921 319 gene locus_tag LOCUS_05390 921 319 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_05390 1982 936 gene locus_tag LOCUS_05400 gene gmd 1982 936 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_05400 2117 3403 gene locus_tag LOCUS_05410 2117 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence145 1222 2199 gene locus_tag LOCUS_05420 1222 2199 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966803.1 protein_id gnl|my_center|LOCUS_05420 2355 3332 gene locus_tag LOCUS_05430 2355 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence146 1020 241 gene locus_tag LOCUS_05440 1020 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1102 1860 gene locus_tag LOCUS_05450 1102 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 3000 1867 gene locus_tag LOCUS_05460 3000 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3551 3015 gene locus_tag LOCUS_05470 3551 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence147 1671 574 gene locus_tag LOCUS_05480 1671 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2646 1759 gene locus_tag LOCUS_05490 2646 1759 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_05490 3259 2726 gene locus_tag LOCUS_05500 3259 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence148 92 1591 gene locus_tag LOCUS_05510 92 1591 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_05510 2808 1588 gene locus_tag LOCUS_05520 2808 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3205 2801 gene locus_tag LOCUS_05530 3205 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05530 >Feature sequence149 102 374 gene locus_tag LOCUS_05540 102 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 392 994 gene locus_tag LOCUS_05550 392 994 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903724.1 protein_id gnl|my_center|LOCUS_05550 973 1986 gene locus_tag LOCUS_05560 973 1986 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_05560 2388 2888 gene locus_tag LOCUS_05570 2388 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence150 1646 978 gene locus_tag LOCUS_05580 1646 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 1729 2646 gene locus_tag LOCUS_05590 1729 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence151 <1 553 gene locus_tag LOCUS_05600 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709433.1:adenylate cyclase 1647 541 gene locus_tag LOCUS_05610 1647 541 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence152 >Feature sequence153 <1 902 gene locus_tag LOCUS_05620 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0R2:alkane 1-monooxygenase 1 983 909 gene locus_tag LOCUS_t00120 983 909 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1600 1037 gene locus_tag LOCUS_05630 1600 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 <3435 1668 gene locus_tag LOCUS_05640 <3435 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA >Feature sequence154 19 1158 gene locus_tag LOCUS_05650 gene gltA 19 1158 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_05650 2310 1162 gene locus_tag LOCUS_05660 2310 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence155 311 1321 gene locus_tag LOCUS_05670 311 1321 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_05670 1394 2353 gene locus_tag LOCUS_05680 gene parA 1394 2353 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_05680 2460 2702 gene locus_tag LOCUS_05690 2460 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2708 2962 gene locus_tag LOCUS_05700 2708 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3238 2942 gene locus_tag LOCUS_05710 3238 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence156 500 1645 gene locus_tag LOCUS_05720 500 1645 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_05720 1660 2250 gene locus_tag LOCUS_05730 1660 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence157 774 373 gene locus_tag LOCUS_05740 774 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 1552 785 gene locus_tag LOCUS_05750 gene sdhB 1552 785 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_05750 <3401 1552 gene locus_tag LOCUS_05760 <3401 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224226.1:succinate dehydrogenase flavoprotein subunit >Feature sequence158 2938 1160 gene locus_tag LOCUS_05770 2938 1160 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence159 2774 135 gene locus_tag LOCUS_05780 2774 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence160 <1 532 gene locus_tag LOCUS_05790 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877622.1:fructose-bisphosphate aldolase 542 1570 gene locus_tag LOCUS_05800 542 1570 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_05800 1575 2480 gene locus_tag LOCUS_05810 1575 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence161 <1 790 gene locus_tag LOCUS_05820 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HCF5:cyclic pyranopterin monophosphate synthase 1252 791 gene locus_tag LOCUS_05830 1252 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2469 1372 gene locus_tag LOCUS_05840 2469 1372 CDS product bacteriochlorophyll synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_05840 <3391 2479 gene locus_tag LOCUS_05850 <3391 2479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941971.1:octaprenyl diphosphate synthase >Feature sequence162 1933 758 gene locus_tag LOCUS_05860 1933 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 <3375 2001 gene locus_tag LOCUS_05870 <3375 2001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E4C3:DNA polymerase >Feature sequence163 >Feature sequence164 37 1170 gene locus_tag LOCUS_05880 37 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 1400 2056 gene locus_tag LOCUS_05890 1400 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence165 958 317 gene locus_tag LOCUS_05900 958 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 962 2122 gene locus_tag LOCUS_05910 962 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence166 1518 724 gene locus_tag LOCUS_05920 1518 724 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815569.1 protein_id gnl|my_center|LOCUS_05920 2466 1606 gene locus_tag LOCUS_05930 2466 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3270 2476 gene locus_tag LOCUS_05940 3270 2476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence167 >Feature sequence168 1 993 gene locus_tag LOCUS_05950 1 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 1863 1033 gene locus_tag LOCUS_05960 gene pqqB 1863 1033 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P6N0 protein_id gnl|my_center|LOCUS_05960 <3274 1921 gene locus_tag LOCUS_05970 <3274 1921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249620.1:ATPase AAA >Feature sequence169 596 108 gene locus_tag LOCUS_05980 596 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 872 597 gene locus_tag LOCUS_05990 872 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066569.1 protein_id gnl|my_center|LOCUS_05990 1127 2140 gene locus_tag LOCUS_06000 1127 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 >Feature sequence170 477 1403 gene locus_tag LOCUS_06010 477 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1459 2181 gene locus_tag LOCUS_06020 1459 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 2382 2777 gene locus_tag LOCUS_06030 2382 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence171 1549 2916 gene locus_tag LOCUS_06040 1549 2916 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence172 841 2124 gene locus_tag LOCUS_06050 gene ychF 841 2124 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_06050 2511 2125 gene locus_tag LOCUS_06060 2511 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 <3227 2548 gene locus_tag LOCUS_06070 <3227 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933229.1:glutamine amidotransferase >Feature sequence173 851 1588 gene locus_tag LOCUS_06080 gene rlmE 851 1588 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83BY4 protein_id gnl|my_center|LOCUS_06080 1619 1963 gene locus_tag LOCUS_06090 1619 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 2267 2539 gene locus_tag LOCUS_06100 2267 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 <3208 2547 gene locus_tag LOCUS_06110 <3208 2547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065655.1:tRNA pseudouridine(13) synthase TruD >Feature sequence174 1336 1995 gene locus_tag LOCUS_06120 1336 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 1979 2347 gene locus_tag LOCUS_06130 1979 2347 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_06130 2356 2772 gene locus_tag LOCUS_06140 2356 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence175 >Feature sequence176 <1 2995 gene locus_tag LOCUS_06150 <1 2995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase >Feature sequence177 481 122 gene locus_tag LOCUS_06160 481 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 998 504 gene locus_tag LOCUS_06170 998 504 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_06170 1209 1961 gene locus_tag LOCUS_06180 1209 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence178 2238 709 gene locus_tag LOCUS_06190 2238 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2381 2305 gene locus_tag LOCUS_t00130 2381 2305 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence179 1262 2194 gene locus_tag LOCUS_06200 1262 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence180 207 662 gene locus_tag LOCUS_06210 207 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1591 698 gene locus_tag LOCUS_06220 1591 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1697 2356 gene locus_tag LOCUS_06230 1697 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2397 2864 gene locus_tag LOCUS_06240 2397 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120443.