>Feature sequence01 <1 680 gene locus_tag LOCUS_0010 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RD00:hercynine oxygenase 1729 677 gene locus_tag LOCUS_0020 1729 677 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_0020 1798 2634 gene locus_tag LOCUS_0030 1798 2634 CDS product oligopeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_0030 6173 2631 gene locus_tag LOCUS_0040 gene smc 6173 2631 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66878 protein_id gnl|my_center|LOCUS_0040 7361 6267 gene locus_tag LOCUS_0050 7361 6267 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_0050 7444 8154 gene locus_tag LOCUS_0060 7444 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0060 8186 8800 gene locus_tag LOCUS_0070 8186 8800 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_0070 9270 8797 gene locus_tag LOCUS_0080 9270 8797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 9566 9300 gene locus_tag LOCUS_0090 9566 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 9642 10736 gene locus_tag LOCUS_0100 9642 10736 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023921.1 protein_id gnl|my_center|LOCUS_0100 11608 10727 gene locus_tag LOCUS_0110 11608 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 12868 11696 gene locus_tag LOCUS_0120 12868 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_0120 12919 13872 gene locus_tag LOCUS_0130 12919 13872 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_0130 14743 14075 gene locus_tag LOCUS_0140 14743 14075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 14946 14794 gene locus_tag LOCUS_0150 14946 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 15100 16434 gene locus_tag LOCUS_0160 15100 16434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 16492 16728 gene locus_tag LOCUS_0170 16492 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0170 16749 17039 gene locus_tag LOCUS_0180 16749 17039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 17041 17547 gene locus_tag LOCUS_0190 17041 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 17569 18357 gene locus_tag LOCUS_0200 17569 18357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 18387 18671 gene locus_tag LOCUS_0210 18387 18671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 18702 19022 gene locus_tag LOCUS_0220 18702 19022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 21049 19019 gene locus_tag LOCUS_0230 21049 19019 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_0230 21316 21089 gene locus_tag LOCUS_0240 21316 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0240 21392 22429 gene locus_tag LOCUS_0250 21392 22429 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088401.1 protein_id gnl|my_center|LOCUS_0250 22640 22879 gene locus_tag LOCUS_0260 22640 22879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0260 23209 22886 gene locus_tag LOCUS_0270 23209 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0270 23363 23926 gene locus_tag LOCUS_0280 23363 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 24619 23927 gene locus_tag LOCUS_0290 24619 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 24753 24959 gene locus_tag LOCUS_0300 24753 24959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 25462 24956 gene locus_tag LOCUS_0310 gene msrA 25462 24956 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066219.1 protein_id gnl|my_center|LOCUS_0310 26648 25452 gene locus_tag LOCUS_0320 26648 25452 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 protein_id gnl|my_center|LOCUS_0320 28249 26645 gene locus_tag LOCUS_0330 28249 26645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0330 28642 28289 gene locus_tag LOCUS_0340 28642 28289 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_0340 28732 29868 gene locus_tag LOCUS_0350 28732 29868 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_0350 30101 30382 gene locus_tag LOCUS_0360 30101 30382 CDS product effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_0360 30393 32564 gene locus_tag LOCUS_0370 30393 32564 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_0370 32557 32859 gene locus_tag LOCUS_0380 32557 32859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 33740 32868 gene locus_tag LOCUS_0390 gene ctaB 33740 32868 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_0390 33859 34641 gene locus_tag LOCUS_0400 33859 34641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 34647 35054 gene locus_tag LOCUS_0410 34647 35054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546490.1 protein_id gnl|my_center|LOCUS_0410 >Feature sequence02 495 55 gene locus_tag LOCUS_0420 495 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0420 592 837 gene locus_tag LOCUS_0430 592 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0430 844 1218 gene locus_tag LOCUS_0440 844 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 1224 1667 gene locus_tag LOCUS_0450 1224 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 1674 1958 gene locus_tag LOCUS_0460 1674 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 2746 1955 gene locus_tag LOCUS_0470 2746 1955 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_0470 3258 2746 gene locus_tag LOCUS_0480 gene apt 3258 2746 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q038P1 protein_id gnl|my_center|LOCUS_0480 5388 3310 gene locus_tag LOCUS_0490 5388 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 6525 5518 gene locus_tag LOCUS_0500 6525 5518 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_0500 7070 6522 gene locus_tag LOCUS_0510 7070 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728496.1 protein_id gnl|my_center|LOCUS_0510 7741 7067 gene locus_tag LOCUS_0520 7741 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888120.1 protein_id gnl|my_center|LOCUS_0520 9738 7939 gene locus_tag LOCUS_0530 9738 7939 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81F28 protein_id gnl|my_center|LOCUS_0530 11018 10248 gene locus_tag LOCUS_0540 gene sufC 11018 10248 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_0540 12060 11098 gene locus_tag LOCUS_0550 gene tfb 12060 11098 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_0550 12302 12057 gene locus_tag LOCUS_0560 12302 12057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 12696 12394 gene locus_tag LOCUS_0570 12696 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0570 13081 12701 gene locus_tag LOCUS_0580 13081 12701 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_0580 13715 13176 gene locus_tag LOCUS_0590 13715 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0590 14443 13778 gene locus_tag LOCUS_0600 14443 13778 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249969.1 protein_id gnl|my_center|LOCUS_0600 14540 15589 gene locus_tag LOCUS_0610 14540 15589 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_0610 16264 15602 gene locus_tag LOCUS_0620 16264 15602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 16371 16297 gene locus_tag LOCUS_t0010 16371 16297 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16479 17360 gene locus_tag LOCUS_0630 16479 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 17650 19119 gene locus_tag LOCUS_0640 17650 19119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 19163 19522 gene locus_tag LOCUS_0650 19163 19522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 20010 19519 gene locus_tag LOCUS_0660 20010 19519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 21719 20049 gene locus_tag LOCUS_0670 21719 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0670 22627 21794 gene locus_tag LOCUS_0680 22627 21794 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_0680 22723 22917 gene locus_tag LOCUS_0690 22723 22917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0690 22990 23763 gene locus_tag LOCUS_0700 22990 23763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 24140 23760 gene locus_tag LOCUS_0710 24140 23760 CDS product Sec-independent protein secretion pathway component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_0710 25322 24165 gene locus_tag LOCUS_0720 gene mdtG 25322 24165 CDS product multidrug resistance protein MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JN04 protein_id gnl|my_center|LOCUS_0720 26008 25319 gene locus_tag LOCUS_0730 26008 25319 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240536.1 protein_id gnl|my_center|LOCUS_0730 26801 26076 gene locus_tag LOCUS_0740 26801 26076 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_0740 27763 26882 gene locus_tag LOCUS_0750 27763 26882 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946498.1 protein_id gnl|my_center|LOCUS_0750 >Feature sequence03 3066 2548 gene locus_tag LOCUS_0760 3066 2548 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_0760 3183 4679 gene locus_tag LOCUS_0770 3183 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 4960 4682 gene locus_tag LOCUS_0780 4960 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 5260 4964 gene locus_tag LOCUS_0790 5260 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0790 5343 5735 gene locus_tag LOCUS_0800 5343 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_0800 5735 6616 gene locus_tag LOCUS_0810 gene menA 5735 6616 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BK6 protein_id gnl|my_center|LOCUS_0810 6784 7887 gene locus_tag LOCUS_0820 6784 7887 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_0820 9017 8070 gene locus_tag LOCUS_0830 9017 8070 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763183.1 protein_id gnl|my_center|LOCUS_0830 9125 9541 gene locus_tag LOCUS_0840 9125 9541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 9831 9538 gene locus_tag LOCUS_0850 9831 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 10410 9886 gene locus_tag LOCUS_0860 10410 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 10461 10850 gene locus_tag LOCUS_0870 10461 10850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 11131 10829 gene locus_tag LOCUS_0880 11131 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 11213 11425 gene locus_tag LOCUS_0890 11213 11425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 11754 11431 gene locus_tag LOCUS_0900 11754 11431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0900 12337 11939 gene locus_tag LOCUS_0910 12337 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0910 12420 12755 gene locus_tag LOCUS_0920 12420 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 12950 13201 gene locus_tag LOCUS_0930 12950 13201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0930 13253 15103 gene locus_tag LOCUS_0940 13253 15103 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_0940 15134 16009 gene locus_tag LOCUS_0950 gene speB 15134 16009 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_0950 16056 16631 gene locus_tag LOCUS_0960 16056 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_0960 16915 16628 gene locus_tag LOCUS_0970 16915 16628 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_0970 17137 18009 gene locus_tag LOCUS_0980 17137 18009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 19406 18006 gene locus_tag LOCUS_0990 gene cysS 19406 18006 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YID4 protein_id gnl|my_center|LOCUS_0990 20212 19415 gene locus_tag LOCUS_1000 20212 19415 CDS product NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_1000 20555 20247 gene locus_tag LOCUS_1010 20555 20247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 20659 21036 gene locus_tag LOCUS_1020 20659 21036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1020 21056 21337 gene locus_tag LOCUS_1030 21056 21337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 21410 22414 gene locus_tag LOCUS_1040 21410 22414 CDS product ATP-NAD/AcoX kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763693.1 protein_id gnl|my_center|LOCUS_1040 22799 23185 gene locus_tag LOCUS_1050 22799 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1050 23186 24010 gene locus_tag LOCUS_1060 gene purC 23186 24010 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMH6 protein_id gnl|my_center|LOCUS_1060 24265 24777 gene locus_tag LOCUS_1070 24265 24777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 25177 24761 gene locus_tag LOCUS_1080 25177 