>Feature sequence01 1313 126 gene locus_tag LOCUS_00010 gene ftsZ 1313 126 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_00010 1673 2257 gene locus_tag LOCUS_00020 1673 2257 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_00020 2323 2568 gene locus_tag LOCUS_00030 2323 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2636 5101 gene locus_tag LOCUS_00040 2636 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5107 5511 gene locus_tag LOCUS_00050 5107 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5602 9999 gene locus_tag LOCUS_00060 5602 9999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10000 10560 gene locus_tag LOCUS_00070 10000 10560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10642 15108 gene locus_tag LOCUS_00080 10642 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 15174 17843 gene locus_tag LOCUS_00090 15174 17843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 17937 18389 gene locus_tag LOCUS_00100 17937 18389 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902433.1 protein_id gnl|my_center|LOCUS_00100 18399 18995 gene locus_tag LOCUS_00110 18399 18995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 19005 19658 gene locus_tag LOCUS_00120 19005 19658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 19667 20803 gene locus_tag LOCUS_00130 gene ndhH1 19667 20803 CDS product NAD(P)H-quinone oxidoreductase subunit H 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NI12 protein_id gnl|my_center|LOCUS_00130 20814 22376 gene locus_tag LOCUS_00140 20814 22376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22388 23365 gene locus_tag LOCUS_00150 22388 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 23371 23640 gene locus_tag LOCUS_00160 23371 23640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 23637 23909 gene locus_tag LOCUS_00170 23637 23909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 23906 24208 gene locus_tag LOCUS_00180 gene nuoK2 23906 24208 CDS product NADH-quinone oxidoreductase subunit K 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XAR4 protein_id gnl|my_center|LOCUS_00180 24218 26515 gene locus_tag LOCUS_00190 24218 26515 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_00190 26524 28110 gene locus_tag LOCUS_00200 26524 28110 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_00200 28107 29792 gene locus_tag LOCUS_00210 28107 29792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 29837 30349 gene locus_tag LOCUS_00220 29837 30349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30354 31238 gene locus_tag LOCUS_00230 30354 31238 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_00230 31319 32011 gene locus_tag LOCUS_00240 31319 32011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 32059 33339 gene locus_tag LOCUS_00250 32059 33339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 33408 35018 gene locus_tag LOCUS_00260 33408 35018 CDS product acetyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_00260 35030 35887 gene locus_tag LOCUS_00270 35030 35887 CDS product gamma-carboxygeranoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106425.1 protein_id gnl|my_center|LOCUS_00270 35901 37454 gene locus_tag LOCUS_00280 35901 37454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37463 37963 gene locus_tag LOCUS_00290 37463 37963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 38038 38631 gene locus_tag LOCUS_00300 38038 38631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_00300 39894 38614 gene locus_tag LOCUS_00310 39894 38614 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_00310 40971 39949 gene locus_tag LOCUS_00320 40971 39949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_00320 41085 42317 gene locus_tag LOCUS_00330 41085 42317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 42351 42659 gene locus_tag LOCUS_00340 42351 42659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 42649 43119 gene locus_tag LOCUS_00350 42649 43119 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_00350 44975 43128 gene locus_tag LOCUS_00360 44975 43128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 45549 45007 gene locus_tag LOCUS_00370 45549 45007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 48582 45592 gene locus_tag LOCUS_00380 48582 45592 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_00380 49808 48642 gene locus_tag LOCUS_00390 49808 48642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 49937 50719 gene locus_tag LOCUS_00400 49937 50719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50721 51605 gene locus_tag LOCUS_00410 50721 51605 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_00410 53129 51612 gene locus_tag LOCUS_00420 53129 51612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878819.1 protein_id gnl|my_center|LOCUS_00420 53235 53423 gene locus_tag LOCUS_00430 53235 53423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 54013 53372 gene locus_tag LOCUS_00440 54013 53372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 54663 54109 gene locus_tag LOCUS_00450 54663 54109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 54778 55083 gene locus_tag LOCUS_00460 54778 55083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55200 55463 gene locus_tag LOCUS_00470 55200 55463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 56286 55525 gene locus_tag LOCUS_00480 gene sdhB 56286 55525 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224227.1 protein_id gnl|my_center|LOCUS_00480 58114 56288 gene locus_tag LOCUS_00490 gene sdhA 58114 56288 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_00490 58915 58124 gene locus_tag LOCUS_00500 58915 58124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60802 59174 gene locus_tag LOCUS_00510 60802 59174 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228252.1 protein_id gnl|my_center|LOCUS_00510 60943 63174 gene locus_tag LOCUS_00520 60943 63174 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_00520 63185 63427 gene locus_tag LOCUS_00530 63185 63427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 63516 65168 gene locus_tag LOCUS_00540 63516 65168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 65155 66408 gene locus_tag LOCUS_00550 65155 66408 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_00550 66422 67615 gene locus_tag LOCUS_00560 66422 67615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 67887 67612 gene locus_tag LOCUS_00570 67887 67612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 68016 68930 gene locus_tag LOCUS_00580 68016 68930 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_00580 69394 68927 gene locus_tag LOCUS_00590 69394 68927 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_00590 70323 69391 gene locus_tag LOCUS_00600 70323 69391 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_00600 70437 71429 gene locus_tag LOCUS_00610 70437 71429 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_00610 71434 73539 gene locus_tag LOCUS_00620 71434 73539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 73592 75310 gene locus_tag LOCUS_00630 73592 75310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 76146 75307 gene locus_tag LOCUS_00640 76146 75307 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFX8 protein_id gnl|my_center|LOCUS_00640 78127 76163 gene locus_tag LOCUS_00650 gene thrS 78127 76163 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435143.1 protein_id gnl|my_center|LOCUS_00650 79057 78203 gene locus_tag LOCUS_00660 gene arcC 79057 78203 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13982 protein_id gnl|my_center|LOCUS_00660 79168 80310 gene locus_tag LOCUS_00670 79168 80310 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_00670 81938 80313 gene locus_tag LOCUS_00680 81938 80313 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496746.1 protein_id gnl|my_center|LOCUS_00680 82078 83031 gene locus_tag LOCUS_00690 gene ltd 82078 83031 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_00690 84646 83036 gene locus_tag LOCUS_00700 84646 83036 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_00700 84788 85399 gene locus_tag LOCUS_00710 84788 85399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 85417 87297 gene locus_tag LOCUS_00720 gene dnaK 85417 87297 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_00720 87302 87523 gene locus_tag LOCUS_00730 87302 87523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 89037 87529 gene locus_tag LOCUS_00740 gene pepA 89037 87529 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJQ9 protein_id gnl|my_center|LOCUS_00740 90078 89152 gene locus_tag LOCUS_00750 90078 89152 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_00750 90199 90615 gene locus_tag LOCUS_00760 90199 90615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 90738 93680 gene locus_tag LOCUS_00770 90738 93680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 93757 93683 gene locus_tag LOCUS_t00010 93757 93683 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 94119 93787 gene locus_tag LOCUS_00780 94119 93787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 94276 95289 gene locus_tag LOCUS_00790 94276 95289 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHR4 protein_id gnl|my_center|LOCUS_00790 95352 97445 gene locus_tag LOCUS_00800 95352 97445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 98530 97442 gene locus_tag LOCUS_00810 gene nadA 98530 97442 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F8D9 protein_id gnl|my_center|LOCUS_00810 98673 99251 gene locus_tag LOCUS_00820 98673 99251 CDS product O-sialoglycoprotein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868707.1 protein_id gnl|my_center|LOCUS_00820 99267 99860 gene locus_tag LOCUS_00830 99267 99860 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868811.1 protein_id gnl|my_center|LOCUS_00830 99892 100839 gene locus_tag LOCUS_00840 99892 100839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 100887 101723 gene locus_tag LOCUS_00850 100887 101723 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_00850 103108 101738 gene locus_tag LOCUS_00860 103108 101738 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527142.1 protein_id gnl|my_center|LOCUS_00860 103418 103197 gene locus_tag LOCUS_00870 103418 103197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 103306 104013 gene locus_tag LOCUS_00880 103306 104013 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729714.1 protein_id gnl|my_center|LOCUS_00880 104289 104020 gene locus_tag LOCUS_00890 104289 104020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 105173 104298 gene locus_tag LOCUS_00900 gene hbd 105173 104298 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538869.1 protein_id gnl|my_center|LOCUS_00900 105787 105227 gene locus_tag LOCUS_00910 105787 105227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 106948 105806 gene locus_tag LOCUS_00920 106948 105806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 107863 107003 gene locus_tag LOCUS_00930 107863 107003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 109122 107920 gene locus_tag LOCUS_00940 109122 107920 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_00940 109246 109674 gene locus_tag LOCUS_00950 109246 109674 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_00950 109735 110205 gene locus_tag LOCUS_00960 109735 110205 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_00960 110231 111181 gene locus_tag LOCUS_00970 110231 111181 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_00970 111249 112262 gene locus_tag LOCUS_00980 111249 112262 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_00980 112527 112273 gene locus_tag LOCUS_00990 112527 112273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 112813 112541 gene locus_tag LOCUS_01000 112813 112541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 112919 112737 gene locus_tag LOCUS_01010 112919 112737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 113061 115688 gene locus_tag LOCUS_01020 113061 115688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 116091 117134 gene locus_tag LOCUS_01030 116091 117134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 117634 117131 gene locus_tag LOCUS_01040 117634 117131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 118930 117692 gene locus_tag LOCUS_01050 118930 117692 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_01050 119866 119138 gene locus_tag LOCUS_01060 119866 119138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 120056 121897 gene locus_tag LOCUS_01070 120056 121897 CDS product putative sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703227.1 protein_id gnl|my_center|LOCUS_01070 121957 123303 gene locus_tag LOCUS_01080 gene accC 121957 123303 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_01080 123307 124272 gene locus_tag LOCUS_01090 123307 124272 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_01090 125930 124269 gene locus_tag LOCUS_01100 125930 124269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 127065 126091 gene locus_tag LOCUS_01110 127065 126091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 127573 127124 gene locus_tag LOCUS_01120 gene ykhA 127573 127124 CDS product putative acyl-CoA thioester hydrolase YkhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49851 protein_id gnl|my_center|LOCUS_01120 127686 128480 gene locus_tag LOCUS_01130 127686 128480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 128483 129010 gene locus_tag LOCUS_01140 128483 129010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 129015 129893 gene locus_tag LOCUS_01150 129015 129893 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_01150 130090 129884 gene locus_tag LOCUS_01160 130090 129884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 130169 130243 gene locus_tag LOCUS_t00020 130169 130243 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 130296 132197 gene locus_tag LOCUS_01170 130296 132197 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902041.1 protein_id gnl|my_center|LOCUS_01170 132209 132910 gene locus_tag LOCUS_01180 132209 132910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 133995 132907 gene locus_tag LOCUS_01190 133995 132907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 134789 134040 gene locus_tag LOCUS_01200 134789 134040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 135270 134890 gene locus_tag LOCUS_01210 135270 134890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 135740 135366 gene locus_tag LOCUS_01220 gene crcB 135740 135366 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXM8 protein_id gnl|my_center|LOCUS_01220 135821 136822 gene locus_tag LOCUS_01230 135821 136822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249139.1 protein_id gnl|my_center|LOCUS_01230 136827 137543 gene locus_tag LOCUS_01240 136827 137543 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249138.1 protein_id gnl|my_center|LOCUS_01240 137956 137540 gene locus_tag LOCUS_01250 137956 137540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 138021 138869 gene locus_tag LOCUS_01260 gene mutM 138021 138869 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A259 protein_id gnl|my_center|LOCUS_01260 139638 138871 gene locus_tag LOCUS_01270 139638 138871 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973653.1 protein_id gnl|my_center|LOCUS_01270 139896 140450 gene locus_tag LOCUS_01280 139896 140450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 140505 141125 gene locus_tag LOCUS_01290 140505 141125 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_01290 141211 142005 gene locus_tag LOCUS_01300 141211 142005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 145295 142035 gene locus_tag LOCUS_01310 gene mcm 145295 142035 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D452 protein_id gnl|my_center|LOCUS_01310 145468 145914 gene locus_tag LOCUS_01320 145468 145914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 145933 146763 gene locus_tag LOCUS_01330 145933 146763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 147441 146803 gene locus_tag LOCUS_01340 147441 146803 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704971.1 protein_id gnl|my_center|LOCUS_01340 149237 147456 gene locus_tag LOCUS_01350 gene fadD 149237 147456 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_01350 150054 149311 gene locus_tag LOCUS_01360 gene smuG1 150054 149311 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_01360 150505 150062 gene locus_tag LOCUS_01370 150505 150062 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_01370 150641 152008 gene locus_tag LOCUS_01380 150641 152008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 152412 152005 gene locus_tag LOCUS_01390 152412 152005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 152498 153403 gene locus_tag LOCUS_01400 152498 153403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 153413 154339 gene locus_tag LOCUS_01410 153413 154339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 154339 155037 gene locus_tag LOCUS_01420 154339 155037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 156069 155041 gene locus_tag LOCUS_01430 156069 155041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920762.1 protein_id gnl|my_center|LOCUS_01430 156148 157809 gene locus_tag LOCUS_01440 156148 157809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 157871 158686 gene locus_tag LOCUS_01450 gene panB 157871 158686 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_01450 158745 159707 gene locus_tag LOCUS_01460 158745 159707 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_01460 160560 159691 gene locus_tag LOCUS_01470 160560 159691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 161888 160830 gene locus_tag LOCUS_01480 161888 160830 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_01480 162765 161914 gene locus_tag LOCUS_01490 162765 161914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 162858 164201 gene locus_tag LOCUS_01500 162858 164201 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869512.1 protein_id gnl|my_center|LOCUS_01500 164250 165800 gene locus_tag LOCUS_01510 164250 165800 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029952.1 protein_id gnl|my_center|LOCUS_01510 165821 166081 gene locus_tag LOCUS_01520 165821 166081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence02 680 2395 gene locus_tag LOCUS_01530 gene fhs 680 2395 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1S9 protein_id gnl|my_center|LOCUS_01530 2406 3464 gene locus_tag LOCUS_01540 2406 3464 CDS product mRNA surveillance protein Pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_01540 3449 4129 gene locus_tag LOCUS_01550 3449 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 4224 5351 gene