>Feature sequence01 2215 209 gene locus_tag LOCUS_00010 2215 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2610 2449 gene locus_tag LOCUS_00020 2610 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3046 2681 gene locus_tag LOCUS_00030 3046 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4204 3050 gene locus_tag LOCUS_00040 4204 3050 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_00040 4207 4374 gene locus_tag LOCUS_00050 4207 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4352 4723 gene locus_tag LOCUS_00060 4352 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5522 4728 gene locus_tag LOCUS_00070 5522 4728 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_00070 5734 5558 gene locus_tag LOCUS_00080 5734 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 6537 5776 gene locus_tag LOCUS_00090 6537 5776 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_00090 7007 6585 gene locus_tag LOCUS_00100 gene uspA 7007 6585 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277008.1 protein_id gnl|my_center|LOCUS_00100 7406 7017 gene locus_tag LOCUS_00110 7406 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 7503 8804 gene locus_tag LOCUS_00120 7503 8804 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066482.1 protein_id gnl|my_center|LOCUS_00120 8849 9799 gene locus_tag LOCUS_00130 gene tfb 8849 9799 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_00130 9874 10707 gene locus_tag LOCUS_00140 9874 10707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_00140 10768 11247 gene locus_tag LOCUS_00150 10768 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11532 11260 gene locus_tag LOCUS_00160 11532 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12056 11592 gene locus_tag LOCUS_00170 12056 11592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 12159 12482 gene locus_tag LOCUS_00180 gene glnB 12159 12482 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_00180 12556 12984 gene locus_tag LOCUS_00190 gene yxiE 12556 12984 CDS product universal stress protein YxiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42297 protein_id gnl|my_center|LOCUS_00190 13037 13477 gene locus_tag LOCUS_00200 13037 13477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 13924 13484 gene locus_tag LOCUS_00210 13924 13484 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_00210 14359 13931 gene locus_tag LOCUS_00220 gene yxiE 14359 13931 CDS product universal stress protein YxiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42297 protein_id gnl|my_center|LOCUS_00220 14501 14932 gene locus_tag LOCUS_00230 14501 14932 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KH28 protein_id gnl|my_center|LOCUS_00230 15840 14929 gene locus_tag LOCUS_00240 15840 14929 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876847.1 protein_id gnl|my_center|LOCUS_00240 15905 17071 gene locus_tag LOCUS_00250 15905 17071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 17068 17799 gene locus_tag LOCUS_00260 17068 17799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 17805 18197 gene locus_tag LOCUS_00270 17805 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18470 18198 gene locus_tag LOCUS_00280 18470 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 18600 19073 gene locus_tag LOCUS_00290 18600 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 19841 19257 gene locus_tag LOCUS_00300 19841 19257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 20416 19874 gene locus_tag LOCUS_00310 20416 19874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 21789 20482 gene locus_tag LOCUS_00320 21789 20482 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM12 protein_id gnl|my_center|LOCUS_00320 21891 22220 gene locus_tag LOCUS_00330 gene glnB-1 21891 22220 CDS product nitrogen regulatory protein P-II 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_00330 23030 22458 gene locus_tag LOCUS_00340 23030 22458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 23713 23096 gene locus_tag LOCUS_00350 23713 23096 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393986.1 protein_id gnl|my_center|LOCUS_00350 24138 23710 gene locus_tag LOCUS_00360 24138 23710 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846975.1 protein_id gnl|my_center|LOCUS_00360 25047 24199 gene locus_tag LOCUS_00370 25047 24199 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876847.1 protein_id gnl|my_center|LOCUS_00370 25469 25131 gene locus_tag LOCUS_00380 25469 25131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 25586 26482 gene locus_tag LOCUS_00390 gene mdh 25586 26482 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDF3 protein_id gnl|my_center|LOCUS_00390 26567 26992 gene locus_tag LOCUS_00400 26567 26992 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846975.1 protein_id gnl|my_center|LOCUS_00400 27006 27476 gene locus_tag LOCUS_00410 27006 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 27541 28071 gene locus_tag LOCUS_00420 27541 28071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 28118 29872 gene locus_tag LOCUS_00430 28118 29872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 30196 29873 gene locus_tag LOCUS_00440 30196 29873 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461711.1 protein_id gnl|my_center|LOCUS_00440 30381 31343 gene locus_tag LOCUS_00450 30381 31343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 31348 31746 gene locus_tag LOCUS_00460 31348 31746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 32097 31747 gene locus_tag LOCUS_00470 gene cheY 32097 31747 CDS product chemotaxis protein CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56312 protein_id gnl|my_center|LOCUS_00470 32379 32173 gene locus_tag LOCUS_00480 32379 32173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 34040 32394 gene locus_tag LOCUS_00490 34040 32394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 34186 34986 gene locus_tag LOCUS_00500 34186 34986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 35049 35936 gene locus_tag LOCUS_00510 35049 35936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 36577 35951 gene locus_tag LOCUS_00520 36577 35951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 36697 39465 gene locus_tag LOCUS_00530 36697 39465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 40815 39457 gene locus_tag LOCUS_00540 40815 39457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 41413 40817 gene locus_tag LOCUS_00550 41413 40817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 43415 41565 gene locus_tag LOCUS_00560 43415 41565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 44020 43640 gene locus_tag LOCUS_00570 gene cheY 44020 43640 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965516.1 protein_id gnl|my_center|LOCUS_00570 44986 44153 gene locus_tag LOCUS_00580 44986 44153 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868674.1 protein_id gnl|my_center|LOCUS_00580 45684 44980 gene locus_tag LOCUS_00590 45684 44980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 47242 45695 gene locus_tag LOCUS_00600 gene cheA44H 47242 45695 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943817.1 protein_id gnl|my_center|LOCUS_00600 48293 47229 gene locus_tag LOCUS_00610 48293 47229 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_00610 49195 48479 gene locus_tag LOCUS_00620 49195 48479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 50481 49192 gene locus_tag LOCUS_00630 50481 49192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 51714 50647 gene locus_tag LOCUS_00640 51714 50647 CDS product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387843.1 protein_id gnl|my_center|LOCUS_00640 52932 51799 gene locus_tag LOCUS_00650 52932 51799 CDS product chemotaxis sensory transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087148.1 protein_id gnl|my_center|LOCUS_00650 54500 53004 gene locus_tag LOCUS_00660 54500 53004 CDS product flagellar assembly protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_00660 56173 54500 gene locus_tag LOCUS_00670 56173 54500 CDS product flagellar protein FlaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980611.1 protein_id gnl|my_center|LOCUS_00670 56907 56206 gene locus_tag LOCUS_00680 56907 56206 CDS product flagellar accessory protein FlaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064668.1 protein_id gnl|my_center|LOCUS_00680 57108 58241 gene locus_tag LOCUS_00690 57108 58241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 58766 58251 gene locus_tag LOCUS_00700 58766 58251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 59264 58791 gene locus_tag LOCUS_00710 59264 58791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023018.1 protein_id gnl|my_center|LOCUS_00710 60563 59265 gene locus_tag LOCUS_00720 60563 59265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 >Feature sequence02 2300 213 gene locus_tag LOCUS_00730 2300 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3435 2293 gene locus_tag LOCUS_00740 3435 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 4969 3437 gene locus_tag LOCUS_00750 4969 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980185.1 protein_id gnl|my_center|LOCUS_00750 5805 4966 gene locus_tag LOCUS_00760 5805 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5905 6723 gene locus_tag LOCUS_00770 gene nadX 5905 6723 CDS product L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_00770 6815 7753 gene locus_tag LOCUS_00780 6815 7753 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA69 protein_id gnl|my_center|LOCUS_00780 7784 8185 gene locus_tag LOCUS_00790 7784 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 9006 8182 gene locus_tag LOCUS_00800 gene nadC 9006 8182 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_00800 9196 9008 gene locus_tag LOCUS_00810 9196 9008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 9812 9198 gene locus_tag LOCUS_00820 9812 9198 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_00820 9959 11128 gene locus_tag LOCUS_00830 9959 11128 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_00830 11140 11637 gene locus_tag LOCUS_00840 11140 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_00840 11775 12137 gene locus_tag LOCUS_00850 11775 12137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 12199 14238 gene locus_tag LOCUS_00860 gene hppA 12199 14238 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_00860 14420 14235 gene locus_tag LOCUS_00870 14420 14235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 14732 14475 gene locus_tag LOCUS_00880 14732 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14783 15172 gene locus_tag LOCUS_00890 14783 15172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064546.1 protein_id gnl|my_center|LOCUS_00890 15567 15160 gene locus_tag LOCUS_00900 15567 15160 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249984.1 protein_id gnl|my_center|LOCUS_00900 16655 15570 gene locus_tag LOCUS_00910 16655 15570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 16755 17627 gene locus_tag LOCUS_00920 gene ctaB 16755 17627 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIL7 protein_id gnl|my_center|LOCUS_00920 17923 17624 gene locus_tag LOCUS_00930 17923 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 20096 17925 gene locus_tag LOCUS_00940 20096 17925 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846861.1 protein_id gnl|my_center|LOCUS_00940 20386 20105 gene locus_tag LOCUS_00950 20386 20105 CDS product effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_00950 21756 20617 gene locus_tag LOCUS_00960 21756 20617 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_00960 22246 21839 gene locus_tag LOCUS_00970 22246 21839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 22385 22738 gene locus_tag LOCUS_00980 22385 22738 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_00980 22791 24389 gene locus_tag LOCUS_00990 22791 24389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 24435 25631 gene locus_tag LOCUS_01000 24435 25631 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762266.1 protein_id gnl|my_center|LOCUS_01000 25873 26103 gene locus_tag LOCUS_01010 25873 26103 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251002.1 protein_id gnl|my_center|LOCUS_01010 26299 26093 gene locus_tag LOCUS_01020 26299 26093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 26401 27090 gene locus_tag LOCUS_01030 26401 27090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 27341 27087 gene locus_tag LOCUS_01040 27341 27087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 27498 27755 gene locus_tag LOCUS_01050 27498 27755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 28125 27892 gene locus_tag LOCUS_01060 28125 27892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 29390 28353 gene locus_tag LOCUS_01070 gene adhA 29390 28353 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_01070 29389 29691 gene locus_tag LOCUS_01080 29389 29691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 29727 31757 gene locus_tag LOCUS_01090 29727 31757 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_01090 32074 31754 gene locus_tag LOCUS_01100 32074 31754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 32579 32268 gene locus_tag LOCUS_01110 32579 32268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 32656 33402 gene locus_tag LOCUS_01120 32656 33402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 33429 33884 gene locus_tag LOCUS_01130 33429 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 34596 33847 gene locus_tag LOCUS_01140 34596 33847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 35123 34629 gene locus_tag LOCUS_01150 35123 34629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 35413 35126 gene locus_tag LOCUS_01160 35413 35126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 35685 35449 gene locus_tag LOCUS_01170 35685 35449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 37202 35739 gene locus_tag LOCUS_01180 37202 35739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 37411 37336 gene locus_tag LOCUS_t00010 37411 37336 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37503 37703 gene locus_tag LOCUS_01190 37503 37703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 38237 37680 gene locus_tag LOCUS_01200 38237 37680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 38326 38796 gene locus_tag LOCUS_01210 38326 38796 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976435.1 protein_id gnl|my_center|LOCUS_01210 38835 39386 gene locus_tag LOCUS_01220 38835 39386 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_01220 40564 39383 gene locus_tag LOCUS_01230 40564 39383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 42503 40734 gene locus_tag LOCUS_01240 gene pepF 42503 40734 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_01240 42788 42534 gene locus_tag LOCUS_01250 42788 42534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022645.1 protein_id gnl|my_center|LOCUS_01250 42928 43206 gene locus_tag LOCUS_01260 42928 43206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 43312 43689 gene locus_tag LOCUS_01270 43312 43689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 43723 45063 gene locus_tag LOCUS_01280 gene ndh 43723 45063 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_01280 45449 45075 gene locus_tag LOCUS_01290 45449 45075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 46494 45490 gene locus_tag LOCUS_01300 46494 45490 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878288.1 protein_id gnl|my_center|LOCUS_01300 46635 46802 gene locus_tag LOCUS_01310 46635 46802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 47323 47129 gene locus_tag LOCUS_01320 47323 47129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 47790 47425 gene locus_tag LOCUS_01330 47790 47425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 48263 47787 gene locus_tag LOCUS_01340 48263 47787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 48569 48342 gene locus_tag LOCUS_01350 48569 48342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 49682 48693 gene locus_tag LOCUS_01360 49682 48693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 50260 49793 gene locus_tag LOCUS_01370 50260 49793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 >Feature sequence03 339 614 gene locus_tag LOCUS_01380 339 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 1627 611 gene locus_tag LOCUS_01390 1627 611 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_01390 3182 1665 gene locus_tag LOCUS_01400 3182 1665 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870707.1 protein_id gnl|my_center|LOCUS_01400 3664 3179 gene locus_tag LOCUS_01410 3664 3179 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_01410 5358 3670 gene locus_tag LOCUS_01420 5358 3670 CDS product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 protein_id gnl|my_center|LOCUS_01420 5578 5982 gene locus_tag LOCUS_01430 5578 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 6922 5984 gene locus_tag LOCUS_01440 6922 5984 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 protein_id gnl|my_center|LOCUS_01440 7934 6969 gene locus_tag LOCUS_01450 7934 6969 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_01450 7918 8082 gene locus_tag LOCUS_01460 7918 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8125 8358 gene locus_tag LOCUS_01470 8125 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8600 8355 gene locus_tag LOCUS_01480 8600 8355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8739 9032 gene locus_tag LOCUS_01490 8739 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9285 9034 gene locus_tag LOCUS_01500 9285 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 9693 9322 gene locus_tag LOCUS_01510 9693 9322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 10032 9736 gene locus_tag LOCUS_01520 10032 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 10085 10816 gene locus_tag LOCUS_01530 10085 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 12248 10842 gene locus_tag LOCUS_01540 12248 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453275.1 protein_id gnl|my_center|LOCUS_01540 15375 12322 gene locus_tag LOCUS_01550 15375 12322 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAA8 protein_id gnl|my_center|LOCUS_01550 16744 15572 gene locus_tag LOCUS_01560 gene carA 16744 15572 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RG87 protein_id gnl|my_center|LOCUS_01560 17992 16796 gene locus_tag LOCUS_01570 17992 16796 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_01570 18448 18029 gene locus_tag LOCUS_01580 18448 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 18984 18484 gene locus_tag LOCUS_01590 18984 18484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 19208 20365 gene locus_tag LOCUS_01600 19208 20365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 20397 20849 gene locus_tag LOCUS_01610 20397 20849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_01610 21156 21536 gene locus_tag LOCUS_01620 21156 21536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 22539 21538 gene locus_tag LOCUS_01630 22539 21538 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_01630 22776 22543 gene locus_tag LOCUS_01640 22776 22543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_01640 23763 22846 gene locus_tag LOCUS_01650 23763 22846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 24546 23818 gene locus_tag LOCUS_01660 24546 23818 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870273.1 protein_id gnl|my_center|LOCUS_01660 25231 24581 gene locus_tag LOCUS_01670 25231 24581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 25335 25622 gene locus_tag LOCUS_01680 25335 25622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 25681 27120 gene locus_tag LOCUS_01690 gene proS 25681 27120 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E028 protein_id gnl|my_center|LOCUS_01690 27149 28468 gene locus_tag LOCUS_01700 27149 28468 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123294.1 protein_id gnl|my_center|LOCUS_01700 29493 28465 gene locus_tag LOCUS_01710 29493 28465 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_01710 29581 30543 gene locus_tag LOCUS_01720 29581 30543 CDS product oligopeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_01720 34064 30540 gene locus_tag LOCUS_01730 34064 30540 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_01730 34202 34942 gene locus_tag LOCUS_01740 34202 34942 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903317.1 protein_id gnl|my_center|LOCUS_01740 36035 34935 gene locus_tag LOCUS_01750 36035 34935 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_01750 36146 37084 gene locus_tag LOCUS_01760 36146 37084 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_01760 37889 37089 gene locus_tag LOCUS_01770 37889 37089 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979652.1 protein_id gnl|my_center|LOCUS_01770 38539 37886 gene locus_tag LOCUS_01780 38539 37886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 38978 38589 gene locus_tag LOCUS_01790 38978 38589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 39515 39027 gene locus_tag LOCUS_01800 39515 39027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 39801 40517 gene locus_tag LOCUS_01810 39801 40517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 40562 41182 gene locus_tag LOCUS_01820 40562 41182 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_01820 41418 41179 gene locus_tag LOCUS_01830 41418 41179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 41917 41396 gene locus_tag LOCUS_01840 41917 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 42212 41952 gene locus_tag LOCUS_01850 42212 41952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 42278 43372 gene locus_tag LOCUS_01860 42278 43372 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023921.1 protein_id gnl|my_center|LOCUS_01860 >Feature sequence04 417 1487 gene locus_tag LOCUS_01870 417 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1569 2216 gene locus_tag LOCUS_01880 1569 2216 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358841.1 protein_id gnl|my_center|LOCUS_01880 3443 2217 gene locus_tag LOCUS_01890 3443 2217 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_01890 3585 4214 gene locus_tag LOCUS_01900 3585 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4558 4211 gene locus_tag LOCUS_01910 4558 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 4632 4937 gene locus_tag LOCUS_01920 4632 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 5161 4934 gene locus_tag LOCUS_01930 5161 4934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 5702 5172 gene locus_tag LOCUS_01940 5702 5172 CDS product oxetanocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_01940 5898 6449 gene locus_tag LOCUS_01950 5898 6449 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_01950 6476 6552 gene locus_tag LOCUS_t00020 6476 6552 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6611 6868 gene locus_tag LOCUS_01960 6611 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 6904 7143 gene locus_tag LOCUS_01970 6904 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 7137 7355 gene locus_tag LOCUS_01980 7137 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 7392 7805 gene locus_tag LOCUS_01990 7392 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 8227 7802 gene locus_tag LOCUS_02000 8227 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 8798 8448 gene locus_tag LOCUS_02010 8798 8448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 8966 9115 gene locus_tag LOCUS_02020 8966 9115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 9915 9112 gene locus_tag LOCUS_02030 9915 9112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10124 10966 gene locus_tag LOCUS_02040 10124 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 11176 12384 gene locus_tag LOCUS_02050 11176 12384 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_02050 12960 12373 gene locus_tag LOCUS_02060 gene purE 12960 12373 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS7 protein_id gnl|my_center|LOCUS_02060 13199 14041 gene locus_tag LOCUS_02070 13199 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 14089 15240 gene locus_tag LOCUS_02080 gene purK 14089 15240 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_02080 15381 16187 gene locus_tag LOCUS_02090 15381 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 16307 17008 gene locus_tag LOCUS_02100 16307 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 17028 18134 gene locus_tag LOCUS_02110 17028 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 18195 18581 gene locus_tag LOCUS_02120 18195 18581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 18720 19244 gene locus_tag LOCUS_02130 18720 19244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 20064 19246 gene locus_tag LOCUS_02140 20064 