24761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_1080 25228 25635 gene locus_tag LOCUS_1090 25228 25635 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_1090 26441 25998 gene locus_tag LOCUS_1100 26441 25998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 26751 26521 gene locus_tag LOCUS_1110 26751 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 27023 26775 gene locus_tag LOCUS_1120 27023 26775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 >Feature sequence04 166 336 gene locus_tag LOCUS_1130 166 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 333 1262 gene locus_tag LOCUS_1140 333 1262 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_1140 2245 1277 gene locus_tag LOCUS_1150 gene ytcB 2245 1277 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_1150 4469 2247 gene locus_tag LOCUS_1160 4469 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 4616 5680 gene locus_tag LOCUS_1170 4616 5680 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_1170 5689 6570 gene locus_tag LOCUS_1180 5689 6570 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_1180 7249 6575 gene locus_tag LOCUS_1190 7249 6575 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787482.1 protein_id gnl|my_center|LOCUS_1190 8393 7281 gene locus_tag LOCUS_1200 8393 7281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 9803 8439 gene locus_tag LOCUS_1210 9803 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 9937 11100 gene locus_tag LOCUS_1220 9937 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 11161 12684 gene locus_tag LOCUS_1230 11161 12684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 12749 13861 gene locus_tag LOCUS_1240 12749 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 13942 15243 gene locus_tag LOCUS_1250 13942 15243 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730935.1 protein_id gnl|my_center|LOCUS_1250 15290 16345 gene locus_tag LOCUS_1260 15290 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 16369 17598 gene locus_tag LOCUS_1270 16369 17598 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_1270 18593 17595 gene locus_tag LOCUS_1280 18593 17595 CDS product NDP-hexose-3-ketoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202146.1 protein_id gnl|my_center|LOCUS_1280 19051 18635 gene locus_tag LOCUS_1290 19051 18635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1290 19148 19969 gene locus_tag LOCUS_1300 19148 19969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 19966 20943 gene locus_tag LOCUS_1310 gene rfbD 19966 20943 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67175 protein_id gnl|my_center|LOCUS_1310 20996 21754 gene locus_tag LOCUS_1320 20996 21754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1320 >Feature sequence05 1346 300 gene locus_tag LOCUS_1330 1346 300 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763436.1 protein_id gnl|my_center|LOCUS_1330 1421 2230 gene locus_tag LOCUS_1340 1421 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1340 2332 3729 gene locus_tag LOCUS_1350 2332 3729 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_1350 3735 4289 gene locus_tag LOCUS_1360 3735 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 4964 4269 gene locus_tag LOCUS_1370 gene bioD 4964 4269 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT8 protein_id gnl|my_center|LOCUS_1370 6274 4961 gene locus_tag LOCUS_1380 gene bioA 6274 4961 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_1380 6366 7346 gene locus_tag LOCUS_1390 gene bioB 6366 7346 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE51 protein_id gnl|my_center|LOCUS_1390 7336 8466 gene locus_tag LOCUS_1400 gene kbl 7336 8466 CDS product 8-amino-7-oxononanoate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31777 protein_id gnl|my_center|LOCUS_1400 8655 9386 gene locus_tag LOCUS_1410 gene ccdA 8655 9386 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_1410 9392 10477 gene locus_tag LOCUS_1420 9392 10477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1420 10585 11241 gene locus_tag LOCUS_1430 10585 11241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_1430 11572 11234 gene locus_tag LOCUS_1440 11572 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 11815 12552 gene locus_tag LOCUS_1450 11815 12552 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_1450 12589 13407 gene locus_tag LOCUS_1460 12589 13407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_1460 13629 14624 gene locus_tag LOCUS_1470 13629 14624 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_1470 14624 15436 gene locus_tag LOCUS_1480 14624 15436 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_1480 15433 15699 gene locus_tag LOCUS_1490 15433 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 15741 16136 gene locus_tag LOCUS_1500 15741 16136 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_1500 16142 16600 gene locus_tag LOCUS_1510 16142 16600 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_1510 16603 17349 gene locus_tag LOCUS_1520 16603 17349 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875650.1 protein_id gnl|my_center|LOCUS_1520 17349 17552 gene locus_tag LOCUS_1530 17349 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 17549 17812 gene locus_tag LOCUS_1540 17549 17812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1540 17809 18138 gene locus_tag LOCUS_1550 17809 18138 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_1550 18138 18569 gene locus_tag LOCUS_1560 18138 18569 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_1560 18571 19056 gene locus_tag LOCUS_1570 18571 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 19057 19773 gene locus_tag LOCUS_1580 19057 19773 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978391.1 protein_id gnl|my_center|LOCUS_1580 19778 20299 gene locus_tag LOCUS_1590 19778 20299 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_1590 20496 20888 gene locus_tag LOCUS_1600 20496 20888 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250477.1 protein_id gnl|my_center|LOCUS_1600 20878 21435 gene locus_tag LOCUS_1610 20878 21435 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867447.1 protein_id gnl|my_center|LOCUS_1610 21451 21738 gene locus_tag LOCUS_1620 21451 21738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1620 21798 21873 gene locus_tag LOCUS_t0020 21798 21873 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 656 985 gene locus_tag LOCUS_1630 656 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 1030 2136 gene locus_tag LOCUS_1640 gene sucC 1030 2136 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUY3 protein_id gnl|my_center|LOCUS_1640 2133 3050 gene locus_tag LOCUS_1650 2133 3050 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_1650 4375 3260 gene locus_tag LOCUS_1660 4375 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 5118 5327 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acctttgtcacctttatcacc 5813 6910 gene locus_tag LOCUS_1670 5813 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 7136 6930 gene locus_tag LOCUS_1680 7136 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 7971 7174 gene locus_tag LOCUS_1690 7971 7174 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_1690 9770 7968 gene locus_tag LOCUS_1700 9770 7968 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_1700 9934 10764 gene locus_tag LOCUS_1710 9934 10764 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_1710 10770 11564 gene locus_tag LOCUS_1720 10770 11564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 11588 12601 gene locus_tag LOCUS_1730 gene trxB 11588 12601 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7P6 protein_id gnl|my_center|LOCUS_1730 12846 12604 gene locus_tag LOCUS_1740 12846 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_1740 13826 12906 gene locus_tag LOCUS_1750 13826 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 14594 13857 gene locus_tag LOCUS_1760 14594 13857 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_1760 15316 14636 gene locus_tag LOCUS_1770 gene serB 15316 14636 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065985.1 protein_id gnl|my_center|LOCUS_1770 15387 15674 gene locus_tag LOCUS_1780 15387 15674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 16051 15677 gene locus_tag LOCUS_1790 16051 15677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 16157 17599 gene locus_tag LOCUS_1800 gene proS 16157 17599 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM28 protein_id gnl|my_center|LOCUS_1800 17633 18124 gene locus_tag LOCUS_1810 17633 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 >Feature sequence07 459 698 gene locus_tag LOCUS_1820 459 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1820 892 713 gene locus_tag LOCUS_1830 892 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1830 1746 829 gene locus_tag LOCUS_1840 1746 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_1840 2984 1764 gene locus_tag LOCUS_1850 gene ychF 2984 1764 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_1850 3392 3036 gene locus_tag LOCUS_1860 3392 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1860 3803 3393 gene locus_tag LOCUS_1870 3803 3393 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_1870 4055 4888 gene locus_tag LOCUS_1880 gene mqnD 4055 4888 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_1880 5809 4880 gene locus_tag LOCUS_1890 gene dusB 5809 4880 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_1890 5924 6202 gene locus_tag LOCUS_1900 5924 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 7283 6195 gene locus_tag LOCUS_1910 7283 6195 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_1910 7346 7519 gene locus_tag LOCUS_1920 7346 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 7994 7509 gene locus_tag LOCUS_1930 7994 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_1930 8271 8044 gene locus_tag LOCUS_1940 8271 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_1940 9618 8302 gene locus_tag LOCUS_1950 9618 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 9756 10757 gene locus_tag LOCUS_1960 9756 10757 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868869.1 protein_id gnl|my_center|LOCUS_1960 10754 12118 gene locus_tag LOCUS_1970 10754 12118 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868868.1 protein_id gnl|my_center|LOCUS_1970 12454 12122 gene locus_tag LOCUS_1980 12454 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1980 12642 12463 gene locus_tag LOCUS_1990 12642 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 13253 12852 gene locus_tag LOCUS_2000 13253 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 14545 13256 gene locus_tag LOCUS_2010 14545 13256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 14628 15074 gene locus_tag LOCUS_2020 14628 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 15503 15075 gene locus_tag LOCUS_2030 15503 15075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 <17194 15503 gene locus_tag LOCUS_2040 <17194 15503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978604.1:leucyl aminopeptidase >Feature sequence08 776 1237 gene locus_tag LOCUS_2050 gene bcp 776 1237 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_2050 2200 1256 gene locus_tag LOCUS_2060 2200 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 2295 2672 gene locus_tag LOCUS_2070 2295 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2070 2906 2673 gene locus_tag LOCUS_2080 2906 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 3003 4445 gene locus_tag LOCUS_2090 3003 4445 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_2090 5560 4442 gene locus_tag LOCUS_2100 5560 4442 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763062.1 protein_id gnl|my_center|LOCUS_2100 5665 6444 gene locus_tag LOCUS_2110 5665 6444 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_2110 6441 7502 gene locus_tag LOCUS_2120 6441 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2120 7506 8165 gene locus_tag LOCUS_2130 7506 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 8206 9030 gene locus_tag LOCUS_2140 gene aroE 8206 9030 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ55 protein_id gnl|my_center|LOCUS_2140 9027 9881 gene locus_tag LOCUS_2150 9027 9881 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_2150 