locus_tag LOCUS_01560 4224 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 5921 5355 gene locus_tag LOCUS_01570 5921 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 6063 5988 gene locus_tag LOCUS_t00030 6063 5988 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6929 6111 gene locus_tag LOCUS_01580 gene rph 6929 6111 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D8T5 protein_id gnl|my_center|LOCUS_01580 7555 6968 gene locus_tag LOCUS_01590 gene mogA 7555 6968 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140668.1 protein_id gnl|my_center|LOCUS_01590 7759 9450 gene locus_tag LOCUS_01600 7759 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9447 10406 gene locus_tag LOCUS_01610 9447 10406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 11368 10403 gene locus_tag LOCUS_01620 11368 10403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 12493 11468 gene locus_tag LOCUS_01630 12493 11468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 12595 13575 gene locus_tag LOCUS_01640 12595 13575 CDS product serralysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875690.1 protein_id gnl|my_center|LOCUS_01640 13604 14704 gene locus_tag LOCUS_01650 13604 14704 CDS product bacteriochlorophyll synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_01650 15423 14701 gene locus_tag LOCUS_01660 gene menG 15423 14701 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88SI6 protein_id gnl|my_center|LOCUS_01660 15560 15874 gene locus_tag LOCUS_01670 15560 15874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 15895 18000 gene locus_tag LOCUS_01680 15895 18000 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_01680 18047 18349 gene locus_tag LOCUS_01690 18047 18349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 18400 18957 gene locus_tag LOCUS_01700 18400 18957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 18970 20025 gene locus_tag LOCUS_01710 18970 20025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 20035 20334 gene locus_tag LOCUS_01720 20035 20334 CDS product ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_01720 20367 22109 gene locus_tag LOCUS_01730 20367 22109 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_01730 22121 23506 gene locus_tag LOCUS_01740 22121 23506 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_01740 23533 24150 gene locus_tag LOCUS_01750 23533 24150 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065914.1 protein_id gnl|my_center|LOCUS_01750 24240 26663 gene locus_tag LOCUS_01760 24240 26663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 26660 27610 gene locus_tag LOCUS_01770 26660 27610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 29244 27607 gene locus_tag LOCUS_01780 gene nadB 29244 27607 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F601 protein_id gnl|my_center|LOCUS_01780 29424 33353 gene locus_tag LOCUS_01790 29424 33353 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_01790 33363 34367 gene locus_tag LOCUS_01800 33363 34367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 34360 34953 gene locus_tag LOCUS_01810 34360 34953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 36281 34968 gene locus_tag LOCUS_01820 36281 34968 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_01820 36568 38556 gene locus_tag LOCUS_01830 36568 38556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 38566 38862 gene locus_tag LOCUS_01840 38566 38862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867957.1 protein_id gnl|my_center|LOCUS_01840 39227 38859 gene locus_tag LOCUS_01850 39227 38859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 40475 39234 gene locus_tag LOCUS_01860 40475 39234 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_01860 40952 40491 gene locus_tag LOCUS_01870 40952 40491 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_01870 42200 41028 gene locus_tag LOCUS_01880 42200 41028 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762413.1 protein_id gnl|my_center|LOCUS_01880 43385 42279 gene locus_tag LOCUS_01890 43385 42279 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_01890 43976 43398 gene locus_tag LOCUS_01900 43976 43398 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_01900 44524 43988 gene locus_tag LOCUS_01910 gene rplJ 44524 43988 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_01910 45550 44609 gene locus_tag LOCUS_01920 45550 44609 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_01920 45709 48402 gene locus_tag LOCUS_01930 gene mutS 45709 48402 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S254 protein_id gnl|my_center|LOCUS_01930 48407 50356 gene locus_tag LOCUS_01940 48407 50356 CDS product DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020571.1 protein_id gnl|my_center|LOCUS_01940 51533 50358 gene locus_tag LOCUS_01950 gene aroA 51533 50358 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C630 protein_id gnl|my_center|LOCUS_01950 52433 51588 gene locus_tag LOCUS_01960 52433 51588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 52565 52479 gene locus_tag LOCUS_t00040 52565 52479 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 55344 52612 gene locus_tag LOCUS_01970 gene gyrA 55344 52612 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0R0 protein_id gnl|my_center|LOCUS_01970 57295 55334 gene locus_tag LOCUS_01980 gene gyrB 57295 55334 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94604 protein_id gnl|my_center|LOCUS_01980 57508 58302 gene locus_tag LOCUS_01990 gene aroD 57508 58302 CDS product 3-dehydroquinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_01990 59171 58299 gene locus_tag LOCUS_02000 59171 58299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 63226 59168 gene locus_tag LOCUS_02010 63226 59168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 63360 64391 gene locus_tag LOCUS_02020 63360 64391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 64392 65129 gene locus_tag LOCUS_02030 64392 65129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 65135 66478 gene locus_tag LOCUS_02040 65135 66478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 67224 66475 gene locus_tag LOCUS_02050 67224 66475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 68554 67448 gene locus_tag LOCUS_02060 68554 67448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 69979 68570 gene locus_tag LOCUS_02070 69979 68570 CDS product putative FeS assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703482.1 protein_id gnl|my_center|LOCUS_02070 70756 70001 gene locus_tag LOCUS_02080 gene sufC 70756 70001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_02080 70883 71380 gene locus_tag LOCUS_02090 70883 71380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 72004 71351 gene locus_tag LOCUS_02100 gene maf 72004 71351 CDS product Maf-like protein maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XXL9 protein_id gnl|my_center|LOCUS_02100 76779 72013 gene locus_tag LOCUS_02110 76779 72013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 77936 76896 gene locus_tag LOCUS_02120 77936 76896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 78020 79432 gene locus_tag LOCUS_02130 78020 79432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 79471 80184 gene locus_tag LOCUS_02140 79471 80184 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702045.1 protein_id gnl|my_center|LOCUS_02140 80181 80333 gene locus_tag LOCUS_02150 80181 80333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 80390 81448 gene locus_tag LOCUS_02160 80390 81448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 81445 82488 gene locus_tag LOCUS_02170 81445 82488 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_02170 83030 82482 gene locus_tag LOCUS_02180 83030 82482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 84277 83105 gene locus_tag LOCUS_02190 84277 83105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 84379 85509 gene locus_tag LOCUS_02200 84379 85509 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_02200 85536 86147 gene locus_tag LOCUS_02210 85536 86147 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_02210 86166 87473 gene locus_tag LOCUS_02220 86166 87473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 87512 89290 gene locus_tag LOCUS_02230 87512 89290 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869674.1 protein_id gnl|my_center|LOCUS_02230 89350 94149 gene locus_tag LOCUS_02240 89350 94149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 95132 94152 gene locus_tag LOCUS_02250 gene fabH 95132 94152 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DA2 protein_id gnl|my_center|LOCUS_02250 95265 96626 gene locus_tag LOCUS_02260 95265 96626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 98063 96627 gene locus_tag LOCUS_02270 98063 96627 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_02270 99248 98076 gene locus_tag LOCUS_02280 99248 98076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 100527 99250 gene locus_tag LOCUS_02290 100527 99250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 101308 100502 gene locus_tag LOCUS_02300 101308 100502 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_02300 102054 101317 gene locus_tag LOCUS_02310 102054 101317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 102291 102115 gene locus_tag LOCUS_02320 102291 102115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 103716 102307 gene locus_tag LOCUS_02330 103716 102307 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_02330 104564 103752 gene locus_tag LOCUS_02340 104564 103752 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226739.1 protein_id gnl|my_center|LOCUS_02340 104746 107844 gene locus_tag LOCUS_02350 104746 107844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 107918 109960 gene locus_tag LOCUS_02360 107918 109960 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_02360 110032 111333 gene locus_tag LOCUS_02370 110032 111333 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_02370 111335 112156 gene locus_tag LOCUS_02380 111335 112156 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_02380 112216 112491 gene locus_tag LOCUS_02390 112216 112491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147166.1 protein_id gnl|my_center|LOCUS_02390 112820 114166 gene locus_tag LOCUS_02400 gene purA 112820 114166 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7Y9 protein_id gnl|my_center|LOCUS_02400 114172 114477 gene locus_tag LOCUS_02410 114172 114477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 114533 116152 gene locus_tag LOCUS_02420 gene pruA 114533 116152 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_02420 116269 117720 gene locus_tag LOCUS_02430 116269 117720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 117777 118565 gene locus_tag LOCUS_02440 117777 118565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 120706 118562 gene locus_tag LOCUS_02450 120706 118562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 120828 121874 gene locus_tag LOCUS_02460 120828 121874 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251195.1 protein_id gnl|my_center|LOCUS_02460 121925 122422 gene locus_tag LOCUS_02470 121925 122422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 123877 122426 gene locus_tag LOCUS_02480 123877 122426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 124005 124790 gene locus_tag LOCUS_02490 124005 124790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 125007 124795 gene locus_tag LOCUS_02500 125007 124795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 126470 125082 gene locus_tag LOCUS_02510 126470 125082 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027167.1 protein_id gnl|my_center|LOCUS_02510 127245 126538 gene locus_tag LOCUS_02520 gene deoC 127245 126538 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I237 protein_id gnl|my_center|LOCUS_02520 128296 127250 gene locus_tag LOCUS_02530 gene serC 128296 127250 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80862 protein_id gnl|my_center|LOCUS_02530 128456 129037 gene locus_tag LOCUS_02540 128456 129037 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249171.1 protein_id gnl|my_center|LOCUS_02540 129034 130176 gene locus_tag LOCUS_02550 129034 130176 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_02550 130272 132083 gene locus_tag LOCUS_02560 130272 132083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 132234 132149 gene locus_tag LOCUS_t00050 132234 132149 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 132288 132488 gene locus_tag LOCUS_02570 132288 132488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 133196 132474 gene locus_tag LOCUS_02580 gene pepE 133196 132474 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_02580 133966 133205 gene locus_tag LOCUS_02590 133966 133205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 134184 133963 gene locus_tag LOCUS_02600 134184 133963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 135036 134248 gene locus_tag LOCUS_02610 135036 134248 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_02610 135515 135234 gene locus_tag LOCUS_02620 135515 135234 CDS product 50S ribosomal protein L44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869747.1 protein_id gnl|my_center|LOCUS_02620 135792 136196 gene locus_tag LOCUS_02630 135792 136196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 136193 136534 gene locus_tag LOCUS_02640 136193 136534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 136859 138361 gene locus_tag LOCUS_02650 gene purF 136859 138361 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87YI6 protein_id gnl|my_center|LOCUS_02650 138408 139895 gene locus_tag LOCUS_02660 138408 139895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 140530 139892 gene locus_tag LOCUS_02670 140530 139892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 141494 140574 gene locus_tag LOCUS_02680 141494 140574 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918612.1 protein_id gnl|my_center|LOCUS_02680 142259 141504 gene locus_tag LOCUS_02690 gene etfB 142259 141504 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_02690 143473 142301 gene locus_tag LOCUS_02700 gene gcdH 143473 142301 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_02700 144756 143542 gene locus_tag LOCUS_02710 144756 143542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 144886 145371 gene locus_tag LOCUS_02720 144886 145371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 145384 146499 gene locus_tag LOCUS_02730 145384 146499 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_02730 146586 148127 gene locus_tag LOCUS_02740 146586 148127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 149303 148131 gene locus_tag LOCUS_02750 149303 148131 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_02750 149425 149937 gene locus_tag LOCUS_02760 149425 149937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 151161 149938 gene locus_tag LOCUS_02770 gene cca 151161 149938 CDS product CCA-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FKF0 protein_id gnl|my_center|LOCUS_02770 151235 151642 gene locus_tag LOCUS_02780 151235 151642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706415.1 protein_id gnl|my_center|LOCUS_02780 152680 151649 gene locus_tag LOCUS_02790 152680 151649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 153693 152701 gene locus_tag LOCUS_02800 153693 152701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 153762 153837 gene locus_tag LOCUS_t00060 153762 153837 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 153895 154572 gene locus_tag LOCUS_02810 153895 154572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 154622 156244 gene locus_tag LOCUS_02820 154622 156244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 156921 156241 gene locus_tag LOCUS_02830 156921 156241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 157035 157301 gene locus_tag LOCUS_02840 157035 157301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 157352 157558 gene locus_tag LOCUS_02850 157352 157558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 158053 157559 gene locus_tag LOCUS_02860 158053 157559 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496839.1 protein_id gnl|my_center|LOCUS_02860 158148 158756 gene locus_tag LOCUS_02870 158148 158756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 159907 160458 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gacggagtaggagataattcagat 160690 160767 gene locus_tag LOCUS_t00070 160690 160767 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 161056 161274 gene locus_tag LOCUS_02880 161056 161274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 161315 162031 gene locus_tag LOCUS_02890 161315 162031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 162154 162888 gene locus_tag LOCUS_02900 162154 162888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 162885 163634 gene locus_tag LOCUS_02910 162885 163634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence03 879 804 gene locus_tag LOCUS_t00080 879 804 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1004 1582 gene locus_tag LOCUS_02920 1004 1582 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_02920 1936 3075 gene locus_tag LOCUS_02930 gene rfc 1936 3075 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060778.1 protein_id gnl|my_center|LOCUS_02930 3152 3076 gene locus_tag LOCUS_t00090 3152 3076 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3512 3354 gene locus_tag LOCUS_02940 3512 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3445 4680 gene locus_tag LOCUS_02950 3445 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4750 6168 gene locus_tag LOCUS_02960 gene frdA 4750 6168 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KN48 protein_id gnl|my_center|LOCUS_02960 6176 6598 gene locus_tag LOCUS_02970 gene hit 6176 6598 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_02970 6652 8205 gene locus_tag LOCUS_02980 6652 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8226 8846 gene locus_tag LOCUS_02990 8226 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 8938 14007 gene locus_tag LOCUS_03000 8938 14007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 14752 14018 gene locus_tag LOCUS_03010 14752 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 15651 14836 gene locus_tag LOCUS_03020 15651 14836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 16793 15684 gene locus_tag LOCUS_03030 16793 15684 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_03030 18859 16790 gene locus_tag LOCUS_03040 18859 16790 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_03040 19001 19282 gene locus_tag LOCUS_03050 19001 19282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 21245 19251 gene locus_tag LOCUS_03060 21245 