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 20156 20830 gene locus_tag LOCUS_02150 20156 20830 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_02150 20976 20827 gene locus_tag LOCUS_02160 20976 20827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 21070 22044 gene locus_tag LOCUS_02170 21070 22044 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902973.1 protein_id gnl|my_center|LOCUS_02170 22046 23155 gene locus_tag LOCUS_02180 22046 23155 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064582.1 protein_id gnl|my_center|LOCUS_02180 23159 23467 gene locus_tag LOCUS_02190 23159 23467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 24288 23470 gene locus_tag LOCUS_02200 24288 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 24375 24635 gene locus_tag LOCUS_02210 24375 24635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 24878 25435 gene locus_tag LOCUS_02220 24878 25435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 25492 26088 gene locus_tag LOCUS_02230 25492 26088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 26171 26500 gene locus_tag LOCUS_02240 26171 26500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 26696 26935 gene locus_tag LOCUS_02250 26696 26935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 27419 27045 gene locus_tag LOCUS_02260 27419 27045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 27528 28847 gene locus_tag LOCUS_02270 27528 28847 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_02270 28978 30261 gene locus_tag LOCUS_02280 28978 30261 CDS product gliding motility protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583682.1 protein_id gnl|my_center|LOCUS_02280 31307 30258 gene locus_tag LOCUS_02290 31307 30258 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979396.1 protein_id gnl|my_center|LOCUS_02290 31354 32073 gene locus_tag LOCUS_02300 31354 32073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 32188 33579 gene locus_tag LOCUS_02310 32188 33579 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_02310 33592 34140 gene locus_tag LOCUS_02320 33592 34140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 34817 34137 gene locus_tag LOCUS_02330 gene bioD 34817 34137 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHS9 protein_id gnl|my_center|LOCUS_02330 35263 34850 gene locus_tag LOCUS_02340 35263 34850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 35525 36850 gene locus_tag LOCUS_02350 35525 36850 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496781.1 protein_id gnl|my_center|LOCUS_02350 36917 37897 gene locus_tag LOCUS_02360 gene bioB 36917 37897 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBZ3 protein_id gnl|my_center|LOCUS_02360 37881 39017 gene locus_tag LOCUS_02370 37881 39017 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KM3 protein_id gnl|my_center|LOCUS_02370 39212 39943 gene locus_tag LOCUS_02380 gene ccdA 39212 39943 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152681.1 protein_id gnl|my_center|LOCUS_02380 39940 41061 gene locus_tag LOCUS_02390 39940 41061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 41155 41796 gene locus_tag LOCUS_02400 41155 41796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_02400 42149 41814 gene locus_tag LOCUS_02410 42149 41814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 42728 43111 gene locus_tag LOCUS_02420 42728 43111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence05 1932 1072 gene locus_tag LOCUS_02430 gene nfo 1932 1072 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z593 protein_id gnl|my_center|LOCUS_02430 2007 3038 gene locus_tag LOCUS_02440 2007 3038 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_02440 3031 4158 gene locus_tag LOCUS_02450 3031 4158 CDS product DNA primase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762192.1 protein_id gnl|my_center|LOCUS_02450 4278 7133 gene locus_tag LOCUS_02460 4278 7133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 7134 7676 gene locus_tag LOCUS_02470 7134 7676 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763094.1 protein_id gnl|my_center|LOCUS_02470 7710 8669 gene locus_tag LOCUS_02480 7710 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 8745 8672 gene locus_tag LOCUS_t00030 8745 8672 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8798 8971 gene locus_tag LOCUS_02490 8798 8971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 9167 9571 gene locus_tag LOCUS_02500 9167 9571 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_02500 9603 10865 gene locus_tag LOCUS_02510 9603 10865 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_02510 10846 11226 gene locus_tag LOCUS_02520 10846 11226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 11262 11717 gene locus_tag LOCUS_02530 11262 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 11775 14435 gene locus_tag LOCUS_02540 11775 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 15396 14593 gene locus_tag LOCUS_02550 15396 14593 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_02550 15969 15436 gene locus_tag LOCUS_02560 gene cobA 15969 15436 CDS product cob(I)alamin adenosyltransferase/cobinamide ATP-dependent adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_02560 16058 17413 gene locus_tag LOCUS_02570 16058 17413 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_02570 18040 17393 gene locus_tag LOCUS_02580 gene cbiC 18040 17393 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP7 protein_id gnl|my_center|LOCUS_02580 18782 18030 gene locus_tag LOCUS_02590 18782 18030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 19834 18779 gene locus_tag LOCUS_02600 gene cbiG 19834 18779 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 protein_id gnl|my_center|LOCUS_02600 20955 19867 gene locus_tag LOCUS_02610 gene cbiD 20955 19867 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP6 protein_id gnl|my_center|LOCUS_02610 21065 21922 gene locus_tag LOCUS_02620 21065 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 23065 21899 gene locus_tag LOCUS_02630 gene metK 23065 21899 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_02630 23330 23079 gene locus_tag LOCUS_02640 23330 23079 CDS product Sm ribonucleo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_02640 23430 24089 gene locus_tag LOCUS_02650 23430 24089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 24188 26941 gene locus_tag LOCUS_02660 24188 26941 CDS product large helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867939.1 protein_id gnl|my_center|LOCUS_02660 28335 26938 gene locus_tag LOCUS_02670 28335 26938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 28402 29349 gene locus_tag LOCUS_02680 28402 29349 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_02680 29330 30094 gene locus_tag LOCUS_02690 29330 30094 CDS product daunorubicin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_02690 30175 30101 gene locus_tag LOCUS_t00040 30175 30101 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31220 30213 gene locus_tag LOCUS_02700 31220 30213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876418.1 protein_id gnl|my_center|LOCUS_02700 31339 32478 gene locus_tag LOCUS_02710 31339 32478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 32510 33079 gene locus_tag LOCUS_02720 gene grpE 32510 33079 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM95 protein_id gnl|my_center|LOCUS_02720 33092 34945 gene locus_tag LOCUS_02730 gene dnaK 33092 34945 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_02730 34980 36074 gene locus_tag LOCUS_02740 gene dnaJ 34980 36074 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182E7 protein_id gnl|my_center|LOCUS_02740 >Feature sequence06 265 495 gene locus_tag LOCUS_02750 265 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 578 1063 gene locus_tag LOCUS_02760 578 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1735 1199 gene locus_tag LOCUS_02770 1735 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2604 1894 gene locus_tag LOCUS_02780 2604 1894 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_02780 2672 2747 gene locus_tag LOCUS_t00050 2672 2747 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3234 2761 gene locus_tag LOCUS_02790 3234 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 3324 3833 gene locus_tag LOCUS_02800 3324 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4847 3816 gene locus_tag LOCUS_02810 4847 3816 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_02810 4899 5393 gene locus_tag LOCUS_02820 4899 5393 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_02820 5434 6579 gene locus_tag LOCUS_02830 5434 6579 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_02830 6624 7379 gene locus_tag LOCUS_02840 6624 7379 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_02840 8440 7376 gene locus_tag LOCUS_02850 8440 7376 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084207594.1 protein_id gnl|my_center|LOCUS_02850 8506 9147 gene locus_tag LOCUS_02860 8506 9147 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762844.1 protein_id gnl|my_center|LOCUS_02860 9155 11092 gene locus_tag LOCUS_02870 9155 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146646.1 protein_id gnl|my_center|LOCUS_02870 11362 11084 gene locus_tag LOCUS_02880 11362 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 12446 11436 gene locus_tag LOCUS_02890 12446 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_02890 12519 13583 gene locus_tag LOCUS_02900 12519 13583 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102862.1 protein_id gnl|my_center|LOCUS_02900 14430 13588 gene locus_tag LOCUS_02910 14430 13588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 15698 14451 gene locus_tag LOCUS_02920 15698 14451 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_02920 16527 15688 gene locus_tag LOCUS_02930 gene panB 16527 15688 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYW9 protein_id gnl|my_center|LOCUS_02930 17284 16520 gene locus_tag LOCUS_02940 17284 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_02940 18192 17299 gene locus_tag LOCUS_02950 18192 17299 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876216.1 protein_id gnl|my_center|LOCUS_02950 18326 19237 gene locus_tag LOCUS_02960 18326 19237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_02960 19744 19229 gene locus_tag LOCUS_02970 gene nudF 19744 19229 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54570 protein_id gnl|my_center|LOCUS_02970 20695 19772 gene locus_tag LOCUS_02980 20695 19772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 20882 22039 gene locus_tag LOCUS_02990 20882 22039 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_02990 22191 22736 gene locus_tag LOCUS_03000 22191 22736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 22736 24031 gene locus_tag LOCUS_03010 22736 24031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 24064 24453 gene locus_tag LOCUS_03020 24064 24453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 24446 26005 gene locus_tag LOCUS_03030 24446 26005 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_03030 26397 26008 gene locus_tag LOCUS_03040 26397 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 26721 26431 gene locus_tag LOCUS_03050 26721 26431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 26971 27552 gene locus_tag LOCUS_03060 26971 27552 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_03060 27549 28793 gene locus_tag LOCUS_03070 27549 28793 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146536.1 protein_id gnl|my_center|LOCUS_03070 28790 29476 gene locus_tag LOCUS_03080 28790 29476 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_03080 29833 29477 gene locus_tag LOCUS_03090 29833 29477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 29905 30450 gene locus_tag LOCUS_03100 29905 30450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 30550 31125 gene locus_tag LOCUS_03110 30550 31125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 32018 31356 gene locus_tag LOCUS_03120 32018 31356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 32271 32035 gene locus_tag LOCUS_03130 32271 32035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 33321 32284 gene locus_tag LOCUS_03140 33321 32284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 34034 33375 gene locus_tag LOCUS_03150 34034 33375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence07 2661 3584 gene locus_tag LOCUS_03160 2661 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3993 3595 gene locus_tag LOCUS_03170 3993 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 4303 5223 gene locus_tag LOCUS_03180 4303 5223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_03180 5256 5786 gene locus_tag LOCUS_03190 5256 5786 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_03190 6018 7577 gene locus_tag LOCUS_03200 6018 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 7691 9514 gene locus_tag LOCUS_03210 7691 9514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 9650 10648 gene locus_tag LOCUS_03220 9650 10648 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_03220 11075 10653 gene locus_tag LOCUS_03230 11075 10653 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_03230 11155 13644 gene locus_tag LOCUS_03240 11155 13644 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140731.1 protein_id gnl|my_center|LOCUS_03240 13651 14058 gene locus_tag LOCUS_03250 13651 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 14079 15017 gene locus_tag LOCUS_03260 14079 15017 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_03260 15023 16612 gene locus_tag LOCUS_03270 15023 16612 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_03270 16613 17008 gene locus_tag LOCUS_03280 16613 17008 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_03280 17566 17009 gene locus_tag LOCUS_03290 17566 17009 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_03290 20335 17609 gene locus_tag LOCUS_03300 20335 17609 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_03300 21008 20352 gene locus_tag LOCUS_03310 21008 20352 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_03310 21332 21051 gene locus_tag LOCUS_03320 21332 21051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 23897 21342 gene locus_tag LOCUS_03330 23897 21342 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762568.1 protein_id gnl|my_center|LOCUS_03330 24443 23907 gene locus_tag LOCUS_03340 24443 23907 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_03340 24557 26056 gene locus_tag LOCUS_03350 24557 26056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 26328 26053 gene locus_tag LOCUS_03360 26328 26053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 26609 26370 gene locus_tag LOCUS_03370 26609 26370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 27056 26658 gene locus_tag LOCUS_03380 27056 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 27334 27053 gene locus_tag LOCUS_03390 27334 27053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 27407 27808 gene locus_tag LOCUS_03400 27407 27808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881169.1 protein_id gnl|my_center|LOCUS_03400 27805 28698 gene locus_tag LOCUS_03410 gene menA 27805 28698 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BK6 protein_id gnl|my_center|LOCUS_03410 28734 29834 gene locus_tag LOCUS_03420 28734 29834 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_03420 30524 29835 gene locus_tag LOCUS_03430 30524 29835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 31730 30789 gene locus_tag LOCUS_03440 31730 30789 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763183.1 protein_id gnl|my_center|LOCUS_03440 31849 32265 gene locus_tag LOCUS_03450 31849 32265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 32579 32259 gene locus_tag LOCUS_03460 32579 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 33141 32635 gene locus_tag LOCUS_03470 33141 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 33195 33581 gene locus_tag LOCUS_03480 33195 33581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 33889 33563 gene locus_tag LOCUS_03490 33889 33563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 33976 34188 gene locus_tag LOCUS_03500 33976 34188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence08 284 805 gene locus_tag LOCUS_03510 284 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1334 840 gene locus_tag LOCUS_03520 gene cysC 1334 840 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_03520 1928 1386 gene locus_tag LOCUS_03530 1928 1386 CDS product hemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964078.1 protein_id gnl|my_center|LOCUS_03530 2797 1955 gene locus_tag LOCUS_03540 2797 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2858 3091 gene locus_tag LOCUS_03550 2858 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 4240 3329 gene locus_tag LOCUS_03560 gene tfb 4240 3329 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_03560 4388 5320 gene locus_tag LOCUS_03570 4388 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 5336 6886 gene locus_tag LOCUS_03580 5336 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 7093 6878 gene locus_tag LOCUS_03590 7093 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 7829 7167 gene locus_tag LOCUS_03600 7829 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 9329 7884 gene locus_tag LOCUS_03610 9329 7884 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_03610 10772 9402 gene locus_tag LOCUS_03620 10772 9402 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865056.1 protein_id gnl|my_center|LOCUS_03620 10901 12646 gene locus_tag LOCUS_03630 10901 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 12689 13567 gene locus_tag LOCUS_03640 12689 13567 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_03640 13567 14514 gene locus_tag LOCUS_03650 13567 14514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14511 15410 gene locus_tag LOCUS_03660 gene rnz 14511 15410 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_03660 15412 16143 gene locus_tag LOCUS_03670 15412 16143 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_03670 16879 16127 gene locus_tag LOCUS_03680 16879 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17350 16958 gene locus_tag LOCUS_03690 17350 16958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_03690 17898 17347 gene locus_tag LOCUS_03700 17898 17347 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_03700 17969 18514 gene locus_tag LOCUS_03710 17969 18514 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_03710 18511 19848 gene locus_tag LOCUS_03720 18511 19848 CDS product CCA-adding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 protein_id gnl|my_center|LOCUS_03720 19823 20581 gene locus_tag LOCUS_03730 19823 20581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 20582 21190 gene locus_tag LOCUS_03740 20582 21190 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_03740 21223 22161 gene locus_tag LOCUS_03750 21223 22161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 22293 22216 gene locus_tag LOCUS_t00060 22293 22216 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 22351 22560 gene locus_tag LOCUS_03760 22351 22560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 23308 22568 gene locus_tag LOCUS_03770 23308 22568 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967172.1 protein_id gnl|my_center|LOCUS_03770 23395 23622 gene locus_tag LOCUS_03780 23395 23622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 23903 23619 gene locus_tag LOCUS_03790 23903 23619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 24491 23934 gene locus_tag LOCUS_03800 24491 23934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 24547 26007 gene locus_tag LOCUS_03810 24547 26007 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_03810 26286 26008 gene locus_tag LOCUS_03820 26286 26008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 28035 26341 gene locus_tag LOCUS_03830 28035 26341 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_03830 28137 29459 gene locus_tag LOCUS_03840 28137 29459 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_03840 32836 29456 gene locus_tag LOCUS_03850 32836 29456 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496881.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence09 106 22 gene locus_tag LOCUS_t00070 106 22 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 729 193 gene locus_tag LOCUS_03860 729 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 852 1529 gene locus_tag LOCUS_03870 852 1529 CDS product translation initiation factor 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868639.1 protein_id gnl|my_center|LOCUS_03870 2803 1520 gene locus_tag LOCUS_03880 2803 1520 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250513.1 protein_id gnl|my_center|LOCUS_03880 3224 2862 gene locus_tag LOCUS_03890 3224 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 4336 3296 gene locus_tag LOCUS_03900 4336 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4467 4883 gene locus_tag LOCUS_03910 4467 4883 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877206.1 protein_id gnl|my_center|LOCUS_03910 4873 5331 gene locus_tag LOCUS_03920 4873 5331 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_03920 6228 5527 gene locus_tag LOCUS_03930 6228 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7193 6225 gene locus_tag LOCUS_03940 7193 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7337 7981 gene locus_tag LOCUS_03950 7337 7981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_03950 8540 7989 gene locus_tag LOCUS_03960 8540 7989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9274 8624 gene locus_tag LOCUS_03970 gene sodA 9274 8624 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDP2 protein_id gnl|my_center|LOCUS_03970 9444 10355 gene locus_tag LOCUS_03980 gene tfb 9444 10355 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_03980 11804 10371 gene locus_tag LOCUS_03990 11804 10371 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256452.1 protein_id gnl|my_center|LOCUS_03990 12153 11905 gene locus_tag LOCUS_04000 12153 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 12467 12207 gene locus_tag LOCUS_04010 12467 12207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 12566 12724 gene locus_tag LOCUS_04020 12566 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 12747 13175 gene locus_tag LOCUS_04030 12747 13175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 15689 13389 gene locus_tag LOCUS_04040 15689 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 17029 15689 gene locus_tag LOCUS_04050 17029 15689 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_04050 17858 17214 gene locus_tag LOCUS_04060 17858 17214 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002024041.1 protein_id gnl|my_center|LOCUS_04060 18817 17927 gene locus_tag LOCUS_04070 18817 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 19368 18892 gene locus_tag LOCUS_04080 19368 18892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 19444 19812 gene locus_tag LOCUS_04090 19444 19812 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256786.1 protein_id gnl|my_center|LOCUS_04090 20693 19791 gene locus_tag LOCUS_04100 20693 19791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 21198 20791 gene locus_tag LOCUS_04110 21198 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 21721 21320 gene locus_tag LOCUS_04120 21721 21320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 22433 22164 gene locus_tag LOCUS_04130 22433 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 22596 22835 gene locus_tag LOCUS_04140 22596 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 22837 23364 gene locus_tag LOCUS_04150 22837 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 23754 23368 gene locus_tag LOCUS_04160 23754 23368 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_04160 25625 23844 gene locus_tag LOCUS_04170 25625 23844 CDS product translation initiation factor aIF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_04170 26033 25632 gene locus_tag LOCUS_04180 26033 25632 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_04180 26235 26035 gene locus_tag LOCUS_04190 26235 26035 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_04190 26456 26244 gene locus_tag LOCUS_04200 26456 26244 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762341.1 protein_id gnl|my_center|LOCUS_04200 26839 26453 gene locus_tag LOCUS_04210 26839 26453 CDS product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_04210 28311 26902 gene locus_tag LOCUS_04220 28311 26902 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_04220 28297 28384 gene locus_tag LOCUS_t00080 28297 28384 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28442 29284 gene locus_tag LOCUS_04230 28442 29284 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_04230 29290 30015 gene locus_tag LOCUS_04240 29290 30015 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972341.