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence181 1233 13 gene locus_tag LOCUS_06250 1233 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 1406 2401 gene locus_tag LOCUS_06260 1406 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence182 1546 2190 gene locus_tag LOCUS_06270 1546 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 <3138 2191 gene locus_tag LOCUS_06280 <3138 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583631.1:phosphate starvation-inducible protein PsiE >Feature sequence183 312 3023 gene locus_tag LOCUS_06290 312 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence184 <1 1058 gene locus_tag LOCUS_06300 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066516.1:copper-translocating P-type ATPase 1127 1621 gene locus_tag LOCUS_06310 1127 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1675 2067 gene locus_tag LOCUS_06320 1675 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence185 410 1099 gene locus_tag LOCUS_06330 410 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence186 >Feature sequence187 3 3098 gene locus_tag LOCUS_06340 3 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence188 453 163 gene locus_tag LOCUS_06350 453 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1430 450 gene locus_tag LOCUS_06360 1430 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence189 272 886 gene locus_tag LOCUS_06370 272 886 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038606.1 protein_id gnl|my_center|LOCUS_06370 1150 857 gene locus_tag LOCUS_06380 1150 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1645 1172 gene locus_tag LOCUS_06390 1645 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence190 <1 691 gene locus_tag LOCUS_06400 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZX5:3-methyl-2-oxobutanoate hydroxymethyltransferase 1186 692 gene locus_tag LOCUS_06410 1186 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1207 2184 gene locus_tag LOCUS_06420 1207 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence191 100 633 gene locus_tag LOCUS_06430 100 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1813 635 gene locus_tag LOCUS_06440 1813 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1973 2581 gene locus_tag LOCUS_06450 1973 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence192 >Feature sequence193 <1 610 gene locus_tag LOCUS_06460 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979315.1:deoxyhypusine synthase 603 2048 gene locus_tag LOCUS_06470 603 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2938 2051 gene locus_tag LOCUS_06480 2938 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence194 758 249 gene locus_tag LOCUS_06490 758 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1219 758 gene locus_tag LOCUS_06500 1219 758 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_06500 1836 1219 gene locus_tag LOCUS_06510 1836 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2384 1842 gene locus_tag LOCUS_06520 2384 1842 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_06520 2784 2395 gene locus_tag LOCUS_06530 2784 2395 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence195 2022 205 gene locus_tag LOCUS_06540 gene asnB 2022 205 CDS product asparagine synthetase [glutamine-hydrolyzing] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54420 protein_id gnl|my_center|LOCUS_06540 2850 2227 gene locus_tag LOCUS_06550 2850 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence196 52 127 gene locus_tag LOCUS_t00140 52 127 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 436 1353 gene locus_tag LOCUS_06560 436 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1803 1390 gene locus_tag LOCUS_06570 1803 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1865 2128 gene locus_tag LOCUS_06580 1865 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2216 2674 gene locus_tag LOCUS_06590 2216 2674 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084974.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence197 2892 2590 gene locus_tag LOCUS_06600 2892 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence198 84 854 gene locus_tag LOCUS_06610 84 854 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_06610 2207 843 gene locus_tag LOCUS_06620 2207 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence199 169 726 gene locus_tag LOCUS_06630 169 726 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_06630 732 1469 gene locus_tag LOCUS_06640 732 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1492 1842 gene locus_tag LOCUS_06650 gene arsC 1492 1842 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Z4 protein_id gnl|my_center|LOCUS_06650 2347 1793 gene locus_tag LOCUS_06660 2347 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2536 2357 gene locus_tag LOCUS_06670 2536 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence200 468 1361 gene locus_tag LOCUS_06680 468 1361 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_06680 1838 1362 gene locus_tag LOCUS_06690 1838 1362 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_06690 2782 1838 gene locus_tag LOCUS_06700 2782 1838 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence201 824 483 gene locus_tag LOCUS_06710 824 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 920 1966 gene locus_tag LOCUS_06720 920 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 2474 1953 gene locus_tag LOCUS_06730 2474 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence202 1474 155 gene locus_tag LOCUS_06740 1474 155 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence203 >Feature sequence204 1884 1282 gene locus_tag LOCUS_06750 1884 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2207 1878 gene locus_tag LOCUS_06760 2207 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 2932 2255 gene locus_tag LOCUS_06770 2932 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence205 <1 635 gene locus_tag LOCUS_06780 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876473.1:tRNA pseudouridine(38-40) synthase TruA 1095 628 gene locus_tag LOCUS_06790 1095 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1210 2391 gene locus_tag LOCUS_06800 gene kbl 1210 2391 CDS product 8-amino-7-oxononanoate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31777 protein_id gnl|my_center|LOCUS_06800 >Feature sequence206 >Feature sequence207 663 1127 gene locus_tag LOCUS_06810 663 1127 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence208 336 1124 gene locus_tag LOCUS_06820 336 1124 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250740.1 protein_id gnl|my_center|LOCUS_06820 1121 1633 gene locus_tag LOCUS_06830 1121 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1570 1731 gene locus_tag LOCUS_06840 1570 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1742 2545 gene locus_tag LOCUS_06850 1742 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence209 >Feature sequence210 981 109 gene locus_tag LOCUS_06860 981 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_06860 971 1372 gene locus_tag LOCUS_06870 971 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1999 1373 gene locus_tag LOCUS_06880 1999 1373 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence211 3 2426 gene locus_tag LOCUS_06890 3 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2506 2733 gene locus_tag LOCUS_06900 2506 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence212 1819 2217 gene locus_tag LOCUS_06910 1819 2217 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919875.