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 21409 22335 gene locus_tag LOCUS_03070 gene tfb 21409 22335 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_03070 22399 23694 gene locus_tag LOCUS_03080 22399 23694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 27328 23678 gene locus_tag LOCUS_03090 gene nrdJ 27328 23678 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F3P1 protein_id gnl|my_center|LOCUS_03090 27891 27499 gene locus_tag LOCUS_03100 27891 27499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148883.1 protein_id gnl|my_center|LOCUS_03100 27944 29191 gene locus_tag LOCUS_03110 gene icdA 27944 29191 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z7G5 protein_id gnl|my_center|LOCUS_03110 32601 29233 gene locus_tag LOCUS_03120 32601 29233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 32714 33184 gene locus_tag LOCUS_03130 32714 33184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 34161 33175 gene locus_tag LOCUS_03140 34161 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 34265 34639 gene locus_tag LOCUS_03150 34265 34639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 35247 34636 gene locus_tag LOCUS_03160 35247 34636 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117603.1 protein_id gnl|my_center|LOCUS_03160 35845 35258 gene locus_tag LOCUS_03170 35845 35258 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_03170 36588 35893 gene locus_tag LOCUS_03180 36588 35893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 36914 36594 gene locus_tag LOCUS_03190 36914 36594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 36992 37426 gene locus_tag LOCUS_03200 gene rlmH 36992 37426 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CRD3 protein_id gnl|my_center|LOCUS_03200 37795 37427 gene locus_tag LOCUS_03210 gene panD 37795 37427 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4N0 protein_id gnl|my_center|LOCUS_03210 37941 45911 gene locus_tag LOCUS_03220 37941 45911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 46057 46422 gene locus_tag LOCUS_03230 46057 46422 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_03230 46415 46900 gene locus_tag LOCUS_03240 46415 46900 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_03240 46903 47340 gene locus_tag LOCUS_03250 46903 47340 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_03250 47352 47558 gene locus_tag LOCUS_03260 47352 47558 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_03260 47610 47687 gene locus_tag LOCUS_t00100 47610 47687 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 47764 49893 gene locus_tag LOCUS_03270 gene ligA 47764 49893 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43813 protein_id gnl|my_center|LOCUS_03270 50700 49894 gene locus_tag LOCUS_03280 50700 49894 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867248.1 protein_id gnl|my_center|LOCUS_03280 50891 51931 gene locus_tag LOCUS_03290 50891 51931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 52839 51934 gene locus_tag LOCUS_03300 52839 51934 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_03300 52912 54039 gene locus_tag LOCUS_03310 52912 54039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 54092 54445 gene locus_tag LOCUS_03320 54092 54445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 54503 54579 gene locus_tag LOCUS_t00110 54503 54579 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 54704 55081 gene locus_tag LOCUS_03330 54704 55081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 55477 55085 gene locus_tag LOCUS_03340 55477 55085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 56024 55470 gene locus_tag LOCUS_03350 56024 55470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 56129 56902 gene locus_tag LOCUS_03360 56129 56902 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_03360 57433 56903 gene locus_tag LOCUS_03370 gene nfuA 57433 56903 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2P8 protein_id gnl|my_center|LOCUS_03370 57647 58561 gene locus_tag LOCUS_03380 gene moaA 57647 58561 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63S72 protein_id gnl|my_center|LOCUS_03380 59844 58546 gene locus_tag LOCUS_03390 59844 58546 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249921.1 protein_id gnl|my_center|LOCUS_03390 60985 59867 gene locus_tag LOCUS_03400 60985 59867 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_03400 61190 64288 gene locus_tag LOCUS_03410 61190 64288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 64396 68220 gene locus_tag LOCUS_03420 64396 68220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 68220 68996 gene locus_tag LOCUS_03430 68220 68996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 68993 69715 gene locus_tag LOCUS_03440 68993 69715 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200384.1 protein_id gnl|my_center|LOCUS_03440 70342 69728 gene locus_tag LOCUS_03450 70342 69728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144231.1 protein_id gnl|my_center|LOCUS_03450 70775 70347 gene locus_tag LOCUS_03460 70775 70347 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_03460 70989 73148 gene locus_tag LOCUS_03470 70989 73148 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_03470 73162 75291 gene locus_tag LOCUS_03480 73162 75291 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146615.1 protein_id gnl|my_center|LOCUS_03480 75365 76000 gene locus_tag LOCUS_03490 75365 76000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 76104 76757 gene locus_tag LOCUS_03500 76104 76757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 76744 77112 gene locus_tag LOCUS_03510 76744 77112 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877304.1 protein_id gnl|my_center|LOCUS_03510 77815 77228 gene locus_tag LOCUS_03520 77815 77228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 78040 78564 gene locus_tag LOCUS_03530 78040 78564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 79808 78567 gene locus_tag LOCUS_03540 79808 78567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 79907 83176 gene locus_tag LOCUS_03550 79907 83176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 83317 84288 gene locus_tag LOCUS_03560 83317 84288 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_03560 84326 85258 gene locus_tag LOCUS_03570 84326 85258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 85315 88944 gene locus_tag LOCUS_03580 85315 88944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 88944 93842 gene locus_tag LOCUS_03590 88944 93842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 93881 95293 gene locus_tag LOCUS_03600 gene dapE 93881 95293 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946545.1 protein_id gnl|my_center|LOCUS_03600 95378 96013 gene locus_tag LOCUS_03610 95378 96013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 96773 96018 gene locus_tag LOCUS_03620 96773 96018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 96862 97995 gene locus_tag LOCUS_03630 96862 97995 CDS product TIGR01210 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_03630 98084 98362 gene locus_tag LOCUS_03640 98084 98362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 98373 100169 gene locus_tag LOCUS_03650 98373 100169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 100238 101521 gene locus_tag LOCUS_03660 gene ychF 100238 101521 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496963.1 protein_id gnl|my_center|LOCUS_03660 101995 101681 gene locus_tag LOCUS_03670 101995 101681 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870009.1 protein_id gnl|my_center|LOCUS_03670 103038 102016 gene locus_tag LOCUS_03680 103038 102016 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_03680 103679 103035 gene locus_tag LOCUS_03690 103679 103035 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_03690 104011 103733 gene locus_tag LOCUS_03700 104011 103733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 104963 104097 gene locus_tag LOCUS_03710 104963 104097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 105243 104980 gene locus_tag LOCUS_03720 105243 104980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 106456 105338 gene locus_tag LOCUS_03730 106456 105338 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902232.1 protein_id gnl|my_center|LOCUS_03730 107225 106545 gene locus_tag LOCUS_03740 107225 106545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 107769 107227 gene locus_tag LOCUS_03750 107769 107227 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_03750 107852 108976 gene locus_tag LOCUS_03760 107852 108976 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_03760 109059 110369 gene locus_tag LOCUS_03770 109059 110369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 110520 111089 gene locus_tag LOCUS_03780 110520 111089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 113865 111082 gene locus_tag LOCUS_03790 113865 111082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_03790 113979 115247 gene locus_tag LOCUS_03800 113979 115247 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_03800 115440 115249 gene locus_tag LOCUS_03810 115440 115249 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546429.1 protein_id gnl|my_center|LOCUS_03810 116003 115539 gene locus_tag LOCUS_03820 116003 115539 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978712.1 protein_id gnl|my_center|LOCUS_03820 117405 116008 gene locus_tag LOCUS_03830 117405 116008 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118348.1 protein_id gnl|my_center|LOCUS_03830 118909 117410 gene locus_tag LOCUS_03840 gene phr 118909 117410 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_03840 119057 119680 gene locus_tag LOCUS_03850 119057 119680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 119708 120181 gene locus_tag LOCUS_03860 gene ccp 119708 120181 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124248.1 protein_id gnl|my_center|LOCUS_03860 120181 121548 gene locus_tag LOCUS_03870 120181 121548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 121652 122869 gene locus_tag LOCUS_03880 121652 122869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 122873 123613 gene locus_tag LOCUS_03890 122873 123613 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333296.1 protein_id gnl|my_center|LOCUS_03890 123688 124707 gene locus_tag LOCUS_03900 123688 124707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence04 2657 735 gene locus_tag LOCUS_03910 2657 735 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_03910 3098 2682 gene locus_tag LOCUS_03920 3098 2682 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_03920 3580 3110 gene locus_tag LOCUS_03930 3580 3110 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_03930 4341 3577 gene locus_tag LOCUS_03940 4341 3577 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061173.1 protein_id gnl|my_center|LOCUS_03940 4853 4344 gene locus_tag LOCUS_03950 4853 4344 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879399.1 protein_id gnl|my_center|LOCUS_03950 5329 4853 gene locus_tag LOCUS_03960 5329 4853 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_03960 5982 5326 gene locus_tag LOCUS_03970 5982 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 6546 5995 gene locus_tag LOCUS_03980 6546 5995 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_03980 6947 6558 gene locus_tag LOCUS_03990 6947 6558 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_03990 7112 6960 gene locus_tag LOCUS_04000 7112 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 7640 7116 gene locus_tag LOCUS_04010 7640 7116 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_04010 8335 7637 gene locus_tag LOCUS_04020 8335 7637 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_04020 8763 8332 gene locus_tag LOCUS_04030 8763 8332 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875656.1 protein_id gnl|my_center|LOCUS_04030 9172 8774 gene locus_tag LOCUS_04040 9172 8774 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_04040 9501 9175 gene locus_tag LOCUS_04050 9501 9175 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_04050 9763 9503 gene locus_tag LOCUS_04060 9763 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 9948 9763 gene locus_tag LOCUS_04070 9948 9763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 10272 10069 gene locus_tag LOCUS_04080 10272 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 11022 10273 gene locus_tag LOCUS_04090 11022 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11556 11032 gene locus_tag LOCUS_04100 11556 11032 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867459.1 protein_id gnl|my_center|LOCUS_04100 12066 11566 gene locus_tag LOCUS_04110 12066 11566 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_04110 12797 12069 gene locus_tag LOCUS_04120 12797 12069 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_04120 13107 12808 gene locus_tag LOCUS_04130 13107 12808 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_04130 13982 13104 gene locus_tag LOCUS_04140 13982 13104 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_04140 15066 13987 gene locus_tag LOCUS_04150 15066 13987 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_04150 15359 17110 gene locus_tag LOCUS_04160 15359 17110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 17976 17116 gene locus_tag LOCUS_04170 17976 17116 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978476.1 protein_id gnl|my_center|LOCUS_04170 20153 17976 gene locus_tag LOCUS_04180 20153 17976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 21862 20252 gene locus_tag LOCUS_04190 21862 20252 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_04190 25383 21952 gene locus_tag LOCUS_04200 25383 21952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 25553 26638 gene locus_tag LOCUS_04210 25553 26638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 26853 26635 gene locus_tag LOCUS_04220 26853 26635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 28001 26862 gene locus_tag LOCUS_04230 28001 26862 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249503.1 protein_id gnl|my_center|LOCUS_04230 30722 28389 gene locus_tag LOCUS_04240 30722 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 31496 30762 gene locus_tag LOCUS_04250 31496 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 32839 31565 gene locus_tag LOCUS_04260 32839 31565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 33554 33282 gene locus_tag LOCUS_04270 33554 33282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 33553 34488 gene locus_tag LOCUS_04280 33553 34488 CDS product amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031147.1 protein_id gnl|my_center|LOCUS_04280 35484 34477 gene locus_tag LOCUS_04290 gene glnII 35484 34477 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_04290 35824 35748 gene locus_tag LOCUS_t00120 35824 35748 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 35878 36432 gene locus_tag LOCUS_04300 35878 36432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 36472 37248 gene locus_tag LOCUS_04310 36472 37248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 37290 37366 gene locus_tag LOCUS_t00130 37290 37366 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37464 37631 gene locus_tag LOCUS_04320 37464 37631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 38276 37614 gene locus_tag LOCUS_04330 38276 37614 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876672.1 protein_id gnl|my_center|LOCUS_04330 39281 38319 gene locus_tag LOCUS_04340 39281 38319 CDS product putative sugar-phosphate nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704340.1 protein_id gnl|my_center|LOCUS_04340 39386 40594 gene locus_tag LOCUS_04350 gene sucC 39386 40594 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020801.1 protein_id gnl|my_center|LOCUS_04350 40594 41514 gene locus_tag LOCUS_04360 gene sucD 40594 41514 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53591 protein_id gnl|my_center|LOCUS_04360 41560 42585 gene locus_tag LOCUS_04370 41560 42585 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188769.1 protein_id gnl|my_center|LOCUS_04370 42658 43908 gene locus_tag LOCUS_04380 42658 43908 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_04380 43975 45744 gene locus_tag LOCUS_04390 43975 45744 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_04390 45787 46305 gene locus_tag LOCUS_04400 gene grpE 45787 46305 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MTK5 protein_id gnl|my_center|LOCUS_04400 46396 48387 gene locus_tag LOCUS_04410 46396 48387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 48998 48384 gene locus_tag LOCUS_04420 48998 48384 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_04420 49678 48995 gene locus_tag LOCUS_04430 49678 48995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 49800 50915 gene locus_tag LOCUS_04440 49800 50915 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_04440 50994 51743 gene locus_tag LOCUS_04450 50994 51743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 53527 51725 gene locus_tag LOCUS_04460 53527 51725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 53585 54769 gene locus_tag LOCUS_04470 53585 54769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 55940 54771 gene locus_tag LOCUS_04480 55940 54771 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYC6 protein_id gnl|my_center|LOCUS_04480 56094 56717 gene locus_tag LOCUS_04490 56094 56717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 57137 56712 gene locus_tag LOCUS_04500 57137 56712 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_04500 58329 57148 gene locus_tag LOCUS_04510 gene kbl 58329 57148 CDS product 8-amino-7-oxononanoate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31777 protein_id gnl|my_center|LOCUS_04510 58429 59316 gene locus_tag LOCUS_04520 58429 59316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 59364 59798 gene locus_tag LOCUS_04530 59364 59798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 60666 59785 gene locus_tag LOCUS_04540 60666 59785 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_04540 61226 60681 gene locus_tag LOCUS_04550 61226 60681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 62195 61281 gene locus_tag LOCUS_04560 62195 61281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 63416 62208 gene locus_tag LOCUS_04570 63416 62208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 65101 63413 gene locus_tag LOCUS_04580 65101 63413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 66044 65106 gene locus_tag LOCUS_04590 66044 65106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_04590 67054 66041 gene locus_tag LOCUS_04600 67054 66041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 68045 67047 gene