9871 11139 gene locus_tag LOCUS_2160 gene aroA 9871 11139 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_2160 11201 12268 gene locus_tag LOCUS_2170 11201 12268 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496747.1 protein_id gnl|my_center|LOCUS_2170 12271 13635 gene locus_tag LOCUS_2180 gene aspC 12271 13635 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y2 protein_id gnl|my_center|LOCUS_2180 13636 14487 gene locus_tag LOCUS_2190 13636 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 14491 14895 gene locus_tag LOCUS_2200 14491 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2200 16206 14878 gene locus_tag LOCUS_2210 16206 14878 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979932.1 protein_id gnl|my_center|LOCUS_2210 >Feature sequence09 771 1115 gene locus_tag LOCUS_2220 771 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 1293 1126 gene locus_tag LOCUS_2230 1293 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 1722 1315 gene locus_tag LOCUS_2240 1722 1315 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082958.1 protein_id gnl|my_center|LOCUS_2240 2225 1731 gene locus_tag LOCUS_2250 2225 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082186.1 protein_id gnl|my_center|LOCUS_2250 2611 2255 gene locus_tag LOCUS_2260 2611 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2260 2716 3195 gene locus_tag LOCUS_2270 2716 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 4657 3182 gene locus_tag LOCUS_2280 4657 3182 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146849.1 protein_id gnl|my_center|LOCUS_2280 4764 5492 gene locus_tag LOCUS_2290 4764 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 5760 5500 gene locus_tag LOCUS_2300 5760 5500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 6358 5876 gene locus_tag LOCUS_2310 6358 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 6512 7858 gene locus_tag LOCUS_2320 6512 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2320 8196 7879 gene locus_tag LOCUS_2330 8196 7879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2330 8377 8231 gene locus_tag LOCUS_2340 8377 8231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2340 9017 8709 gene locus_tag LOCUS_2350 9017 8709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2350 9887 9291 gene locus_tag LOCUS_2360 9887 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2360 10041 9965 gene locus_tag LOCUS_t0030 10041 9965 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10120 10374 gene locus_tag LOCUS_2370 10120 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144139.1 protein_id gnl|my_center|LOCUS_2370 10376 12145 gene locus_tag LOCUS_2380 gene pepF 10376 12145 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_2380 12323 13636 gene locus_tag LOCUS_2390 12323 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2390 14184 13633 gene locus_tag LOCUS_2400 14184 13633 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_2400 14691 14230 gene locus_tag LOCUS_2410 14691 14230 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963650.1 protein_id gnl|my_center|LOCUS_2410 14742 15290 gene locus_tag LOCUS_2420 14742 15290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 15524 15267 gene locus_tag LOCUS_2430 15524 15267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 15609 15683 gene locus_tag LOCUS_t0040 15609 15683 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence10 729 367 gene locus_tag LOCUS_2440 729 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 1354 851 gene locus_tag LOCUS_2450 1354 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_2450 2445 1354 gene locus_tag LOCUS_2460 2445 1354 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_2460 2673 3242 gene locus_tag LOCUS_2470 2673 3242 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_2470 3242 3430 gene locus_tag LOCUS_2480 3242 3430 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 protein_id gnl|my_center|LOCUS_2480 3432 4253 gene locus_tag LOCUS_2490 3432 4253 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_2490 5185 4250 gene locus_tag LOCUS_2500 5185 4250 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA69 protein_id gnl|my_center|LOCUS_2500 6095 5277 gene locus_tag LOCUS_2510 6095 5277 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_2510 6236 7072 gene locus_tag LOCUS_2520 6236 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 7069 8595 gene locus_tag LOCUS_2530 7069 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980185.1 protein_id gnl|my_center|LOCUS_2530 8642 9775 gene locus_tag LOCUS_2540 8642 9775 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980186.1 protein_id gnl|my_center|LOCUS_2540 9772 11853 gene locus_tag LOCUS_2550 9772 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 12338 11850 gene locus_tag LOCUS_2560 12338 11850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 12391 13080 gene locus_tag LOCUS_2570 12391 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 13572 13081 gene locus_tag LOCUS_2580 13572 13081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 14042 13572 gene locus_tag LOCUS_2590 14042 13572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2590 14133 14792 gene locus_tag LOCUS_2600 14133 14792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 15503 14793 gene locus_tag LOCUS_2610 15503 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2610 >Feature sequence11 70 145 gene locus_tag LOCUS_t0050 70 145 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 226 423 gene locus_tag LOCUS_2620 226 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 458 697 gene locus_tag LOCUS_2630 458 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2630 691 909 gene locus_tag LOCUS_2640 691 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 941 1357 gene locus_tag LOCUS_2650 941 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 1739 1344 gene locus_tag LOCUS_2660 1739 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2660 1810 2007 gene locus_tag LOCUS_2670 1810 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 2366 2013 gene locus_tag LOCUS_2680 2366 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2680 2521 2670 gene locus_tag LOCUS_2690 2521 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 3580 2660 gene locus_tag LOCUS_2700 3580 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 4539 3718 gene locus_tag LOCUS_2710 4539 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 4578 5417 gene locus_tag LOCUS_2720 4578 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 5468 6676 gene locus_tag LOCUS_2730 5468 6676 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_2730 7217 6678 gene locus_tag LOCUS_2740 7217 6678 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_2740 7326 8468 gene locus_tag LOCUS_2750 gene purK 7326 8468 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_2750 8525 8908 gene locus_tag LOCUS_2760 8525 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2760 8883 9056 gene locus_tag LOCUS_2770 8883 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 9049 9576 gene locus_tag LOCUS_2780 9049 9576 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_2780 9620 10309 gene locus_tag LOCUS_2790 9620 10309 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_2790 10312 11280 gene locus_tag LOCUS_2800 10312 11280 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_2800 11281 12387 gene locus_tag LOCUS_2810 11281 12387 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_2810 12384 12710 gene locus_tag LOCUS_2820 12384 12710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 12774 13346 gene locus_tag LOCUS_2830 12774 13346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 13399 13758 gene locus_tag LOCUS_2840 13399 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 13803 14126 gene locus_tag LOCUS_2850 13803 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2850 14511 14137 gene locus_tag LOCUS_2860 14511 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 >Feature sequence12 330 1214 gene locus_tag LOCUS_2870 gene menA 330 1214 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HGQ4 protein_id gnl|my_center|LOCUS_2870 1257 2360 gene locus_tag LOCUS_2880 1257 2360 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_2880 3493 2543 gene locus_tag LOCUS_2890 3493 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2890 3600 4016 gene locus_tag LOCUS_2900 3600 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2900 4324 4013 gene locus_tag LOCUS_2910 4324 4013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 4891 4376 gene locus_tag LOCUS_2920 4891 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 4942 5331 gene locus_tag LOCUS_2930 4942 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 5612 5310 gene locus_tag LOCUS_2940 5612 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 5697 5909 gene locus_tag LOCUS_2950 5697 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 6250 5915 gene locus_tag LOCUS_2960 6250 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 6807 6409 gene locus_tag LOCUS_2970 6807 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2970 6889 7239 gene locus_tag LOCUS_2980 6889 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 7418 7675 gene locus_tag LOCUS_2990 7418 7675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 7726 9576 gene locus_tag LOCUS_3000 7726 9576 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_3000 9616 10482 gene locus_tag LOCUS_3010 gene speB 9616 10482 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_3010 10519 11103 gene locus_tag LOCUS_3020 10519 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_3020 11387 11100 gene locus_tag LOCUS_3030 11387 11100 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_3030 11609 12481 gene locus_tag LOCUS_3040 11609 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 12513 13514 gene locus_tag LOCUS_3050 12513 13514 CDS product ATP-NAD/AcoX kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763693.1 protein_id gnl|my_center|LOCUS_3050 >Feature sequence13 1138 266 gene locus_tag LOCUS_3060 1138 266 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_3060 2283 1213 gene locus_tag LOCUS_3070 2283 1213 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 protein_id gnl|my_center|LOCUS_3070 3192 2287 gene locus_tag LOCUS_3080 3192 2287 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_3080 4190 3195 gene locus_tag LOCUS_3090 4190 3195 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_3090 4792 4241 gene locus_tag LOCUS_3100 4792 4241 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_3100 5593 4847 gene locus_tag LOCUS_3110 5593 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 6371 5595 gene locus_tag LOCUS_3120 gene xapG 6371 5595 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D15 protein_id gnl|my_center|LOCUS_3120 8200 6428 gene locus_tag LOCUS_3130 8200 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 9525 8233 gene locus_tag LOCUS_3140 9525 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 9642 10646 gene locus_tag LOCUS_3150 9642 10646 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875972.1 protein_id gnl|my_center|LOCUS_3150 12380 10659 gene locus_tag LOCUS_3160 12380 10659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 13489 12437 gene locus_tag LOCUS_3170 13489 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3170 >Feature sequence14 362 1939 gene locus_tag LOCUS_3180 362 1939 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_3180 2268 1945 gene locus_tag LOCUS_3190 2268 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3190 3283 2306 gene locus_tag LOCUS_3200 3283 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3200 4539 3370 gene locus_tag LOCUS_3210 4539 3370 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887528.1 protein_id gnl|my_center|LOCUS_3210 5564 4542 gene locus_tag LOCUS_3220 5564 4542 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887529.1 protein_id gnl|my_center|LOCUS_3220 5731 6237 gene locus_tag LOCUS_3230 5731 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 6544 6230 gene locus_tag LOCUS_3240 6544 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3240 6615 7262 gene locus_tag LOCUS_3250 6615 