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence10 1097 474 gene locus_tag LOCUS_04250 1097 474 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021577.1 protein_id gnl|my_center|LOCUS_04250 2062 1094 gene locus_tag LOCUS_04260 2062 1094 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_04260 2668 2138 gene locus_tag LOCUS_04270 2668 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5198 2928 gene locus_tag LOCUS_04280 5198 2928 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_04280 5346 5978 gene locus_tag LOCUS_04290 5346 5978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6819 6253 gene locus_tag LOCUS_04300 6819 6253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7077 6838 gene locus_tag LOCUS_04310 7077 6838 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_04310 7619 7122 gene locus_tag LOCUS_04320 7619 7122 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_04320 9390 7765 gene locus_tag LOCUS_04330 9390 7765 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_04330 10772 9381 gene locus_tag LOCUS_04340 10772 9381 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_04340 10824 11936 gene locus_tag LOCUS_04350 10824 11936 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_04350 11933 12214 gene locus_tag LOCUS_04360 11933 12214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12540 12211 gene locus_tag LOCUS_04370 12540 12211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 13069 12605 gene locus_tag LOCUS_04380 13069 12605 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_04380 14133 13096 gene locus_tag LOCUS_04390 14133 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 14554 14480 gene locus_tag LOCUS_t00090 14554 14480 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14639 15193 gene locus_tag LOCUS_04400 14639 15193 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_04400 16212 15319 gene locus_tag LOCUS_04410 16212 15319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16330 16716 gene locus_tag LOCUS_04420 16330 16716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 16936 17010 gene locus_tag LOCUS_t00100 16936 17010 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17872 17012 gene locus_tag LOCUS_04430 17872 17012 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF0 protein_id gnl|my_center|LOCUS_04430 18604 18017 gene locus_tag LOCUS_04440 18604 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19135 18773 gene locus_tag LOCUS_04450 19135 18773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 19809 19246 gene locus_tag LOCUS_04460 19809 19246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 20071 20640 gene locus_tag LOCUS_04470 20071 20640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 20707 21021 gene locus_tag LOCUS_04480 20707 21021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 21077 21592 gene locus_tag LOCUS_04490 21077 21592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 21927 21658 gene locus_tag LOCUS_04500 21927 21658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 22369 22040 gene locus_tag LOCUS_04510 22369 22040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 22496 22945 gene locus_tag LOCUS_04520 22496 22945 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 protein_id gnl|my_center|LOCUS_04520 22945 24366 gene locus_tag LOCUS_04530 22945 24366 CDS product recombinase RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_04530 24329 24571 gene locus_tag LOCUS_04540 24329 24571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 24571 25833 gene locus_tag LOCUS_04550 24571 25833 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_04550 25875 26486 gene locus_tag LOCUS_04560 25875 26486 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879809.1 protein_id gnl|my_center|LOCUS_04560 26512 26940 gene locus_tag LOCUS_04570 26512 26940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 protein_id gnl|my_center|LOCUS_04570 27094 28557 gene locus_tag LOCUS_04580 27094 28557 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 protein_id gnl|my_center|LOCUS_04580 28593 29390 gene locus_tag LOCUS_04590 28593 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence11 124 771 gene locus_tag LOCUS_04600 124 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 768 1379 gene locus_tag LOCUS_04610 768 1379 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_04610 1384 2448 gene locus_tag LOCUS_04620 1384 2448 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877787.1 protein_id gnl|my_center|LOCUS_04620 4195 2435 gene locus_tag LOCUS_04630 4195 2435 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_04630 4866 4234 gene locus_tag LOCUS_04640 4866 4234 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_04640 5505 4876 gene locus_tag LOCUS_04650 5505 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5612 7243 gene locus_tag LOCUS_04660 5612 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7230 8576 gene locus_tag LOCUS_04670 7230 8576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 8583 8894 gene locus_tag LOCUS_04680 8583 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 9432 8887 gene locus_tag LOCUS_04690 9432 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9514 10572 gene locus_tag LOCUS_04700 9514 10572 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887529.1 protein_id gnl|my_center|LOCUS_04700 10562 11737 gene locus_tag LOCUS_04710 10562 11737 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887528.1 protein_id gnl|my_center|LOCUS_04710 13092 11734 gene locus_tag LOCUS_04720 13092 11734 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_04720 13210 16392 gene locus_tag LOCUS_04730 13210 16392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 16628 17650 gene locus_tag LOCUS_04740 16628 17650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 17694 18020 gene locus_tag LOCUS_04750 17694 18020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 19598 18021 gene locus_tag LOCUS_04760 19598 18021 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_04760 20449 19673 gene locus_tag LOCUS_04770 20449 19673 CDS product phosphoribosylaminoimidazole carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020480.1 protein_id gnl|my_center|LOCUS_04770 21400 20486 gene locus_tag LOCUS_04780 21400 20486 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_04780 21490 22716 gene locus_tag LOCUS_04790 21490 22716 CDS product TIGR00299 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060969.1 protein_id gnl|my_center|LOCUS_04790 22713 23513 gene locus_tag LOCUS_04800 22713 23513 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142045.1 protein_id gnl|my_center|LOCUS_04800 23510 24667 gene locus_tag LOCUS_04810 gene iscS 23510 24667 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_04810 25484 24669 gene locus_tag LOCUS_04820 25484 24669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 26441 25569 gene locus_tag LOCUS_04830 26441 25569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 27337 26501 gene locus_tag LOCUS_04840 27337 26501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 28478 27651 gene locus_tag LOCUS_04850 28478 27651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 28659 28910 gene locus_tag LOCUS_04860 gene rpoH 28659 28910 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870552.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence12 241 1026 gene locus_tag LOCUS_04870 241 1026 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496756.1 protein_id gnl|my_center|LOCUS_04870 1028 1639 gene locus_tag LOCUS_04880 1028 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1931 1629 gene locus_tag LOCUS_04890 1931 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2524 3144 gene locus_tag LOCUS_04900 2524 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532967.1 protein_id gnl|my_center|LOCUS_04900 3145 3765 gene locus_tag LOCUS_04910 3145 3765 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405389.1 protein_id gnl|my_center|LOCUS_04910 3851 4000 gene locus_tag LOCUS_04920 3851 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 4402 4091 gene locus_tag LOCUS_04930 4402 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 5400 4402 gene locus_tag LOCUS_04940 5400 4402 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496568.1 protein_id gnl|my_center|LOCUS_04940 6517 5408 gene locus_tag LOCUS_04950 6517 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7378 6569 gene locus_tag LOCUS_04960 7378 6569 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879043.1 protein_id gnl|my_center|LOCUS_04960 8146 7382 gene locus_tag LOCUS_04970 8146 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 9454 8198 gene locus_tag LOCUS_04980 9454 8198 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_04980 10113 9451 gene locus_tag LOCUS_04990 10113 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 10176 11216 gene locus_tag LOCUS_05000 10176 11216 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_05000 11555 11217 gene locus_tag LOCUS_05010 11555 11217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 12560 11565 gene locus_tag LOCUS_05020 12560 11565 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_05020 13102 12557 gene locus_tag LOCUS_05030 13102 12557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143201.1 protein_id gnl|my_center|LOCUS_05030 13707 13102 gene locus_tag LOCUS_05040 13707 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 14635 13856 gene locus_tag LOCUS_05050 gene sufC 14635 13856 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_05050 15687 14731 gene locus_tag LOCUS_05060 gene tfb 15687 14731 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_05060 15929 15684 gene locus_tag LOCUS_05070 15929 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 16324 16025 gene locus_tag LOCUS_05080 16324 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 16709 16329 gene locus_tag LOCUS_05090 16709 16329 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_05090 17357 16794 gene locus_tag LOCUS_05100 17357 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 18088 17411 gene locus_tag LOCUS_05110 18088 17411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 18184 19260 gene locus_tag LOCUS_05120 18184 19260 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_05120 19321 20061 gene locus_tag LOCUS_05130 19321 20061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 20580 20062 gene locus_tag LOCUS_05140 20580 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 20916 21479 gene locus_tag LOCUS_05150 20916 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 21514 21924 gene locus_tag LOCUS_05160 21514 21924 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249829.1 protein_id gnl|my_center|LOCUS_05160 22045 22737 gene locus_tag LOCUS_05170 22045 22737 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879162.1 protein_id gnl|my_center|LOCUS_05170 22880 24205 gene locus_tag LOCUS_05180 22880 24205 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_05180 24247 25404 gene locus_tag LOCUS_05190 24247 25404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 25584 26291 gene locus_tag LOCUS_05200 25584 26291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 26873 26481 gene locus_tag LOCUS_05210 26873 26481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 26954 27514 gene locus_tag LOCUS_05220 26954 27514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_05220 28838 27498 gene locus_tag LOCUS_05230 28838 27498 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence13 <1 928 gene locus_tag LOCUS_05240 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948041.1:malate dehydrogenase 945 1595 gene locus_tag LOCUS_05250 945 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 1622 2494 gene locus_tag LOCUS_05260 gene putA 1622 2494 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_05260 4047 2476 gene locus_tag LOCUS_05270 gene rocA 4047 2476 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HP91 protein_id gnl|my_center|LOCUS_05270 4895 4047 gene locus_tag LOCUS_05280 4895 4047 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393578.1 protein_id gnl|my_center|LOCUS_05280 5907 4939 gene locus_tag LOCUS_05290 5907 4939 CDS product 2-oxoacid ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_05290 6056 5907 gene locus_tag LOCUS_05300 6056 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6307 6068 gene locus_tag LOCUS_05310 6307 6068 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763319.1 protein_id gnl|my_center|LOCUS_05310 6923 7339 gene locus_tag LOCUS_05320 6923 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 7530 7778 gene locus_tag LOCUS_05330 7530 7778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 10512 7816 gene locus_tag LOCUS_05340 10512 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 10487 11077 gene locus_tag LOCUS_05350 10487 11077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 11821 11072 gene locus_tag LOCUS_05360 11821 11072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 12029 13219 gene locus_tag LOCUS_05370 12029 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 13224 14048 gene locus_tag LOCUS_05380 13224 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_05380 14208 14038 gene locus_tag LOCUS_05390 14208 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 14568 14482 gene locus_tag LOCUS_t00110 14568 14482 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15347 14601 gene locus_tag LOCUS_05400 15347 14601 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024437.1 protein_id gnl|my_center|LOCUS_05400 15460 16494 gene locus_tag LOCUS_05410 15460 16494 CDS product isocitrate/isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_05410 17025 16495 gene locus_tag LOCUS_05420 17025 16495 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250624.1 protein_id gnl|my_center|LOCUS_05420 17701 17006 gene locus_tag LOCUS_05430 gene rsmA 17701 17006 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1F1 protein_id gnl|my_center|LOCUS_05430 18264 17698 gene locus_tag LOCUS_05440 18264 17698 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249851.1 protein_id gnl|my_center|LOCUS_05440 18609 18283 gene locus_tag LOCUS_05450 18609 18283 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_05450 18911 18609 gene locus_tag LOCUS_05460 18911 18609 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762332.1 protein_id gnl|my_center|LOCUS_05460 20344 19250 gene locus_tag LOCUS_05470 20344 19250 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_05470 20649 20467 gene locus_tag LOCUS_05480 20649 20467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 22420 20693 gene locus_tag LOCUS_05490 22420 20693 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_05490 23284 22472 gene locus_tag LOCUS_05500 23284 22472 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_05500 24125 23268 gene locus_tag LOCUS_05510 24125 23268 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053788.1 protein_id gnl|my_center|LOCUS_05510 24270 25625 gene locus_tag LOCUS_05520 24270 25625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249139.1 protein_id gnl|my_center|LOCUS_05520 25612 26289 gene locus_tag LOCUS_05530 25612 26289 CDS product fibrillarin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_05530 26906 26286 gene locus_tag LOCUS_05540 26906 26286 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_05540 27789 27184 gene locus_tag LOCUS_05550 27789 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 27898 29037 gene locus_tag LOCUS_05560 27898 29037 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence14 2180 957 gene locus_tag LOCUS_05570 2180 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2517 2236 gene locus_tag LOCUS_05580 2517 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2596 3057 gene locus_tag LOCUS_05590 2596 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4815 3196 gene locus_tag LOCUS_05600 4815 3196 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_05600 4969 5895 gene locus_tag LOCUS_05610 4969 5895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 6647 5943 gene locus_tag LOCUS_05620 6647 5943 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_05620 6748 7206 gene locus_tag LOCUS_05630 gene bcp 6748 7206 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_05630 8121 7225 gene locus_tag LOCUS_05640 8121 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 9144 8527 gene locus_tag LOCUS_05650 9144 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 9239 9616 gene locus_tag LOCUS_05660 9239 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 9850 9620 gene locus_tag LOCUS_05670 9850 9620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9915 11408 gene locus_tag LOCUS_05680 9915 11408 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_05680 12523 11405 gene locus_tag LOCUS_05690 12523 11405 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763062.1 protein_id gnl|my_center|LOCUS_05690 12684 13466 gene locus_tag LOCUS_05700 12684 13466 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_05700 13459 14514 gene locus_tag LOCUS_05710 13459 14514 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_05710 14518 15183 gene locus_tag LOCUS_05720 14518 15183 CDS product 3-dehydroquinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249221.1 protein_id gnl|my_center|LOCUS_05720 15356 16174 gene locus_tag LOCUS_05730 gene aroE 15356 16174 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ55 protein_id gnl|my_center|LOCUS_05730 16174 17028 gene locus_tag LOCUS_05740 16174 17028 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_05740 17018 18283 gene locus_tag LOCUS_05750 17018 18283 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876404.1 protein_id gnl|my_center|LOCUS_05750 18669 18292 gene locus_tag LOCUS_05760 18669 18292 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_05760 18756 18962 gene locus_tag LOCUS_05770 18756 18962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 20595 18967 gene locus_tag LOCUS_05780 20595 18967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 20700 21794 gene locus_tag LOCUS_05790 20700 21794 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496747.1 protein_id gnl|my_center|LOCUS_05790 21828 23168 gene locus_tag LOCUS_05800 gene aspC 21828 23168 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y2 protein_id gnl|my_center|LOCUS_05800 23165 24022 gene locus_tag LOCUS_05810 23165 24022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 24109 24429 gene locus_tag LOCUS_05820 24109 24429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 25740 24412 gene locus_tag LOCUS_05830 25740 24412 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979932.1 protein_id gnl|my_center|LOCUS_05830 25892 26089 gene locus_tag LOCUS_05840 25892 26089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 26124 27419 gene locus_tag LOCUS_05850 26124 27419 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_05850 27484 28185 gene locus_tag LOCUS_05860 27484 28185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 28190 28627 gene locus_tag LOCUS_05870 28190 28627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 29061 28624 gene locus_tag LOCUS_05880 29061 28624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 >Feature sequence15 1652 939 gene locus_tag LOCUS_05890 1652 939 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877124.1 protein_id gnl|my_center|LOCUS_05890 2144 1653 gene locus_tag LOCUS_05900 2144 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2221 3753 gene locus_tag LOCUS_05910 2221 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 5107 3755 gene locus_tag LOCUS_05920 5107 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 5830 5177 gene locus_tag LOCUS_05930 5830 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 5941 6441 gene locus_tag LOCUS_05940 5941 6441 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 protein_id gnl|my_center|LOCUS_05940 6464 8617 gene locus_tag LOCUS_05950 6464 8617 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_05950 8660 8878 gene locus_tag LOCUS_05960 8660 8878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 9128 8901 gene locus_tag LOCUS_05970 9128 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 9233 9610 gene locus_tag LOCUS_05980 gene crcB 9233 9610 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EER0 protein_id gnl|my_center|LOCUS_05980 9910 9596 gene locus_tag LOCUS_05990 9910 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 10040 11188 gene locus_tag LOCUS_06000 10040 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 11521 11222 gene locus_tag LOCUS_06010 11521 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 12226 11627 gene locus_tag LOCUS_06020 12226 11627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12253 13404 gene locus_tag LOCUS_06030 12253 13404 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877001.1 protein_id gnl|my_center|LOCUS_06030 13659 13399 gene locus_tag LOCUS_06040 13659 13399 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_06040 13740 14381 gene locus_tag LOCUS_06050 13740 14381 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_06050 15436 14378 gene locus_tag LOCUS_06060 15436 14378 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979564.1 protein_id gnl|my_center|LOCUS_06060 15493 16008 gene locus_tag LOCUS_06070 15493 16008 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_06070 16161 16009 gene locus_tag LOCUS_06080 16161 16009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 16322 16170 gene locus_tag LOCUS_06090 16322 16170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 16889 16353 gene locus_tag LOCUS_06100 16889 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 16940 17218 gene locus_tag LOCUS_06110 16940 17218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 17221 17535 gene locus_tag LOCUS_06120 17221 17535 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_06120 17571 18317 gene locus_tag LOCUS_06130 17571 18317 CDS product DNA polymerase III sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 protein_id gnl|my_center|LOCUS_06130 18353 19756 gene locus_tag LOCUS_06140 18353 19756 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_06140 19805 21265 gene locus_tag LOCUS_06150 19805 21265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 21307 22101 gene locus_tag LOCUS_06160 21307 22101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 23141 22098 gene locus_tag LOCUS_06170 23141 22098 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_06170 23747 23175 gene locus_tag LOCUS_06180 23747 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 23829 24914 gene locus_tag LOCUS_06190 23829 24914 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_06190 24911 25393 gene locus_tag LOCUS_06200 24911 25393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 25740 25390 gene locus_tag LOCUS_06210 25740 25390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 26778 25885 gene locus_tag LOCUS_06220 26778 25885 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_06220 27243 26788 gene locus_tag LOCUS_06230 27243 26788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence16 2218 890 gene locus_tag LOCUS_06240 2218 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496732.1 protein_id gnl|my_center|LOCUS_06240 2552 2211 gene locus_tag LOCUS_06250 2552 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2812 2570 gene locus_tag LOCUS_06260 2812 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3738 3076 gene locus_tag LOCUS_06270 3738 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4095 3760 gene locus_tag LOCUS_06280 4095 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 4472 4131 gene locus_tag LOCUS_06290 4472 4131 CDS product NagC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869778.1 protein_id gnl|my_center|LOCUS_06290 4945 4469 gene locus_tag LOCUS_06300 4945 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_06300 5038 6078 gene locus_tag LOCUS_06310 5038 6078 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755922.1 protein_id gnl|my_center|LOCUS_06310 6141 6575 gene locus_tag LOCUS_06320 6141 6575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 6680 8332 gene locus_tag LOCUS_06330 6680 8332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8367 8735 gene locus_tag LOCUS_06340 8367 8735 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_06340 9584 8736 gene locus_tag LOCUS_06350 9584 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 9971 11104 gene locus_tag LOCUS_06360 9971 11104 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 protein_id gnl|my_center|LOCUS_06360 11085 11618 gene locus_tag LOCUS_06370 11085 11618 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_06370 11641 12159 gene locus_tag LOCUS_06380 11641 12159 