locus_tag LOCUS_04610 68045 67047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_04610 70290 68122 gene locus_tag LOCUS_04620 70290 68122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 72008 70290 gene locus_tag LOCUS_04630 72008 70290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 72808 72092 gene locus_tag LOCUS_04640 gene rlmB 72808 72092 CDS product 23S rRNA (guanosine-2'-O-)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83CW6 protein_id gnl|my_center|LOCUS_04640 73362 72805 gene locus_tag LOCUS_04650 73362 72805 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920406.1 protein_id gnl|my_center|LOCUS_04650 73448 73999 gene locus_tag LOCUS_04660 73448 73999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 74485 74000 gene locus_tag LOCUS_04670 74485 74000 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121177.1 protein_id gnl|my_center|LOCUS_04670 75329 74556 gene locus_tag LOCUS_04680 gene nadE 75329 74556 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_04680 75993 75343 gene locus_tag LOCUS_04690 75993 75343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 76098 79292 gene locus_tag LOCUS_04700 gene ileS 76098 79292 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HXZ6 protein_id gnl|my_center|LOCUS_04700 80713 79295 gene locus_tag LOCUS_04710 80713 79295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 82229 80799 gene locus_tag LOCUS_04720 82229 80799 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_04720 82957 82259 gene locus_tag LOCUS_04730 82957 82259 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_04730 83470 83078 gene locus_tag LOCUS_04740 83470 83078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 85514 83508 gene locus_tag LOCUS_04750 85514 83508 CDS product electron transfer flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943422.1 protein_id gnl|my_center|LOCUS_04750 85635 86642 gene locus_tag LOCUS_04760 85635 86642 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_04760 86660 87418 gene locus_tag LOCUS_04770 86660 87418 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048202361.1 protein_id gnl|my_center|LOCUS_04770 87521 90943 gene locus_tag LOCUS_04780 87521 90943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 90952 91425 gene locus_tag LOCUS_04790 90952 91425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 92285 91434 gene locus_tag LOCUS_04800 92285 91434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 92776 92291 gene locus_tag LOCUS_04810 gene bcp 92776 92291 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_04810 93504 92860 gene locus_tag LOCUS_04820 gene nth 93504 92860 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_04820 93722 93504 gene locus_tag LOCUS_04830 93722 93504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 95581 93746 gene locus_tag LOCUS_04840 95581 93746 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867537.1 protein_id gnl|my_center|LOCUS_04840 95782 96129 gene locus_tag LOCUS_04850 95782 96129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 96411 96133 gene locus_tag LOCUS_04860 96411 96133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 96473 97375 gene locus_tag LOCUS_04870 96473 97375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 97448 99523 gene locus_tag LOCUS_04880 gene hppA 97448 99523 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHJ2 protein_id gnl|my_center|LOCUS_04880 99570 100532 gene locus_tag LOCUS_04890 99570 100532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 100541 101128 gene locus_tag LOCUS_04900 100541 101128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 101402 101130 gene locus_tag LOCUS_04910 101402 101130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 <103933 101476 gene locus_tag LOCUS_04920 <103933 101476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112756.1:muropeptide MFS transporter AmpG >Feature sequence05 1287 925 gene locus_tag LOCUS_04930 1287 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 3636 1327 gene locus_tag LOCUS_04940 3636 1327 CDS product aminodeoxychorismate components I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886842.1 protein_id gnl|my_center|LOCUS_04940 4423 3641 gene locus_tag LOCUS_04950 4423 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13002 4468 gene locus_tag LOCUS_04960 13002 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13313 15526 gene locus_tag LOCUS_04970 gene maeB 13313 15526 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_04970 17151 15535 gene locus_tag LOCUS_04980 gene pckA 17151 15535 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TBF9 protein_id gnl|my_center|LOCUS_04980 17199 21005 gene locus_tag LOCUS_04990 17199 21005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 21190 22068 gene locus_tag LOCUS_05000 21190 22068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 22093 23397 gene locus_tag LOCUS_05010 22093 23397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 23510 23974 gene locus_tag LOCUS_05020 23510 23974 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_05020 23984 24664 gene locus_tag LOCUS_05030 23984 24664 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867652.1 protein_id gnl|my_center|LOCUS_05030 24664 25044 gene locus_tag LOCUS_05040 24664 25044 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_05040 25055 25939 gene locus_tag LOCUS_05050 25055 25939 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053732.1 protein_id gnl|my_center|LOCUS_05050 25985 26959 gene locus_tag LOCUS_05060 25985 26959 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251091.1 protein_id gnl|my_center|LOCUS_05060 28003 26951 gene locus_tag LOCUS_05070 28003 26951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 30916 28064 gene locus_tag LOCUS_05080 gene leuS 30916 28064 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLA8 protein_id gnl|my_center|LOCUS_05080 31068 31832 gene locus_tag LOCUS_05090 31068 31832 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_05090 31832 32233 gene locus_tag LOCUS_05100 31832 32233 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_05100 34887 32230 gene locus_tag LOCUS_05110 gene aceE 34887 32230 CDS product pyruvate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZVD6 protein_id gnl|my_center|LOCUS_05110 35530 34958 gene locus_tag LOCUS_05120 35530 34958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 36742 35585 gene locus_tag LOCUS_05130 36742 35585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 36878 38803 gene locus_tag LOCUS_05140 36878 38803 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496391.1 protein_id gnl|my_center|LOCUS_05140 38813 39388 gene locus_tag LOCUS_05150 38813 39388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 39398 40000 gene locus_tag LOCUS_05160 gene SUA5 39398 40000 CDS product translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124515.1 protein_id gnl|my_center|LOCUS_05160 39979 40989 gene locus_tag LOCUS_05170 39979 40989 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_05170 42050 41136 gene locus_tag LOCUS_05180 42050 41136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728967.1 protein_id gnl|my_center|LOCUS_05180 42387 42061 gene locus_tag LOCUS_05190 42387 42061 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY77 protein_id gnl|my_center|LOCUS_05190 42737 42393 gene locus_tag LOCUS_05200 42737 42393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 43447 42767 gene locus_tag LOCUS_05210 gene rpe 43447 42767 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD84 protein_id gnl|my_center|LOCUS_05210 43569 43886 gene locus_tag LOCUS_05220 43569 43886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 45406 43883 gene locus_tag LOCUS_05230 45406 43883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 45511 45660 gene locus_tag LOCUS_05240 45511 45660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 45733 47235 gene locus_tag LOCUS_05250 45733 47235 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_05250 47261 48325 gene locus_tag LOCUS_05260 47261 48325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 48549 48791 gene locus_tag LOCUS_05270 48549 48791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 50689 49082 gene locus_tag LOCUS_05280 gene fumC 50689 49082 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9L0 protein_id gnl|my_center|LOCUS_05280 51251 50769 gene locus_tag LOCUS_05290 51251 50769 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E3D9G4 protein_id gnl|my_center|LOCUS_05290 51336 52466 gene locus_tag LOCUS_05300 51336 52466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 52871 52473 gene locus_tag LOCUS_05310 gene csaA 52871 52473 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948249.1 protein_id gnl|my_center|LOCUS_05310 53456 52872 gene locus_tag LOCUS_05320 gene pyrE 53456 52872 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727B2 protein_id gnl|my_center|LOCUS_05320 53595 57566 gene locus_tag LOCUS_05330 53595 57566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 58322 57567 gene locus_tag LOCUS_05340 58322 57567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 58434 59564 gene locus_tag LOCUS_05350 58434 59564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 59604 60728 gene locus_tag LOCUS_05360 59604 60728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_05360 61148 60729 gene locus_tag LOCUS_05370 61148 60729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 61852 61208 gene locus_tag LOCUS_05380 61852 61208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 67050 61915 gene locus_tag LOCUS_05390 67050 61915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 68801 67146 gene locus_tag LOCUS_05400 68801 67146 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_05400 70145 68865 gene locus_tag LOCUS_05410 gene metK 70145 68865 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9E3 protein_id gnl|my_center|LOCUS_05410 70253 71005 gene locus_tag LOCUS_05420 70253 71005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 72371 71007 gene locus_tag LOCUS_05430 72371 71007 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762823.1 protein_id gnl|my_center|LOCUS_05430 72422 72658 gene locus_tag LOCUS_05440 72422 72658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 72770 73702 gene locus_tag LOCUS_05450 72770 73702 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979217.1 protein_id gnl|my_center|LOCUS_05450 73704 74486 gene locus_tag LOCUS_05460 73704 74486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_05460 75672 74488 gene locus_tag LOCUS_05470 75672 74488 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020259.1 protein_id gnl|my_center|LOCUS_05470 75771 76388 gene locus_tag LOCUS_05480 75771 76388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 76463 78433 gene locus_tag LOCUS_05490 76463 78433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 78583 79143 gene locus_tag LOCUS_05500 78583 79143 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868386.1 protein_id gnl|my_center|LOCUS_05500 79164 79565 gene locus_tag LOCUS_05510 79164 79565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 79617 80000 gene locus_tag LOCUS_05520 gene gcvH 79617 80000 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKW9 protein_id gnl|my_center|LOCUS_05520 80005 80544 gene locus_tag LOCUS_05530 80005 80544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 80956 80546 gene locus_tag LOCUS_05540 80956 80546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 81018 81464 gene locus_tag LOCUS_05550 81018 81464 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722083.1 protein_id gnl|my_center|LOCUS_05550 81562 81489 gene locus_tag LOCUS_t00140 81562 81489 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 82813 81638 gene locus_tag LOCUS_05560 82813 81638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 83009 84103 gene locus_tag LOCUS_05570 gene aspC 83009 84103 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_05570 84221 84604 gene locus_tag LOCUS_05580 84221 84604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 84606 85553 gene locus_tag LOCUS_05590 84606 85553 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_05590 86795 85545 gene locus_tag LOCUS_05600 gene eno 86795 85545 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42848 protein_id gnl|my_center|LOCUS_05600 87277 86843 gene locus_tag LOCUS_05610 87277 86843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 87336 87854 gene locus_tag LOCUS_05620 87336 87854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 88690 87851 gene locus_tag LOCUS_05630 88690 87851 CDS product phthiotriol/phenolphthiotriol dimycocerosates methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TXK3 protein_id gnl|my_center|LOCUS_05630 89232 88678 gene locus_tag LOCUS_05640 89232 88678 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_05640 91519 89258 gene locus_tag LOCUS_05650 91519 89258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 92830 91661 gene locus_tag LOCUS_05660 92830 91661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867599.1 protein_id gnl|my_center|LOCUS_05660 93075 93542 gene locus_tag LOCUS_05670 93075 93542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 93552 94196 gene locus_tag LOCUS_05680 93552 94196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 94234 94443 gene locus_tag LOCUS_05690 94234 94443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 94487 95011 gene locus_tag LOCUS_05700 94487 95011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 95037 95480 gene locus_tag LOCUS_05710 95037 95480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 96285 95488 gene locus_tag LOCUS_05720 96285 95488 CDS product dimethylargininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_05720 96427 96849 gene locus_tag LOCUS_05730 96427 96849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_05730 98797 96851 gene locus_tag LOCUS_05740 98797 96851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 98940 98856 gene locus_tag LOCUS_t00150 98940 98856 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 970 1047 gene locus_tag LOCUS_t00160 970 1047 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1658 1071 gene locus_tag LOCUS_05750 1658 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 1943 3448 gene locus_tag LOCUS_05760 1943 3448 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_05760 3487 4224 gene locus_tag LOCUS_05770 3487 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4421 4239 gene locus_tag LOCUS_05780 4421 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 5547 4537 gene locus_tag LOCUS_05790 5547 4537 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_05790 7838 5544 gene locus_tag LOCUS_05800 gene uvrB 7838 5544 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJH7 protein_id gnl|my_center|LOCUS_05800 8778 7840 gene locus_tag LOCUS_05810 8778 7840 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887497.1 protein_id gnl|my_center|LOCUS_05810 10703 8778 gene locus_tag LOCUS_05820 10703 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 10755 11984 gene locus_tag LOCUS_05830 10755 11984 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_05830 11974 14355 gene locus_tag LOCUS_05840 11974 14355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 14434 15129 gene locus_tag LOCUS_05850 14434 15129 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762843.1 protein_id gnl|my_center|LOCUS_05850 15267 15905 gene locus_tag LOCUS_05860 15267 15905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 15979 16593 gene locus_tag LOCUS_05870 15979 16593 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_05870 16793 17773 gene locus_tag LOCUS_05880 16793 17773 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB61 protein_id gnl|my_center|LOCUS_05880 17828 18583 gene locus_tag LOCUS_05890 17828 18583 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187V6 protein_id gnl|my_center|LOCUS_05890 18622 19707 gene locus_tag LOCUS_05900 18622 19707 CDS product NADP-dependent aryl-alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083050.1 protein_id gnl|my_center|LOCUS_05900 19720 20484 gene locus_tag LOCUS_05910 19720 20484 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583308.1 protein_id gnl|my_center|LOCUS_05910 20511 21605 gene locus_tag LOCUS_05920 20511 21605 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002304146.1 protein_id gnl|my_center|LOCUS_05920 22691 21609 gene locus_tag LOCUS_05930 22691 21609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 23418 22756 gene locus_tag LOCUS_05940 23418 22756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 23949 23482 gene locus_tag LOCUS_05950 23949 23482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 26334 24268 gene locus_tag LOCUS_05960 26334 24268 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877796.1 protein_id gnl|my_center|LOCUS_05960 26431 29037 gene locus_tag LOCUS_05970 26431 29037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29034 30158 gene locus_tag LOCUS_05980 29034 30158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 30155 30730 gene locus_tag LOCUS_05990 30155 30730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 31955 30732 gene locus_tag LOCUS_06000 31955 30732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 32009 33091 gene locus_tag LOCUS_06010 32009 33091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 33105 33470 gene locus_tag LOCUS_06020 33105 33470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119620.1 protein_id gnl|my_center|LOCUS_06020 33527 34231 gene locus_tag LOCUS_06030 33527 34231 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_06030 34231 37596 gene locus_tag LOCUS_06040 34231 37596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 37598 38599 gene locus_tag LOCUS_06050 37598 38599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 39623 38583 gene locus_tag LOCUS_06060 39623 38583 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250622.1 protein_id gnl|my_center|LOCUS_06060 39768 40355 gene locus_tag LOCUS_06070 39768 40355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 40428 41891 gene locus_tag LOCUS_06080 gene guaB 40428 41891 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RT5 protein_id gnl|my_center|LOCUS_06080 41866 42417 gene locus_tag LOCUS_06090 gene msrA 41866 42417 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_06090 42518 42952 gene locus_tag LOCUS_06100 42518 42952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 42969 43808 gene locus_tag LOCUS_06110 42969 43808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 45066 43798 gene locus_tag LOCUS_06120 45066 43798 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_06120 45144 