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3250 7272 7883 gene locus_tag LOCUS_3260 7272 7883 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_3260 8937 7876 gene locus_tag LOCUS_3270 8937 7876 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877787.1 protein_id gnl|my_center|LOCUS_3270 9541 8930 gene locus_tag LOCUS_3280 9541 8930 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_3280 10185 9538 gene locus_tag LOCUS_3290 10185 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3290 10260 10874 gene locus_tag LOCUS_3300 10260 10874 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496416.1 protein_id gnl|my_center|LOCUS_3300 10974 10887 gene locus_tag LOCUS_t0060 10974 10887 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11007 11261 gene locus_tag LOCUS_3310 11007 11261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 11263 12501 gene locus_tag LOCUS_3320 11263 12501 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_3320 12510 13142 gene locus_tag LOCUS_3330 12510 13142 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_3330 >Feature sequence15 1138 323 gene locus_tag LOCUS_3340 gene cysQ 1138 323 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_3340 1355 1140 gene locus_tag LOCUS_3350 1355 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 1801 1373 gene locus_tag LOCUS_3360 1801 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 2498 2046 gene locus_tag LOCUS_3370 2498 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 2627 3286 gene locus_tag LOCUS_3380 2627 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 3850 3296 gene locus_tag LOCUS_3390 3850 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 3965 4159 gene locus_tag LOCUS_3400 3965 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3400 4234 4788 gene locus_tag LOCUS_3410 4234 4788 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_3410 4836 5150 gene locus_tag LOCUS_3420 4836 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 5821 5147 gene locus_tag LOCUS_3430 5821 5147 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 protein_id gnl|my_center|LOCUS_3430 6744 5818 gene locus_tag LOCUS_3440 6744 5818 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496725.1 protein_id gnl|my_center|LOCUS_3440 7502 6744 gene locus_tag LOCUS_3450 7502 6744 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_3450 7560 8576 gene locus_tag LOCUS_3460 7560 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 8611 9417 gene locus_tag LOCUS_3470 8611 9417 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_3470 9779 9414 gene locus_tag LOCUS_3480 9779 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3480 10128 9790 gene locus_tag LOCUS_3490 10128 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 11513 10278 gene locus_tag LOCUS_3500 11513 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3500 12600 11545 gene locus_tag LOCUS_3510 12600 11545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3510 12764 13483 gene locus_tag LOCUS_3520 12764 13483 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_3520 >Feature sequence16 1006 530 gene locus_tag LOCUS_3530 1006 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_3530 2477 1056 gene locus_tag LOCUS_3540 2477 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 2836 2615 gene locus_tag LOCUS_3550 2836 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3550 3077 3002 gene locus_tag LOCUS_t0070 3077 3002 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3147 4043 gene locus_tag LOCUS_3560 3147 4043 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_3560 4212 4030 gene locus_tag LOCUS_3570 4212 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 5333 4209 gene locus_tag LOCUS_3580 5333 4209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_3580 5452 6012 gene locus_tag LOCUS_3590 5452 6012 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_3590 6395 6015 gene locus_tag LOCUS_3600 6395 6015 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979541.1 protein_id gnl|my_center|LOCUS_3600 6411 6827 gene locus_tag LOCUS_3610 6411 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3610 6831 8039 gene locus_tag LOCUS_3620 6831 8039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3620 8097 9242 gene locus_tag LOCUS_3630 8097 9242 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_3630 9223 10455 gene locus_tag LOCUS_3640 9223 10455 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496498.1 protein_id gnl|my_center|LOCUS_3640 10452 11714 gene locus_tag LOCUS_3650 10452 11714 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876455.1 protein_id gnl|my_center|LOCUS_3650 12717 11752 gene locus_tag LOCUS_3660 gene yrbG 12717 11752 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_3660 12887 13234 gene locus_tag LOCUS_3670 12887 13234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3670 >Feature sequence17 862 2196 gene locus_tag LOCUS_3680 862 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3680 2199 3986 gene locus_tag LOCUS_3690 2199 3986 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002378512.1 protein_id gnl|my_center|LOCUS_3690 4062 4838 gene locus_tag LOCUS_3700 4062 4838 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_3700 4840 5610 gene locus_tag LOCUS_3710 4840 5610 CDS product teichoic acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877555.1 protein_id gnl|my_center|LOCUS_3710 5689 6240 gene locus_tag LOCUS_3720 5689 6240 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_3720 6292 7287 gene locus_tag LOCUS_3730 6292 7287 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868293.1 protein_id gnl|my_center|LOCUS_3730 7302 8171 gene locus_tag LOCUS_3740 7302 8171 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980041.1 protein_id gnl|my_center|LOCUS_3740 8739 8161 gene locus_tag LOCUS_3750 8739 8161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3750 8834 9904 gene locus_tag LOCUS_3760 8834 9904 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 protein_id gnl|my_center|LOCUS_3760 9979 10854 gene locus_tag LOCUS_3770 9979 10854 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_3770 >Feature sequence18 1086 382 gene locus_tag LOCUS_3780 1086 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3780 1118 1438 gene locus_tag LOCUS_3790 1118 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 1486 1557 gene locus_tag LOCUS_t0080 1486 1557 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2164 1568 gene locus_tag LOCUS_3800 2164 1568 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_3800 2604 2167 gene locus_tag LOCUS_3810 2604 2167 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 protein_id gnl|my_center|LOCUS_3810 3067 2606 gene locus_tag LOCUS_3820 3067 2606 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_3820 3464 3153 gene locus_tag LOCUS_3830 3464 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3830 3806 3694 gene locus_tag LOCUS_r0010 3806 3694 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3932 5716 gene locus_tag LOCUS_3840 3932 5716 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_3840 5713 6552 gene locus_tag LOCUS_3850 5713 6552 CDS product tRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_3850 6770 6549 gene locus_tag LOCUS_3860 6770 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3860 7299 6805 gene locus_tag LOCUS_3870 7299 6805 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_3870 7374 8462 gene locus_tag LOCUS_3880 7374 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3880 9536 8454 gene locus_tag LOCUS_3890 9536 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3890 9587 10189 gene locus_tag LOCUS_3900 9587 10189 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_3900 10373 10299 gene locus_tag LOCUS_t0090 10373 10299 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11051 10416 gene locus_tag LOCUS_3910 11051 10416 CDS product PqqC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7E5 protein_id gnl|my_center|LOCUS_3910 11130 11204 gene locus_tag LOCUS_t0100 11130 11204 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11266 12117 gene locus_tag LOCUS_3920 11266 12117 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879048.1 protein_id gnl|my_center|LOCUS_3920 >Feature sequence19 1917 1141 gene locus_tag LOCUS_3930 1917 1141 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYL8 protein_id gnl|my_center|LOCUS_3930 2918 1914 gene locus_tag LOCUS_3940 2918 1914 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_3940 3084 3410 gene locus_tag LOCUS_3950 3084 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3950 4068 3412 gene locus_tag LOCUS_3960 4068 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3960 5078 4269 gene locus_tag LOCUS_3970 5078 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3970 5209 6438 gene locus_tag LOCUS_3980 5209 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3980 6672 6484 gene locus_tag LOCUS_3990 6672 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3990 6891 6730 gene locus_tag LOCUS_4000 6891 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4000 7018 6932 gene locus_tag LOCUS_t0110 7018 6932 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7797 7051 gene locus_tag LOCUS_4010 7797 7051 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021690.1 protein_id gnl|my_center|LOCUS_4010 7903 8937 gene locus_tag LOCUS_4020 7903 8937 CDS product isocitrate/isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_4020 9486 8926 gene locus_tag LOCUS_4030 9486 8926 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867555.1 protein_id gnl|my_center|LOCUS_4030 10147 9443 gene locus_tag LOCUS_4040 10147 9443 CDS product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021455.1 protein_id gnl|my_center|LOCUS_4040 10710 10144 gene locus_tag LOCUS_4050 10710 10144 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249851.1 protein_id gnl|my_center|LOCUS_4050 11054 10728 gene locus_tag LOCUS_4060 11054 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 11355 11056 gene locus_tag LOCUS_4070 11355 11056 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762332.1 protein_id gnl|my_center|LOCUS_4070 <12047 11391 gene locus_tag LOCUS_4080 <12047 11391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762467.1:DNA repair and recombination protein RadA >Feature sequence20 274 1248 gene locus_tag LOCUS_4090 274 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4090 1233 2261 gene locus_tag LOCUS_4100 1233 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 2670 2263 gene locus_tag LOCUS_4110 2670 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 3829 2672 gene locus_tag LOCUS_4120 3829 2672 CDS product UDP-N,N'-diacetylbacillosamine 2-epimerase (hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXH8 protein_id gnl|my_center|LOCUS_4120 4961 3867 gene locus_tag LOCUS_4130 4961 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782235.1 protein_id gnl|my_center|LOCUS_4130 5143 5841 gene locus_tag LOCUS_4140 5143 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4140 5876 6571 gene locus_tag LOCUS_4150 5876 6571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392279.1 protein_id gnl|my_center|LOCUS_4150 7394 6585 gene locus_tag LOCUS_4160 7394 6585 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_4160 8385 7399 gene locus_tag LOCUS_4170 8385 7399 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261006.1 protein_id gnl|my_center|LOCUS_4170 8520 9392 gene locus_tag LOCUS_4180 8520 9392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_4180 10566 9400 gene locus_tag LOCUS_4190 10566 9400 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876812.1 protein_id gnl|my_center|LOCUS_4190 >Feature sequence21 1361 180 gene locus_tag LOCUS_4200 1361 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4200 2373 1375 gene locus_tag LOCUS_4210 2373 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 3301 2420 gene locus_tag LOCUS_4220 3301 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4220 4348 3338 gene locus_tag LOCUS_4230 4348 3338 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_4230 4520 4445 gene locus_tag LOCUS_t0120 4520 4445 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5210 4542 gene locus_tag LOCUS_4240 5210 4542 