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 protein_id gnl|my_center|LOCUS_06380 12223 13470 gene locus_tag LOCUS_06390 12223 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 14023 13472 gene locus_tag LOCUS_06400 14023 13472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14333 14082 gene locus_tag LOCUS_06410 14333 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 15025 14369 gene locus_tag LOCUS_06420 15025 14369 CDS product diaminohydroxyphosphoribosylaminopyrimidine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_06420 16202 15012 gene locus_tag LOCUS_06430 16202 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_06430 16945 16199 gene locus_tag LOCUS_06440 16945 16199 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_06440 17358 16942 gene locus_tag LOCUS_06450 17358 16942 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978358.1 protein_id gnl|my_center|LOCUS_06450 18029 17361 gene locus_tag LOCUS_06460 18029 17361 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_06460 18689 18108 gene locus_tag LOCUS_06470 gene ribE 18689 18108 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67604 protein_id gnl|my_center|LOCUS_06470 19404 18721 gene locus_tag LOCUS_06480 19404 18721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 20008 19673 gene locus_tag LOCUS_06490 20008 19673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 20323 20541 gene locus_tag LOCUS_06500 20323 20541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 20538 20780 gene locus_tag LOCUS_06510 20538 20780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 21643 20786 gene locus_tag LOCUS_06520 21643 20786 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_06520 22727 21651 gene locus_tag LOCUS_06530 gene adh1 22727 21651 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880876.1 protein_id gnl|my_center|LOCUS_06530 23050 22763 gene locus_tag LOCUS_06540 23050 22763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 23510 23058 gene locus_tag LOCUS_06550 23510 23058 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250227.1 protein_id gnl|my_center|LOCUS_06550 23887 23579 gene locus_tag LOCUS_06560 23887 23579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 24013 23938 gene locus_tag LOCUS_t00120 24013 23938 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24700 24035 gene locus_tag LOCUS_06570 24700 24035 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_06570 25815 24703 gene locus_tag LOCUS_06580 25815 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 <27176 25861 gene locus_tag LOCUS_06590 <27176 25861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250687.1:intein-containing adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence17 41 247 gene locus_tag LOCUS_06600 41 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 272 763 gene locus_tag LOCUS_06610 272 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 1087 758 gene locus_tag LOCUS_06620 1087 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 1168 2448 gene locus_tag LOCUS_06630 1168 2448 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_06630 2589 2963 gene locus_tag LOCUS_06640 2589 2963 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546418.1 protein_id gnl|my_center|LOCUS_06640 5902 2969 gene locus_tag LOCUS_06650 5902 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6344 7003 gene locus_tag LOCUS_06660 6344 7003 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_06660 9489 7006 gene locus_tag LOCUS_06670 9489 7006 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_06670 9665 10222 gene locus_tag LOCUS_06680 9665 10222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 11954 10212 gene locus_tag LOCUS_06690 11954 10212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 12128 11961 gene locus_tag LOCUS_06700 12128 11961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 12360 12187 gene locus_tag LOCUS_06710 12360 12187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 12455 14629 gene locus_tag LOCUS_06720 12455 14629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 14710 16356 gene locus_tag LOCUS_06730 14710 16356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16360 17157 gene locus_tag LOCUS_06740 16360 17157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 17160 18791 gene locus_tag LOCUS_06750 17160 18791 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090948.1 protein_id gnl|my_center|LOCUS_06750 18788 19561 gene locus_tag LOCUS_06760 18788 19561 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389055.1 protein_id gnl|my_center|LOCUS_06760 19881 19558 gene locus_tag LOCUS_06770 19881 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 19979 20287 gene locus_tag LOCUS_06780 19979 20287 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_06780 20294 21286 gene locus_tag LOCUS_06790 20294 21286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 22186 21275 gene locus_tag LOCUS_06800 gene tfb 22186 21275 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_06800 22902 22273 gene locus_tag LOCUS_06810 22902 22273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 23824 22904 gene locus_tag LOCUS_06820 23824 22904 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_06820 23947 25215 gene locus_tag LOCUS_06830 23947 25215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence18 895 437 gene locus_tag LOCUS_06840 895 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1014 1265 gene locus_tag LOCUS_06850 1014 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1307 1759 gene locus_tag LOCUS_06860 1307 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2529 1756 gene locus_tag LOCUS_06870 2529 1756 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_06870 2744 3046 gene locus_tag LOCUS_06880 2744 3046 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_06880 3071 3355 gene locus_tag LOCUS_06890 3071 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 3391 3843 gene locus_tag LOCUS_06900 3391 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3833 4189 gene locus_tag LOCUS_06910 3833 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4245 6341 gene locus_tag LOCUS_06920 4245 6341 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_06920 6409 7917 gene locus_tag LOCUS_06930 gene abfD 6409 7917 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_06930 8627 7920 gene locus_tag LOCUS_06940 8627 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 9481 8672 gene locus_tag LOCUS_06950 9481 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 9656 9988 gene locus_tag LOCUS_06960 gene trx 9656 9988 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B01 protein_id gnl|my_center|LOCUS_06960 10057 10605 gene locus_tag LOCUS_06970 10057 10605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 10968 10606 gene locus_tag LOCUS_06980 10968 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11084 11010 gene locus_tag LOCUS_t00130 11084 11010 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11157 12545 gene locus_tag LOCUS_06990 11157 12545 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_06990 12627 12785 gene locus_tag LOCUS_07000 12627 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 13478 12879 gene locus_tag LOCUS_07010 13478 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 13614 13778 gene locus_tag LOCUS_07020 13614 13778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 14585 14070 gene locus_tag LOCUS_07030 14585 14070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 15239 14670 gene locus_tag LOCUS_07040 15239 14670 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028374.1 protein_id gnl|my_center|LOCUS_07040 15786 16442 gene locus_tag LOCUS_07050 15786 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 16456 17061 gene locus_tag LOCUS_07060 16456 17061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 17155 17547 gene locus_tag LOCUS_07070 17155 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 17540 18046 gene locus_tag LOCUS_07080 17540 18046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 18058 19263 gene locus_tag LOCUS_07090 18058 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 19318 19986 gene locus_tag LOCUS_07100 19318 19986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 20316 20005 gene locus_tag LOCUS_07110 20316 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 20595 20963 gene locus_tag LOCUS_07120 20595 20963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 21877 21158 gene locus_tag LOCUS_07130 21877 21158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 21971 22750 gene locus_tag LOCUS_07140 21971 22750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256951.1 protein_id gnl|my_center|LOCUS_07140 22881 23264 gene locus_tag LOCUS_07150 22881 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 23369 23884 gene locus_tag LOCUS_07160 23369 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 24566 23889 gene locus_tag LOCUS_07170 gene rpiA 24566 23889 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_07170 25499 24567 gene locus_tag LOCUS_07180 25499 24567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence19 1736 936 gene locus_tag LOCUS_07190 1736 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2476 1733 gene locus_tag LOCUS_07200 gene cobA 2476 1733 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_07200 3408 2473 gene locus_tag LOCUS_07210 gene hemC 3408 2473 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66621 protein_id gnl|my_center|LOCUS_07210 4703 3405 gene locus_tag LOCUS_07220 4703 3405 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_07220 5398 4718 gene locus_tag LOCUS_07230 5398 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 5808 5398 gene locus_tag LOCUS_07240 5808 5398 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_07240 5900 6148 gene locus_tag LOCUS_07250 5900 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 6461 6156 gene locus_tag LOCUS_07260 6461 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 7552 6458 gene locus_tag LOCUS_07270 7552 6458 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_07270 8656 7667 gene locus_tag LOCUS_07280 8656 7667 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709972.1 protein_id gnl|my_center|LOCUS_07280 9298 8666 gene locus_tag LOCUS_07290 9298 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_07290 13983 9388 gene locus_tag LOCUS_07300 13983 9388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 14836 14060 gene locus_tag LOCUS_07310 14836 14060 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYL8 protein_id gnl|my_center|LOCUS_07310 15165 14833 gene locus_tag LOCUS_07320 15165 14833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07320 15876 15211 gene locus_tag LOCUS_07330 15876 15211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07330 16349 16056 gene locus_tag LOCUS_07340 16349 16056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 16900 16394 gene locus_tag LOCUS_07350 16900 16394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 16934 17254 gene locus_tag LOCUS_07360 16934 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 17348 18037 gene locus_tag LOCUS_07370 17348 18037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 18693 18049 gene locus_tag LOCUS_07380 18693 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 18772 19245 gene locus_tag LOCUS_07390 18772 19245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 19598 19242 gene locus_tag LOCUS_07400 19598 19242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 21111 19648 gene locus_tag LOCUS_07410 21111 19648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 21190 21357 gene locus_tag LOCUS_07420 21190 21357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 22478 21600 gene locus_tag LOCUS_07430 22478 21600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 22590 22665 gene locus_tag LOCUS_t00140 22590 22665 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 22788 23534 gene locus_tag LOCUS_07440 22788 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 23524 24183 gene locus_tag LOCUS_07450 23524 24183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence20 45 527 gene locus_tag LOCUS_07460 45 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 555 845 gene locus_tag LOCUS_07470 555 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1000 1734 gene locus_tag LOCUS_07480 1000 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3417 1723 gene locus_tag LOCUS_07490 3417 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3612 3995 gene locus_tag LOCUS_07500 3612 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 4102 5076 gene locus_tag LOCUS_07510 4102 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 5086 5841 gene locus_tag LOCUS_07520 5086 5841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 5931 6419 gene locus_tag LOCUS_07530 5931 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 6471 8024 gene locus_tag LOCUS_07540 6471 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 10125 8005 gene locus_tag LOCUS_07550 10125 8005 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005309.1 protein_id gnl|my_center|LOCUS_07550 10524 10192 gene locus_tag LOCUS_07560 10524 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_07560 10877 10512 gene locus_tag LOCUS_07570 10877 10512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_07570 11220 10888 gene locus_tag LOCUS_07580 11220 10888 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021357.1 protein_id gnl|my_center|LOCUS_07580 11360 12049 gene locus_tag LOCUS_07590 11360 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 12601 12320 gene locus_tag LOCUS_07600 12601 12320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 13784 12609 gene locus_tag LOCUS_07610 13784 12609 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887528.1 protein_id gnl|my_center|LOCUS_07610 14808 13774 gene locus_tag LOCUS_07620 14808 13774 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887529.1 protein_id gnl|my_center|LOCUS_07620 15415 14948 gene locus_tag LOCUS_07630 15415 14948 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887530.1 protein_id gnl|my_center|LOCUS_07630 16343 15564 gene locus_tag LOCUS_07640 gene phnE 16343 15564 CDS product phosphonate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_07640 17082 16315 gene locus_tag LOCUS_07650 gene phnC2 17082 16315 CDS product phosphonates import ATP-binding protein PhnC 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYL7 protein_id gnl|my_center|LOCUS_07650 18044 17091 gene locus_tag LOCUS_07660 18044 17091 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110317.1 protein_id gnl|my_center|LOCUS_07660 18228 18443 gene locus_tag LOCUS_07670 18228 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 18456 19187 gene locus_tag LOCUS_07680 18456 19187 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_07680 19365 19682 gene locus_tag LOCUS_07690 19365 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 19687 20466 gene locus_tag LOCUS_07700 19687 20466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 21163 20600 gene locus_tag LOCUS_07710 21163 20600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 21919 21278 gene locus_tag LOCUS_07720 21919 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 22633 23247 gene locus_tag LOCUS_07730 22633 23247 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496416.1 protein_id gnl|my_center|LOCUS_07730 23348 23262 gene locus_tag LOCUS_t00150 23348 23262 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 23360 23635 gene locus_tag LOCUS_07740 23360 23635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 23637 24875 gene locus_tag LOCUS_07750 23637 24875 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence21 <1 865 gene locus_tag LOCUS_07760 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053651.1:RNA-splicing ligase RtcB 862 1272 gene locus_tag LOCUS_07770 862 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1276 1590 gene locus_tag LOCUS_07780 1276 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2096 1587 gene locus_tag LOCUS_07790 2096 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2718 2918 gene locus_tag LOCUS_07800 2718 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 2911 3147 gene locus_tag LOCUS_07810 2911 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3251 3496 gene locus_tag LOCUS_07820 3251 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 3605 3985 gene locus_tag LOCUS_07830 3605 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4367 4167 gene locus_tag LOCUS_07840 4367 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5293 4370 gene locus_tag LOCUS_07850 5293 4370 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_07850 5649 5365 gene locus_tag LOCUS_07860 5649 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 5873 6046 gene locus_tag LOCUS_07870 5873 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6122 6466 gene locus_tag LOCUS_07880 6122 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7279 6476 gene locus_tag LOCUS_07890 7279 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7389 8018 gene locus_tag LOCUS_07900 7389 8018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 8387 8764 gene locus_tag LOCUS_07910 8387 8764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 8769 9281 gene locus_tag LOCUS_07920 gene ectA 8769 9281 CDS product L-2,4-diaminobutyric acid acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263923.1 protein_id gnl|my_center|LOCUS_07920 9281 10585 gene locus_tag LOCUS_07930 gene ectB 9281 10585 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_07930 10668 10967 gene locus_tag LOCUS_07940 10668 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 10964 11887 gene locus_tag LOCUS_07950 10964 11887 CDS product ectoine hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040098.1 protein_id gnl|my_center|LOCUS_07950 11908 12399 gene locus_tag LOCUS_07960 11908 12399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 12655 12903 gene locus_tag LOCUS_07970 12655 12903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 12969 13220 gene locus_tag LOCUS_07980 12969 13220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 13406 13591 gene locus_tag LOCUS_07990 13406 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 13701 13943 gene locus_tag LOCUS_08000 13701 13943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 14922 13969 gene locus_tag LOCUS_08010 gene thiL 14922 13969 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67883 protein_id gnl|my_center|LOCUS_08010 16204 14906 gene locus_tag LOCUS_08020 16204 14906 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_08020 16258 16331 gene locus_tag LOCUS_t00160 16258 16331 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 16729 16559 gene locus_tag LOCUS_08030 16729 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 16821 17006 gene locus_tag LOCUS_08040 16821 17006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 17289 17008 gene locus_tag LOCUS_08050 17289 17008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 17369 17965 gene locus_tag LOCUS_08060 17369 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 18138 17962 gene locus_tag LOCUS_08070 18138 17962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 20056 18311 gene locus_tag LOCUS_08080 20056 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 20130 20594 gene locus_tag LOCUS_08090 20130 20594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 20668 20596 gene locus_tag LOCUS_t00170 20668 20596 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 20931 20710 gene locus_tag LOCUS_08100 20931 20710 CDS product histone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870446.1 protein_id gnl|my_center|LOCUS_08100 21047 21790 gene locus_tag LOCUS_08110 21047 21790 CDS product deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002458670.1 protein_id gnl|my_center|LOCUS_08110 21822 22148 gene locus_tag LOCUS_08120 21822 22148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 22203 22973 gene locus_tag LOCUS_08130 22203 22973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 23483 22962 gene locus_tag LOCUS_08140 23483 22962 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146480.1 protein_id gnl|my_center|LOCUS_08140 24079 23480 gene locus_tag LOCUS_08150 24079 23480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence22 502 1269 gene locus_tag LOCUS_08160 502 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1304 2293 gene locus_tag LOCUS_08170 gene trxB 1304 2293 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D7P6 protein_id gnl|my_center|LOCUS_08170 2380 3834 gene locus_tag LOCUS_08180 2380 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 4306 4899 gene locus_tag LOCUS_08190 4306 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6187 4949 gene locus_tag LOCUS_08200 6187 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 6766 6275 gene locus_tag LOCUS_08210 6766 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 7905 6766 gene locus_tag LOCUS_08220 7905 6766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_08220 8008 8430 gene locus_tag LOCUS_08230 8008 8430 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089292.1 protein_id gnl|my_center|LOCUS_08230 9456 8431 gene locus_tag LOCUS_08240 9456 8431 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065440.1 protein_id gnl|my_center|LOCUS_08240 9704 9498 gene locus_tag LOCUS_08250 9704 9498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 9834 11000 gene locus_tag LOCUS_08260 gene citA 9834 11000 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S598 protein_id gnl|my_center|LOCUS_08260 11203 10997 gene locus_tag LOCUS_08270 11203 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 11776 11309 gene locus_tag LOCUS_08280 11776 11309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 11863 12255 gene locus_tag LOCUS_08290 11863 12255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 12496 12239 gene locus_tag LOCUS_08300 12496 12239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 13890 12613 gene locus_tag LOCUS_08310 13890 12613 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_08310 13948 14892 gene locus_tag LOCUS_08320 13948 14892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 14996 16090 gene locus_tag LOCUS_08330 14996 16090 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_08330 16111 16743 gene locus_tag LOCUS_08340 16111 16743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 17190 19142 gene locus_tag LOCUS_08350 17190 19142 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_08350 19132 21951 gene locus_tag LOCUS_08360 gene uvrA 19132 21951 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7B1 protein_id gnl|my_center|LOCUS_08360 22002 23555 gene locus_tag LOCUS_08370 22002 23555 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_08370 24159 23557 gene locus_tag LOCUS_08380 24159 23557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence23 1156 2697 gene locus_tag LOCUS_08390 1156 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2701 3153 gene locus_tag LOCUS_08400 2701 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3164 3967 gene locus_tag LOCUS_08410 3164 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338609.1 protein_id gnl|my_center|LOCUS_08410 4140 3964 gene locus_tag LOCUS_08420 4140 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4247 4801 gene locus_tag LOCUS_08430 4247 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5187 4840 gene locus_tag LOCUS_08440 5187 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6955 5237 gene locus_tag LOCUS_08450 6955 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 7108 7302 gene locus_tag LOCUS_08460 7108 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 7919 7317 gene locus_tag LOCUS_08470 7919 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 8092 8280 gene locus_tag LOCUS_08480 8092 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 8823 8410 gene locus_tag LOCUS_08490 8823 8410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 8930 9928 gene locus_tag LOCUS_08500 8930 9928 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_08500 9974 10174 gene locus_tag LOCUS_08510 9974 10174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 10926 10171 gene locus_tag LOCUS_08520 10926 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 10907 11227 gene locus_tag LOCUS_08530 10907 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 11983 11384 gene locus_tag LOCUS_08540 11983 11384 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_08540 12423 11986 gene locus_tag LOCUS_08550 12423 11986 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 protein_id gnl|my_center|LOCUS_08550 12891 12427 gene locus_tag LOCUS_08560 12891 12427 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_08560 13284 12973 gene locus_tag LOCUS_08570 13284 