45683 gene locus_tag LOCUS_06130 gene orn 45144 45683 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CEU2 protein_id gnl|my_center|LOCUS_06130 45780 48029 gene locus_tag LOCUS_06140 45780 48029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 48056 48616 gene locus_tag LOCUS_06150 48056 48616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 50360 48588 gene locus_tag LOCUS_06160 50360 48588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 51331 50438 gene locus_tag LOCUS_06170 51331 50438 CDS product met-10+ related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868385.1 protein_id gnl|my_center|LOCUS_06170 51420 54371 gene locus_tag LOCUS_06180 51420 54371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 56103 54379 gene locus_tag LOCUS_06190 56103 54379 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_06190 56159 58327 gene locus_tag LOCUS_06200 56159 58327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 58561 58328 gene locus_tag LOCUS_06210 58561 58328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 58797 58564 gene locus_tag LOCUS_06220 58797 58564 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_06220 58914 63623 gene locus_tag LOCUS_06230 58914 63623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 64355 63624 gene locus_tag LOCUS_06240 64355 63624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 64459 65670 gene locus_tag LOCUS_06250 64459 65670 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_06250 65723 66781 gene locus_tag LOCUS_06260 65723 66781 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528460.1 protein_id gnl|my_center|LOCUS_06260 67387 66782 gene locus_tag LOCUS_06270 67387 66782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 68427 67393 gene locus_tag LOCUS_06280 68427 67393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_06280 68612 68791 gene locus_tag LOCUS_06290 68612 68791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 68840 71146 gene locus_tag LOCUS_06300 68840 71146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460248.1 protein_id gnl|my_center|LOCUS_06300 72468 71149 gene locus_tag LOCUS_06310 72468 71149 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 protein_id gnl|my_center|LOCUS_06310 72611 72688 gene locus_tag LOCUS_t00170 72611 72688 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 72828 73829 gene locus_tag LOCUS_06320 72828 73829 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_06320 75556 73856 gene locus_tag LOCUS_06330 75556 73856 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_06330 75809 75561 gene locus_tag LOCUS_06340 75809 75561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 76420 75875 gene locus_tag LOCUS_06350 76420 75875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 79038 76477 gene locus_tag LOCUS_06360 79038 76477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 79544 79068 gene locus_tag LOCUS_06370 79544 79068 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_06370 79632 80984 gene locus_tag LOCUS_06380 79632 80984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 84805 80987 gene locus_tag LOCUS_06390 84805 80987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 86119 84866 gene locus_tag LOCUS_06400 86119 84866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 87259 86189 gene locus_tag LOCUS_06410 gene ctaB 87259 86189 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_06410 88376 87291 gene locus_tag LOCUS_06420 88376 87291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 88671 88414 gene locus_tag LOCUS_06430 88671 88414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 89917 88757 gene locus_tag LOCUS_06440 89917 88757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 91046 89970 gene locus_tag LOCUS_06450 91046 89970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence07 682 1113 gene locus_tag LOCUS_06460 682 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1412 1110 gene locus_tag LOCUS_06470 1412 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1861 1394 gene locus_tag LOCUS_06480 1861 1394 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_06480 1965 2942 gene locus_tag LOCUS_06490 1965 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 5401 2939 gene locus_tag LOCUS_06500 5401 2939 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_06500 5554 8478 gene locus_tag LOCUS_06510 5554 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 8516 8992 gene locus_tag LOCUS_06520 8516 8992 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958244.1 protein_id gnl|my_center|LOCUS_06520 9764 9375 gene locus_tag LOCUS_06530 9764 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024037.1 protein_id gnl|my_center|LOCUS_06530 10889 9804 gene locus_tag LOCUS_06540 gene pyrD 10889 9804 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KXR7 protein_id gnl|my_center|LOCUS_06540 10960 11367 gene locus_tag LOCUS_06550 10960 11367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 11500 13758 gene locus_tag LOCUS_06560 11500 13758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13805 15013 gene locus_tag LOCUS_06570 13805 15013 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_06570 15018 16118 gene locus_tag LOCUS_06580 15018 16118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 17290 16115 gene locus_tag LOCUS_06590 gene mqnC 17290 16115 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJC2 protein_id gnl|my_center|LOCUS_06590 18603 17287 gene locus_tag LOCUS_06600 gene pepP 18603 17287 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44881 protein_id gnl|my_center|LOCUS_06600 20073 18646 gene locus_tag LOCUS_06610 20073 18646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 21242 20190 gene locus_tag LOCUS_06620 21242 20190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 21323 22333 gene locus_tag LOCUS_06630 21323 22333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 24335 22338 gene locus_tag LOCUS_06640 24335 22338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 25119 24385 gene locus_tag LOCUS_06650 25119 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 26176 25121 gene locus_tag LOCUS_06660 26176 25121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 27675 26251 gene locus_tag LOCUS_06670 gene pntB 27675 26251 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_06670 27992 27678 gene locus_tag LOCUS_06680 27992 27678 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_06680 29152 27992 gene locus_tag LOCUS_06690 gene pntaA 29152 27992 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931189.1 protein_id gnl|my_center|LOCUS_06690 29980 29270 gene locus_tag LOCUS_06700 29980 29270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 30090 31028 gene locus_tag LOCUS_06710 30090 31028 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_06710 31049 31804 gene locus_tag LOCUS_06720 31049 31804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 31905 31828 gene locus_tag LOCUS_t00180 31905 31828 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 32377 31943 gene locus_tag LOCUS_06730 32377 31943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 32420 32749 gene locus_tag LOCUS_06740 32420 32749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 34666 32750 gene locus_tag LOCUS_06750 34666 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_06750 35368 34742 gene locus_tag LOCUS_06760 gene psmB 35368 34742 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_06760 35537 35941 gene locus_tag LOCUS_06770 35537 35941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 35951 36544 gene locus_tag LOCUS_06780 35951 36544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146800.1 protein_id gnl|my_center|LOCUS_06780 37930 36548 gene locus_tag LOCUS_06790 37930 36548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 38029 39084 gene locus_tag LOCUS_06800 38029 39084 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_06800 40164 39079 gene locus_tag LOCUS_06810 40164 39079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 40199 41035 gene locus_tag LOCUS_06820 40199 41035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 41036 41884 gene locus_tag LOCUS_06830 gene thyA 41036 41884 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_06830 41894 42409 gene locus_tag LOCUS_06840 gene folA 41894 42409 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEC3 protein_id gnl|my_center|LOCUS_06840 42470 43204 gene locus_tag LOCUS_06850 42470 43204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 43205 43600 gene locus_tag LOCUS_06860 gene yuxK 43205 43600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_06860 45054 43597 gene locus_tag LOCUS_06870 45054 43597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 45450 45091 gene locus_tag LOCUS_06880 45450 45091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 46284 45526 gene locus_tag LOCUS_06890 46284 45526 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_06890 47201 46329 gene locus_tag LOCUS_06900 47201 46329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 47344 47772 gene locus_tag LOCUS_06910 47344 47772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 47852 48124 gene locus_tag LOCUS_06920 47852 48124 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199372.1 protein_id gnl|my_center|LOCUS_06920 48259 49179 gene locus_tag LOCUS_06930 48259 49179 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867914.1 protein_id gnl|my_center|LOCUS_06930 50217 49180 gene locus_tag LOCUS_06940 50217 49180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 51779 50214 gene locus_tag LOCUS_06950 51779 50214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 52436 51789 gene locus_tag LOCUS_06960 52436 51789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 54326 52446 gene locus_tag LOCUS_06970 54326 52446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 54422 55258 gene locus_tag LOCUS_06980 54422 55258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 55255 56232 gene locus_tag LOCUS_06990 55255 56232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 56309 57178 gene locus_tag LOCUS_07000 56309 57178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 58121 57180 gene locus_tag LOCUS_07010 58121 57180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 58500 58204 gene locus_tag LOCUS_07020 58500 58204 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012981234.1 protein_id gnl|my_center|LOCUS_07020 60092 58512 gene locus_tag LOCUS_07030 60092 58512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 63196 60092 gene locus_tag LOCUS_07040 63196 60092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 66915 63193 gene locus_tag LOCUS_07050 66915 63193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 67515 66928 gene locus_tag LOCUS_07060 67515 66928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 67801 69174 gene locus_tag LOCUS_07070 67801 69174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 69459 69166 gene locus_tag LOCUS_07080 69459 69166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 70412 69498 gene locus_tag LOCUS_07090 70412 69498 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_07090 70759 70448 gene locus_tag LOCUS_07100 70759 70448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 70934 71713 gene locus_tag LOCUS_07110 70934 71713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 71710 72159 gene locus_tag LOCUS_07120 71710 72159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 72162 73007 gene locus_tag LOCUS_07130 72162 73007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 73018 73884 gene locus_tag LOCUS_07140 73018 73884 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902392.1 protein_id gnl|my_center|LOCUS_07140 73897 76683 gene locus_tag LOCUS_07150 73897 76683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 76953 76684 gene locus_tag LOCUS_07160 76953 76684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 77035 77367 gene locus_tag LOCUS_07170 77035 77367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 77373 77663 gene locus_tag LOCUS_07180 77373 77663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 79541 77676 gene locus_tag LOCUS_07190 79541 77676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 80406 79759 gene locus_tag LOCUS_07200 80406 79759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769002.1 protein_id gnl|my_center|LOCUS_07200 81294 80428 gene locus_tag LOCUS_07210 81294 80428 CDS product LAO/AO transport system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730150.1 protein_id gnl|my_center|LOCUS_07210 81716 81279 gene locus_tag LOCUS_07220 81716 81279 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_07220 81826 83379 gene locus_tag LOCUS_07230 81826 83379 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_07230 83390 83584 gene locus_tag LOCUS_07240 83390 83584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 83589 83993 gene locus_tag LOCUS_07250 83589 83993 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392669.1 protein_id gnl|my_center|LOCUS_07250 84014 84259 gene locus_tag LOCUS_07260 84014 84259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 84922 84260 gene locus_tag LOCUS_07270 84922 84260 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_07270 85106 84995 gene locus_tag LOCUS_r00010 85106 84995 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence08 <1 714 gene locus_tag LOCUS_07280 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259082.1:arginine ABC transporter ATP-binding protein 1604 711 gene locus_tag LOCUS_07290 1604 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1702 2781 gene locus_tag LOCUS_07300 1702 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2902 4605 gene locus_tag LOCUS_07310 gene mdlB 2902 4605 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125248.1 protein_id gnl|my_center|LOCUS_07310 4598 5035 gene locus_tag LOCUS_07320 4598 5035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5095 5430 gene locus_tag LOCUS_07330 5095 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 5452 5700 gene locus_tag LOCUS_07340 5452 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 5761 6363 gene locus_tag LOCUS_07350 5761 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 6443 7849 gene locus_tag LOCUS_07360 6443 7849 CDS product flotillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_07360 7905 9128 gene locus_tag LOCUS_07370 7905 9128 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459846.1 protein_id gnl|my_center|LOCUS_07370 9931 9125 gene locus_tag LOCUS_07380 9931 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 10929 9952 gene locus_tag LOCUS_07390 10929 9952 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_07390 12114 10939 gene locus_tag LOCUS_07400 12114 10939 CDS product pheromone shutdown protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656981.1 protein_id gnl|my_center|LOCUS_07400 12953 12114 gene locus_tag LOCUS_07410 12953 12114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 13009 13680 gene locus_tag LOCUS_07420 13009 13680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 13686 14252 gene locus_tag LOCUS_07430 13686 14252 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_07430 14320 15651 gene locus_tag LOCUS_07440 14320 15651 CDS product carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_07440 15651 19016 gene locus_tag LOCUS_07450 15651 19016 CDS product carbamoyl phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_07450 19081 21099 gene locus_tag LOCUS_07460 19081 21099 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020139.1 protein_id gnl|my_center|LOCUS_07460 22659 21082 gene locus_tag LOCUS_07470 gene lysS 22659 21082 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E175 protein_id gnl|my_center|LOCUS_07470 23262 22669 gene locus_tag LOCUS_07480 23262 22669 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496888.1 protein_id gnl|my_center|LOCUS_07480 23784 23335 gene locus_tag LOCUS_07490 gene dut 23784 23335 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66592 protein_id gnl|my_center|LOCUS_07490 23874 24284 gene locus_tag LOCUS_07500 23874 24284 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869589.1 protein_id gnl|my_center|LOCUS_07500 25319 24297 gene locus_tag LOCUS_07510 gene fadB5 25319 24297 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_07510 25901 25329 gene locus_tag LOCUS_07520 25901 25329 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214821.1 protein_id gnl|my_center|LOCUS_07520 26248 25910 gene locus_tag LOCUS_07530 26248 25910 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EGD7 protein_id gnl|my_center|LOCUS_07530 26702 26250 gene locus_tag LOCUS_07540 26702 26250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 26820 27908 gene locus_tag LOCUS_07550 26820 27908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_07550 28676 28071 gene locus_tag LOCUS_07560 28676 28071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 29003 28695 gene locus_tag LOCUS_07570 29003 28695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 29707 29015 gene locus_tag LOCUS_07580 29707 29015 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496770.1 protein_id gnl|my_center|LOCUS_07580 29812 31059 gene locus_tag LOCUS_07590 29812 31059 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_07590 31068 32795 gene locus_tag LOCUS_07600 gene argS 31068 32795 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFK0 protein_id gnl|my_center|LOCUS_07600 33107 32796 gene locus_tag LOCUS_07610 33107 32796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 33165 33623 gene locus_tag LOCUS_07620 33165 33623 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_07620 34206 33634 gene locus_tag LOCUS_07630 gene ubiX 34206 33634 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HX08 protein_id gnl|my_center|LOCUS_07630 35439 34243 gene locus_tag LOCUS_07640 gene cefD 35439 34243 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_07640 36110 35436 gene locus_tag LOCUS_07650 gene lipB 36110 35436 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ3 protein_id gnl|my_center|LOCUS_07650 37556 36120 gene locus_tag LOCUS_07660 37556 36120 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 protein_id gnl|my_center|LOCUS_07660 38858 37566 gene locus_tag LOCUS_07670 38858 37566 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW2 protein_id gnl|my_center|LOCUS_07670 39871 38861 gene locus_tag LOCUS_07680 39871 38861 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067042.1 protein_id gnl|my_center|LOCUS_07680 41109 39871 gene locus_tag LOCUS_07690 gene bkdA1 41109 39871 CDS product 2-oxoisovalerate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I1M2 protein_id gnl|my_center|LOCUS_07690 