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_4240 7909 5255 gene locus_tag LOCUS_4250 7909 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4250 10252 8096 gene locus_tag LOCUS_4260 10252 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4260 10477 10316 gene locus_tag LOCUS_4270 10477 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4270 10914 10546 gene locus_tag LOCUS_4280 10914 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4280 >Feature sequence22 <1 686 gene locus_tag LOCUS_4290 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871103.1:cobalt-precorrin-4 C(11)-methyltransferase 1437 667 gene locus_tag LOCUS_4300 gene murI 1437 667 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD40 protein_id gnl|my_center|LOCUS_4300 1529 2188 gene locus_tag LOCUS_4310 1529 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_4310 2925 2215 gene locus_tag LOCUS_4320 2925 2215 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_4320 4401 2962 gene locus_tag LOCUS_4330 4401 2962 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_4330 5296 4454 gene locus_tag LOCUS_4340 gene nfo 5296 4454 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYJ7 protein_id gnl|my_center|LOCUS_4340 5392 6411 gene locus_tag LOCUS_4350 5392 6411 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_4350 6401 7522 gene locus_tag LOCUS_4360 6401 7522 CDS product DNA primase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762192.1 protein_id gnl|my_center|LOCUS_4360 7591 10440 gene locus_tag LOCUS_4370 7591 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4370 >Feature sequence23 412 1926 gene locus_tag LOCUS_4380 412 1926 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_4380 1955 2971 gene locus_tag LOCUS_4390 1955 2971 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_4390 3465 3190 gene locus_tag LOCUS_4400 3465 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4400 4827 3586 gene locus_tag LOCUS_4410 4827 3586 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496866.1 protein_id gnl|my_center|LOCUS_4410 4930 5865 gene locus_tag LOCUS_4420 4930 5865 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_4420 6254 5856 gene locus_tag LOCUS_4430 6254 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4430 6304 6963 gene locus_tag LOCUS_4440 6304 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_4440 7520 6954 gene locus_tag LOCUS_4450 7520 6954 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2B5 protein_id gnl|my_center|LOCUS_4450 8701 7517 gene locus_tag LOCUS_4460 8701 7517 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_4460 8718 9416 gene locus_tag LOCUS_4470 8718 9416 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_4470 >Feature sequence24 770 943 gene locus_tag LOCUS_4480 770 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 1397 933 gene locus_tag LOCUS_4490 1397 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4490 2162 1437 gene locus_tag LOCUS_4500 2162 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 2308 2637 gene locus_tag LOCUS_4510 2308 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4510 3249 2638 gene locus_tag LOCUS_4520 3249 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4520 3696 3403 gene locus_tag LOCUS_4530 3696 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4530 4686 3715 gene locus_tag LOCUS_4540 4686 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4540 4797 5243 gene locus_tag LOCUS_4550 4797 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4550 6583 5225 gene locus_tag LOCUS_4560 6583 5225 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_4560 7689 6850 gene locus_tag LOCUS_4570 7689 6850 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688306.1 protein_id gnl|my_center|LOCUS_4570 8020 8163 gene locus_tag LOCUS_4580 8020 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4580 8229 9170 gene locus_tag LOCUS_4590 gene tfb 8229 9170 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_4590 9345 9148 gene locus_tag LOCUS_4600 9345 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4600 <10604 9345 gene locus_tag LOCUS_4610 <10604 9345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846316.1:elongation factor EF-2 >Feature sequence25 1407 331 gene locus_tag LOCUS_4620 gene carA 1407 331 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ3 protein_id gnl|my_center|LOCUS_4620 2750 1545 gene locus_tag LOCUS_4630 2750 1545 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_4630 3217 2849 gene locus_tag LOCUS_4640 3217 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4640 3337 3795 gene locus_tag LOCUS_4650 3337 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546787.1 protein_id gnl|my_center|LOCUS_4650 4343 3792 gene locus_tag LOCUS_4660 4343 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4660 5343 4345 gene locus_tag LOCUS_4670 5343 4345 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_4670 5586 5395 gene locus_tag LOCUS_4680 5586 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4680 5705 6868 gene locus_tag LOCUS_4690 5705 6868 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_4690 7048 6872 gene locus_tag LOCUS_4700 7048 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4700 7155 7598 gene locus_tag LOCUS_4710 7155 7598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4710 8859 7582 gene locus_tag LOCUS_4720 8859 7582 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_4720 8937 9881 gene locus_tag LOCUS_4730 8937 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4730 >Feature sequence26 1148 324 gene locus_tag LOCUS_4740 gene purC 1148 324 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMH6 protein_id gnl|my_center|LOCUS_4740 1537 1157 gene locus_tag LOCUS_4750 1537 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4750 2196 1957 gene locus_tag LOCUS_4760 2196 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 3632 2196 gene locus_tag LOCUS_4770 gene purF 3632 2196 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_4770 5781 3625 gene locus_tag LOCUS_4780 5781 3625 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868861.1 protein_id gnl|my_center|LOCUS_4780 6461 5778 gene locus_tag LOCUS_4790 gene purQ 6461 5778 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPA5 protein_id gnl|my_center|LOCUS_4790 6536 6952 gene locus_tag LOCUS_4800 gene yhcV 6536 6952 CDS product CBS domain-containing protein YhcV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54606 protein_id gnl|my_center|LOCUS_4800 7209 6949 gene locus_tag LOCUS_4810 7209 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4810 8514 7270 gene locus_tag LOCUS_4820 8514 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 >Feature sequence27 <1 634 gene locus_tag LOCUS_4830 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065420.1:ABC transporter ATP-binding protein 631 1920 gene locus_tag LOCUS_4840 631 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 1936 2667 gene locus_tag LOCUS_4850 1936 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 3929 2679 gene locus_tag LOCUS_4860 3929 2679 CDS product glucose sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_4860 4409 4170 gene locus_tag LOCUS_4870 4409 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4870 4496 4774 gene locus_tag LOCUS_4880 4496 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 5202 4777 gene locus_tag LOCUS_4890 5202 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4890 5469 5227 gene locus_tag LOCUS_4900 5469 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4900 5527 5991 gene locus_tag LOCUS_4910 5527 5991 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_4910 6042 6410 gene locus_tag LOCUS_4920 6042 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 6412 6702 gene locus_tag LOCUS_4930 6412 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4930 6740 7678 gene locus_tag LOCUS_4940 6740 7678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4940 <9390 7883 gene locus_tag LOCUS_4950 <9390 7883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289376.1:membrane protein >Feature sequence28 246 91 gene locus_tag LOCUS_4960 246 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4960 730 302 gene locus_tag LOCUS_4970 730 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4970 866 1759 gene locus_tag LOCUS_4980 866 1759 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_4980 1792 2124 gene locus_tag LOCUS_4990 1792 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4990 2249 2743 gene locus_tag LOCUS_5000 2249 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 2876 3919 gene locus_tag LOCUS_5010 2876 3919 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_5010 4701 3916 gene locus_tag LOCUS_5020 4701 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5020 6146 4743 gene locus_tag LOCUS_5030 6146 4743 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_5030 6928 6182 gene locus_tag LOCUS_5040 6928 6182 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_5040 7283 6963 gene locus_tag LOCUS_5050 7283 6963 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_5050 7565 7293 gene locus_tag LOCUS_5060 7565 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 7541 8146 gene locus_tag LOCUS_5070 7541 8146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5070 8166 8318 gene locus_tag LOCUS_5080 8166 8318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 8324 8473 gene locus_tag LOCUS_5090 8324 8473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5090 8970 8476 gene locus_tag LOCUS_5100 8970 8476 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846895.1 protein_id gnl|my_center|LOCUS_5100 >Feature sequence29 319 1095 gene locus_tag LOCUS_5110 319 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869661.1 protein_id gnl|my_center|LOCUS_5110 1092 1391 gene locus_tag LOCUS_5120 1092 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5120 1843 1397 gene locus_tag LOCUS_5130 1843 1397 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_5130 2231 1833 gene locus_tag LOCUS_5140 2231 1833 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_5140 2366 3964 gene locus_tag LOCUS_5150 gene pckA2 2366 3964 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_5150 5952 3961 gene locus_tag LOCUS_5160 5952 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5160 6064 6684 gene locus_tag LOCUS_5170 gene sodA 6064 6684 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_5170 6747 7169 gene locus_tag LOCUS_5180 6747 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 >Feature sequence30 127 684 gene locus_tag LOCUS_5190 127 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 693 1013 gene locus_tag LOCUS_5200 693 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5200 1256 1014 gene locus_tag LOCUS_5210 1256 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5210 1327 2067 gene locus_tag LOCUS_5220 1327 2067 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967172.1 protein_id gnl|my_center|LOCUS_5220 2304 2071 gene locus_tag LOCUS_5230 2304 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5230 2339 2413 gene locus_tag LOCUS_t0130 2339 2413 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3169 2414 gene locus_tag LOCUS_5240 3169 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5240 4490 3144 gene locus_tag LOCUS_5250 4490 3144 CDS product CCA-adding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 protein_id gnl|my_center|LOCUS_5250 5019 4474 gene locus_tag LOCUS_5260 5019 4474 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_5260 5115 5633 gene locus_tag LOCUS_5270 5115 5633 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 protein_id gnl|my_center|LOCUS_5270 5633 6019 gene locus_tag LOCUS_5280 5633 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876072.1 protein_id gnl|my_center|LOCUS_5280 6108 6395 gene locus_tag LOCUS_5290 6108 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 7300 6398 gene locus_tag LOCUS_5300 gene rnz 7300 6398 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_5300 <8154 7311 gene locus_tag LOCUS_5310 <8154 7311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978942.1:ribose-phosphate pyrophosphokinase >Feature sequence31 431 610 gene locus_tag LOCUS_5320 431 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 614 757 gene locus_tag