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence213 2520 349 gene locus_tag LOCUS_06920 2520 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250389.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence214 <1 626 gene locus_tag LOCUS_06930 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458890.1:ABC transporter substrate-binding protein 849 1694 gene locus_tag LOCUS_06940 849 1694 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_06940 1697 2617 gene locus_tag LOCUS_06950 1697 2617 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence215 423 872 gene locus_tag LOCUS_06960 423 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1516 869 gene locus_tag LOCUS_06970 1516 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence216 1297 1381 gene locus_tag LOCUS_t00150 1297 1381 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence217 287 2605 gene locus_tag LOCUS_06980 287 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence218 1558 1187 gene locus_tag LOCUS_06990 1558 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2294 1563 gene locus_tag LOCUS_07000 2294 1563 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence219 125 2212 gene locus_tag LOCUS_07010 125 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 <2775 2213 gene locus_tag LOCUS_07020 <2775 2213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C7MGQ8:quinolinate synthase A >Feature sequence220 227 415 gene locus_tag LOCUS_07030 227 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1714 416 gene locus_tag LOCUS_07040 1714 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 <2763 1782 gene locus_tag LOCUS_07050 <2763 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004188769.1:farnesyl-diphosphate farnesyltransferase >Feature sequence221 2329 1121 gene locus_tag LOCUS_07060 2329 1121 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence222 1209 1913 gene locus_tag LOCUS_07070 gene rpiA 1209 1913 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NS9 protein_id gnl|my_center|LOCUS_07070 1961 2037 gene locus_tag LOCUS_t00160 1961 2037 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2344 2039 gene locus_tag LOCUS_07080 2344 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence223 <1 632 gene locus_tag LOCUS_07090 <1 632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S4K5:exodeoxyribonuclease 7 large subunit 629 853 gene locus_tag LOCUS_07100 629 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 887 1189 gene locus_tag LOCUS_07110 887 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 2003 1176 gene locus_tag LOCUS_07120 2003 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence224 66 977 gene locus_tag LOCUS_07130 gene hemF 66 977 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_07130 992 2251 gene locus_tag LOCUS_07140 gene hemG 992 2251 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383354.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence225 493 1449 gene locus_tag LOCUS_07150 493 1449 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence226 266 2632 gene locus_tag LOCUS_07160 266 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence227 >Feature sequence228 136 423 gene locus_tag LOCUS_07170 136 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1559 486 gene locus_tag LOCUS_07180 1559 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2704 1619 gene locus_tag LOCUS_07190 2704 1619 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence229 <2712 751 gene locus_tag LOCUS_07200 <2712 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020139.1:DNA mismatch repair protein MutS >Feature sequence230 1163 984 gene locus_tag LOCUS_07210 1163 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence231 1944 1066 gene locus_tag LOCUS_07220 1944 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence232 1270 644 gene locus_tag LOCUS_07230 1270 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1553 1275 gene locus_tag LOCUS_07240 1553 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1992 1558 gene locus_tag LOCUS_07250 1992 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence233 382 1407 gene locus_tag LOCUS_07260 382 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence234 1206 358 gene locus_tag LOCUS_07270 1206 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1839 1216 gene locus_tag LOCUS_07280 1839 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence235 582 1832 gene locus_tag LOCUS_07290 gene eno1 582 1832 CDS product enolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F2Q3 protein_id gnl|my_center|LOCUS_07290 >Feature sequence236 1538 294 gene locus_tag LOCUS_07300 1538 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1684 2325 gene locus_tag LOCUS_07310 1684 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence237 >Feature sequence238 1204 698 gene locus_tag LOCUS_07320 1204 698 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLE7 protein_id gnl|my_center|LOCUS_07320 2108 1209 gene locus_tag LOCUS_07330 2108 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 <2667 2158 gene locus_tag LOCUS_07340 <2667 2158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870641.1:serine/threonine protein kinase >Feature sequence239 <1 1710 gene locus_tag LOCUS_07350 <1 1710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902671.1:flagellar assembly protein J 1752 2210 gene locus_tag LOCUS_07360 1752 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence240 1401 148 gene locus_tag LOCUS_07370 1401 148 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence241 286 360 gene locus_tag LOCUS_t00170 286 360 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 456 1385 gene locus_tag LOCUS_07380 456 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence242 715 2067 gene locus_tag LOCUS_07390 715 2067 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence243 <1 1330 gene locus_tag LOCUS_07400 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YID4:cysteine--tRNA ligase <2624 1331 gene locus_tag LOCUS_07410 <2624 1331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083081.1:cytosine deaminase >Feature sequence244 2234 717 gene locus_tag LOCUS_07420 2234 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2327 2521 gene locus_tag LOCUS_07430 2327 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence245 1835 567 gene locus_tag LOCUS_07440 1835 567 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393432.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence246 >Feature sequence247 2 991 gene locus_tag LOCUS_07450 2 991 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877361.1 protein_id gnl|my_center|LOCUS_07450 1036 1284 gene locus_tag LOCUS_07460 1036 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 2277 1285 gene locus_tag LOCUS_07470 2277 1285 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249172.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence248 1537 107 gene locus_tag LOCUS_07480 1537 107 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 protein_id gnl|my_center|LOCUS_07480 <2600 1548 gene locus_tag LOCUS_07490 <2600 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I1M0:lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex >Feature sequence249 >Feature sequence250 >Feature sequence251 1027 104 gene locus_tag LOCUS_07500 1027 104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814724.1 protein_id gnl|my_center|LOCUS_07500 1560 1024 gene locus_tag LOCUS_07510 1560 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 <2593 1586 gene locus_tag LOCUS_07520 <2593 1586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230333.1:benzoyl-CoA oxygenase subunit B >Feature sequence252 1307 411 gene locus_tag LOCUS_07530 1307 411 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259101.1 protein_id gnl|my_center|LOCUS_07530 1445 1714 gene locus_tag LOCUS_07540 1445 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence253 1291 281 gene locus_tag LOCUS_07550 gene bkdA2 1291 281 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M1 protein_id gnl|my_center|LOCUS_07550 2542 1301 gene locus_tag LOCUS_07560 gene bkdA1 2542 1301 CDS product 2-oxoisovalerate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M2 protein_id gnl|my_center|LOCUS_07560 >Feature sequence254 1741 491 gene locus_tag LOCUS_07570 1741 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1824 2537 gene locus_tag LOCUS_07580 1824 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence255 308 1372 gene locus_tag LOCUS_07590 308 