42198 41155 gene locus_tag LOCUS_07700 gene lipA 42198 41155 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ4 protein_id gnl|my_center|LOCUS_07700 42299 43057 gene locus_tag LOCUS_07710 42299 43057 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918305.1 protein_id gnl|my_center|LOCUS_07710 43044 43463 gene locus_tag LOCUS_07720 43044 43463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 43570 43486 gene locus_tag LOCUS_t00190 43570 43486 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 43757 46654 gene locus_tag LOCUS_07730 43757 46654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 46733 55687 gene locus_tag LOCUS_07740 46733 55687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 56152 55676 gene locus_tag LOCUS_07750 56152 55676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 58226 56190 gene locus_tag LOCUS_07760 58226 56190 CDS product DNA repair helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_07760 58517 58317 gene locus_tag LOCUS_07770 58517 58317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 58893 58522 gene locus_tag LOCUS_07780 58893 58522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 59141 60379 gene locus_tag LOCUS_07790 59141 60379 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146536.1 protein_id gnl|my_center|LOCUS_07790 60482 61837 gene locus_tag LOCUS_07800 gene gdhA 60482 61837 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_07800 62586 61846 gene locus_tag LOCUS_07810 62586 61846 CDS product glutamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937416.1 protein_id gnl|my_center|LOCUS_07810 65172 62587 gene locus_tag LOCUS_07820 65172 62587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 65488 65186 gene locus_tag LOCUS_07830 65488 65186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 65918 65490 gene locus_tag LOCUS_07840 65918 65490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 67183 65960 gene locus_tag LOCUS_07850 67183 65960 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKN9 protein_id gnl|my_center|LOCUS_07850 67284 67733 gene locus_tag LOCUS_07860 67284 67733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 68758 67736 gene locus_tag LOCUS_07870 gene tfb 68758 67736 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250231.1 protein_id gnl|my_center|LOCUS_07870 68898 70037 gene locus_tag LOCUS_07880 gene gcvT 68898 70037 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY54 protein_id gnl|my_center|LOCUS_07880 70101 71654 gene locus_tag LOCUS_07890 70101 71654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 72490 71651 gene locus_tag LOCUS_07900 72490 71651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 72614 73981 gene locus_tag LOCUS_07910 72614 73981 CDS product glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_07910 73978 75498 gene locus_tag LOCUS_07920 gene gcvPB 73978 75498 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY57 protein_id gnl|my_center|LOCUS_07920 75534 76388 gene locus_tag LOCUS_07930 75534 76388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 76445 76921 gene locus_tag LOCUS_07940 76445 76921 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_07940 76927 77871 gene locus_tag LOCUS_07950 76927 77871 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_07950 77894 78157 gene locus_tag LOCUS_07960 77894 78157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 78189 78264 gene locus_tag LOCUS_t00200 78189 78264 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 <1 6873 gene locus_tag LOCUS_07970 <1 6873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P16397:bacillopeptidase F 7003 7173 gene locus_tag LOCUS_07980 7003 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 7800 7174 gene locus_tag LOCUS_07990 7800 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 7852 8343 gene locus_tag LOCUS_08000 7852 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 9840 8344 gene locus_tag LOCUS_08010 9840 8344 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_08010 9921 12788 gene locus_tag LOCUS_08020 gene alaS 9921 12788 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_08020 12834 14036 gene locus_tag LOCUS_08030 12834 14036 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_08030 14041 15132 gene locus_tag LOCUS_08040 14041 15132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 15216 18263 gene locus_tag LOCUS_08050 15216 18263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 18272 18748 gene locus_tag LOCUS_08060 18272 18748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 20520 18751 gene locus_tag LOCUS_08070 20520 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 20531 21292 gene locus_tag LOCUS_08080 20531 21292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_08080 21359 22618 gene locus_tag LOCUS_08090 gene purD 21359 22618 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1F7 protein_id gnl|my_center|LOCUS_08090 22738 32259 gene locus_tag LOCUS_08100 22738 32259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 32337 33575 gene locus_tag LOCUS_08110 32337 33575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 33716 37894 gene locus_tag LOCUS_08120 33716 37894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 37963 40491 gene locus_tag LOCUS_08130 37963 40491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 41248 40478 gene locus_tag LOCUS_08140 41248 40478 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_08140 41486 47206 gene locus_tag LOCUS_08150 41486 47206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 47248 47718 gene locus_tag LOCUS_08160 47248 47718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 48051 47719 gene locus_tag LOCUS_08170 48051 47719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 48124 49128 gene locus_tag LOCUS_08180 48124 49128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 49834 49109 gene locus_tag LOCUS_08190 49834 49109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 49722 50474 gene locus_tag LOCUS_08200 49722 50474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 50526 51677 gene locus_tag LOCUS_08210 gene dnaJ 50526 51677 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9A6 protein_id gnl|my_center|LOCUS_08210 53794 51674 gene locus_tag LOCUS_08220 53794 51674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 53857 55641 gene locus_tag LOCUS_08230 53857 55641 CDS product archaeosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496944.1 protein_id gnl|my_center|LOCUS_08230 55716 56171 gene locus_tag LOCUS_08240 55716 56171 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_08240 56356 56237 gene locus_tag LOCUS_08250 56356 56237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 56346 57068 gene locus_tag LOCUS_08260 56346 57068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 59036 57069 gene locus_tag LOCUS_08270 59036 57069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 60931 59165 gene locus_tag LOCUS_08280 60931 59165 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064200.1 protein_id gnl|my_center|LOCUS_08280 61653 60925 gene locus_tag LOCUS_08290 61653 60925 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867642.1 protein_id gnl|my_center|LOCUS_08290 64545 61654 gene locus_tag LOCUS_08300 64545 61654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 64638 64826 gene locus_tag LOCUS_08310 64638 64826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 66588 64834 gene locus_tag LOCUS_08320 66588 64834 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_08320 68135 66597 gene locus_tag LOCUS_08330 68135 66597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 68293 69333 gene locus_tag LOCUS_08340 68293 69333 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876640.1 protein_id gnl|my_center|LOCUS_08340 69403 74184 gene locus_tag LOCUS_08350 69403 74184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 74227 74850 gene locus_tag LOCUS_08360 gene adk 74227 74850 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE31 protein_id gnl|my_center|LOCUS_08360 74858 75172 gene locus_tag LOCUS_08370 74858 75172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 75177 75446 gene locus_tag LOCUS_08380 75177 75446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 75518 77197 gene locus_tag LOCUS_08390 75518 77197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence10 269 194 gene locus_tag LOCUS_t00210 269 194 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1361 327 gene locus_tag LOCUS_08400 1361 327 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_08400 3145 1358 gene locus_tag LOCUS_08410 3145 1358 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_08410 3301 4335 gene locus_tag LOCUS_08420 3301 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4401 7088 gene locus_tag LOCUS_08430 gene citB 4401 7088 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_08430 7153 7794 gene locus_tag LOCUS_08440 7153 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 7905 14336 gene locus_tag LOCUS_08450 7905 14336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 14407 15672 gene locus_tag LOCUS_08460 gene ahcY 14407 15672 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G6 protein_id gnl|my_center|LOCUS_08460 16673 15693 gene locus_tag LOCUS_08470 16673 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 17414 16740 gene locus_tag LOCUS_08480 17414 16740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 19424 17469 gene locus_tag LOCUS_08490 19424 17469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 19623 21272 gene locus_tag LOCUS_08500 19623 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 21478 23817 gene locus_tag LOCUS_08510 21478 23817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 23822 24919 gene locus_tag LOCUS_08520 23822 24919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 24924 25967 gene locus_tag LOCUS_08530 24924 25967 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023817.1 protein_id gnl|my_center|LOCUS_08530 25964 26773 gene locus_tag LOCUS_08540 25964 26773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_08540 26795 27976 gene locus_tag LOCUS_08550 26795 27976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031788.1 protein_id gnl|my_center|LOCUS_08550 28895 27981 gene locus_tag LOCUS_08560 28895 27981 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576383.1 protein_id gnl|my_center|LOCUS_08560 29629 28892 gene locus_tag LOCUS_08570 29629 28892 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704527.1 protein_id gnl|my_center|LOCUS_08570 30563 29733 gene locus_tag LOCUS_08580 30563 29733 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731334.1 protein_id gnl|my_center|LOCUS_08580 31045 30590 gene locus_tag LOCUS_08590 31045 30590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 32100 31054 gene locus_tag LOCUS_08600 32100 31054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 32764 32189 gene locus_tag LOCUS_08610 32764 32189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 33807 32797 gene locus_tag LOCUS_08620 gene gpsA 33807 32797 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4U9 protein_id gnl|my_center|LOCUS_08620 33912 33996 gene locus_tag LOCUS_t00220 33912 33996 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34103 36136 gene locus_tag LOCUS_08630 34103 36136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 36163 36846 gene locus_tag LOCUS_08640 36163 36846 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_08640 36872 39334 gene locus_tag LOCUS_08650 36872 39334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879315.1 protein_id gnl|my_center|LOCUS_08650 39345 40124 gene locus_tag LOCUS_08660 gene exoA 39345 40124 CDS product exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121736.1 protein_id gnl|my_center|LOCUS_08660 40198 40995 gene locus_tag LOCUS_08670 40198 40995 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_08670 41000 41938 gene locus_tag LOCUS_08680 41000 41938 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870761.1 protein_id gnl|my_center|LOCUS_08680 41935 42786 gene locus_tag LOCUS_08690 41935 42786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 42786 43883 gene locus_tag LOCUS_08700 42786 43883 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_08700 44807 43884 gene locus_tag LOCUS_08710 44807 43884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 46136 44817 gene locus_tag LOCUS_08720 46136 44817 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_08720 47225 46170 gene locus_tag LOCUS_08730 47225 46170 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_08730 48885 47245 gene locus_tag LOCUS_08740 48885 47245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 49993 49040 gene locus_tag LOCUS_08750 49993 49040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 50975 49995 gene locus_tag LOCUS_08760 50975 49995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 53755 50978 gene locus_tag LOCUS_08770 53755 50978 CDS product xanthine dehydrogenase molybdenum-binding subunit XdhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393458.1 protein_id gnl|my_center|LOCUS_08770 54331 53765 gene locus_tag LOCUS_08780 54331 53765 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_08780 55039 54389 gene locus_tag LOCUS_08790 55039 54389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 56297 55083 gene locus_tag LOCUS_08800 56297 55083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 57169 56324 gene locus_tag LOCUS_08810 57169 56324 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_08810 57792 57226 gene locus_tag LOCUS_08820 57792 57226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 59824 57785 gene locus_tag LOCUS_08830 59824 57785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 60984 59842 gene locus_tag LOCUS_08840 gene caiA 60984 59842 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_08840 61997 61032 gene locus_tag LOCUS_08850 gene yrbG 61997 61032 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_08850 64880 62010 gene locus_tag LOCUS_08860 64880 62010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 66299 65139 gene locus_tag LOCUS_08870 66299 65139 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_08870 67216 66308 gene locus_tag LOCUS_08880 gene trxB 67216 66308 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_08880 67713 67318 gene locus_tag LOCUS_08890 67713 67318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 68315 67713 gene locus_tag LOCUS_08900 68315 67713 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483431.1 protein_id gnl|my_center|LOCUS_08900 68790 68317 gene locus_tag LOCUS_08910 68790 68317 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251224.1 protein_id gnl|my_center|LOCUS_08910 69527 68814 gene locus_tag LOCUS_08920 69527 68814 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_08920 69620 70480 gene locus_tag LOCUS_08930 69620 70480 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence11 473 2395 gene locus_tag LOCUS_08940 473 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2413 3045 gene locus_tag LOCUS_08950 2413 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 3573 3064 gene locus_tag LOCUS_08960 3573 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 3951 3640 gene locus_tag LOCUS_08970 3951 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4067 4414 gene locus_tag LOCUS_08980 4067 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 4474 5622 gene locus_tag LOCUS_08990 gene caiA 4474 5622 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000215329.1 protein_id gnl|my_center|LOCUS_08990 5661 6041 gene locus_tag LOCUS_09000 5661 6041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 6102 6566 gene locus_tag LOCUS_09010 6102 6566 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_09010 7100 6576 gene locus_tag LOCUS_09020 7100 6576 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_09020 7211 8428 gene locus_tag LOCUS_09030 7211 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 10705 8420 gene locus_tag LOCUS_09040 10705 8420 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_09040 11530 10724 gene locus_tag LOCUS_09050 gene fdhD 11530 10724 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R194 protein_id gnl|my_center|LOCUS_09050 11621 12007 gene locus_tag LOCUS_09060 11621 12007 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 protein_id gnl|my_center|LOCUS_09060 12013 12897 gene locus_tag LOCUS_09070 12013 12897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 13965 12874 gene locus_tag LOCUS_09080 13965 12874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 14113 14346 gene locus_tag LOCUS_09090 14113 14346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 14625 14356 gene locus_tag LOCUS_09100 14625 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 16550 14679 gene locus_tag LOCUS_09110 16550 14679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 16666 17208 gene locus_tag LOCUS_09120 16666 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 18029 17211 gene locus_tag LOCUS_09130 18029 17211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 18684 18034 gene locus_tag LOCUS_09140 18684 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 20076 18871 gene locus_tag LOCUS_09150 20076 18871 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289337.1 protein_id gnl|my_center|LOCUS_09150 20313 20119 gene locus_tag LOCUS_09160 20313 20119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 20404 21264 gene locus_tag LOCUS_09170 gene mqnD 20404 21264 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_09170 21265 21744 gene locus_tag LOCUS_09180 21265 21744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 22535 21735 gene locus_tag LOCUS_09190 22535 21735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 23748 22540 gene locus_tag LOCUS_09200 gene mqnE 23748 22540 CDS product aminodeoxyfutalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH43 protein_id gnl|my_center|LOCUS_09200 23900 24685 gene locus_tag LOCUS_09210 23900 24685 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870186.1 protein_id gnl|my_center|LOCUS_09210 24682 25629 gene locus_tag LOCUS_09220 24682 25629 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_09220 25677 26567 gene locus_tag LOCUS_09230 25677 26567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 28084 26564 gene locus_tag LOCUS_09240 28084 26564 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_09240 29322 28132 gene locus_tag LOCUS_09250 29322 28132 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_09250 29389 29907 gene locus_tag LOCUS_09260 29389 29907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 31044 29911 gene locus_tag LOCUS_09270 31044 29911 CDS product acyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114002.1 