LOCUS_5330 614 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5330 822 1016 gene locus_tag LOCUS_5340 822 1016 CDS product putative cold shock protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701240.1 protein_id gnl|my_center|LOCUS_5340 1459 1103 gene locus_tag LOCUS_5350 1459 1103 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877947.1 protein_id gnl|my_center|LOCUS_5350 1571 2278 gene locus_tag LOCUS_5360 1571 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 2315 2764 gene locus_tag LOCUS_5370 2315 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 3225 2761 gene locus_tag LOCUS_5380 3225 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5380 3766 3260 gene locus_tag LOCUS_5390 gene ftnA 3766 3260 CDS product H-type ferritin FtnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949467.1 protein_id gnl|my_center|LOCUS_5390 3860 5413 gene locus_tag LOCUS_5400 3860 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5400 5447 5896 gene locus_tag LOCUS_5410 5447 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5410 5953 6516 gene locus_tag LOCUS_5420 5953 6516 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_5420 6938 6537 gene locus_tag LOCUS_5430 6938 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5430 7632 6970 gene locus_tag LOCUS_5440 7632 6970 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_5440 >Feature sequence32 663 496 gene locus_tag LOCUS_5450 663 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 1032 703 gene locus_tag LOCUS_5460 1032 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5460 1122 1430 gene locus_tag LOCUS_5470 1122 1430 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_5470 1417 2436 gene locus_tag LOCUS_5480 1417 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 3083 2448 gene locus_tag LOCUS_5490 3083 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5490 4005 3088 gene locus_tag LOCUS_5500 4005 3088 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_5500 4157 5392 gene locus_tag LOCUS_5510 4157 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 <7730 5709 gene locus_tag LOCUS_5520 <7730 5709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879109.1:amino acid transporter >Feature sequence33 112 882 gene locus_tag LOCUS_5530 112 882 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_5530 926 1396 gene locus_tag LOCUS_5540 926 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5540 2208 1393 gene locus_tag LOCUS_5550 gene pheA 2208 1393 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJB0 protein_id gnl|my_center|LOCUS_5550 2761 2201 gene locus_tag LOCUS_5560 2761 2201 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_5560 3796 2801 gene locus_tag LOCUS_5570 3796 2801 CDS product S-adenosyl-L-methionine--L-histidine 3-amino-3-carboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_5570 3841 5193 gene locus_tag LOCUS_5580 3841 5193 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879748.1 protein_id gnl|my_center|LOCUS_5580 5270 5195 gene locus_tag LOCUS_t0140 5270 5195 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5347 6447 gene locus_tag LOCUS_5590 5347 6447 CDS product glucose sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_5590 6449 7603 gene locus_tag LOCUS_5600 6449 7603 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_5600 >Feature sequence34 <1 959 gene locus_tag LOCUS_5610 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFL5:isoleucine--tRNA ligase 1035 1364 gene locus_tag LOCUS_5620 1035 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5620 1408 2514 gene locus_tag LOCUS_5630 gene sucC 1408 2514 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUY3 protein_id gnl|my_center|LOCUS_5630 2511 3425 gene locus_tag LOCUS_5640 2511 3425 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_5640 3425 4045 gene locus_tag LOCUS_5650 3425 4045 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_5650 6530 4038 gene locus_tag LOCUS_5660 6530 4038 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_5660 6590 7051 gene locus_tag LOCUS_5670 6590 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5670 >Feature sequence35 103 1449 gene locus_tag LOCUS_5680 103 1449 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_5680 1483 1869 gene locus_tag LOCUS_5690 1483 1869 CDS product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_5690 1866 2084 gene locus_tag LOCUS_5700 1866 2084 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762341.1 protein_id gnl|my_center|LOCUS_5700 2093 2296 gene locus_tag LOCUS_5710 2093 2296 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_5710 2298 2699 gene locus_tag LOCUS_5720 2298 2699 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_5720 2706 4487 gene locus_tag LOCUS_5730 2706 4487 CDS product translation initiation factor aIF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_5730 4891 4490 gene locus_tag LOCUS_5740 4891 4490 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846726.1 protein_id gnl|my_center|LOCUS_5740 5337 4924 gene locus_tag LOCUS_5750 5337 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5750 5420 6694 gene locus_tag LOCUS_5760 5420 6694 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763349.1 protein_id gnl|my_center|LOCUS_5760 7349 6684 gene locus_tag LOCUS_5770 7349 6684 CDS product translation initiation factor 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877219.1 protein_id gnl|my_center|LOCUS_5770 >Feature sequence36 826 257 gene locus_tag LOCUS_5780 826 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250983.1 protein_id gnl|my_center|LOCUS_5780 984 1478 gene locus_tag LOCUS_5790 984 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5790 1528 2736 gene locus_tag LOCUS_5800 1528 2736 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_5800 2736 3356 gene locus_tag LOCUS_5810 2736 3356 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_5810 4368 3397 gene locus_tag LOCUS_5820 4368 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 6860 4395 gene locus_tag LOCUS_5830 6860 4395 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_5830 6932 7393 gene locus_tag LOCUS_5840 6932 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 >Feature sequence37 917 93 gene locus_tag LOCUS_5850 917 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 1547 939 gene locus_tag LOCUS_5860 1547 939 CDS product AMMECR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_5860 1602 2660 gene locus_tag LOCUS_5870 1602 2660 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_5870 2878 3060 gene locus_tag LOCUS_5880 2878 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5880 3259 3065 gene locus_tag LOCUS_5890 3259 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5890 3540 3322 gene locus_tag LOCUS_5900 3540 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5900 3582 4271 gene locus_tag LOCUS_5910 3582 4271 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_5910 4309 5127 gene locus_tag LOCUS_5920 4309 5127 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865197.1 protein_id gnl|my_center|LOCUS_5920 5117 5983 gene locus_tag LOCUS_5930 5117 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5930 5980 7356 gene locus_tag LOCUS_5940 5980 7356 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_5940 >Feature sequence38 1015 554 gene locus_tag LOCUS_5950 1015 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5950 2576 1341 gene locus_tag LOCUS_5960 2576 1341 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_5960 3105 3503 gene locus_tag LOCUS_5970 3105 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 3983 3786 gene locus_tag LOCUS_5980 3983 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5980 4193 4035 gene locus_tag LOCUS_5990 4193 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5990 4909 4316 gene locus_tag LOCUS_6000 4909 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6000 5469 5056 gene locus_tag LOCUS_6010 5469 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6010 5484 6224 gene locus_tag LOCUS_6020 5484 6224 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_6020 >Feature sequence39 438 1001 gene locus_tag LOCUS_6030 438 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_6030 2286 985 gene locus_tag LOCUS_6040 2286 985 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_6040 2388 3398 gene locus_tag LOCUS_6050 2388 3398 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_6050 3439 3885 gene locus_tag LOCUS_6060 3439 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6060 5973 3886 gene locus_tag LOCUS_6070 5973 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6070 6148 6612 gene locus_tag LOCUS_6080 6148 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6080 >Feature sequence40 136 1272 gene locus_tag LOCUS_6090 136 1272 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_6090 1329 1757 gene locus_tag LOCUS_6100 1329 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6100 1802 3550 gene locus_tag LOCUS_6110 1802 3550 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_6110 3612 4262 gene locus_tag LOCUS_6120 3612 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 4263 4799 gene locus_tag LOCUS_6130 4263 4799 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_6130 5302 4796 gene locus_tag LOCUS_6140 5302 4796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6140 5541 5305 gene locus_tag LOCUS_6150 5541 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6150 >Feature sequence41 411 1181 gene locus_tag LOCUS_6160 gene yrhO 411 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05405 protein_id gnl|my_center|LOCUS_6160 1245 1706 gene locus_tag LOCUS_6170 1245 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 1679 1912 gene locus_tag LOCUS_6180 1679 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6180 2103 2513 gene locus_tag LOCUS_6190 2103 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6190 2552 3604 gene locus_tag LOCUS_6200 2552 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6200 3912 3601 gene locus_tag LOCUS_6210 3912 3601 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 protein_id gnl|my_center|LOCUS_6210 3863 5158 gene locus_tag LOCUS_6220 3863 5158 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867359.1 protein_id gnl|my_center|LOCUS_6220 5196 6125 gene locus_tag LOCUS_6230 5196 6125 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 protein_id gnl|my_center|LOCUS_6230 >Feature sequence42 499 1302 gene locus_tag LOCUS_6240 499 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6240 3587 1299 gene locus_tag LOCUS_6250 3587 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6250 3693 5681 gene locus_tag LOCUS_6260 3693 5681 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368420.1 protein_id gnl|my_center|LOCUS_6260 >Feature sequence43 1535 75 gene locus_tag LOCUS_6270 1535 75 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 protein_id gnl|my_center|LOCUS_6270 2132 1704 gene locus_tag LOCUS_6280 2132 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6280 2779 2144 gene locus_tag LOCUS_6290 2779 2144 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_6290 4082 2820 gene locus_tag LOCUS_6300 4082 2820 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_6300 4324 4082 gene locus_tag LOCUS_6310 4324 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6310 5708 4287 gene locus_tag LOCUS_6320 5708 4287 CDS product recombinase RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_6320 6157 5708 gene locus_tag LOCUS_6330 6157 5708 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_6330 >Feature sequence44 <1 1200 gene locus_tag LOCUS_6340 <1 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002438995.1:Fe-S cluster assembly protein SufD 1206 2450 gene locus_tag LOCUS_6350 1206 2450 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4M4 protein_id gnl|my_center|LOCUS_6350 2447 2896 gene locus_tag LOCUS_6360 2447 2896 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_6360 2893 3225 gene locus_tag LOCUS_6370 2893 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6370 4426 3215 gene locus_tag LOCUS_6380 4426 3215 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_6380 4554 5216 gene locus_tag LOCUS_6390 4554 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6390 5519 5202 gene