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1778 1374 gene locus_tag LOCUS_07600 1778 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence256 434 1366 gene locus_tag LOCUS_07610 gene etfA 434 1366 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WNG9 protein_id gnl|my_center|LOCUS_07610 2134 1367 gene locus_tag LOCUS_07620 gene ycbL 2134 1367 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_07620 >Feature sequence257 258 1019 gene locus_tag LOCUS_07630 258 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence258 1362 373 gene locus_tag LOCUS_07640 1362 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2361 1372 gene locus_tag LOCUS_07650 2361 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence259 3 2216 gene locus_tag LOCUS_07660 3 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence260 >Feature sequence261 >Feature sequence262 44 343 gene locus_tag LOCUS_07670 44 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 951 340 gene locus_tag LOCUS_07680 951 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1553 963 gene locus_tag LOCUS_07690 1553 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2239 1556 gene locus_tag LOCUS_07700 2239 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence263 >Feature sequence264 >Feature sequence265 <2447 1808 gene locus_tag LOCUS_07710 <2447 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142473.1:threonine aldolase >Feature sequence266 502 963 gene locus_tag LOCUS_07720 502 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence267 <1 640 gene locus_tag LOCUS_07730 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868749.1:DUF58 domain-containing protein 650 1576 gene locus_tag LOCUS_07740 650 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 <2425 1573 gene locus_tag LOCUS_07750 <2425 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878203.1:aspartate kinase >Feature sequence268 <2422 770 gene locus_tag LOCUS_07760 <2422 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RIQ3:leucine--tRNA ligase >Feature sequence269 560 2053 gene locus_tag LOCUS_07770 gene pepA 560 2053 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGC8 protein_id gnl|my_center|LOCUS_07770 >Feature sequence270 >Feature sequence271 17 1003 gene locus_tag LOCUS_07780 17 1003 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_07780 1876 989 gene locus_tag LOCUS_07790 1876 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence272 711 1295 gene locus_tag LOCUS_07800 711 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903833.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence273 >Feature sequence274 692 1132 gene locus_tag LOCUS_07810 692 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence275 >Feature sequence276 1720 1418 gene locus_tag LOCUS_07820 1720 1418 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021517.1 protein_id gnl|my_center|LOCUS_07820 1986 1717 gene locus_tag LOCUS_07830 1986 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2258 1983 gene locus_tag LOCUS_07840 2258 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07840 >Feature sequence277 1763 750 gene locus_tag LOCUS_07850 1763 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 >Feature sequence278 394 35 gene locus_tag LOCUS_07860 394 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 839 411 gene locus_tag LOCUS_07870 839 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1180 1830 gene locus_tag LOCUS_07880 1180 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 2096 1827 gene locus_tag LOCUS_07890 2096 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence279 158 1738 gene locus_tag LOCUS_07900 158 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 <2348 1793 gene locus_tag LOCUS_07910 <2348 1793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962368.1:L-threonine 3-dehydrogenase >Feature sequence280 >Feature sequence281 1831 248 gene locus_tag LOCUS_07920 1831 248 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_07920 2192 1818 gene locus_tag LOCUS_07930 2192 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence282 1492 458 gene locus_tag LOCUS_07940 1492 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence283 <1 581 gene locus_tag LOCUS_07950 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404083.1:ABC transporter ATP-binding protein >Feature sequence284 150 320 gene locus_tag LOCUS_07960 150 320 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_07960 336 1121 gene locus_tag LOCUS_07970 336 1121 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_07970 1160 1402 gene locus_tag LOCUS_07980 1160 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1491 2246 gene locus_tag LOCUS_07990 1491 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence285 1401 1072 gene locus_tag LOCUS_08000 1401 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence286 >Feature sequence287 >Feature sequence288 <1 2201 gene locus_tag LOCUS_08010 <1 2201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0C0R0:DNA gyrase subunit A >Feature sequence289 166 795 gene locus_tag LOCUS_08020 gene lipB 166 795 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NNJ1 protein_id gnl|my_center|LOCUS_08020 883 1455 gene locus_tag LOCUS_08030 883 1455 CDS product aromatic acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_08030 >Feature sequence290 181 1020 gene locus_tag LOCUS_08040 181 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence291 <1 631 gene locus_tag LOCUS_08050 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879731.1:adenylosuccinate lyase 1281 616 gene locus_tag LOCUS_08060 1281 616 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_08060 1453 2175 gene locus_tag LOCUS_08070 gene psmA 1453 2175 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence292 820 1533 gene locus_tag LOCUS_08080 820 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence293 1337 615 gene locus_tag LOCUS_08090 1337 615 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence294 299 1153 gene locus_tag LOCUS_08100 299 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1633 1133 gene locus_tag LOCUS_08110 1633 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence295 1418 204 gene locus_tag LOCUS_08120 1418 204 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_08120 <2255 1482 gene locus_tag LOCUS_08130 <2255 1482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004200734.1:DNA topoisomerase III >Feature sequence296 1797 814 gene locus_tag LOCUS_08140 1797 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence297 <1 654 gene locus_tag LOCUS_08150 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHE5:cyclic dehypoxanthine futalosine synthase <2252 666 gene locus_tag LOCUS_08160 <2252 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889584.1:N-glycosidase F >Feature sequence298 94 1233 gene locus_tag LOCUS_08170 94 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1313 1633 gene locus_tag LOCUS_08180 1313 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 <2249 1636 gene locus_tag LOCUS_08190 <2249 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902041.1:multidrug ABC transporter ATP-binding protein >Feature sequence299 1714 494 gene locus_tag LOCUS_08200 1714 494 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence300 1259 699 gene locus_tag LOCUS_08210 1259 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 <2230 1418 gene locus_tag LOCUS_08220 <2230 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496860.1:ATPase >Feature sequence301 <1 1425 gene locus_tag LOCUS_08230 <1 1425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CH39:(6-4) photolyase <2227 1415 gene locus_tag LOCUS_08240 <2227 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3CPW6:endonuclease 8 >Feature sequence302 989 1996 gene locus_tag LOCUS_08250 989 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence303 1777 1445 gene locus_tag LOCUS_08260 1777 1445 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005015014.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence304 633 139 gene locus_tag LOCUS_08270 633 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2210 633 gene locus_tag LOCUS_08280 2210 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence305 >Feature sequence306 1604 1852 gene locus_tag LOCUS_08290 1604 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence307 >Feature sequence308 9 797 gene locus_tag LOCUS_08300 9 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1994 798 gene locus_tag LOCUS_08310 1994 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895577.