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 14898 13375 gene locus_tag LOCUS_08580 14898 13375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 16138 14960 gene locus_tag LOCUS_08590 16138 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 19993 16190 gene locus_tag LOCUS_08600 19993 16190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 <22868 19993 gene locus_tag LOCUS_08610 <22868 19993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867738.1:DNA-directed RNA polymerase subunit B >Feature sequence24 323 754 gene locus_tag LOCUS_08620 323 754 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_08620 1237 755 gene locus_tag LOCUS_08630 1237 755 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_08630 1727 1272 gene locus_tag LOCUS_08640 1727 1272 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_08640 1876 1730 gene locus_tag LOCUS_08650 1876 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1903 2718 gene locus_tag LOCUS_08660 1903 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869661.1 protein_id gnl|my_center|LOCUS_08660 2715 3014 gene locus_tag LOCUS_08670 2715 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3424 3011 gene locus_tag LOCUS_08680 3424 3011 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_08680 3854 3450 gene locus_tag LOCUS_08690 3854 3450 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_08690 4010 5614 gene locus_tag LOCUS_08700 gene pckA2 4010 5614 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_08700 5723 5902 gene locus_tag LOCUS_08710 5723 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 7674 5899 gene locus_tag LOCUS_08720 7674 5899 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810002.1 protein_id gnl|my_center|LOCUS_08720 8148 7900 gene locus_tag LOCUS_08730 8148 7900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 8809 8429 gene locus_tag LOCUS_08740 8809 8429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 8952 9539 gene locus_tag LOCUS_08750 8952 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 11560 9497 gene locus_tag LOCUS_08760 11560 9497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 11643 12725 gene locus_tag LOCUS_08770 11643 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 12773 13393 gene locus_tag LOCUS_08780 gene sodA 12773 13393 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_08780 13803 13411 gene locus_tag LOCUS_08790 13803 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 13859 14281 gene locus_tag LOCUS_08800 13859 14281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14291 15676 gene locus_tag LOCUS_08810 14291 15676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 15673 16578 gene locus_tag LOCUS_08820 gene argF 15673 16578 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18186 protein_id gnl|my_center|LOCUS_08820 16836 16579 gene locus_tag LOCUS_08830 16836 16579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 16984 17727 gene locus_tag LOCUS_08840 16984 17727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 18059 18424 gene locus_tag LOCUS_08850 18059 18424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_08850 18412 18744 gene locus_tag LOCUS_08860 18412 18744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461986.1 protein_id gnl|my_center|LOCUS_08860 20221 18785 gene locus_tag LOCUS_08870 20221 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 20551 21519 gene locus_tag LOCUS_08880 20551 21519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence25 23 982 gene locus_tag LOCUS_08890 23 982 CDS product 2-oxoacid ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_08890 1037 1324 gene locus_tag LOCUS_08900 1037 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2015 1464 gene locus_tag LOCUS_08910 2015 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2793 2245 gene locus_tag LOCUS_08920 2793 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3625 2855 gene locus_tag LOCUS_08930 gene cofE 3625 2855 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065736.1 protein_id gnl|my_center|LOCUS_08930 3693 4970 gene locus_tag LOCUS_08940 gene leuC 3693 4970 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67078 protein_id gnl|my_center|LOCUS_08940 4967 5449 gene locus_tag LOCUS_08950 4967 5449 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_08950 5460 6875 gene locus_tag LOCUS_08960 gene leuC 5460 6875 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA7 protein_id gnl|my_center|LOCUS_08960 6872 7456 gene locus_tag LOCUS_08970 gene leuD 6872 7456 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94568 protein_id gnl|my_center|LOCUS_08970 8159 7434 gene locus_tag LOCUS_08980 8159 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8611 8162 gene locus_tag LOCUS_08990 8611 8162 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_08990 9063 8608 gene locus_tag LOCUS_09000 9063 8608 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867656.1 protein_id gnl|my_center|LOCUS_09000 9403 9056 gene locus_tag LOCUS_09010 9403 9056 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 protein_id gnl|my_center|LOCUS_09010 10077 9451 gene locus_tag LOCUS_09020 10077 9451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 10165 10851 gene locus_tag LOCUS_09030 10165 10851 CDS product rRNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_09030 10848 11531 gene locus_tag LOCUS_09040 10848 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 11534 12268 gene locus_tag LOCUS_09050 11534 12268 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_09050 12268 13086 gene locus_tag LOCUS_09060 12268 13086 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053857.1 protein_id gnl|my_center|LOCUS_09060 13088 13297 gene locus_tag LOCUS_09070 13088 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 13284 13526 gene locus_tag LOCUS_09080 13284 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 13552 13956 gene locus_tag LOCUS_09090 13552 13956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 13986 14672 gene locus_tag LOCUS_09100 13986 14672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 14708 15466 gene locus_tag LOCUS_09110 14708 15466 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986927.1 protein_id gnl|my_center|LOCUS_09110 15931 15425 gene locus_tag LOCUS_09120 15931 15425 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496839.1 protein_id gnl|my_center|LOCUS_09120 16751 15921 gene locus_tag LOCUS_09130 16751 15921 CDS product inorganic polyphosphate/ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_09130 16833 17678 gene locus_tag LOCUS_09140 16833 17678 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJI0 protein_id gnl|my_center|LOCUS_09140 17656 17991 gene locus_tag LOCUS_09150 17656 17991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 18062 18997 gene locus_tag LOCUS_09160 18062 18997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 19065 21086 gene locus_tag LOCUS_09170 19065 21086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence26 2126 33 gene locus_tag LOCUS_09180 2126 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2225 2758 gene locus_tag LOCUS_09190 2225 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3248 2760 gene locus_tag LOCUS_09200 3248 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4030 3287 gene locus_tag LOCUS_09210 4030 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 5688 4030 gene locus_tag LOCUS_09220 5688 4030 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868104.1 protein_id gnl|my_center|LOCUS_09220 6892 5723 gene locus_tag LOCUS_09230 6892 5723 CDS product S-adenosyl-L-homocysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_09230 7033 7347 gene locus_tag LOCUS_09240 gene hcaC 7033 7347 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_09240 7692 7375 gene locus_tag LOCUS_09250 7692 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 7954 8568 gene locus_tag LOCUS_09260 7954 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09260 8576 9964 gene locus_tag LOCUS_09270 gene cysS 8576 9964 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YID4 protein_id gnl|my_center|LOCUS_09270 9928 10110 gene locus_tag LOCUS_09280 9928 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 10070 10297 gene locus_tag LOCUS_09290 10070 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 10294 10614 gene locus_tag LOCUS_09300 10294 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 10611 11897 gene locus_tag LOCUS_09310 10611 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 12328 12561 gene locus_tag LOCUS_09320 12328 12561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 13955 12744 gene locus_tag LOCUS_09330 gene ychF 13955 12744 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_09330 14358 13999 gene locus_tag LOCUS_09340 14358 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 14770 14360 gene locus_tag LOCUS_09350 14770 14360 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_09350 14853 15368 gene locus_tag LOCUS_09360 14853 15368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 15909 15373 gene locus_tag LOCUS_09370 15909 15373 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875902.1 protein_id gnl|my_center|LOCUS_09370 15993 16985 gene locus_tag LOCUS_09380 15993 16985 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_09380 17318 16977 gene locus_tag LOCUS_09390 17318 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 17431 18855 gene locus_tag LOCUS_09400 17431 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 19457 18873 gene locus_tag LOCUS_09410 19457 18873 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_09410 19753 19481 gene locus_tag LOCUS_09420 19753 19481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 20572 19757 gene locus_tag LOCUS_09430 20572 19757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 20913 21767 gene locus_tag LOCUS_09440 gene tfb 20913 21767 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence27 926 147 gene locus_tag LOCUS_09450 gene crt2 926 147 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_09450 3063 946 gene locus_tag LOCUS_09460 3063 946 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085943.1 protein_id gnl|my_center|LOCUS_09460 3789 3106 gene locus_tag LOCUS_09470 3789 3106 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080220.1 protein_id gnl|my_center|LOCUS_09470 3840 4217 gene locus_tag LOCUS_09480 3840 4217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5507 4224 gene locus_tag LOCUS_09490 5507 4224 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_09490 5999 5601 gene locus_tag LOCUS_09500 5999 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 6125 6850 gene locus_tag LOCUS_09510 6125 6850 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_09510 6909 7601 gene locus_tag LOCUS_09520 gene menG 6909 7601 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHX3 protein_id gnl|my_center|LOCUS_09520 7598 8755 gene locus_tag LOCUS_09530 7598 8755 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990057.1 protein_id gnl|my_center|LOCUS_09530 8780 9133 gene locus_tag LOCUS_09540 8780 9133 CDS product Sec-independent protein secretion pathway component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_09540 9945 9136 gene locus_tag LOCUS_09550 9945 9136 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DVI3 protein_id gnl|my_center|LOCUS_09550 10177 9983 gene locus_tag LOCUS_09560 10177 9983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 10437 12182 gene locus_tag LOCUS_09570 10437 12182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09570 12303 12887 gene locus_tag LOCUS_09580 12303 12887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 13051 12890 gene locus_tag LOCUS_09590 13051 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 13042 14454 gene locus_tag LOCUS_09600 13042 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 14467 15297 gene locus_tag LOCUS_09610 gene ydfG 14467 15297 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588802.1 protein_id gnl|my_center|LOCUS_09610 15368 16936 gene locus_tag LOCUS_09620 15368 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 17242 18042 gene locus_tag LOCUS_09630 17242 18042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 18921 18319 gene locus_tag LOCUS_09640 18921 18319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 19121 19441 gene locus_tag LOCUS_09650 19121 19441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 19586 20302 gene locus_tag LOCUS_09660 19586 20302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 20439 20648 gene locus_tag LOCUS_09670 20439 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 20660 21064 gene locus_tag LOCUS_09680 20660 21064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 21134 21230 gene locus_tag LOCUS_t00180 21134 21230 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence28 470 1306 gene locus_tag LOCUS_09690 470 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869902.1 protein_id gnl|my_center|LOCUS_09690 1303 2247 gene locus_tag LOCUS_09700 1303 2247 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870599.1 protein_id gnl|my_center|LOCUS_09700 2271 3014 gene locus_tag LOCUS_09710 2271 3014 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_09710 3015 3656 gene locus_tag LOCUS_09720 3015 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3653 4630 gene locus_tag LOCUS_09730 3653 4630 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980132.1 protein_id gnl|my_center|LOCUS_09730 4632 6344 gene locus_tag LOCUS_09740 4632 6344 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_09740 6350 7213 gene locus_tag LOCUS_09750 6350 7213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181553.1 protein_id gnl|my_center|LOCUS_09750 8027 7215 gene locus_tag LOCUS_09760 8027 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 8078 8386 gene locus_tag LOCUS_09770 gene hcaC 8078 8386 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_09770 8411 8680 gene locus_tag LOCUS_09780 8411 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_09780 8700 9449 gene locus_tag LOCUS_09790 8700 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 9488 9835 gene locus_tag LOCUS_09800 9488 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10172 9870 gene locus_tag LOCUS_09810 10172 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 11042 10284 gene locus_tag LOCUS_09820 11042 10284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 11597 11328 gene locus_tag LOCUS_09830 11597 11328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 12285 11932 gene locus_tag LOCUS_09840 12285 11932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 12450 12378 gene locus_tag LOCUS_t00190 12450 12378 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12728 13744 gene locus_tag LOCUS_09850 gene corA 12728 13744 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLT7 protein_id gnl|my_center|LOCUS_09850 14557 13760 gene locus_tag LOCUS_09860 14557 13760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 15536 14568 gene locus_tag LOCUS_09870 gene dusB 15536 14568 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_09870 18293 15558 gene locus_tag LOCUS_09880 18293 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 21529 18461 gene locus_tag LOCUS_09890 21529 18461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence29 <1 676 gene locus_tag LOCUS_09900 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878987.1:50S ribosomal protein L1 669 1535 gene locus_tag LOCUS_09910 669 1535 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870010.1 protein_id gnl|my_center|LOCUS_09910 2167 1532 gene locus_tag LOCUS_09920 2167 1532 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939941.1 protein_id gnl|my_center|LOCUS_09920 2552 2241 gene locus_tag LOCUS_09930 2552 2241 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_09930 3330 2815 gene locus_tag LOCUS_09940 3330 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3881 3417 gene locus_tag LOCUS_09950 3881 3417 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809130.1 protein_id gnl|my_center|LOCUS_09950 3987 4280 gene locus_tag LOCUS_09960 3987 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 4398 6623 gene locus_tag LOCUS_09970 4398 6623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460248.1 protein_id gnl|my_center|LOCUS_09970 6944 6630 gene locus_tag LOCUS_09980 6944 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 7272 9944 gene locus_tag LOCUS_09990 7272 9944 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_09990 9949 12813 gene locus_tag LOCUS_10000 gene leuS 9949 12813 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_10000 13162 13725 gene locus_tag LOCUS_10010 13162 13725 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_10010 13762 14127 gene locus_tag LOCUS_10020 13762 14127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979704.1 protein_id gnl|my_center|LOCUS_10020 14830 14129 gene locus_tag LOCUS_10030 14830 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 15100 14924 gene locus_tag LOCUS_10040 15100 14924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 15236 15574 gene locus_tag LOCUS_10050 15236 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 16251 15586 gene locus_tag LOCUS_10060 16251 15586 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_10060 17216 16248 gene locus_tag LOCUS_10070 17216 16248 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_10070 18898 17213 gene locus_tag LOCUS_10080 18898 17213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 19247 19017 gene locus_tag LOCUS_10090 19247 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 19189 19389 gene locus_tag LOCUS_10100 19189 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 19464 19670 gene locus_tag LOCUS_10110 19464 19670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 19799 20176 gene locus_tag LOCUS_10120 19799 20176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence30 1173 670 gene locus_tag LOCUS_10130 1173 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1899 1261 gene locus_tag LOCUS_10140 1899 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2246 2533 gene locus_tag LOCUS_10150 2246 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2537 3568 gene locus_tag LOCUS_10160 2537 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3565 4581 gene locus_tag LOCUS_10170 3565 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4619 4813 gene locus_tag LOCUS_10180 4619 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4852 5565 gene locus_tag LOCUS_10190 4852 5565 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877948.1 protein_id gnl|my_center|LOCUS_10190 5572 6171 gene locus_tag LOCUS_10200 5572 6171 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_10200 6214 6567 gene locus_tag LOCUS_10210 6214 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 7235 6564 gene locus_tag LOCUS_10220 7235 6564 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 protein_id gnl|my_center|LOCUS_10220 8155 7241 gene locus_tag LOCUS_10230 8155 7241 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496725.1 protein_id gnl|my_center|LOCUS_10230 8914 8156 gene locus_tag LOCUS_10240 8914 8156 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_10240 8983 9987 gene locus_tag LOCUS_10250 8983 9987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 10023 10820 gene locus_tag LOCUS_10260 10023 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 11217 10822 gene locus_tag LOCUS_10270 11217 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 11537 11229 gene locus_tag LOCUS_10280 11537 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 11655 11479 gene locus_tag LOCUS_10290 11655 11479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 12944 11700 gene locus_tag LOCUS_10300 12944 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 14081 12963 gene locus_tag LOCUS_10310 14081 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 14168 14887 gene locus_tag LOCUS_10320 14168 14887 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_10320 14892 16037 gene locus_tag LOCUS_10330 14892 16037 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_10330 16068 16742 gene locus_tag LOCUS_10340 16068 16742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 17388 16723 gene locus_tag LOCUS_10350 17388 16723 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876402.1 protein_id gnl|my_center|LOCUS_10350 18062 17385 gene locus_tag LOCUS_10360 18062 17385 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980489.1 protein_id gnl|my_center|LOCUS_10360 18784 18059 gene locus_tag LOCUS_10370 18784 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 18907 19086 gene locus_tag LOCUS_10380 18907 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence31 1096 1482 gene locus_tag LOCUS_10390 1096 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1799 2098 gene locus_tag LOCUS_10400 1799 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 2509 2108 gene locus_tag LOCUS_10410 2509 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2665 3279 gene locus_tag LOCUS_10420 2665 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3963 3283 gene locus_tag LOCUS_10430 3963 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 4210 4004 gene locus_tag LOCUS_10440 4210 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 4392 4603 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acaaaaaagggtacgacaaa 5542 5466 gene locus_tag LOCUS_t00200 5542 5466 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5619 6629 gene locus_tag LOCUS_10450 5619 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6645 8087 gene locus_tag LOCUS_10460 6645 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 8445 9359 gene locus_tag LOCUS_10470 8445 9359 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_10470 9548 10102 gene locus_tag LOCUS_10480 9548 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 10462 10094 gene locus_tag LOCUS_10490 10462 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 11259 12695 gene locus_tag LOCUS_10500 11259 12695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 12965 12696 gene locus_tag LOCUS_10510 12965 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 13232 13053 gene locus_tag LOCUS_10520 13232 13053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 14602 13979 gene locus_tag LOCUS_10530 14602 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 15288 14698 gene locus_tag LOCUS_10540 15288 14698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 15558 17318 gene locus_tag LOCUS_10550 15558 17318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 17318 17674 gene locus_tag LOCUS_10560 17318 17674 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879738.1 protein_id gnl|my_center|LOCUS_10560 18099 17671 gene locus_tag LOCUS_10570 18099 17671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence32 125 655 gene locus_tag LOCUS_10580 125 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 3532 1160 gene locus_tag LOCUS_10590 3532 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259586.1 protein_id gnl|my_center|LOCUS_10590 3828 3691 gene locus_tag LOCUS_10600 3828 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 4709 4479 gene locus_tag LOCUS_10610 4709 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 5148 4807 gene locus_tag LOCUS_10620 5148 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 6708 5290 gene locus_tag LOCUS_10630 6708 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979621.1 protein_id gnl|my_center|LOCUS_10630 7208 6714 gene locus_tag LOCUS_10640 7208 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 8082 7255 gene locus_tag LOCUS_10650 8082 7255 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979622.1 protein_id gnl|my_center|LOCUS_10650 8456 8148 gene locus_tag LOCUS_10660 8456 8148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 8628 8476 gene locus_tag LOCUS_10670 8628 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 8931 8683 gene locus_tag LOCUS_10680 8931 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 9492 9629 gene locus_tag LOCUS_10690 9492 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 10319 9660 gene locus_tag LOCUS_10700 10319 9660 CDS product PhoU family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763249.1 protein_id gnl|my_center|LOCUS_10700 11152 10319 gene locus_tag LOCUS_10710 gene pstB 11152 10319 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYZ3 protein_id gnl|my_center|LOCUS_10710 12075 11149 gene locus_tag LOCUS_10720 12075 11149 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG4 protein_id gnl|my_center|LOCUS_10720 13043 12072 gene locus_tag LOCUS_10730 gene pstC 13043 12072 CDS product phosphate transport system permease protein PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45191 protein_id gnl|my_center|LOCUS_10730 13171 14205 gene locus_tag LOCUS_10740 13171 14205 