protein_id gnl|my_center|LOCUS_09270 31125 31850 gene locus_tag LOCUS_09280 31125 31850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 32171 31851 gene locus_tag LOCUS_09290 32171 31851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 32231 33073 gene locus_tag LOCUS_09300 32231 33073 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250424.1 protein_id gnl|my_center|LOCUS_09300 33118 34809 gene locus_tag LOCUS_09310 33118 34809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 35404 34802 gene locus_tag LOCUS_09320 gene ycgM 35404 34802 CDS product fumarylacetoacetate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207728.1 protein_id gnl|my_center|LOCUS_09320 35429 36457 gene locus_tag LOCUS_09330 gene dnaJ 35429 36457 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_09330 36585 39728 gene locus_tag LOCUS_09340 36585 39728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 41971 39764 gene locus_tag LOCUS_09350 41971 39764 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060960.1 protein_id gnl|my_center|LOCUS_09350 42684 42076 gene locus_tag LOCUS_09360 42684 42076 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_09360 43134 42694 gene locus_tag LOCUS_09370 43134 42694 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876681.1 protein_id gnl|my_center|LOCUS_09370 43272 44543 gene locus_tag LOCUS_09380 43272 44543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_09380 44553 45539 gene locus_tag LOCUS_09390 44553 45539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 45529 45933 gene locus_tag LOCUS_09400 45529 45933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 46727 45897 gene locus_tag LOCUS_09410 46727 45897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 47052 46741 gene locus_tag LOCUS_09420 47052 46741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 47280 47053 gene locus_tag LOCUS_09430 47280 47053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 47626 47264 gene locus_tag LOCUS_09440 47626 47264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 48419 47628 gene locus_tag LOCUS_09450 48419 47628 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_09450 49135 48416 gene locus_tag LOCUS_09460 49135 48416 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_09460 49812 49135 gene locus_tag LOCUS_09470 49812 49135 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_09470 50565 49876 gene locus_tag LOCUS_09480 50565 49876 CDS product RNA-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876324.1 protein_id gnl|my_center|LOCUS_09480 51321 50614 gene locus_tag LOCUS_09490 gene psmA 51321 50614 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_09490 51421 52092 gene locus_tag LOCUS_09500 51421 52092 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251230.1 protein_id gnl|my_center|LOCUS_09500 52127 53485 gene locus_tag LOCUS_09510 52127 53485 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_09510 53550 54137 gene locus_tag LOCUS_09520 53550 54137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 54369 54130 gene locus_tag LOCUS_09530 54369 54130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 55609 54350 gene locus_tag LOCUS_09540 55609 54350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_09540 56235 55612 gene locus_tag LOCUS_09550 56235 55612 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZUG0 protein_id gnl|my_center|LOCUS_09550 56809 56240 gene locus_tag LOCUS_09560 56809 56240 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_09560 56874 57854 gene locus_tag LOCUS_09570 56874 57854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 63140 57846 gene locus_tag LOCUS_09580 63140 57846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence12 651 1448 gene locus_tag LOCUS_09590 651 1448 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_09590 1501 3201 gene locus_tag LOCUS_09600 1501 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 3798 3205 gene locus_tag LOCUS_09610 3798 3205 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927085.1 protein_id gnl|my_center|LOCUS_09610 5009 3807 gene locus_tag LOCUS_09620 gene metB 5009 3807 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56069 protein_id gnl|my_center|LOCUS_09620 5715 5116 gene locus_tag LOCUS_09630 5715 5116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57256 protein_id gnl|my_center|LOCUS_09630 6105 5788 gene locus_tag LOCUS_09640 6105 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6188 7564 gene locus_tag LOCUS_09650 6188 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 7575 8357 gene locus_tag LOCUS_09660 7575 8357 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X264 protein_id gnl|my_center|LOCUS_09660 8444 10777 gene locus_tag LOCUS_09670 8444 10777 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000856405.1 protein_id gnl|my_center|LOCUS_09670 10816 11850 gene locus_tag LOCUS_09680 10816 11850 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_09680 11902 13422 gene locus_tag LOCUS_09690 11902 13422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 13469 14938 gene locus_tag LOCUS_09700 13469 14938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 15578 14940 gene locus_tag LOCUS_09710 15578 14940 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877104.1 protein_id gnl|my_center|LOCUS_09710 16323 15583 gene locus_tag LOCUS_09720 16323 15583 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_09720 19350 16372 gene locus_tag LOCUS_09730 gene uvrA 19350 16372 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_09730 20629 19418 gene locus_tag LOCUS_09740 20629 19418 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227717.1 protein_id gnl|my_center|LOCUS_09740 20716 21480 gene locus_tag LOCUS_09750 20716 21480 CDS product UPF0721 transmembrane protein y4hK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55478 protein_id gnl|my_center|LOCUS_09750 22011 21481 gene locus_tag LOCUS_09760 22011 21481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 22632 22081 gene locus_tag LOCUS_09770 gene apt 22632 22081 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDM9 protein_id gnl|my_center|LOCUS_09770 24221 22701 gene locus_tag LOCUS_09780 24221 22701 CDS product adenine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889443.1 protein_id gnl|my_center|LOCUS_09780 25562 24252 gene locus_tag LOCUS_09790 25562 24252 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_09790 26130 27320 gene locus_tag LOCUS_09800 26130 27320 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016873.1 protein_id gnl|my_center|LOCUS_09800 27345 27959 gene locus_tag LOCUS_09810 27345 27959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 27985 28818 gene locus_tag LOCUS_09820 27985 28818 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_09820 29222 28815 gene locus_tag LOCUS_09830 29222 28815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 29409 29636 gene locus_tag LOCUS_09840 29409 29636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 29748 30239 gene locus_tag LOCUS_09850 29748 30239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 30258 31049 gene locus_tag LOCUS_09860 30258 31049 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_09860 31178 32029 gene locus_tag LOCUS_09870 gene cysD 31178 32029 CDS product sulfate adenylyltransferase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KGW0 protein_id gnl|my_center|LOCUS_09870 32029 33918 gene locus_tag LOCUS_09880 32029 33918 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385211.1 protein_id gnl|my_center|LOCUS_09880 33972 34499 gene locus_tag LOCUS_09890 33972 34499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 34509 35783 gene locus_tag LOCUS_09900 34509 35783 CDS product cell division protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869789.1 protein_id gnl|my_center|LOCUS_09900 35833 36477 gene locus_tag LOCUS_09910 35833 36477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 36705 36457 gene locus_tag LOCUS_09920 36705 36457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 37509 36709 gene locus_tag LOCUS_09930 37509 36709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 37634 40681 gene locus_tag LOCUS_09940 gene purSL 37634 40681 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN9 protein_id gnl|my_center|LOCUS_09940 40681 41496 gene locus_tag LOCUS_09950 gene pfaS 40681 41496 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_09950 41537 42151 gene locus_tag LOCUS_09960 41537 42151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 42177 43073 gene locus_tag LOCUS_09970 gene rluD 42177 43073 CDS product ribosomal large subunit pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119269.1 protein_id gnl|my_center|LOCUS_09970 44600 43074 gene locus_tag LOCUS_09980 44600 43074 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031209.1 protein_id gnl|my_center|LOCUS_09980 44667 46481 gene locus_tag LOCUS_09990 44667 46481 CDS product putative Xaa-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CB2 protein_id gnl|my_center|LOCUS_09990 46945 46484 gene locus_tag LOCUS_10000 46945 46484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 47166 47561 gene locus_tag LOCUS_10010 47166 47561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 47605 48447 gene locus_tag LOCUS_10020 47605 48447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 49200 48442 gene locus_tag LOCUS_10030 49200 48442 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_10030 50940 49222 gene locus_tag LOCUS_10040 50940 49222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 51580 50990 gene locus_tag LOCUS_10050 51580 50990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 51699 52616 gene locus_tag LOCUS_10060 51699 52616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 52721 52637 gene locus_tag LOCUS_t00230 52721 52637 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 53242 52763 gene locus_tag LOCUS_10070 53242 52763 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_10070 54527 53325 gene locus_tag LOCUS_10080 54527 53325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 55554 54628 gene locus_tag LOCUS_10090 55554 54628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 55696 56583 gene locus_tag LOCUS_10100 55696 56583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence13 <1 1588 gene locus_tag LOCUS_10110 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O32150:extracellular ribonuclease 1657 1733 gene locus_tag LOCUS_t00240 1657 1733 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1857 2801 gene locus_tag LOCUS_10120 1857 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2891 4117 gene locus_tag LOCUS_10130 2891 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 5178 4126 gene locus_tag LOCUS_10140 gene guaC 5178 4126 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFP5 protein_id gnl|my_center|LOCUS_10140 5318 5243 gene locus_tag LOCUS_t00250 5318 5243 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5463 5723 gene locus_tag LOCUS_10150 5463 5723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 5723 5971 gene locus_tag LOCUS_10160 5723 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 6019 6921 gene locus_tag LOCUS_10170 6019 6921 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_10170 7866 6913 gene locus_tag LOCUS_10180 7866 6913 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_10180 8698 7856 gene locus_tag LOCUS_10190 8698 7856 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_10190 8821 11403 gene locus_tag LOCUS_10200 8821 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 11469 12407 gene locus_tag LOCUS_10210 11469 12407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 12412 12945 gene locus_tag LOCUS_10220 12412 12945 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903263.1 protein_id gnl|my_center|LOCUS_10220 12951 13925 gene locus_tag LOCUS_10230 12951 13925 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_10230 16460 14121 gene locus_tag LOCUS_10240 16460 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 16628 16702 gene locus_tag LOCUS_t00260 16628 16702 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 17362 16718 gene locus_tag LOCUS_10250 17362 16718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 17635 17393 gene locus_tag LOCUS_10260 17635 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 19057 17645 gene locus_tag LOCUS_10270 19057 17645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 19351 19067 gene locus_tag LOCUS_10280 19351 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 20559 19348 gene locus_tag LOCUS_10290 20559 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 20670 21251 gene locus_tag LOCUS_10300 20670 21251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 23800 21248 gene locus_tag LOCUS_10310 23800 21248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 23915 24172 gene locus_tag LOCUS_10320 23915 24172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 24185 25582 gene locus_tag LOCUS_10330 24185 25582 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_10330 25862 25596 gene locus_tag LOCUS_10340 25862 25596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 26193 26645 gene locus_tag LOCUS_10350 26193 26645 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530912.1 protein_id gnl|my_center|LOCUS_10350 27630 26731 gene locus_tag LOCUS_10360 27630 26731 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404249.1 protein_id gnl|my_center|LOCUS_10360 28477 27722 gene locus_tag LOCUS_10370 28477 27722 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_10370 28534 29457 gene locus_tag LOCUS_10380 28534 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 30379 29438 gene locus_tag LOCUS_10390 30379 29438 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_10390 30957 30382 gene locus_tag LOCUS_10400 30957 30382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 31643 30954 gene locus_tag LOCUS_10410 31643 30954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 31822 34881 gene locus_tag LOCUS_10420 31822 34881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 34941 35987 gene locus_tag LOCUS_10430 34941 35987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 36728 36000 gene locus_tag LOCUS_10440 36728 36000 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994509.1 protein_id gnl|my_center|LOCUS_10440 37224 37925 gene locus_tag LOCUS_10450 gene rpiA 37224 37925 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CG8 protein_id gnl|my_center|LOCUS_10450 37975 38051 gene locus_tag LOCUS_t00270 37975 38051 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38124 38200 gene locus_tag LOCUS_t00280 38124 38200 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 38318 39646 gene locus_tag LOCUS_10460 38318 39646 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762130.1 protein_id gnl|my_center|LOCUS_10460 39724 40938 gene locus_tag LOCUS_10470 gene ivd 39724 40938 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_10470 41022 40947 gene locus_tag LOCUS_t00290 41022 40947 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 41110 47310 gene locus_tag LOCUS_10480 41110 47310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 47348 48196 gene locus_tag LOCUS_10490 gene hbd 47348 48196 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVG1 protein_id gnl|my_center|LOCUS_10490 48245 51469 gene locus_tag LOCUS_10500 48245 51469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence14 1297 497 gene locus_tag LOCUS_10510 1297 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1448 1918 gene locus_tag LOCUS_10520 1448 1918 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_10520 2092 2355 gene locus_tag LOCUS_10530 2092 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2358 2549 gene locus_tag LOCUS_10540 2358 2549 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_10540 2584 3390 gene locus_tag LOCUS_10550 2584 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3839 3387 gene locus_tag LOCUS_10560 3839 3387 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_10560 4984 3842 gene locus_tag LOCUS_10570 4984 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5614 4985 gene locus_tag LOCUS_10580 gene queE 5614 4985 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZC3 protein_id gnl|my_center|LOCUS_10580 6211 5627 gene locus_tag LOCUS_10590 gene folE 6211 5627 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW2 protein_id gnl|my_center|LOCUS_10590 6380 6216 gene locus_tag LOCUS_10600 6380 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6751 6437 gene locus_tag LOCUS_10610 6751 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7183 6764 gene locus_tag LOCUS_10620 7183 6764 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_10620 8744 7185 gene locus_tag LOCUS_10630 8744 7185 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_10630 9331 8852 gene locus_tag LOCUS_10640 9331 8852 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G8 protein_id gnl|my_center|LOCUS_10640 10124 9336 gene locus_tag LOCUS_10650 10124 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 11192 10185 gene locus_tag LOCUS_10660 11192 10185 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_10660 11325 12524 gene locus_tag LOCUS_10670 gene hutI 11325 12524 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKJ7 protein_id gnl|my_center|LOCUS_10670 13009 13084 gene locus_tag LOCUS_t00300 13009 13084 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13827 13102 gene locus_tag LOCUS_10680 13827 13102 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403895.1 protein_id gnl|my_center|LOCUS_10680 15367 13832 gene locus_tag LOCUS_10690 gene hutH 15367 13832 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB3 protein_id gnl|my_center|LOCUS_10690 17388 15376 gene locus_tag LOCUS_10700 gene hutU 17388 15376 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_10700 18005 17385 gene locus_tag LOCUS_10710 18005 17385 CDS product methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965607.1 protein_id gnl|my_center|LOCUS_10710 19044 17998 gene locus_tag LOCUS_10720 19044 17998 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_10720 20315 19053 gene locus_tag LOCUS_10730 20315 19053 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_10730 20466 20870 gene locus_tag LOCUS_10740 20466 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 20867 21412 gene locus_tag LOCUS_10750 20867 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_10750 23584 21398 gene locus_tag LOCUS_10760 gene metG 23584 21398 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3M1 protein_id gnl|my_center|LOCUS_10760 23723 24793 gene locus_tag LOCUS_10770 23723 24793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_10770 25706 