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence309 704 1297 gene locus_tag LOCUS_08320 704 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1334 1915 gene locus_tag LOCUS_08330 1334 1915 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence310 632 706 gene locus_tag LOCUS_t00180 632 706 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 811 1128 gene locus_tag LOCUS_08340 811 1128 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867516.1 protein_id gnl|my_center|LOCUS_08340 1422 1129 gene locus_tag LOCUS_08350 1422 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1560 1955 gene locus_tag LOCUS_08360 1560 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence311 730 86 gene locus_tag LOCUS_08370 730 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence312 <1 943 gene locus_tag LOCUS_08380 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73KL7:L-methionine gamma-lyase >Feature sequence313 150 1070 gene locus_tag LOCUS_08390 150 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence314 <2144 1179 gene locus_tag LOCUS_08400 <2144 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903168.1:glycine cleavage system protein T >Feature sequence315 958 686 gene locus_tag LOCUS_08410 958 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 <2143 1067 gene locus_tag LOCUS_08420 <2143 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878512.1:TIGR01210 family radical SAM protein >Feature sequence316 908 303 gene locus_tag LOCUS_08430 gene ribC 908 303 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262006.1 protein_id gnl|my_center|LOCUS_08430 1345 908 gene locus_tag LOCUS_08440 1345 908 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061254.1 protein_id gnl|my_center|LOCUS_08440 <2130 1424 gene locus_tag LOCUS_08450 <2130 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020597.1:3,4-dihydroxy-2-butanone-4-phosphate synthase >Feature sequence317 436 83 gene locus_tag LOCUS_08460 436 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence318 604 1818 gene locus_tag LOCUS_08470 604 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence319 >Feature sequence320 1827 1249 gene locus_tag LOCUS_08480 1827 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence321 746 1324 gene locus_tag LOCUS_08490 746 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence322 115 555 gene locus_tag LOCUS_08500 115 555 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence323 1257 352 gene locus_tag LOCUS_08510 gene purC2 1257 352 CDS product putative phosphoribosylaminoimidazole-succinocarboxamide synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W81 protein_id gnl|my_center|LOCUS_08510 1972 1310 gene locus_tag LOCUS_08520 1972 1310 CDS product translation initiation factor 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence324 >Feature sequence325 1170 154 gene locus_tag LOCUS_08530 gene ctaB 1170 154 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RG8 protein_id gnl|my_center|LOCUS_08530 >Feature sequence326 >Feature sequence327 >Feature sequence328 >Feature sequence329 203 1846 gene locus_tag LOCUS_08540 203 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence330 >Feature sequence331 831 259 gene locus_tag LOCUS_08550 831 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence332 629 249 gene locus_tag LOCUS_08560 629 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1606 683 gene locus_tag LOCUS_08570 1606 683 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence333 1115 399 gene locus_tag LOCUS_08580 1115 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 1152 1919 gene locus_tag LOCUS_08590 1152 1919 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022244.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence334 1176 1922 gene locus_tag LOCUS_08600 1176 1922 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence335 1972 554 gene locus_tag LOCUS_08610 gene trkA 1972 554 CDS product potassium transporter peripheral membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253838.1 protein_id gnl|my_center|LOCUS_08610 >Feature sequence336 1666 23 gene locus_tag LOCUS_08620 gene purH 1666 23 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NRT9 protein_id gnl|my_center|LOCUS_08620 >Feature sequence337 1651 302 gene locus_tag LOCUS_08630 1651 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence338 1748 267 gene locus_tag LOCUS_08640 1748 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 1943 2018 gene locus_tag LOCUS_t00190 1943 2018 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence339 >Feature sequence340 >Feature sequence341 >Feature sequence342 1720 503 gene locus_tag LOCUS_08650 1720 503 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence343 177 758 gene locus_tag LOCUS_08660 177 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 763 1494 gene locus_tag LOCUS_08670 763 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence344 >Feature sequence345 1183 470 gene locus_tag LOCUS_08680 1183 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 <1986 1173 gene locus_tag LOCUS_08690 <1986 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057210.1:dihydroflavonol-4-reductase >Feature sequence346 396 785 gene locus_tag LOCUS_08700 396 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 816 1337 gene locus_tag LOCUS_08710 816 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1363 1833 gene locus_tag LOCUS_08720 1363 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence347 324 869 gene locus_tag LOCUS_08730 gene orn 324 869 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L01 protein_id gnl|my_center|LOCUS_08730 1737 871 gene locus_tag LOCUS_08740 1737 871 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence348 <1 1492 gene locus_tag LOCUS_08750 <1 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence349 >Feature sequence350 >Feature sequence351 488 1432 gene locus_tag LOCUS_08760 488 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 1946 1362 gene locus_tag LOCUS_08770 1946 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence352 >Feature sequence353 >Feature sequence354 1255 290 gene locus_tag LOCUS_08780 1255 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1420 1872 gene locus_tag LOCUS_08790 1420 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence355 504 430 gene locus_tag LOCUS_t00200 504 430 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1039 566 gene locus_tag LOCUS_08800 1039 566 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890466.1 protein_id gnl|my_center|LOCUS_08800 1090 1701 gene locus_tag LOCUS_08810 1090 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence356 520 1545 gene locus_tag LOCUS_08820 520 1545 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869954.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence357 544 1302 gene locus_tag LOCUS_08830 544 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence358 150 1820 gene locus_tag LOCUS_08840 150 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence359 312 782 gene locus_tag LOCUS_08850 312 782 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_08850 793 1209 gene locus_tag LOCUS_08860 793 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence360 >Feature sequence361 >Feature sequence362 <1 1305 gene locus_tag LOCUS_08870 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0DJM2:chaperone protein DnaK >Feature sequence363 >Feature sequence364 152 481 gene locus_tag LOCUS_08880 152 481 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_08880 1551 529 gene locus_tag LOCUS_08890 1551 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence365 >Feature sequence366 <1869 103 gene locus_tag LOCUS_08900 <1869 103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877871.1:ATP-dependent protease LonB >Feature sequence367 <1 778 gene locus_tag LOCUS_08910 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel protein >Feature sequence368 1383 133 gene locus_tag LOCUS_08920 1383 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence369 808 446 gene locus_tag LOCUS_08930 808 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 <1862 818 gene locus_tag LOCUS_08940 <1862 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012709069.1:bb3-type cytochrome oxidase subunit IV >Feature sequence370 >Feature sequence371 >Feature sequence372 >Feature sequence373 1121 1570 gene locus_tag LOCUS_08950 1121 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence374 <1 1537 gene locus_tag LOCUS_08960 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020145.1:thermosome subunit >Feature sequence375 >Feature sequence376 144 1505 gene locus_tag LOCUS_08970 