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755922.1 protein_id gnl|my_center|LOCUS_10740 14860 14219 gene locus_tag LOCUS_10750 14860 14219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 16245 15001 gene locus_tag LOCUS_10760 16245 15001 CDS product phosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1K8 protein_id gnl|my_center|LOCUS_10760 16383 16676 gene locus_tag LOCUS_10770 16383 16676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 17545 16682 gene locus_tag LOCUS_10780 17545 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_10780 17743 18054 gene locus_tag LOCUS_10790 17743 18054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 18556 18035 gene locus_tag LOCUS_10800 18556 18035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence33 1020 676 gene locus_tag LOCUS_10810 1020 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1471 1022 gene locus_tag LOCUS_10820 1471 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3184 1472 gene locus_tag LOCUS_10830 3184 1472 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_10830 3279 3788 gene locus_tag LOCUS_10840 3279 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 3829 4080 gene locus_tag LOCUS_10850 3829 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4114 4980 gene locus_tag LOCUS_10860 gene bcpA 4114 4980 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_10860 5289 5002 gene locus_tag LOCUS_10870 5289 5002 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_10870 5397 5948 gene locus_tag LOCUS_10880 5397 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 6024 5950 gene locus_tag LOCUS_t00210 6024 5950 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6156 6998 gene locus_tag LOCUS_10890 6156 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7047 7120 gene locus_tag LOCUS_t00220 7047 7120 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7169 7771 gene locus_tag LOCUS_10900 7169 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 7982 7779 gene locus_tag LOCUS_10910 7982 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 8081 8998 gene locus_tag LOCUS_10920 8081 8998 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_10920 8998 9933 gene locus_tag LOCUS_10930 8998 9933 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_10930 9930 10199 gene locus_tag LOCUS_10940 9930 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_10940 10206 10682 gene locus_tag LOCUS_10950 10206 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 10844 10683 gene locus_tag LOCUS_10960 10844 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 11123 10893 gene locus_tag LOCUS_10970 11123 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 12112 11120 gene locus_tag LOCUS_10980 12112 11120 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_10980 14239 12113 gene locus_tag LOCUS_10990 14239 12113 CDS product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_10990 16320 14236 gene locus_tag LOCUS_11000 16320 14236 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_11000 16832 16317 gene locus_tag LOCUS_11010 16832 16317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 16945 17913 gene locus_tag LOCUS_11020 16945 17913 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762410.1 protein_id gnl|my_center|LOCUS_11020 17998 17914 gene locus_tag LOCUS_t00230 17998 17914 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence34 <1 777 gene locus_tag LOCUS_11030 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876325.1:proteasome endopeptidase complex,subunit alpha 809 991 gene locus_tag LOCUS_11040 809 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1313 1609 gene locus_tag LOCUS_11050 1313 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1758 1925 gene locus_tag LOCUS_11060 1758 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1883 2875 gene locus_tag LOCUS_11070 1883 2875 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_11070 2875 3687 gene locus_tag LOCUS_11080 2875 3687 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_11080 3684 3950 gene locus_tag LOCUS_11090 3684 3950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3992 4387 gene locus_tag LOCUS_11100 3992 4387 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_11100 4393 4851 gene locus_tag LOCUS_11110 4393 4851 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_11110 4854 5606 gene locus_tag LOCUS_11120 4854 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5606 5809 gene locus_tag LOCUS_11130 5606 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5806 6072 gene locus_tag LOCUS_11140 5806 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 6069 6398 gene locus_tag LOCUS_11150 6069 6398 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_11150 6398 6832 gene locus_tag LOCUS_11160 6398 6832 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_11160 6834 7358 gene locus_tag LOCUS_11170 6834 7358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 7361 8077 gene locus_tag LOCUS_11180 7361 8077 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_11180 8084 8602 gene locus_tag LOCUS_11190 8084 8602 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978390.1 protein_id gnl|my_center|LOCUS_11190 8783 9175 gene locus_tag LOCUS_11200 8783 9175 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_11200 9165 9722 gene locus_tag LOCUS_11210 9165 9722 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875661.1 protein_id gnl|my_center|LOCUS_11210 9731 10018 gene locus_tag LOCUS_11220 9731 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 10089 10164 gene locus_tag LOCUS_t00240 10089 10164 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 10330 10587 gene locus_tag LOCUS_11230 10330 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 10611 10841 gene locus_tag LOCUS_11240 10611 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 10944 11384 gene locus_tag LOCUS_11250 10944 11384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 11445 11597 gene locus_tag LOCUS_11260 11445 11597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11900 12385 gene locus_tag LOCUS_11270 11900 12385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 12498 12767 gene locus_tag LOCUS_11280 12498 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 13402 12995 gene locus_tag LOCUS_11290 13402 12995 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_11290 13715 13404 gene locus_tag LOCUS_11300 13715 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 14288 13758 gene locus_tag LOCUS_11310 14288 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 15400 14576 gene locus_tag LOCUS_11320 gene purC 15400 14576 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMH6 protein_id gnl|my_center|LOCUS_11320 15828 15442 gene locus_tag LOCUS_11330 15828 15442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 16145 15864 gene locus_tag LOCUS_11340 16145 15864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_11340 16495 16187 gene locus_tag LOCUS_11350 16495 16187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 16750 16505 gene locus_tag LOCUS_11360 16750 16505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 17633 16752 gene locus_tag LOCUS_11370 17633 16752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence35 95 394 gene locus_tag LOCUS_11380 95 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 880 413 gene locus_tag LOCUS_11390 880 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1311 3191 gene locus_tag LOCUS_11400 1311 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3236 3601 gene locus_tag LOCUS_11410 3236 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4320 3598 gene locus_tag LOCUS_11420 4320 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4514 4711 gene locus_tag LOCUS_11430 4514 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 4755 6071 gene locus_tag LOCUS_11440 4755 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 6141 6377 gene locus_tag LOCUS_11450 6141 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 6438 6995 gene locus_tag LOCUS_11460 6438 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 7010 7999 gene locus_tag LOCUS_11470 7010 7999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8443 8177 gene locus_tag LOCUS_11480 8443 8177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 9226 8579 gene locus_tag LOCUS_11490 9226 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 9496 9287 gene locus_tag LOCUS_11500 9496 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 9573 9851 gene locus_tag LOCUS_11510 9573 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 10312 9848 gene locus_tag LOCUS_11520 10312 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10389 11390 gene locus_tag LOCUS_11530 10389 11390 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_11530 11445 12107 gene locus_tag LOCUS_11540 11445 12107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 12088 12810 gene locus_tag LOCUS_11550 12088 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 13224 12799 gene locus_tag LOCUS_11560 13224 12799 CDS product diadenosine 5'5'''-P1,P4-tetraphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_11560 13914 13231 gene locus_tag LOCUS_11570 13914 13231 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_11570 15239 14094 gene locus_tag LOCUS_11580 15239 14094 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_11580 15812 15318 gene locus_tag LOCUS_11590 15812 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 16272 16694 gene locus_tag LOCUS_11600 16272 16694 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_11600 16691 16990 gene locus_tag LOCUS_11610 16691 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 >Feature sequence36 1563 1045 gene locus_tag LOCUS_11620 1563 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1677 2462 gene locus_tag LOCUS_11630 1677 2462 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_11630 2501 2923 gene locus_tag LOCUS_11640 2501 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2920 3336 gene locus_tag LOCUS_11650 2920 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 4456 3383 gene locus_tag LOCUS_11660 gene phaC 4456 3383 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206335.1 protein_id gnl|my_center|LOCUS_11660 4934 4458 gene locus_tag LOCUS_11670 4934 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 5090 5449 gene locus_tag LOCUS_11680 5090 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 5494 6426 gene locus_tag LOCUS_11690 5494 6426 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_11690 6791 6417 gene locus_tag LOCUS_11700 6791 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 6867 7532 gene locus_tag LOCUS_11710 6867 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 8086 7529 gene locus_tag LOCUS_11720 8086 7529 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EY6 protein_id gnl|my_center|LOCUS_11720 8642 8088 gene locus_tag LOCUS_11730 8642 8088 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_11730 10044 8620 gene locus_tag LOCUS_11740 10044 8620 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867352.1 protein_id gnl|my_center|LOCUS_11740 10289 10083 gene locus_tag LOCUS_11750 10289 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 12163 10289 gene locus_tag LOCUS_11760 12163 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 12229 12591 gene locus_tag LOCUS_11770 12229 12591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 12628 12990 gene locus_tag LOCUS_11780 12628 12990 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_11780 13049 14866 gene locus_tag LOCUS_11790 13049 14866 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875885.1 protein_id gnl|my_center|LOCUS_11790 15239 14853 gene locus_tag LOCUS_11800 gene mntR 15239 14853 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y623 protein_id gnl|my_center|LOCUS_11800 15442 15789 gene locus_tag LOCUS_11810 15442 15789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 15861 16328 gene locus_tag LOCUS_11820 15861 16328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 16369 16998 gene locus_tag LOCUS_11830 16369 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence37 <1 952 gene locus_tag LOCUS_11840 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761845.1:4-demethylwyosine synthase TYW1 1460 915 gene locus_tag LOCUS_11850 1460 915 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_11850 2100 1465 gene locus_tag LOCUS_11860 2100 1465 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868707.1 protein_id gnl|my_center|LOCUS_11860 2124 2450 gene locus_tag LOCUS_11870 2124 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3427 2444 gene locus_tag LOCUS_11880 3427 2444 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763615.1 protein_id gnl|my_center|LOCUS_11880 4616 3429 gene locus_tag LOCUS_11890 gene ychF 4616 3429 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_11890 4689 5240 gene locus_tag LOCUS_11900 4689 5240 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978114.1 protein_id gnl|my_center|LOCUS_11900 5274 6785 gene locus_tag LOCUS_11910 5274 6785 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_11910 7119 6817 gene locus_tag LOCUS_11920 7119 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7716 7498 gene locus_tag LOCUS_11930 7716 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 7829 9094 gene locus_tag LOCUS_11940 7829 9094 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_11940 9095 9937 gene locus_tag LOCUS_11950 9095 9937 CDS product 8-oxoguanine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_11950 9971 10046 gene locus_tag LOCUS_t00250 9971 10046 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10091 10438 gene locus_tag LOCUS_11960 10091 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 10899 10435 gene locus_tag LOCUS_11970 10899 10435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 12528 10948 gene locus_tag LOCUS_11980 12528 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 13117 12509 gene locus_tag LOCUS_11990 13117 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 16852 13268 gene locus_tag LOCUS_12000 16852 13268 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762428.1 protein_id gnl|my_center|LOCUS_12000 16824 16973 gene locus_tag LOCUS_12010 16824 16973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence38 16 378 gene locus_tag LOCUS_12020 16 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1336 899 gene locus_tag LOCUS_12030 1336 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1544 2215 gene locus_tag LOCUS_12040 1544 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2786 2247 gene locus_tag LOCUS_12050 gene drga 2786 2247 CDS product reductase DrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_12050 4272 2908 gene locus_tag LOCUS_12060 gene phrB 4272 2908 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403840.1 protein_id gnl|my_center|LOCUS_12060 4595 5170 gene locus_tag LOCUS_12070 4595 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 5181 5537 gene locus_tag LOCUS_12080 5181 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 5633 5989 gene locus_tag LOCUS_12090 5633 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6591 6028 gene locus_tag LOCUS_12100 6591 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 6708 6893 gene locus_tag LOCUS_12110 6708 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6907 7272 gene locus_tag LOCUS_12120 6907 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 8051 7278 gene locus_tag LOCUS_12130 8051 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 8338 8054 gene locus_tag LOCUS_12140 8338 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 9231 8335 gene locus_tag LOCUS_12150 gene tfb 9231 8335 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867803.1 protein_id gnl|my_center|LOCUS_12150 9599 9937 gene locus_tag LOCUS_12160 9599 9937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 10058 10258 gene locus_tag LOCUS_12170 10058 10258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 10261 11637 gene locus_tag LOCUS_12180 10261 11637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 11717 12109 gene locus_tag LOCUS_12190 11717 12109 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870063.1 protein_id gnl|my_center|LOCUS_12190 12106 12675 gene locus_tag LOCUS_12200 12106 12675 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 protein_id gnl|my_center|LOCUS_12200 13366 12683 gene locus_tag LOCUS_12210 13366 12683 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_12210 13734 13369 gene locus_tag LOCUS_12220 13734 13369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 13901 14896 gene locus_tag LOCUS_12230 13901 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 15728 14901 gene locus_tag LOCUS_12240 15728 14901 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence39 1150 692 gene locus_tag LOCUS_12250 1150 692 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867694.1 protein_id gnl|my_center|LOCUS_12250 2371 1238 gene locus_tag LOCUS_12260 2371 1238 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_12260 2561 3484 gene locus_tag LOCUS_12270 2561 3484 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_12270 3481 4320 gene locus_tag LOCUS_12280 3481 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4317 5285 gene locus_tag LOCUS_12290 4317 5285 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_12290 5278 6006 gene locus_tag LOCUS_12300 5278 6006 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_12300 6003 6584 gene locus_tag LOCUS_12310 6003 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 6764 6567 gene locus_tag LOCUS_12320 6764 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 7042 6761 gene locus_tag LOCUS_12330 7042 6761 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_12330 7113 8876 gene locus_tag LOCUS_12340 gene adeC 7113 8876 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYI7 protein_id gnl|my_center|LOCUS_12340 8918 10549 gene locus_tag LOCUS_12350 8918 10549 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251253.1 protein_id gnl|my_center|LOCUS_12350 10590 11453 gene locus_tag LOCUS_12360 10590 11453 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931702.1 protein_id gnl|my_center|LOCUS_12360 11833 11450 gene locus_tag LOCUS_12370 11833 11450 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_12370 11982 11815 gene locus_tag LOCUS_12380 11982 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 12995 12093 gene locus_tag LOCUS_12390 12995 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence40 1254 1469 gene locus_tag LOCUS_12400 1254 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 2707 1466 gene locus_tag LOCUS_12410 2707 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 2913 2839 gene locus_tag LOCUS_t00260 2913 2839 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3562 2960 gene locus_tag LOCUS_12420 3562 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3679 4182 gene locus_tag LOCUS_12430 3679 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4618 4172 gene locus_tag LOCUS_12440 4618 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5571 4621 gene locus_tag LOCUS_12450 5571 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 7110 5581 gene locus_tag LOCUS_12460 gene ctaD 7110 5581 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31833 protein_id gnl|my_center|LOCUS_12460 7579 7148 gene locus_tag LOCUS_12470 7579 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 7846 7583 gene locus_tag LOCUS_12480 7846 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 8528 7905 gene locus_tag LOCUS_12490 8528 7905 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846725.1 protein_id gnl|my_center|LOCUS_12490 8582 9253 gene locus_tag LOCUS_12500 8582 9253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_12500 9254 9487 gene locus_tag LOCUS_12510 9254 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 9471 9872 gene locus_tag LOCUS_12520 9471 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 11041 9866 gene locus_tag LOCUS_12530 11041 9866 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_12530 11087 11161 gene locus_tag LOCUS_t00270 11087 11161 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11217 11708 gene locus_tag LOCUS_12540 11217 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 12262 11672 gene locus_tag LOCUS_12550 12262 11672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 12311 12613 gene locus_tag LOCUS_12560 12311 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 12799 13449 gene locus_tag LOCUS_12570 12799 13449 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080200.1 protein_id gnl|my_center|LOCUS_12570 14087 13446 gene locus_tag LOCUS_12580 14087 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 <15075 14127 gene locus_tag LOCUS_12590 <15075 14127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877877.1:S-methyl-5-thioribose-1-phosphate isomerase >Feature sequence41 2356 1145 gene locus_tag LOCUS_12600 2356 1145 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878058.1 protein_id gnl|my_center|LOCUS_12600 2531 3040 gene locus_tag LOCUS_12610 2531 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3369 3037 gene locus_tag LOCUS_12620 3369 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 4195 3392 gene locus_tag LOCUS_12630 4195 3392 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869910.1 protein_id gnl|my_center|LOCUS_12630 4896 4192 gene locus_tag LOCUS_12640 gene hisA 4896 4192 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C71 protein_id gnl|my_center|LOCUS_12640 5501 4893 gene locus_tag LOCUS_12650 gene hisH 5501 4893 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KI0 protein_id gnl|my_center|LOCUS_12650 6088 5501 gene locus_tag LOCUS_12660 gene hisB 6088 5501 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBH1 protein_id gnl|my_center|LOCUS_12660 7082 6108 gene locus_tag LOCUS_12670 7082 6108 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_12670 8149 7079 gene locus_tag LOCUS_12680 gene hisC 8149 7079 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2C4 protein_id gnl|my_center|LOCUS_12680 9417 8146 gene locus_tag LOCUS_12690 gene hisD 9417 8146 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023136.1 protein_id gnl|my_center|LOCUS_12690 10391 9417 gene locus_tag LOCUS_12700 gene hisG 10391 9417 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ68 protein_id gnl|my_center|LOCUS_12700 11685 10429 gene locus_tag LOCUS_12710 11685 10429 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_12710 12782 11685 gene locus_tag LOCUS_12720 12782 11685 CDS product glucose sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_12720 14320 12956 gene locus_tag LOCUS_12730 14320 12956 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066507.