locus_tag LOCUS_6400 5519 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6400 >Feature sequence45 144 1406 gene locus_tag LOCUS_6410 144 1406 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023597.1 protein_id gnl|my_center|LOCUS_6410 1399 1767 gene locus_tag LOCUS_6420 1399 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 1802 2233 gene locus_tag LOCUS_6430 1802 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875912.1 protein_id gnl|my_center|LOCUS_6430 2392 2237 gene locus_tag LOCUS_6440 2392 2237 CDS product ribosome biogenesis protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978934.1 protein_id gnl|my_center|LOCUS_6440 3198 2395 gene locus_tag LOCUS_6450 3198 2395 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_6450 3771 3238 gene locus_tag LOCUS_6460 gene cobA 3771 3238 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_6460 3852 5189 gene locus_tag LOCUS_6470 gene cobB 3852 5189 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T2 protein_id gnl|my_center|LOCUS_6470 5818 5186 gene locus_tag LOCUS_6480 gene cbiC 5818 5186 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP7 protein_id gnl|my_center|LOCUS_6480 >Feature sequence46 328 65 gene locus_tag LOCUS_6490 328 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6490 474 389 gene locus_tag LOCUS_t0150 474 389 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 551 715 gene locus_tag LOCUS_6500 551 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 1806 721 gene locus_tag LOCUS_6510 gene dnaJ 1806 721 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182E7 protein_id gnl|my_center|LOCUS_6510 3730 1832 gene locus_tag LOCUS_6520 gene dnaK 3730 1832 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_6520 4290 3742 gene locus_tag LOCUS_6530 4290 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6530 5442 4312 gene locus_tag LOCUS_6540 5442 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6540 5598 5669 gene locus_tag LOCUS_t0160 5598 5669 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence47 160 684 gene locus_tag LOCUS_6550 160 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6550 1593 1270 gene locus_tag LOCUS_6560 1593 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 2816 1596 gene locus_tag LOCUS_6570 2816 1596 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_6570 3195 2848 gene locus_tag LOCUS_6580 3195 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6580 3177 3539 gene locus_tag LOCUS_6590 3177 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6590 3768 3541 gene locus_tag LOCUS_6600 3768 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 4214 3795 gene locus_tag LOCUS_6610 4214 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6610 5077 4481 gene locus_tag LOCUS_6620 5077 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6620 5150 5686 gene locus_tag LOCUS_6630 5150 5686 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_6630 >Feature sequence48 1680 730 gene locus_tag LOCUS_6640 1680 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6640 2413 1673 gene locus_tag LOCUS_6650 2413 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6650 2508 3965 gene locus_tag LOCUS_6660 2508 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6660 3962 4519 gene locus_tag LOCUS_6670 3962 4519 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_6670 5019 4516 gene locus_tag LOCUS_6680 5019 4516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6680 >Feature sequence49 183 1592 gene locus_tag LOCUS_6690 gene leuC 183 1592 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA7 protein_id gnl|my_center|LOCUS_6690 1596 2183 gene locus_tag LOCUS_6700 gene leuD 1596 2183 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA6 protein_id gnl|my_center|LOCUS_6700 2649 2200 gene locus_tag LOCUS_6710 2649 2200 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_6710 3113 2646 gene locus_tag LOCUS_6720 3113 2646 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_6720 3453 3106 gene locus_tag LOCUS_6730 3453 3106 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_6730 4098 3496 gene locus_tag LOCUS_6740 4098 3496 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869687.1 protein_id gnl|my_center|LOCUS_6740 4182 4871 gene locus_tag LOCUS_6750 4182 4871 CDS product rRNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_6750 4868 5548 gene locus_tag LOCUS_6760 4868 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 >Feature sequence50 275 1195 gene locus_tag LOCUS_6770 gene argF 275 1195 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18186 protein_id gnl|my_center|LOCUS_6770 1230 1718 gene locus_tag LOCUS_6780 1230 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6780 1715 2383 gene locus_tag LOCUS_6790 1715 2383 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_6790 2380 2856 gene locus_tag LOCUS_6800 2380 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 2858 3358 gene locus_tag LOCUS_6810 2858 3358 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_6810 3351 4781 gene locus_tag LOCUS_6820 3351 4781 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_6820 4759 5346 gene locus_tag LOCUS_6830 4759 5346 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_6830 >Feature sequence51 207 818 gene locus_tag LOCUS_6840 207 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6840 853 1266 gene locus_tag LOCUS_6850 853 1266 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762335.1 protein_id gnl|my_center|LOCUS_6850 1343 2044 gene locus_tag LOCUS_6860 1343 2044 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_6860 2034 3359 gene locus_tag LOCUS_6870 2034 3359 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_6870 3388 4575 gene locus_tag LOCUS_6880 3388 4575 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878649.1 protein_id gnl|my_center|LOCUS_6880 4607 5311 gene locus_tag LOCUS_6890 4607 5311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 5490 5308 gene locus_tag LOCUS_6900 5490 5308 CDS product 30S ribosomal protein S27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869892.1 protein_id gnl|my_center|LOCUS_6900 >Feature sequence52 19 1056 gene locus_tag LOCUS_6910 19 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 1096 1569 gene locus_tag LOCUS_6920 1096 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6920 2258 1566 gene locus_tag LOCUS_6930 2258 1566 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020596.1 protein_id gnl|my_center|LOCUS_6930 3406 2264 gene locus_tag LOCUS_6940 3406 2264 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_6940 3869 3519 gene locus_tag LOCUS_6950 gene sufA 3869 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32113 protein_id gnl|my_center|LOCUS_6950 4719 3958 gene locus_tag LOCUS_6960 gene crt2 4719 3958 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_6960 5384 4797 gene locus_tag LOCUS_6970 5384 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 >Feature sequence53 <1 774 gene locus_tag LOCUS_6980 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879898.1:LLM class flavin-dependent oxidoreductase 799 1431 gene locus_tag LOCUS_6990 799 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 1476 2225 gene locus_tag LOCUS_7000 1476 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7000 2578 2252 gene locus_tag LOCUS_7010 2578 2252 CDS product pyrimidine dimer DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065892.1 protein_id gnl|my_center|LOCUS_7010 3562 2588 gene locus_tag LOCUS_7020 3562 2588 CDS product mRNA 3-end processing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762724.1 protein_id gnl|my_center|LOCUS_7020 3698 4279 gene locus_tag LOCUS_7030 gene purN 3698 4279 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CB5 protein_id gnl|my_center|LOCUS_7030 4594 4280 gene locus_tag LOCUS_7040 4594 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 4669 5538 gene locus_tag LOCUS_7050 gene folD 4669 5538 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJV1 protein_id gnl|my_center|LOCUS_7050 >Feature sequence54 391 1785 gene locus_tag LOCUS_7060 391 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7060 4541 1782 gene locus_tag LOCUS_7070 4541 1782 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_7070 5232 4576 gene locus_tag LOCUS_7080 5232 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 >Feature sequence55 889 308 gene locus_tag LOCUS_7090 889 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7090 1315 938 gene locus_tag LOCUS_7100 1315 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 1345 1905 gene locus_tag LOCUS_7110 1345 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7110 2898 2251 gene locus_tag LOCUS_7120 2898 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7120 3401 2949 gene locus_tag LOCUS_7130 3401 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7130 4456 3410 gene locus_tag LOCUS_7140 4456 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7140 5179 4514 gene locus_tag LOCUS_7150 5179 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7150 >Feature sequence56 942 85 gene locus_tag LOCUS_7160 gene bcpA 942 85 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_7160 1479 979 gene locus_tag LOCUS_7170 1479 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7170 1576 3288 gene locus_tag LOCUS_7180 1576 3288 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_7180 3288 3728 gene locus_tag LOCUS_7190 3288 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7190 3728 4078 gene locus_tag LOCUS_7200 3728 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7200 4078 4854 gene locus_tag LOCUS_7210 4078 4854 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_7210 5207 4851 gene locus_tag LOCUS_7220 5207 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_7220 >Feature sequence57 2274 595 gene locus_tag LOCUS_7230 2274 595 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980252.1 protein_id gnl|my_center|LOCUS_7230 2875 2276 gene locus_tag LOCUS_7240 2875 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 3027 4301 gene locus_tag LOCUS_7250 3027 4301 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870340.1 protein_id gnl|my_center|LOCUS_7250 4708 4304 gene locus_tag LOCUS_7260 4708 4304 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_7260 >Feature sequence58 165 241 gene locus_tag LOCUS_t0170 165 241 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 562 1002 gene locus_tag LOCUS_7270 562 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7270 1706 1005 gene locus_tag LOCUS_7280 1706 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7280 1863 1663 gene locus_tag LOCUS_7290 1863 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7290 3463 1871 gene locus_tag LOCUS_7300 gene lysS 3463 1871 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDF8 protein_id gnl|my_center|LOCUS_7300 5046 3460 gene locus_tag LOCUS_7310 5046 3460 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_7310 >Feature sequence59 307 1077 gene locus_tag LOCUS_7320 gene yrhO 307 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05405 protein_id gnl|my_center|LOCUS_7320 1137 1598 gene locus_tag LOCUS_7330 1137 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7330 1640 1804 gene locus_tag LOCUS_7340 1640 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 2227 1805 gene locus_tag LOCUS_7350 2227 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081009.1 protein_id gnl|my_center|LOCUS_7350 2382 2807 gene locus_tag LOCUS_7360 2382 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7360 2846 3898 gene locus_tag LOCUS_7370 2846 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7370 4206 3895 gene locus_tag LOCUS_7380 4206 3895 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868105.1 protein_id gnl|my_center|LOCUS_7380 >Feature sequence60 183 494 gene locus_tag LOCUS_7390 183 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7390 907 491 gene locus_tag LOCUS_7400 907 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7400 1014 1964 gene locus_tag LOCUS_7410 1014 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7410 3250 2147 gene locus_tag LOCUS_7420 3250 2147 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_7420 4189 3293 gene locus_tag LOCUS_7430 gene menA 4189 3293 