144 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1548 1724 gene locus_tag LOCUS_08980 1548 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence377 265 8 gene locus_tag LOCUS_08990 265 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1157 276 gene locus_tag LOCUS_09000 gene rpl4p 1157 276 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_09000 <1841 1160 gene locus_tag LOCUS_09010 <1841 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879418.1:50S ribosomal protein L3 >Feature sequence378 <1 765 gene locus_tag LOCUS_09020 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392090.1:NAD+ synthase 768 1625 gene locus_tag LOCUS_09030 768 1625 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I583 protein_id gnl|my_center|LOCUS_09030 >Feature sequence379 1056 757 gene locus_tag LOCUS_09040 1056 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1796 1104 gene locus_tag LOCUS_09050 1796 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence380 >Feature sequence381 >Feature sequence382 30 554 gene locus_tag LOCUS_09060 30 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 1332 535 gene locus_tag LOCUS_09070 1332 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence383 >Feature sequence384 >Feature sequence385 83 349 gene locus_tag LOCUS_09080 83 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence386 390 941 gene locus_tag LOCUS_09090 390 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 938 1177 gene locus_tag LOCUS_09100 938 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 <1809 1178 gene locus_tag LOCUS_09110 <1809 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877942.1:crotonase >Feature sequence387 <1797 1002 gene locus_tag LOCUS_09120 <1797 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AA23:pseudouridine synthase >Feature sequence388 >Feature sequence389 1642 1058 gene locus_tag LOCUS_09130 1642 1058 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence390 1144 626 gene locus_tag LOCUS_09140 1144 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 1678 1376 gene locus_tag LOCUS_09150 gene rpl12p 1678 1376 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence391 567 1493 gene locus_tag LOCUS_09160 567 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 >Feature sequence392 >Feature sequence393 >Feature sequence394 >Feature sequence395 1060 395 gene locus_tag LOCUS_09170 1060 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 <1767 1071 gene locus_tag LOCUS_09180 <1767 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250014.1:mechanosensitive ion channel protein MscS >Feature sequence396 1314 355 gene locus_tag LOCUS_09190 1314 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768832.1 protein_id gnl|my_center|LOCUS_09190 1446 1373 gene locus_tag LOCUS_t00210 1446 1373 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence397 1274 759 gene locus_tag LOCUS_09200 1274 759 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence398 515 252 gene locus_tag LOCUS_09210 515 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 <1760 518 gene locus_tag LOCUS_09220 <1760 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933799.1:peptidase M24 >Feature sequence399 1635 1189 gene locus_tag LOCUS_09230 1635 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence400 1372 638 gene locus_tag LOCUS_09240 1372 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1744 1373 gene locus_tag LOCUS_09250 1744 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence401 1240 2 gene locus_tag LOCUS_09260 gene metK 1240 2 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q8 protein_id gnl|my_center|LOCUS_09260 >Feature sequence402 <1 1071 gene locus_tag LOCUS_09270 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000215329.1:acyl-CoA dehydrogenase >Feature sequence403 253 534 gene locus_tag LOCUS_09280 253 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1405 704 gene locus_tag LOCUS_09290 1405 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence404 <1 851 gene locus_tag LOCUS_09300 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979498.1:MFS transporter <1723 853 gene locus_tag LOCUS_09310 <1723 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HE32:ornithine carbamoyltransferase >Feature sequence405 585 4 gene locus_tag LOCUS_09320 585 4 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence406 1720 752 gene locus_tag LOCUS_09330 1720 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence407 394 1242 gene locus_tag LOCUS_09340 gene hbd 394 1242 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVG1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence408 391 672 gene locus_tag LOCUS_09350 391 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1200 622 gene locus_tag LOCUS_09360 1200 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1600 1238 gene locus_tag LOCUS_09370 1600 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence409 >Feature sequence410 145 1548 gene locus_tag LOCUS_09380 145 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence411 579 1112 gene locus_tag LOCUS_09390 579 1112 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence412 >Feature sequence413 >Feature sequence414 >Feature sequence415 311 1267 gene locus_tag LOCUS_09400 311 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1242 1571 gene locus_tag LOCUS_09410 1242 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1669 1592 gene locus_tag LOCUS_t00220 1669 1592 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence416 1286 750 gene locus_tag LOCUS_09420 1286 750 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250465.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence417 >Feature sequence418 >Feature sequence419 >Feature sequence420 >Feature sequence421 336 707 gene locus_tag LOCUS_09430 336 707 CDS product chromosome condensation protein CcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944500.1 protein_id gnl|my_center|LOCUS_09430 794 1213 gene locus_tag LOCUS_09440 794 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence422 >Feature sequence423 409 999 gene locus_tag LOCUS_09450 409 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1075 1149 gene locus_tag LOCUS_t00230 1075 1149 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence424 629 18 gene locus_tag LOCUS_09460 629 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 1352 660 gene locus_tag LOCUS_09470 gene tal 1352 660 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUP6 protein_id gnl|my_center|LOCUS_09470 >Feature sequence425 >Feature sequence426 1385 1095 gene locus_tag LOCUS_09480 1385 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09480 >Feature sequence427 <1 1081 gene locus_tag LOCUS_09490 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026198805.1:peptidylprolyl isomerase >Feature sequence428 >Feature sequence429 559 83 gene locus_tag LOCUS_09500 559 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1275 556 gene locus_tag LOCUS_09510 1275 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence430 <1 1177 gene locus_tag LOCUS_09520 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118098.1:surface-associated protein cshA precursor >Feature sequence431 <1 1332 gene locus_tag LOCUS_09530 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762768.1:valine--tRNA ligase >Feature sequence432 <1 1032 gene locus_tag LOCUS_09540 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250100.1:methylmalonyl-CoA mutase 1042 1476 gene locus_tag LOCUS_09550 1042 1476 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence433 >Feature sequence434 >Feature sequence435 >Feature sequence436 326 12 gene locus_tag LOCUS_09560 326 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1013 366 gene locus_tag LOCUS_09570 1013 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence437 >Feature sequence438 230 1195 gene locus_tag LOCUS_09580 230 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence439 133 318 gene locus_tag LOCUS_09590 133 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 <1604 319 gene locus_tag LOCUS_09600 <1604 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053651.1:RNA-splicing ligase RtcB >Feature sequence440 <1599 814 gene locus_tag LOCUS_09610 <1599 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GYZ1:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence441 >Feature sequence442 >Feature sequence443 >Feature sequence444 119 538 gene locus_tag LOCUS_09620 119 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 <1584 535 gene locus_tag LOCUS_09630 <1584 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878921.1:phenylalanine--tRNA ligase subunit beta >Feature sequence445 >Feature sequence446 >Feature sequence447 130 891 gene locus_tag LOCUS_09640 130 891 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Z3 protein_id gnl|my_center|LOCUS_09640 >Feature sequence448 1373 438 gene locus_tag LOCUS_09650 1373 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence449 >Feature sequence450 >Feature sequence451 >Feature sequence452 792 720 gene locus_tag LOCUS_t00240 792 720 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence453 1448 384 gene locus_tag LOCUS_09660 1448 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence454 >Feature sequence455 201 929 gene locus_tag LOCUS_09670 201 929 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876322.