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence42 1177 269 gene locus_tag LOCUS_12740 1177 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1453 2277 gene locus_tag LOCUS_12750 gene mqnD 1453 2277 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_12750 2304 2594 gene locus_tag LOCUS_12760 2304 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2633 2917 gene locus_tag LOCUS_12770 2633 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2952 3263 gene locus_tag LOCUS_12780 2952 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4357 3260 gene locus_tag LOCUS_12790 4357 3260 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_12790 4410 4583 gene locus_tag LOCUS_12800 4410 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5037 4570 gene locus_tag LOCUS_12810 5037 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 5352 5125 gene locus_tag LOCUS_12820 5352 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12820 5422 5808 gene locus_tag LOCUS_12830 5422 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 5887 6324 gene locus_tag LOCUS_12840 5887 6324 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_12840 6335 6880 gene locus_tag LOCUS_12850 6335 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 7272 6877 gene locus_tag LOCUS_12860 7272 6877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7529 7329 gene locus_tag LOCUS_12870 7529 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 7696 8289 gene locus_tag LOCUS_12880 7696 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 8432 9709 gene locus_tag LOCUS_12890 8432 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 9714 11189 gene locus_tag LOCUS_12900 9714 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 11194 11658 gene locus_tag LOCUS_12910 11194 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 12436 11651 gene locus_tag LOCUS_12920 12436 11651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 12543 12722 gene locus_tag LOCUS_12930 12543 12722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 13294 12749 gene locus_tag LOCUS_12940 13294 12749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence43 <1 1096 gene locus_tag LOCUS_12950 <1 1096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980304.1:oxidoreductase 1100 3169 gene locus_tag LOCUS_12960 1100 3169 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_12960 3181 4665 gene locus_tag LOCUS_12970 3181 4665 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_12970 5506 4655 gene locus_tag LOCUS_12980 5506 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 5725 6360 gene locus_tag LOCUS_12990 5725 6360 CDS product PqqC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z7E5 protein_id gnl|my_center|LOCUS_12990 6405 6478 gene locus_tag LOCUS_t00280 6405 6478 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7197 6589 gene locus_tag LOCUS_13000 7197 6589 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_13000 7248 8330 gene locus_tag LOCUS_13010 7248 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 9446 8322 gene locus_tag LOCUS_13020 9446 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 9497 9997 gene locus_tag LOCUS_13030 9497 9997 CDS product ribosomal-protein-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762816.1 protein_id gnl|my_center|LOCUS_13030 11093 10254 gene locus_tag LOCUS_13040 11093 10254 CDS product tRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_13040 12874 11090 gene locus_tag LOCUS_13050 12874 11090 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_13050 12976 13087 gene locus_tag LOCUS_r00010 12976 13087 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 14379 13255 gene locus_tag LOCUS_13060 14379 13255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence44 <1 1137 gene locus_tag LOCUS_13070 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250860.1:dolichol monophosphate mannose synthase 1169 1414 gene locus_tag LOCUS_13080 1169 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1723 1409 gene locus_tag LOCUS_13090 1723 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3715 1802 gene locus_tag LOCUS_13100 3715 1802 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980094.1 protein_id gnl|my_center|LOCUS_13100 4613 3771 gene locus_tag LOCUS_13110 4613 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4739 5020 gene locus_tag LOCUS_13120 4739 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5052 6668 gene locus_tag LOCUS_13130 5052 6668 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_13130 6690 7082 gene locus_tag LOCUS_13140 gene msrB 6690 7082 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74B11 protein_id gnl|my_center|LOCUS_13140 7138 8148 gene locus_tag LOCUS_13150 7138 8148 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_13150 8145 8624 gene locus_tag LOCUS_13160 8145 8624 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870950.1 protein_id gnl|my_center|LOCUS_13160 9220 8621 gene locus_tag LOCUS_13170 9220 8621 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_13170 9326 9742 gene locus_tag LOCUS_13180 gene yfiD 9326 9742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077757.1 protein_id gnl|my_center|LOCUS_13180 11094 9739 gene locus_tag LOCUS_13190 11094 9739 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_13190 11963 11100 gene locus_tag LOCUS_13200 11963 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 12543 12004 gene locus_tag LOCUS_13210 12543 12004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13431 12628 gene locus_tag LOCUS_13220 13431 12628 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865197.1 protein_id gnl|my_center|LOCUS_13220 13987 13475 gene locus_tag LOCUS_13230 13987 13475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 14414 14031 gene locus_tag LOCUS_13240 gene cheY 14414 14031 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963449.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence45 420 1226 gene locus_tag LOCUS_13250 420 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1959 1231 gene locus_tag LOCUS_13260 1959 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2221 2979 gene locus_tag LOCUS_13270 2221 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3050 3125 gene locus_tag LOCUS_t00290 3050 3125 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3723 3184 gene locus_tag LOCUS_13280 3723 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4437 3769 gene locus_tag LOCUS_13290 4437 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 4657 6588 gene locus_tag LOCUS_13300 4657 6588 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946887.1 protein_id gnl|my_center|LOCUS_13300 6578 7252 gene locus_tag LOCUS_13310 6578 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7254 8279 gene locus_tag LOCUS_13320 7254 8279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8440 8919 gene locus_tag LOCUS_13330 8440 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 8984 9532 gene locus_tag LOCUS_13340 8984 9532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 10385 9585 gene locus_tag LOCUS_13350 10385 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 11379 10429 gene locus_tag LOCUS_13360 11379 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 11562 11422 gene locus_tag LOCUS_13370 11562 11422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 11669 11878 gene locus_tag LOCUS_13380 11669 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 11930 12316 gene locus_tag LOCUS_13390 11930 12316 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879906.1 protein_id gnl|my_center|LOCUS_13390 12581 12321 gene locus_tag LOCUS_13400 12581 12321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 12670 13158 gene locus_tag LOCUS_13410 12670 13158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 13252 13875 gene locus_tag LOCUS_13420 13252 13875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence46 176 1366 gene locus_tag LOCUS_13430 176 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1412 2482 gene locus_tag LOCUS_13440 1412 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2795 3553 gene locus_tag LOCUS_13450 2795 3553 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024518.1 protein_id gnl|my_center|LOCUS_13450 3631 4236 gene locus_tag LOCUS_13460 3631 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4503 4243 gene locus_tag LOCUS_13470 4503 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 6059 4536 gene locus_tag LOCUS_13480 gene guaA 6059 4536 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_13480 6642 6064 gene locus_tag LOCUS_13490 6642 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 7410 6667 gene locus_tag LOCUS_13500 7410 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868117.1 protein_id gnl|my_center|LOCUS_13500 7454 8305 gene locus_tag LOCUS_13510 7454 8305 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_13510 8336 9769 gene locus_tag LOCUS_13520 gene guaB 8336 9769 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X168 protein_id gnl|my_center|LOCUS_13520 9804 10271 gene locus_tag LOCUS_13530 9804 10271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 11083 10268 gene locus_tag LOCUS_13540 11083 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 11637 11086 gene locus_tag LOCUS_13550 11637 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 11716 12786 gene locus_tag LOCUS_13560 11716 12786 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_13560 12802 13404 gene locus_tag LOCUS_13570 12802 13404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 13688 13401 gene locus_tag LOCUS_13580 13688 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence47 325 26 gene locus_tag LOCUS_13590 325 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 495 1553 gene locus_tag LOCUS_13600 495 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2653 1589 gene locus_tag LOCUS_13610 gene rlmN 2653 1589 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY6 protein_id gnl|my_center|LOCUS_13610 3996 2734 gene locus_tag LOCUS_13620 3996 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 6622 4064 gene locus_tag LOCUS_13630 6622 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7276 6656 gene locus_tag LOCUS_13640 7276 6656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 7397 7870 gene locus_tag LOCUS_13650 7397 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 8885 7860 gene locus_tag LOCUS_13660 gene purP 8885 7860 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_13660 9124 8915 gene locus_tag LOCUS_13670 9124 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 9263 10666 gene locus_tag LOCUS_13680 gene ndh 9263 10666 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229915.1 protein_id gnl|my_center|LOCUS_13680 10719 11693 gene locus_tag LOCUS_13690 10719 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 11760 13067 gene locus_tag LOCUS_13700 11760 13067 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496866.1 protein_id gnl|my_center|LOCUS_13700 13077 13343 gene locus_tag LOCUS_13710 13077 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence48 1073 132 gene locus_tag LOCUS_13720 1073 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2427 1159 gene locus_tag LOCUS_13730 2427 1159 CDS product threonylcarbamoyladenosine tRNA methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_13730 3791 2430 gene locus_tag LOCUS_13740 gene aspA 3791 2430 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_13740 3903 5252 gene locus_tag LOCUS_13750 3903 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 5323 6255 gene locus_tag LOCUS_13760 5323 6255 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_13760 6258 7055 gene locus_tag LOCUS_13770 6258 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7492 7067 gene locus_tag LOCUS_13780 7492 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 8129 7611 gene locus_tag LOCUS_13790 8129 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 8763 8116 gene locus_tag LOCUS_13800 8763 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 9523 8828 gene locus_tag LOCUS_13810 9523 8828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 9674 10729 gene locus_tag LOCUS_13820 9674 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 10950 10726 gene locus_tag LOCUS_13830 10950 10726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 11329 11754 gene locus_tag LOCUS_13840 11329 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 11756 12235 gene locus_tag LOCUS_13850 11756 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 12880 12221 gene locus_tag LOCUS_13860 12880 12221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence49 651 1496 gene locus_tag LOCUS_13870 651 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1493 1717 gene locus_tag LOCUS_13880 1493 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 2050 1721 gene locus_tag LOCUS_13890 2050 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2588 2112 gene locus_tag LOCUS_13900 2588 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2838 3254 gene locus_tag LOCUS_13910 2838 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 3301 4848 gene locus_tag LOCUS_13920 3301 4848 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_13920 4854 6338 gene locus_tag LOCUS_13930 gene accC 4854 6338 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000756612.1 protein_id gnl|my_center|LOCUS_13930 6347 6862 gene locus_tag LOCUS_13940 6347 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 7347 6877 gene locus_tag LOCUS_13950 7347 6877 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080908.1 protein_id gnl|my_center|LOCUS_13950 7466 7840 gene locus_tag LOCUS_13960 7466 7840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 7883 8407 gene locus_tag LOCUS_13970 7883 8407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 8407 8970 gene locus_tag LOCUS_13980 8407 8970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 8973 10106 gene locus_tag LOCUS_13990 8973 10106 CDS product NADH dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762086.1 protein_id gnl|my_center|LOCUS_13990 10107 11408 gene locus_tag LOCUS_14000 gene nuoH 10107 11408 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WED5 protein_id gnl|my_center|LOCUS_14000 11408 11905 gene locus_tag LOCUS_14010 11408 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 11898 12410 gene locus_tag LOCUS_14020 gene ndhG 11898 12410 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_14020 12391 12696 gene locus_tag LOCUS_14030 gene ndhE 12391 12696 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_14030 >Feature sequence50 77 433 gene locus_tag LOCUS_14040 77 433 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228822.1 protein_id gnl|my_center|LOCUS_14040 593 1735 gene locus_tag LOCUS_14050 593 1735 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_14050 1744 2430 gene locus_tag LOCUS_14060 1744 2430 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879597.1 protein_id gnl|my_center|LOCUS_14060 2485 2955 gene locus_tag LOCUS_14070 2485 2955 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_14070 3569 2952 gene locus_tag LOCUS_14080 3569 2952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 4649 3612 gene locus_tag LOCUS_14090 4649 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 5776 4649 gene locus_tag LOCUS_14100 gene lysK 5776 4649 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH3 protein_id gnl|my_center|LOCUS_14100 6636 5779 gene locus_tag LOCUS_14110 6636 5779 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_14110 6791 6624 gene locus_tag LOCUS_14120 6791 6624 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256239.1 protein_id gnl|my_center|LOCUS_14120 7979 6813 gene locus_tag LOCUS_14130 7979 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 8514 8095 gene locus_tag LOCUS_14140 8514 8095 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_14140 9682 8507 gene locus_tag LOCUS_14150 gene argD 9682 8507 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH5 protein_id gnl|my_center|LOCUS_14150 10478 9675 gene locus_tag LOCUS_14160 10478 9675 CDS product acetylaminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_14160 11528 10482 gene locus_tag LOCUS_14170 11528 10482 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_14170 12411 11557 gene locus_tag LOCUS_14180 gene lysX 12411 11557 CDS product alpha-aminoadipate--LysW ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH23 protein_id gnl|my_center|LOCUS_14180 12578 12411 gene locus_tag LOCUS_14190 12578 12411 CDS product sulfonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence51 178 1761 gene locus_tag LOCUS_14200 178 1761 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_14200 1769 3355 gene locus_tag LOCUS_14210 gene lysS 1769 3355 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABY6 protein_id gnl|my_center|LOCUS_14210 3361 3561 gene locus_tag LOCUS_14220 3361 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 3592 4443 gene locus_tag LOCUS_14230 3592 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 4884 4444 gene locus_tag LOCUS_14240 gene pdxH 4884 4444 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399646.1 protein_id gnl|my_center|LOCUS_14240 5410 4919 gene locus_tag LOCUS_14250 5410 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 5837 5664 gene locus_tag LOCUS_14260 5837 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 6123 5869 gene locus_tag LOCUS_14270 6123 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6365 6213 gene locus_tag LOCUS_14280 6365 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 7342 6389 gene locus_tag LOCUS_14290 7342 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 8109 7501 gene locus_tag LOCUS_14300 8109 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 8169 8603 gene locus_tag LOCUS_14310 8169 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8600 9103 gene locus_tag LOCUS_14320 8600 9103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 9149 9661 gene locus_tag LOCUS_14330 9149 9661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 10482 9658 gene locus_tag LOCUS_14340 10482 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10793 10593 gene locus_tag LOCUS_14350 10793 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11732 10830 gene locus_tag LOCUS_14360 11732 10830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 11987 11820 gene locus_tag LOCUS_14370 11987 11820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 <13033 12284 gene locus_tag LOCUS_14380 <13033 12284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000688306.1:SAM-dependent methyltransferase >Feature sequence52 2956 3447 gene locus_tag LOCUS_14390 2956 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3444 4784 gene locus_tag LOCUS_14400 3444 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 4781 5245 gene locus_tag LOCUS_14410 4781 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 5566 5333 gene locus_tag LOCUS_14420 5566 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 5650 5787 gene locus_tag LOCUS_14430 5650 5787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 6009 6986 gene locus_tag LOCUS_14440 6009 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435274.1 protein_id gnl|my_center|LOCUS_14440 7319 6987 gene locus_tag LOCUS_14450 7319 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 7585 8241 gene locus_tag LOCUS_14460 7585 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 8709 8287 gene locus_tag LOCUS_14470 8709 8287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 9827 8805 gene locus_tag LOCUS_14480 9827 8805 CDS product ring canal kelch-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639451.2 protein_id gnl|my_center|LOCUS_14480 10453 9872 gene locus_tag LOCUS_14490 10453 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 10783 10580 gene locus_tag LOCUS_14500 10783 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 11168 12157 gene locus_tag LOCUS_14510 11168 12157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 12154 12303 gene locus_tag LOCUS_14520 12154 12303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence53 291 860 gene locus_tag LOCUS_14530 291 860 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_14530 850 2685 gene locus_tag LOCUS_14540 850 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2672 3772 gene locus_tag LOCUS_14550 2672 3772 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_14550 4228 3767 gene locus_tag LOCUS_14560 4228 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4300 4542 gene locus_tag LOCUS_14570 4300 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 4564 4917 gene locus_tag LOCUS_14580 4564 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4938 5336 gene locus_tag LOCUS_14590 4938 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 5341 5625 gene locus_tag LOCUS_14600 5341 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 6410 5622 gene locus_tag LOCUS_14610 6410 5622 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846346.1 protein_id gnl|my_center|LOCUS_14610 6923 6411 gene locus_tag LOCUS_14620 gene apt 6923 6411 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MYI9 protein_id gnl|my_center|LOCUS_14620 9132 6973 gene locus_tag LOCUS_14630 9132 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 11311 9215 gene locus_tag LOCUS_14640 11311 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 11417 11881 gene locus_tag LOCUS_14650 11417 11881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence54 1810 737 gene locus_tag LOCUS_14660 1810 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1930 2727 gene locus_tag LOCUS_14670 1930 2727 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249738.1 protein_id gnl|my_center|LOCUS_14670 3068 2763 gene locus_tag LOCUS_14680 3068 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3347 3544 gene locus_tag LOCUS_14690 3347 3544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 3905 3552 gene locus_tag LOCUS_14700 3905 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4004 4390 gene locus_tag LOCUS_14710 4004 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_14710 4924 4409 gene locus_tag LOCUS_14720 gene ftnB 4924 4409 CDS product putative bacterial non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43708 protein_id gnl|my_center|LOCUS_14720 5058 4981 gene locus_tag LOCUS_t00300 5058 4981 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5154 5228 gene locus_tag LOCUS_t00310 5154 5228 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5588 5358 gene locus_tag LOCUS_14730 5588 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 6054 5620 gene locus_tag LOCUS_14740 gene uspA1 6054 5620 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW6 protein_id gnl|my_center|LOCUS_14740 6794 6381 gene locus_tag LOCUS_14750 6794 6381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 9812 6876 gene locus_tag LOCUS_14760 9812 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 11403 9943 gene locus_tag LOCUS_14770 gene argH 11403 9943 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI1 protein_id gnl|my_center|LOCUS_14770 11420 11776 gene locus_tag LOCUS_14780 11420 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence55 2117 297 gene locus_tag LOCUS_14790 2117 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2257 2682 gene locus_tag LOCUS_14800 2257 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3770 2679 gene locus_tag LOCUS_14810 3770 2679 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846248.1 protein_id gnl|my_center|LOCUS_14810 4024 3815 gene locus_tag LOCUS_14820 4024 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 4336 4890 gene locus_tag LOCUS_14830 4336 4890 CDS product putative UbiX-like flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMA6 protein_id gnl|my_center|LOCUS_14830 4919 5347 gene locus_tag LOCUS_14840 4919 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 5547 5344 gene locus_tag LOCUS_14850 5547 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 6362 5565 gene locus_tag LOCUS_14860 gene tatC 6362 5565 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKH3 protein_id gnl|my_center|LOCUS_14860 6858 6394 gene locus_tag LOCUS_14870 6858 6394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 6959 7114 gene locus_tag LOCUS_14880 6959 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 7182 7604 gene locus_tag LOCUS_14890 7182 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 7672 7929 gene locus_tag LOCUS_14900 7672 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 8039 8719 gene locus_tag LOCUS_14910 gene purQ 8039 8719 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPA5 protein_id gnl|my_center|LOCUS_14910 8716 10878 gene locus_tag LOCUS_14920 8716 10878 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868861.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence56 1033 2064 gene locus_tag LOCUS_14930 1033 2064 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_14930 2057 2821 gene locus_tag LOCUS_14940 2057 2821 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_14940 2821 3585 gene locus_tag LOCUS_14950 2821 3585 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_14950 4837 3719 gene locus_tag LOCUS_14960 4837 3719 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286708.1 protein_id gnl|my_center|LOCUS_14960 4955 5917 gene locus_tag LOCUS_14970 4955 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14970 5949 8447 gene locus_tag LOCUS_14980 5949 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14980 8840 8448 gene locus_tag LOCUS_14990 8840 8448 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879391.1 protein_id gnl|my_center|LOCUS_14990 9685 8921 gene locus_tag LOCUS_15000 9685 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 9750 10316 gene locus_tag LOCUS_15010 9750 10316 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence57 1395 586 gene locus_tag LOCUS_15020 1395 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2593 1439 gene locus_tag LOCUS_15030 2593 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_15030 2764 3621 gene locus_tag LOCUS_15040 2764 3621 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_15040 4030 3827 gene locus_tag LOCUS_15050 4030 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 4245 4075 gene locus_tag LOCUS_15060 4245 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4400 4825 gene locus_tag LOCUS_15070 4400 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 5283 4822 gene locus_tag LOCUS_15080 5283 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 5915 5517 gene locus_tag LOCUS_15090 5915 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 6648 6001 gene locus_tag LOCUS_15100 6648 6001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 6910 6725 gene locus_tag LOCUS_15110 6910 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 6961 7260 gene locus_tag LOCUS_15120 6961 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 7620 7255 gene locus_tag LOCUS_15130 7620 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 7960 8346 gene locus_tag LOCUS_15140 7960 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 8396 9283 gene locus_tag LOCUS_15150 gene yfjR 8396 9283 CDS product putative oxidoreductase YfjR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34969 protein_id gnl|my_center|LOCUS_15150 9311 10072 gene locus_tag LOCUS_15160 9311 10072 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878702.1 protein_id gnl|my_center|LOCUS_15160 10638 10069 gene locus_tag LOCUS_15170 10638 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903531.