24798 gene locus_tag LOCUS_10780 gene thrB 25706 24798 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA8 protein_id gnl|my_center|LOCUS_10780 25919 27094 gene locus_tag LOCUS_10790 25919 27094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 27124 28383 gene locus_tag LOCUS_10800 27124 28383 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009563407.1 protein_id gnl|my_center|LOCUS_10800 30017 28386 gene locus_tag LOCUS_10810 30017 28386 CDS product peptide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121082.1 protein_id gnl|my_center|LOCUS_10810 31113 30022 gene locus_tag LOCUS_10820 31113 30022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 31735 31508 gene locus_tag LOCUS_10830 31735 31508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 32993 31740 gene locus_tag LOCUS_10840 32993 31740 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_10840 34083 33067 gene locus_tag LOCUS_10850 gene alkB 34083 33067 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191500.1 protein_id gnl|my_center|LOCUS_10850 34204 35391 gene locus_tag LOCUS_10860 34204 35391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 36642 35434 gene locus_tag LOCUS_10870 36642 35434 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 protein_id gnl|my_center|LOCUS_10870 37298 36648 gene locus_tag LOCUS_10880 37298 36648 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_10880 38317 37376 gene locus_tag LOCUS_10890 38317 37376 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_10890 39129 38314 gene locus_tag LOCUS_10900 39129 38314 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_10900 40009 39308 gene locus_tag LOCUS_10910 40009 39308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence15 2499 235 gene locus_tag LOCUS_10920 2499 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2782 2706 gene locus_tag LOCUS_t00310 2782 2706 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3459 2833 gene locus_tag LOCUS_10930 3459 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3514 5256 gene locus_tag LOCUS_10940 3514 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 5404 7284 gene locus_tag LOCUS_10950 5404 7284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 7304 7855 gene locus_tag LOCUS_10960 7304 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 7860 8579 gene locus_tag LOCUS_10970 7860 8579 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_10970 8591 9715 gene locus_tag LOCUS_10980 8591 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 9794 11914 gene locus_tag LOCUS_10990 9794 11914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13325 11832 gene locus_tag LOCUS_11000 13325 11832 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_11000 13807 13385 gene locus_tag LOCUS_11010 13807 13385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 13902 13978 gene locus_tag LOCUS_t00320 13902 13978 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14048 14923 gene locus_tag LOCUS_11020 gene folD 14048 14923 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W210 protein_id gnl|my_center|LOCUS_11020 14995 15897 gene locus_tag LOCUS_11030 gene purC 14995 15897 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYX0 protein_id gnl|my_center|LOCUS_11030 16525 15899 gene locus_tag LOCUS_11040 16525 15899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 22170 16543 gene locus_tag LOCUS_11050 22170 16543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 22427 22975 gene locus_tag LOCUS_11060 22427 22975 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_11060 22977 23195 gene locus_tag LOCUS_11070 22977 23195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 23209 23514 gene locus_tag LOCUS_11080 23209 23514 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_11080 23514 23690 gene locus_tag LOCUS_11090 23514 23690 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_11090 24593 23691 gene locus_tag LOCUS_11100 24593 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 24669 25607 gene locus_tag LOCUS_11110 24669 25607 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022038.1 protein_id gnl|my_center|LOCUS_11110 25636 26607 gene locus_tag LOCUS_11120 gene putA 25636 26607 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_11120 27232 26624 gene locus_tag LOCUS_11130 27232 26624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 27278 28102 gene locus_tag LOCUS_11140 27278 28102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 29352 28039 gene locus_tag LOCUS_11150 29352 28039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 30515 29385 gene locus_tag LOCUS_11160 30515 29385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 30727 30642 gene locus_tag LOCUS_t00330 30727 30642 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30836 30910 gene locus_tag LOCUS_t00340 30836 30910 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence16 2272 3348 gene locus_tag LOCUS_11170 2272 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 3358 3957 gene locus_tag LOCUS_11180 gene gpmA 3358 3957 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q036I8 protein_id gnl|my_center|LOCUS_11180 5231 3954 gene locus_tag LOCUS_11190 5231 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 5337 5861 gene locus_tag LOCUS_11200 5337 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 5911 6792 gene locus_tag LOCUS_11210 5911 6792 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_11210 6782 7234 gene locus_tag LOCUS_11220 6782 7234 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963099.1 protein_id gnl|my_center|LOCUS_11220 7265 7642 gene locus_tag LOCUS_11230 7265 7642 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_11230 7658 9046 gene locus_tag LOCUS_11240 7658 9046 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204094.1 protein_id gnl|my_center|LOCUS_11240 9402 9043 gene locus_tag LOCUS_11250 9402 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 9944 9417 gene locus_tag LOCUS_11260 9944 9417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 11258 9993 gene locus_tag LOCUS_11270 gene pgk 11258 9993 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023501.1 protein_id gnl|my_center|LOCUS_11270 11357 12613 gene locus_tag LOCUS_11280 11357 12613 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933799.1 protein_id gnl|my_center|LOCUS_11280 12656 12949 gene locus_tag LOCUS_11290 12656 12949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 13105 12953 gene locus_tag LOCUS_11300 13105 12953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 13402 13115 gene locus_tag LOCUS_11310 13402 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 14558 13464 gene locus_tag LOCUS_11320 14558 13464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 15556 14651 gene locus_tag LOCUS_11330 15556 14651 CDS product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867501.1 protein_id gnl|my_center|LOCUS_11330 16141 15569 gene locus_tag LOCUS_11340 16141 15569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 16560 16207 gene locus_tag LOCUS_11350 16560 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 16862 16566 gene locus_tag LOCUS_11360 16862 16566 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_11360 18360 16942 gene locus_tag LOCUS_11370 18360 16942 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_11370 18777 18451 gene locus_tag LOCUS_11380 18777 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 18889 19905 gene locus_tag LOCUS_11390 18889 19905 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_11390 20336 19908 gene locus_tag LOCUS_11400 20336 19908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 21952 20387 gene locus_tag LOCUS_11410 gene crtI 21952 20387 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_11410 22168 23634 gene locus_tag LOCUS_11420 22168 23634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence17 <1 1029 gene locus_tag LOCUS_11430 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729742.1:diacylglycerol kinase 1118 1033 gene locus_tag LOCUS_t00350 1118 1033 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1524 1162 gene locus_tag LOCUS_11440 1524 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 2601 1534 gene locus_tag LOCUS_11450 2601 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 4973 2598 gene locus_tag LOCUS_11460 4973 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5743 4988 gene locus_tag LOCUS_11470 5743 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 5961 6407 gene locus_tag LOCUS_11480 5961 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 6858 6412 gene locus_tag LOCUS_11490 6858 6412 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_11490 8602 6947 gene locus_tag LOCUS_11500 8602 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 8780 9136 gene locus_tag LOCUS_11510 8780 9136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 9223 9414 gene locus_tag LOCUS_11520 9223 9414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 10284 9415 gene locus_tag LOCUS_11530 10284 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 10386 10553 gene locus_tag LOCUS_11540 10386 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 11669 10554 gene locus_tag LOCUS_11550 11669 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 12755 11808 gene locus_tag LOCUS_11560 gene rimK 12755 11808 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYF8 protein_id gnl|my_center|LOCUS_11560 12781 15159 gene locus_tag LOCUS_11570 12781 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 15236 16180 gene locus_tag LOCUS_11580 15236 16180 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_11580 16180 17142 gene locus_tag LOCUS_11590 16180 17142 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385500.1 protein_id gnl|my_center|LOCUS_11590 17813 17139 gene locus_tag LOCUS_11600 17813 17139 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_11600 18345 17806 gene locus_tag LOCUS_11610 18345 17806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 18852 18409 gene locus_tag LOCUS_11620 18852 18409 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060869.1 protein_id gnl|my_center|LOCUS_11620 19064 19456 gene locus_tag LOCUS_11630 19064 19456 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868249.1 protein_id gnl|my_center|LOCUS_11630 19506 19946 gene locus_tag LOCUS_11640 19506 19946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 20972 19947 gene locus_tag LOCUS_11650 gene ilvE 20972 19947 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941317.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence18 <1 1304 gene locus_tag LOCUS_11660 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878271.1:translation initiation factor aIF-2 1389 2372 gene locus_tag LOCUS_11670 1389 2372 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_11670 2429 3337 gene locus_tag LOCUS_11680 2429 3337 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221868.1 protein_id gnl|my_center|LOCUS_11680 4434 3334 gene locus_tag LOCUS_11690 4434 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4945 4553 gene locus_tag LOCUS_11700 4945 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 7625 4971 gene locus_tag LOCUS_11710 7625 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 7712 8434 gene locus_tag LOCUS_11720 7712 8434 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_11720 8522 8438 gene locus_tag LOCUS_t00360 8522 8438 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8547 9512 gene locus_tag LOCUS_11730 8547 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 9568 10914 gene locus_tag LOCUS_11740 gene pepC 9568 10914 CDS product aminopeptidase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010714165.1 protein_id gnl|my_center|LOCUS_11740 11272 10943 gene locus_tag LOCUS_11750 11272 10943 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_11750 12589 11303 gene locus_tag LOCUS_11760 gene tuf 12589 11303 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_11760 13859 12696 gene locus_tag LOCUS_11770 13859 12696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 <15222 13957 gene locus_tag LOCUS_11780 <15222 13957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980151.1:DNA polymerase >Feature sequence19 1183 2667 gene locus_tag LOCUS_11790 1183 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2664 3422 gene locus_tag LOCUS_11800 2664 3422 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I05 protein_id gnl|my_center|LOCUS_11800 4052 3423 gene locus_tag LOCUS_11810 4052 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 4146 4631 gene locus_tag LOCUS_11820 4146 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4691 5197 gene locus_tag LOCUS_11830 4691 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 5184 5951 gene locus_tag LOCUS_11840 5184 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 5944 6156 gene locus_tag LOCUS_11850 5944 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 6881 6153 gene locus_tag LOCUS_11860 6881 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_11860 8559 6949 gene locus_tag LOCUS_11870 gene purH 8559 6949 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IP9 protein_id gnl|my_center|LOCUS_11870 10160 8589 gene locus_tag LOCUS_11880 10160 8589 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_11880 10269 11213 gene locus_tag LOCUS_11890 10269 11213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 11544 11218 gene locus_tag LOCUS_11900 11544 11218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence20 1250 2530 gene locus_tag LOCUS_11910 1250 2530 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_11910 2576 6562 gene locus_tag LOCUS_11920 2576 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 7626 6559 gene locus_tag LOCUS_11930 7626 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence21 <1 703 gene locus_tag LOCUS_11940 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878416.1:glycine--tRNA ligase 739 2250 gene locus_tag LOCUS_11950 739 2250 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870398.1 protein_id gnl|my_center|LOCUS_11950 3831 2251 gene locus_tag LOCUS_11960 3831 2251 CDS product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_11960 5252 3834 gene locus_tag LOCUS_11970 5252 3834 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878341.1 protein_id gnl|my_center|LOCUS_11970 6078 5347 gene locus_tag LOCUS_11980 6078 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence22 757 2544 gene locus_tag LOCUS_11990 757 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2562 3041 gene locus_tag LOCUS_12000 2562 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3043 4323 gene locus_tag LOCUS_12010 3043 4323 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_12010 4342 5151 gene locus_tag LOCUS_12020 4342 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence23 1537 1358 gene locus_tag LOCUS_12030 1537 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2394 1546 gene locus_tag LOCUS_12040 gene ara1 2394 1546 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_12040 2468 4012 gene locus_tag LOCUS_12050 2468 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 4078 5091 gene locus_tag LOCUS_12060 4078 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence24 2177 1173 gene locus_tag LOCUS_12070 2177 1173 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_12070 2266 3402 gene locus_tag LOCUS_12080 2266 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 3433 3507 gene locus_tag LOCUS_t00370 3433 3507 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3749 3513 gene locus_tag LOCUS_12090 3749 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 4831 3746 gene locus_tag LOCUS_12100 gene ribD 4831 3746 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_12100 >Feature sequence25 1206 520 gene locus_tag LOCUS_12110 1206 520 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388361.1 protein_id gnl|my_center|LOCUS_12110 1904 1206 gene locus_tag LOCUS_12120 1904 1206 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWT9 protein_id gnl|my_center|LOCUS_12120 2712 1948 gene locus_tag LOCUS_12130 gene pstB 2712 1948 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MFB2 protein_id gnl|my_center|LOCUS_12130 3942 2725 gene locus_tag LOCUS_12140 3942 2725 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWU1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence26 1702 965 gene locus_tag LOCUS_12150 1702 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 2052 1699 gene locus_tag LOCUS_12160 2052 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2375 2049 gene locus_tag LOCUS_12170 2375 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2683 2378 gene locus_tag LOCUS_12180 2683 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3076 2684 gene locus_tag LOCUS_12190 3076 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence27 617 2722 gene locus_tag LOCUS_12200 617 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence28 103 972 gene locus_tag LOCUS_12210 103 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence29 >Feature sequence30 481 53 gene locus_tag LOCUS_12220 481 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1081 491 gene locus_tag LOCUS_12230 1081 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2652 1084 gene locus_tag LOCUS_12240 gene crtI 2652 1084 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence31 461 1054 gene locus_tag LOCUS_12250 461 1054 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_12250 1975 1046 gene locus_tag LOCUS_12260 1975 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 <2794 1998 gene locus_tag LOCUS_12270 <2794 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227777.1:membrane protein >Feature sequence32 >Feature sequence33 435 151 gene locus_tag LOCUS_12280 435 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 908 1126 gene locus_tag LOCUS_12290 908 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence34 619 1506 gene locus_tag LOCUS_12300 619 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence35 369 46 gene locus_tag LOCUS_12310 369 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 814 1854 gene locus_tag LOCUS_12320 814 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence36 >Feature sequence37 >Feature sequence38 >Feature sequence39 190 1233 gene locus_tag LOCUS_12330 190 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence40 >Feature sequence41 1193 126 gene locus_tag LOCUS_12340 1193 126 CDS product mechanosensitive ion channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence42 >Feature sequence43 >Feature sequence44 >Feature sequence45 862 263 gene locus_tag LOCUS_12350 862 263 CDS product ribosomal-protein-L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704795.1 protein_id gnl|my_center|LOCUS_12350