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence456 1332 739 gene locus_tag LOCUS_09680 1332 739 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022624.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence457 >Feature sequence458 759 520 gene locus_tag LOCUS_09690 759 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 <1534 830 gene locus_tag LOCUS_09700 <1534 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879589.1:ATPase >Feature sequence459 >Feature sequence460 >Feature sequence461 >Feature sequence462 983 1143 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccgtattgtttccttggtcggt >Feature sequence463 198 1076 gene locus_tag LOCUS_09710 198 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence464 <1 524 gene locus_tag LOCUS_09720 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89BL4:orotate phosphoribosyltransferase >Feature sequence465 170 1210 gene locus_tag LOCUS_09730 170 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1222 1521 gene locus_tag LOCUS_09740 1222 1521 CDS product ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence466 >Feature sequence467 <1 548 gene locus_tag LOCUS_09750 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P30949:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence468 >Feature sequence469 246 1019 gene locus_tag LOCUS_09760 246 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence470 >Feature sequence471 984 166 gene locus_tag LOCUS_09770 984 166 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence472 915 1172 gene locus_tag LOCUS_09780 915 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence473 >Feature sequence474 1214 360 gene locus_tag LOCUS_09790 1214 360 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 protein_id gnl|my_center|LOCUS_09790 >Feature sequence475 >Feature sequence476 >Feature sequence477 >Feature sequence478 1094 528 gene locus_tag LOCUS_09800 1094 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1470 1168 gene locus_tag LOCUS_09810 1470 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence479 >Feature sequence480 >Feature sequence481 >Feature sequence482 >Feature sequence483 >Feature sequence484 <1454 573 gene locus_tag LOCUS_09820 <1454 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56881:threonine--tRNA ligase >Feature sequence485 1453 374 gene locus_tag LOCUS_09830 1453 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence486 >Feature sequence487 <1447 507 gene locus_tag LOCUS_09840 <1447 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P94604:DNA gyrase subunit B >Feature sequence488 196 1128 gene locus_tag LOCUS_09850 196 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence489 127 756 gene locus_tag LOCUS_09860 127 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence490 <1432 23 gene locus_tag LOCUS_09870 <1432 23 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001060462.1:MSCRAMM family adhesin SdrC >Feature sequence491 177 842 gene locus_tag LOCUS_09880 177 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence492 >Feature sequence493 1286 636 gene locus_tag LOCUS_09890 1286 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1410 1335 gene locus_tag LOCUS_t00250 1410 1335 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence494 >Feature sequence495 502 92 gene locus_tag LOCUS_09900 502 92 CDS product diadenosine 5'5'''-P1,P4-tetraphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence496 244 1083 gene locus_tag LOCUS_09910 244 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence497 >Feature sequence498 <1402 627 gene locus_tag LOCUS_09920 <1402 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947573.1:glutamate--cysteine ligase >Feature sequence499 600 280 gene locus_tag LOCUS_09930 600 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 878 618 gene locus_tag LOCUS_09940 878 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1262 903 gene locus_tag LOCUS_09950 1262 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence500 >Feature sequence501 <1394 145 gene locus_tag LOCUS_09960 <1394 145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810317.1:thioredoxin >Feature sequence502 <1 839 gene locus_tag LOCUS_09970 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972472.1:MFS transporter >Feature sequence503 >Feature sequence504 >Feature sequence505 >Feature sequence506 1039 53 gene locus_tag LOCUS_09980 1039 53 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence507 427 702 gene locus_tag LOCUS_09990 427 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 692 1024 gene locus_tag LOCUS_10000 692 1024 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence508 >Feature sequence509 155 883 gene locus_tag LOCUS_10010 155 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence510 >Feature sequence511 268 1134 gene locus_tag LOCUS_10020 268 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence512 >Feature sequence513 275 802 gene locus_tag LOCUS_10030 275 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 803 1192 gene locus_tag LOCUS_10040 803 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence514 >Feature sequence515 >Feature sequence516 >Feature sequence517 >Feature sequence518 <1338 243 gene locus_tag LOCUS_10050 <1338 243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T815:cytochrome c oxidase subunit 1 >Feature sequence519 22 95 gene locus_tag LOCUS_t00260 22 95 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 294 1208 gene locus_tag LOCUS_10060 294 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence520 974 171 gene locus_tag LOCUS_10070 974 171 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_10070 1320 1021 gene locus_tag LOCUS_10080 1320 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence521 >Feature sequence522 >Feature sequence523 <1326 487 gene locus_tag LOCUS_10090 <1326 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3E9F4:UvrABC system protein B >Feature sequence524 1086 328 gene locus_tag LOCUS_10100 1086 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence525 >Feature sequence526 893 45 gene locus_tag LOCUS_10110 893 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence527 <1 648 gene locus_tag LOCUS_10120 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFC4:NADH-quinone oxidoreductase subunit N >Feature sequence528 >Feature sequence529 >Feature sequence530 <1 810 gene locus_tag LOCUS_10130 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73RS2:bifunctional protein FolD >Feature sequence531 885 379 gene locus_tag LOCUS_10140 885 379 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence532 953 561 gene locus_tag LOCUS_10150 953 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence533 >Feature sequence534 >Feature sequence535 >Feature sequence536 1286 1213 gene locus_tag LOCUS_t00270 1286 1213 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence537 192 911 gene locus_tag LOCUS_10160 192 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence538 >Feature sequence539 78 3 gene locus_tag LOCUS_t00280 78 3 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 293 90 gene locus_tag LOCUS_10170 293 90 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_10170 737 303 gene locus_tag LOCUS_10180 737 303 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_10180 1222 737 gene locus_tag LOCUS_10190 1222 737 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence540 733 116 gene locus_tag LOCUS_10200 733 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence541 >Feature sequence542 >Feature sequence543 852 46 gene locus_tag LOCUS_10210 852 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence544 >Feature sequence545 640 14 gene locus_tag LOCUS_10220 640 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 <1267 683 gene locus_tag LOCUS_10230 <1267 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q816A7:fructose-1,6-bisphosphatase >Feature sequence546 >Feature sequence547 50 1177 gene locus_tag LOCUS_10240 gene yrbG 50 1177 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162457.