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BK6 protein_id gnl|my_center|LOCUS_7430 4639 4238 gene locus_tag LOCUS_7440 4639 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_7440 >Feature sequence61 144 560 gene locus_tag LOCUS_7450 144 560 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_7450 609 848 gene locus_tag LOCUS_7460 609 848 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_7460 860 1426 gene locus_tag LOCUS_7470 860 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7470 2119 1487 gene locus_tag LOCUS_7480 2119 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7480 2267 4549 gene locus_tag LOCUS_7490 gene acn 2267 4549 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_7490 >Feature sequence62 <1 2474 gene locus_tag LOCUS_7500 <1 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64SZ4:carbamoyl-phosphate synthase (glutamine-hydrolyzing) 3220 2471 gene locus_tag LOCUS_7510 3220 2471 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_7510 3254 3556 gene locus_tag LOCUS_7520 3254 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7520 3856 3557 gene locus_tag LOCUS_7530 3856 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7530 >Feature sequence63 1550 279 gene locus_tag LOCUS_7540 gene leuC 1550 279 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67078 protein_id gnl|my_center|LOCUS_7540 1623 2396 gene locus_tag LOCUS_7550 1623 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7550 2432 2983 gene locus_tag LOCUS_7560 2432 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 3008 3556 gene locus_tag LOCUS_7570 3008 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 3983 3549 gene locus_tag LOCUS_7580 3983 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7580 >Feature sequence64 322 1611 gene locus_tag LOCUS_7590 322 1611 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979283.1 protein_id gnl|my_center|LOCUS_7590 1622 3511 gene locus_tag LOCUS_7600 1622 3511 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_7600 3819 3556 gene locus_tag LOCUS_7610 3819 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610 3965 3879 gene locus_tag LOCUS_t0180 3965 3879 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4041 4205 gene locus_tag LOCUS_7620 4041 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7620 >Feature sequence65 <1 561 gene locus_tag LOCUS_7630 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766012.1:dehydrogenase 577 1173 gene locus_tag LOCUS_7640 577 1173 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_7640 1178 1666 gene locus_tag LOCUS_7650 1178 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7650 1694 3025 gene locus_tag LOCUS_7660 gene rfbH 1694 3025 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_7660 3101 3988 gene locus_tag LOCUS_7670 3101 3988 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_7670 >Feature sequence66 3 467 gene locus_tag LOCUS_7680 3 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7680 1921 485 gene locus_tag LOCUS_7690 1921 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 2018 2974 gene locus_tag LOCUS_7700 2018 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7700 3045 4169 gene locus_tag LOCUS_7710 3045 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 >Feature sequence67 549 1139 gene locus_tag LOCUS_7720 549 1139 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_7720 2272 1136 gene locus_tag LOCUS_7730 2272 1136 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_7730 2337 2963 gene locus_tag LOCUS_7740 2337 2963 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_7740 3629 2955 gene locus_tag LOCUS_7750 3629 2955 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867184.1 protein_id gnl|my_center|LOCUS_7750 >Feature sequence68 36 848 gene locus_tag LOCUS_7760 36 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 949 2346 gene locus_tag LOCUS_7770 949 2346 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_7770 2347 2889 gene locus_tag LOCUS_7780 2347 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7780 3564 2869 gene locus_tag LOCUS_7790 gene bioD 3564 2869 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS9 protein_id gnl|my_center|LOCUS_7790 <4250 3561 gene locus_tag LOCUS_7800 <4250 3561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496781.1:adenosylmethionine--8-amino-7-oxononanoate transaminase >Feature sequence69 916 428 gene locus_tag LOCUS_7810 916 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7810 1003 1659 gene locus_tag LOCUS_7820 1003 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7820 2151 1660 gene locus_tag LOCUS_7830 2151 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 2609 2151 gene locus_tag LOCUS_7840 2609 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7840 2703 3347 gene locus_tag LOCUS_7850 2703 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7850 4093 3362 gene locus_tag LOCUS_7860 4093 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7860 >Feature sequence70 1449 601 gene locus_tag LOCUS_7870 1449 601 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_7870 1483 2223 gene locus_tag LOCUS_7880 1483 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871158.1 protein_id gnl|my_center|LOCUS_7880 2260 2829 gene locus_tag LOCUS_7890 2260 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7890 >Feature sequence71 147 596 gene locus_tag LOCUS_7900 147 596 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_7900 593 931 gene locus_tag LOCUS_7910 593 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7910 2132 921 gene locus_tag LOCUS_7920 2132 921 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_7920 2262 2924 gene locus_tag LOCUS_7930 2262 2924 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_7930 3236 2910 gene locus_tag LOCUS_7940 3236 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 >Feature sequence72 685 422 gene locus_tag LOCUS_7950 685 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7950 1360 743 gene locus_tag LOCUS_7960 1360 743 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439458.1 protein_id gnl|my_center|LOCUS_7960 1422 2093 gene locus_tag LOCUS_7970 1422 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_7970 2117 2353 gene locus_tag LOCUS_7980 2117 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980 2337 2738 gene locus_tag LOCUS_7990 2337 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7990 3907 2735 gene locus_tag LOCUS_8000 3907 2735 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_8000 3950 4024 gene locus_tag LOCUS_t0190 3950 4024 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence73 1243 380 gene locus_tag LOCUS_8010 1243 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8010 1323 2528 gene locus_tag LOCUS_8020 1323 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8020 >Feature sequence74 1602 91 gene locus_tag LOCUS_8030 1602 91 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_8030 2187 1636 gene locus_tag LOCUS_8040 2187 1636 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249293.1 protein_id gnl|my_center|LOCUS_8040 2259 3452 gene locus_tag LOCUS_8050 gene ychF 2259 3452 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_8050 >Feature sequence75 3479 1119 gene locus_tag LOCUS_8060 3479 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8060 >Feature sequence76 1434 199 gene locus_tag LOCUS_8070 1434 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 1802 3124 gene locus_tag LOCUS_8080 1802 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8080 3125 3547 gene locus_tag LOCUS_8090 3125 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8090 3623 3550 gene locus_tag LOCUS_t0200 3623 3550 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence77 964 404 gene locus_tag LOCUS_8100 964 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8100 1274 1570 gene locus_tag LOCUS_8110 1274 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8110 1602 2636 gene locus_tag LOCUS_8120 1602 2636 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_8120 >Feature sequence78 1240 788 gene locus_tag LOCUS_8130 1240 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8130 1289 2098 gene locus_tag LOCUS_8140 gene nueM 1289 2098 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880030.1 protein_id gnl|my_center|LOCUS_8140 3252 2095 gene locus_tag LOCUS_8150 gene metK 3252 2095 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_8150 >Feature sequence79 89 3 gene locus_tag LOCUS_t0210 89 3 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 173 1447 gene locus_tag LOCUS_8160 173 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8160 1968 1453 gene locus_tag LOCUS_8170 1968 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8170 2707 1961 gene locus_tag LOCUS_8180 2707 1961 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021690.1 protein_id gnl|my_center|LOCUS_8180 3186 2749 gene locus_tag LOCUS_8190 3186 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8190 >Feature sequence80 907 1362 gene locus_tag LOCUS_8200 907 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8200 1662 1381 gene locus_tag LOCUS_8210 1662 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8210 2060 1683 gene locus_tag LOCUS_8220 2060 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8220 2250 2555 gene locus_tag LOCUS_8230 gene ndoA 2250 2555 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117586.1 protein_id gnl|my_center|LOCUS_8230 >Feature sequence81 857 441 gene locus_tag LOCUS_8240 857 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 1334 909 gene locus_tag LOCUS_8250 1334 909 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002290819.1 protein_id gnl|my_center|LOCUS_8250 1728 1351 gene locus_tag LOCUS_8260 1728 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8260 2059 1721 gene locus_tag LOCUS_8270 2059 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8270 2838 2119 gene locus_tag LOCUS_8280 2838 2119 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_8280 >Feature sequence82 <1 907 gene locus_tag LOCUS_8290 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P0A1A6:branched-chain-amino-acid aminotransferase 909 1379 gene locus_tag LOCUS_8300 909 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8300 1376 1645 gene locus_tag LOCUS_8310 1376 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_8310 2585 1647 gene locus_tag LOCUS_8320 2585 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8320 >Feature sequence83 2458 1097 gene locus_tag LOCUS_8330 gene aspA 2458 1097 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIP0 protein_id gnl|my_center|LOCUS_8330 >Feature sequence84 587 258 gene locus_tag LOCUS_8340 587 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8340 1112 651 gene locus_tag LOCUS_8350 1112 651 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_8350 2221 1142 gene locus_tag LOCUS_8360 2221 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8360 2425 2303 gene locus_tag LOCUS_8370 2425 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8370 2581 2505 gene locus_tag LOCUS_t0220 2581 2505 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence85 2312 1515 gene locus_tag LOCUS_8380 2312 1515 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_8380 >Feature sequence86 <1 656 gene locus_tag LOCUS_8390 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250232.1:endonuclease 977 822 gene locus_tag LOCUS_8400 977 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8400 <2206 1000 gene locus_tag LOCUS_8410 <2206 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762026.1:acetyl-coenzyme A synthetase >Feature sequence87 1295 327 gene locus_tag LOCUS_8420 1295 327 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_8420 1853 1320 gene locus_tag LOCUS_8430 1853 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8430 >Feature sequence88 >Feature sequence89 >Feature sequence90 1024 434 gene locus_tag LOCUS_8440 1024 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8440 >Feature sequence91 1526 135 gene locus_tag LOCUS_8450 1526 135 CDS product nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339547.1 protein_id gnl|my_center|LOCUS_8450 >Feature sequence92 1543 128 gene locus_tag LOCUS_8460 1543 128 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876437.1 protein_id gnl|my_center|LOCUS_8460