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence58 208 1578 gene locus_tag LOCUS_15180 208 1578 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868868.1 protein_id gnl|my_center|LOCUS_15180 1898 1581 gene locus_tag LOCUS_15190 1898 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 2159 1908 gene locus_tag LOCUS_15200 2159 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 2679 2281 gene locus_tag LOCUS_15210 2679 2281 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250213.1 protein_id gnl|my_center|LOCUS_15210 3967 2687 gene locus_tag LOCUS_15220 3967 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4049 4489 gene locus_tag LOCUS_15230 4049 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 4897 4490 gene locus_tag LOCUS_15240 4897 4490 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003369350.1 protein_id gnl|my_center|LOCUS_15240 5006 5353 gene locus_tag LOCUS_15250 5006 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 6597 5350 gene locus_tag LOCUS_15260 6597 5350 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_15260 7449 6634 gene locus_tag LOCUS_15270 7449 6634 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_15270 8177 7452 gene locus_tag LOCUS_15280 8177 7452 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_15280 9064 8165 gene locus_tag LOCUS_15290 9064 8165 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002385462.1 protein_id gnl|my_center|LOCUS_15290 9155 9538 gene locus_tag LOCUS_15300 9155 9538 CDS product nickel-responsive regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289104.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence59 1569 2063 gene locus_tag LOCUS_15310 1569 2063 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_15310 2938 2576 gene locus_tag LOCUS_15320 2938 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 3075 3317 gene locus_tag LOCUS_15330 3075 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 3304 4506 gene locus_tag LOCUS_15340 3304 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 5528 4557 gene locus_tag LOCUS_15350 5528 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 5655 5924 gene locus_tag LOCUS_15360 5655 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 6026 6409 gene locus_tag LOCUS_15370 6026 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 6709 6428 gene locus_tag LOCUS_15380 6709 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 6774 6950 gene locus_tag LOCUS_15390 6774 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 7534 6956 gene locus_tag LOCUS_15400 7534 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 7608 8093 gene locus_tag LOCUS_15410 7608 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 8108 9508 gene locus_tag LOCUS_15420 8108 9508 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709100.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence60 417 1208 gene locus_tag LOCUS_15430 417 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 3406 1205 gene locus_tag LOCUS_15440 3406 1205 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_15440 3400 3999 gene locus_tag LOCUS_15450 3400 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 4001 5779 gene locus_tag LOCUS_15460 4001 5779 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_15460 5776 7161 gene locus_tag LOCUS_15470 5776 7161 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_15470 7164 7796 gene locus_tag LOCUS_15480 gene atpD 7164 7796 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184E4 protein_id gnl|my_center|LOCUS_15480 7796 7927 gene locus_tag LOCUS_15490 7796 7927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 7980 8291 gene locus_tag LOCUS_15500 7980 8291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 8785 8324 gene locus_tag LOCUS_15510 8785 8324 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence61 <1 801 gene locus_tag LOCUS_15520 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496498.1:7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG 798 2051 gene locus_tag LOCUS_15530 798 2051 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870949.1 protein_id gnl|my_center|LOCUS_15530 2052 3413 gene locus_tag LOCUS_15540 2052 3413 CDS product zinc-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_15540 4365 3418 gene locus_tag LOCUS_15550 gene yrbG 4365 3418 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_15550 4509 4856 gene locus_tag LOCUS_15560 4509 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 4905 5651 gene locus_tag LOCUS_15570 4905 5651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 5731 6459 gene locus_tag LOCUS_15580 5731 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 6516 7538 gene locus_tag LOCUS_15590 6516 7538 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_15590 7616 8875 gene locus_tag LOCUS_15600 7616 8875 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence62 889 1098 gene locus_tag LOCUS_15610 889 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1099 1434 gene locus_tag LOCUS_15620 1099 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 1436 1993 gene locus_tag LOCUS_15630 1436 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 2610 1990 gene locus_tag LOCUS_15640 2610 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2798 2986 gene locus_tag LOCUS_15650 2798 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 4056 3160 gene locus_tag LOCUS_15660 4056 3160 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_15660 4136 4212 gene locus_tag LOCUS_t00320 4136 4212 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4363 4596 gene locus_tag LOCUS_15670 4363 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 4781 8071 gene locus_tag LOCUS_15680 4781 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 8121 8606 gene locus_tag LOCUS_15690 8121 8606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978265.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence63 1534 2223 gene locus_tag LOCUS_15700 1534 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4650 2335 gene locus_tag LOCUS_15710 4650 2335 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_15710 5472 4654 gene locus_tag LOCUS_15720 5472 4654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5806 5528 gene locus_tag LOCUS_15730 5806 5528 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63PF1 protein_id gnl|my_center|LOCUS_15730 5882 6637 gene locus_tag LOCUS_15740 5882 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 7994 6630 gene locus_tag LOCUS_15750 7994 6630 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence64 1316 2248 gene locus_tag LOCUS_15760 1316 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 2363 2608 gene locus_tag LOCUS_15770 2363 2608 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_15770 3238 2846 gene locus_tag LOCUS_15780 3238 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4259 3282 gene locus_tag LOCUS_15790 4259 3282 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709462.1 protein_id gnl|my_center|LOCUS_15790 4827 4339 gene locus_tag LOCUS_15800 4827 4339 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544986.1 protein_id gnl|my_center|LOCUS_15800 5011 5586 gene locus_tag LOCUS_15810 gene purN 5011 5586 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU8 protein_id gnl|my_center|LOCUS_15810 5903 5583 gene locus_tag LOCUS_15820 5903 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5992 6855 gene locus_tag LOCUS_15830 gene folD 5992 6855 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_15830 6845 7408 gene locus_tag LOCUS_15840 6845 7408 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E301 protein_id gnl|my_center|LOCUS_15840 8661 7399 gene locus_tag LOCUS_15850 gene purD 8661 7399 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EJ4 protein_id gnl|my_center|LOCUS_15850 >Feature sequence65 172 3570 gene locus_tag LOCUS_15860 172 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3933 3775 gene locus_tag LOCUS_15870 3933 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence66 525 2090 gene locus_tag LOCUS_15880 gene pyrG 525 2090 CDS product CTP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_15880 3709 2711 gene locus_tag LOCUS_15890 3709 2711 CDS product ATP-NAD/AcoX kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763693.1 protein_id gnl|my_center|LOCUS_15890 3904 4800 gene locus_tag LOCUS_15900 gene fieF 3904 4800 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074103.1 protein_id gnl|my_center|LOCUS_15900 4888 5259 gene locus_tag LOCUS_15910 4888 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 5822 5382 gene locus_tag LOCUS_15920 gene uspA1 5822 5382 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW6 protein_id gnl|my_center|LOCUS_15920 5984 6466 gene locus_tag LOCUS_15930 gene cheY 5984 6466 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940575.1 protein_id gnl|my_center|LOCUS_15930 7401 6532 gene locus_tag LOCUS_15940 7401 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 <8941 7592 gene locus_tag LOCUS_15950 <8941 7592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000994077.1:PAS domain-containing sensor histidine kinase >Feature sequence67 574 293 gene locus_tag LOCUS_15960 574 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 768 1049 gene locus_tag LOCUS_15970 768 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 1051 1569 gene locus_tag LOCUS_15980 1051 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1669 2571 gene locus_tag LOCUS_15990 1669 2571 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528582.1 protein_id gnl|my_center|LOCUS_15990 3940 3002 gene locus_tag LOCUS_16000 3940 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 4363 3944 gene locus_tag LOCUS_16010 4363 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5550 4651 gene locus_tag LOCUS_16020 5550 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 6338 5643 gene locus_tag LOCUS_16030 6338 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6745 6449 gene locus_tag LOCUS_16040 6745 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7139 6945 gene locus_tag LOCUS_16050 7139 6945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence68 941 1234 gene locus_tag LOCUS_16060 941 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1614 1216 gene locus_tag LOCUS_16070 1614 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2010 3266 gene locus_tag LOCUS_16080 2010 3266 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_16080 3606 3259 gene locus_tag LOCUS_16090 3606 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 4048 3608 gene locus_tag LOCUS_16100 4048 3608 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_16100 5289 4045 gene locus_tag LOCUS_16110 5289 4045 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4M4 protein_id gnl|my_center|LOCUS_16110 5600 5292 gene locus_tag LOCUS_16120 5600 5292 CDS product Rieske family ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004434108.1 protein_id gnl|my_center|LOCUS_16120 7006 5606 gene locus_tag LOCUS_16130 gene sufB 7006 5606 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 protein_id gnl|my_center|LOCUS_16130 <7751 7031 gene locus_tag LOCUS_16140 <7751 7031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976894.1:Fe-S cluster assembly protein SufB >Feature sequence69 1431 508 gene locus_tag LOCUS_16150 1431 508 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904186.1 protein_id gnl|my_center|LOCUS_16150 2302 2060 gene locus_tag LOCUS_16160 2302 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 2260 2406 gene locus_tag LOCUS_16170 2260 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 3537 3253 gene locus_tag LOCUS_16180 3537 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 4021 3836 gene locus_tag LOCUS_16190 4021 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 5239 4214 gene locus_tag LOCUS_16200 5239 4214 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_16200 5321 5403 gene locus_tag LOCUS_t00330 5321 5403 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5671 5477 gene locus_tag LOCUS_16210 5671 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 6001 5726 gene locus_tag LOCUS_16220 6001 5726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 6096 6416 gene locus_tag LOCUS_16230 6096 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6487 6624 gene locus_tag LOCUS_16240 6487 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <7541 6633 gene locus_tag LOCUS_16250 <7541 6633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070719.1:sodium:calcium antiporter >Feature sequence70 1182 169 gene locus_tag LOCUS_16260 1182 169 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_16260 1739 1179 gene locus_tag LOCUS_16270 1739 1179 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_16270 2356 1736 gene locus_tag LOCUS_16280 2356 1736 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875670.1 protein_id gnl|my_center|LOCUS_16280 2913 2359 gene locus_tag LOCUS_16290 2913 2359 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_16290 4354 2924 gene locus_tag LOCUS_16300 4354 2924 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_16300 4772 4347 gene locus_tag LOCUS_16310 4772 4347 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_16310 5241 4774 gene locus_tag LOCUS_16320 5241 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 5904 5248 gene locus_tag LOCUS_16330 5904 5248 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_16330 6388 5906 gene locus_tag LOCUS_16340 6388 5906 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869975.1 protein_id gnl|my_center|LOCUS_16340 >Feature sequence71 <1 860 gene locus_tag LOCUS_16350 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F219:dihydroxy-acid dehydratase 1282 2631 gene locus_tag LOCUS_16360 1282 2631 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_16360 2628 3221 gene locus_tag LOCUS_16370 gene pabA 2628 3221 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_16370 3218 4264 gene locus_tag LOCUS_16380 gene trpD 3218 4264 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EF2 protein_id gnl|my_center|LOCUS_16380 4318 5034 gene locus_tag LOCUS_16390 4318 5034 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870432.1 protein_id gnl|my_center|LOCUS_16390 5031 6221 gene locus_tag LOCUS_16400 gene trpB1 5031 6221 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_16400 >Feature sequence72 457 173 gene locus_tag LOCUS_16410 457 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 1983 496 gene locus_tag LOCUS_16420 1983 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 1871 2083 gene locus_tag LOCUS_16430 1871 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2105 3226 gene locus_tag LOCUS_16440 2105 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 4030 3227 gene locus_tag LOCUS_16450 4030 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 5835 4027 gene locus_tag LOCUS_16460 5835 4027 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence73 407 1138 gene locus_tag LOCUS_16470 gene cbiL 407 1138 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943625.1 protein_id gnl|my_center|LOCUS_16470 1163 2017 gene locus_tag LOCUS_16480 1163 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 2064 2825 gene locus_tag LOCUS_16490 gene cbiF 2064 2825 CDS product cobalt-precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_16490 3583 2822 gene locus_tag LOCUS_16500 gene murI 3583 2822 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_16500 3682 4329 gene locus_tag LOCUS_16510 3682 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_16510 4398 4889 gene locus_tag LOCUS_16520 4398 4889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence74 496 858 gene locus_tag LOCUS_16530 496 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 906 1574 gene locus_tag LOCUS_16540 906 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 1684 1860 gene locus_tag LOCUS_16550 1684 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2246 1857 gene locus_tag LOCUS_16560 2246 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 2708 3997 gene locus_tag LOCUS_16570 2708 3997 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_16570 5429 3990 gene locus_tag LOCUS_16580 5429 3990 CDS product DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_16580 5478 6035 gene locus_tag LOCUS_16590 5478 6035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence75 385 290 gene locus_tag LOCUS_t00340 385 290 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1558 641 gene locus_tag LOCUS_16600 1558 641 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_16600 2661 1555 gene locus_tag LOCUS_16610 gene sucC 2661 1555 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKV5 protein_id gnl|my_center|LOCUS_16610 3031 2702 gene locus_tag LOCUS_16620 3031 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 <6193 3215 gene locus_tag LOCUS_16630 <6193 3215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876987.1:isoleucine--tRNA ligase >Feature sequence76 1144 548 gene locus_tag LOCUS_16640 1144 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 1151 3067 gene locus_tag LOCUS_16650 1151 3067 CDS product fibronectin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_16650 3060 3539 gene locus_tag LOCUS_16660 3060 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_16660 3523 4134 gene locus_tag LOCUS_16670 3523 4134 CDS product AMMECR1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_16670 4505 4131 gene locus_tag LOCUS_16680 4505 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_16680 5656 4502 gene locus_tag LOCUS_16690 5656 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence77 3019 1082 gene locus_tag LOCUS_16700 3019 1082 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878475.1 protein_id gnl|my_center|LOCUS_16700 4463 3063 gene locus_tag LOCUS_16710 4463 3063 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846244.1 protein_id gnl|my_center|LOCUS_16710 5905 4460 gene locus_tag LOCUS_16720 gene gatA2 5905 4460 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX8 protein_id gnl|my_center|LOCUS_16720 >Feature sequence78 976 380 gene locus_tag LOCUS_16730 976 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 1057 1461 gene locus_tag LOCUS_16740 1057 1461 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_16740 1526 1996 gene locus_tag LOCUS_16750 1526 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 3279 1993 gene locus_tag LOCUS_16760 3279 1993 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_16760 4137 3493 gene locus_tag LOCUS_16770 4137 3493 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258880.1 protein_id gnl|my_center|LOCUS_16770 4624 4175 gene locus_tag LOCUS_16780 4624 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 4894 5109 gene locus_tag LOCUS_16790 4894 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 5119 5850 gene locus_tag LOCUS_16800 5119 5850 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence79 1227 559 gene locus_tag LOCUS_16810 1227 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 1804 2814 gene locus_tag LOCUS_16820 1804 2814 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_16820 3250 2834 gene locus_tag LOCUS_16830 3250 2834 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007597092.1 protein_id gnl|my_center|LOCUS_16830 3449 4420 gene locus_tag LOCUS_16840 3449 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence80 531 97 gene locus_tag LOCUS_16850 531 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1392 610 gene locus_tag LOCUS_16860 1392 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 1488 1913 gene locus_tag LOCUS_16870 1488 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 2200 3156 gene locus_tag LOCUS_16880 2200 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 3855 3208 gene locus_tag LOCUS_16890 3855 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3967 4329 gene locus_tag LOCUS_16900 3967 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence81 1653 553 gene locus_tag LOCUS_16910 1653 553 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_16910 1883 1653 gene locus_tag LOCUS_16920 1883 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1951 2646 gene locus_tag LOCUS_16930 1951 2646 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_16930 2650 4536 gene locus_tag LOCUS_16940 2650 4536 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence82 1350 1781 gene locus_tag LOCUS_16950 1350 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 2267 1797 gene locus_tag LOCUS_16960 2267 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2379 2795 gene locus_tag LOCUS_16970 2379 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3598 2807 gene locus_tag LOCUS_16980 3598 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 4141 3692 gene locus_tag LOCUS_16990 4141 3692 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762782.1 protein_id gnl|my_center|LOCUS_16990 4570 4148 gene locus_tag LOCUS_17000 4570 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 >Feature sequence83 533 1390 gene locus_tag LOCUS_17010 gene tfb 533 1390 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_17010 1394 1828 gene locus_tag LOCUS_17020 1394 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 2122 2871 gene locus_tag LOCUS_17030 gene fabG 2122 2871 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_17030 2905 3114 gene locus_tag LOCUS_17040 2905 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 3116 3928 gene locus_tag LOCUS_17050 gene cysQ 3116 3928 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_17050 4089 3931 gene locus_tag LOCUS_17060 4089 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence84 1785 2687 gene locus_tag LOCUS_17070 1785 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 2687 3694 gene locus_tag LOCUS_17080 2687 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence85 265 708 gene locus_tag LOCUS_17090 265 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 705 1373 gene locus_tag LOCUS_17100 705 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1370 3166 gene locus_tag LOCUS_17110 1370 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3571 3176 gene locus_tag LOCUS_17120 3571 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 >Feature sequence86 <1 1835 gene locus_tag LOCUS_17130 <1 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039969.1:oxidoreductase 1838 2287 gene locus_tag LOCUS_17140 1838 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3037 2279 gene locus_tag LOCUS_17150 3037 2279 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_17150 <3937 3087 gene locus_tag LOCUS_17160 <3937 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8Z332:sensor protein ZraS >Feature sequence87 >Feature sequence88 <1 516 gene locus_tag LOCUS_17170 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762668.1:50S ribosomal protein L16 792 520 gene locus_tag LOCUS_17180 792 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 873 946 gene locus_tag LOCUS_t00350 873 946 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1382 948 gene locus_tag LOCUS_17190 1382 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 2734 1385 gene locus_tag LOCUS_17200 2734 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence89 554 943 gene locus_tag LOCUS_17210 554 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1902 931 gene locus_tag LOCUS_17220 1902 931 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence90 331 1140 gene locus_tag LOCUS_17230 331 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence91 1 1125 gene locus_tag LOCUS_17240 1 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1463 1245 gene locus_tag LOCUS_17250 1463 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence92 153 629 gene locus_tag LOCUS_17260 153 629 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_17260 638 1540 gene locus_tag LOCUS_17270 638 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 1682 1527 gene locus_tag LOCUS_17280 1682 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 2409 1915 gene locus_tag LOCUS_17290 2409 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence93 <1 2143 gene locus_tag LOCUS_17300 <1 2143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846316.1:elongation factor EF-2 >Feature sequence94 <1260 662 gene locus_tag LOCUS_17310 <1260 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2A9:glycine--tRNA ligase