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence548 81 425 gene locus_tag LOCUS_10250 81 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 903 979 gene locus_tag LOCUS_t00290 903 979 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence549 >Feature sequence550 >Feature sequence551 >Feature sequence552 >Feature sequence553 1124 108 gene locus_tag LOCUS_10260 1124 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence554 >Feature sequence555 924 91 gene locus_tag LOCUS_10270 924 91 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870186.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence556 >Feature sequence557 >Feature sequence558 537 154 gene locus_tag LOCUS_10280 537 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence559 1002 43 gene locus_tag LOCUS_10290 1002 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence560 >Feature sequence561 >Feature sequence562 >Feature sequence563 <1 1078 gene locus_tag LOCUS_10300 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146822.1:Fe-S protein, radical SAM family >Feature sequence564 >Feature sequence565 205 609 gene locus_tag LOCUS_10310 205 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_10310 762 1154 gene locus_tag LOCUS_10320 762 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence566 816 649 gene locus_tag LOCUS_10330 816 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence567 >Feature sequence568 473 33 gene locus_tag LOCUS_10340 473 33 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869046.1 protein_id gnl|my_center|LOCUS_10340 669 478 gene locus_tag LOCUS_10350 669 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 <1195 680 gene locus_tag LOCUS_10360 <1195 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762326.1:propionyl-CoA carboxylase subunit beta >Feature sequence569 <1190 451 gene locus_tag LOCUS_10370 <1190 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66908:putative arsenical pump-driving ATPase 1 >Feature sequence570 >Feature sequence571 >Feature sequence572 227 688 gene locus_tag LOCUS_10380 227 688 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_10380 <1187 681 gene locus_tag LOCUS_10390 <1187 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250419.1:serralysin >Feature sequence573 <1 875 gene locus_tag LOCUS_10400 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WA03:putative glycine dehydrogenase (decarboxylating) subunit 2 >Feature sequence574 1183 599 gene locus_tag LOCUS_10410 1183 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence575 >Feature sequence576 >Feature sequence577 269 1048 gene locus_tag LOCUS_10420 269 1048 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence578 >Feature sequence579 <1175 289 gene locus_tag LOCUS_10430 <1175 289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7V9G2:chaperone protein dnaK2 >Feature sequence580 697 254 gene locus_tag LOCUS_10440 697 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence581 >Feature sequence582 >Feature sequence583 >Feature sequence584 <1 1086 gene locus_tag LOCUS_10450 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057620.1:calcium/proton exchanger >Feature sequence585 >Feature sequence586 495 905 gene locus_tag LOCUS_10460 495 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence587 <1158 237 gene locus_tag LOCUS_10470 <1158 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003974987.1:ABC transporter ATP-binding protein >Feature sequence588 >Feature sequence589 >Feature sequence590 >Feature sequence591 >Feature sequence592 352 843 gene locus_tag LOCUS_10480 352 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence593 >Feature sequence594 >Feature sequence595 >Feature sequence596 >Feature sequence597 >Feature sequence598 166 1041 gene locus_tag LOCUS_10490 166 1041 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496979.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence599 >Feature sequence600 >Feature sequence601 476 796 gene locus_tag LOCUS_10500 476 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence602 >Feature sequence603 <1 590 gene locus_tag LOCUS_10510 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001000761.1:phosphonate ABC transporter permease >Feature sequence604 2 928 gene locus_tag LOCUS_10520 2 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence605 <1 948 gene locus_tag LOCUS_10530 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001704940.1:putative lipoprotein aminopeptidase LpqL >Feature sequence606 <1 866 gene locus_tag LOCUS_10540 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104575.1:membrane protein >Feature sequence607 >Feature sequence608 <1114 283 gene locus_tag LOCUS_10550 <1114 283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q03AF8:phosphoglucosamine mutase >Feature sequence609 3 242 gene locus_tag LOCUS_10560 3 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 252 1040 gene locus_tag LOCUS_10570 gene paaB1 252 1040 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709123.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence610 >Feature sequence611 >Feature sequence612 >Feature sequence613 >Feature sequence614 <1102 511 gene locus_tag LOCUS_10580 <1102 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764424.1:flotillin >Feature sequence615 >Feature sequence616 >Feature sequence617 >Feature sequence618 <1090 119 gene locus_tag LOCUS_10590 <1090 119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258200.1:chromosome condensation regulator RCC1 >Feature sequence619 >Feature sequence620 <1086 441 gene locus_tag LOCUS_10600 <1086 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122744.1:single-strand selective monofunctional uracil DNA glycosylase >Feature sequence621 >Feature sequence622 >Feature sequence623 <1 657 gene locus_tag LOCUS_10610 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979301.1:4-demethylwyosine synthase TYW1 >Feature sequence624 <1 515 gene locus_tag LOCUS_10620 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7CII9:NAD(P) transhydrogenase subunit alpha 512 823 gene locus_tag LOCUS_10630 512 823 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence625 >Feature sequence626 >Feature sequence627 >Feature sequence628 >Feature sequence629 >Feature sequence630 685 56 gene locus_tag LOCUS_10640 685 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10640 >Feature sequence631 >Feature sequence632 >Feature sequence633 <1061 174 gene locus_tag LOCUS_10650 <1061 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867600.1:NDP-sugar synthase >Feature sequence634 3 764 gene locus_tag LOCUS_10660 3 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence635 >Feature sequence636 <1 713 gene locus_tag LOCUS_10670 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3D452:Fused isobutyryl-CoA mutase >Feature sequence637 >Feature sequence638 523 741 gene locus_tag LOCUS_10680 523 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence639 183 548 gene locus_tag LOCUS_10690 183 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence640 >Feature sequence641 >Feature sequence642 >Feature sequence643 >Feature sequence644 697 53 gene locus_tag LOCUS_10700 697 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence645 >Feature sequence646 >Feature sequence647 >Feature sequence648 >Feature sequence649 >Feature sequence650 427 305 gene locus_tag LOCUS_10710 427 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 591 427 gene locus_tag LOCUS_10720 591 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence651 >Feature sequence652 >Feature sequence653 >Feature sequence654 >Feature sequence655 <1 551 gene locus_tag LOCUS_10730 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867508.1:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence656 >Feature sequence657 >Feature sequence658 932 177 gene locus_tag LOCUS_10740 gene rfbA 932 177 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676164.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence659 >Feature sequence660 >Feature sequence661 >Feature sequence662 >Feature sequence663 453 73 gene locus_tag LOCUS_10750 453 73 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence664 >Feature sequence665 >Feature sequence666 >Feature sequence667 943 293 gene locus_tag LOCUS_10760 943 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence668 646 104 gene locus_tag LOCUS_10770 646 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770