>Feature sequence001 109 4818 gene locus_tag LOCUS_00010 109 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 4811 5674 gene locus_tag LOCUS_00020 4811 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5755 6333 gene locus_tag LOCUS_00030 5755 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6392 7219 gene locus_tag LOCUS_00040 6392 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7223 7624 gene locus_tag LOCUS_00050 7223 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7634 8116 gene locus_tag LOCUS_00060 7634 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8109 8804 gene locus_tag LOCUS_00070 8109 8804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8815 10530 gene locus_tag LOCUS_00080 8815 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868605.1 protein_id gnl|my_center|LOCUS_00080 10540 12333 gene locus_tag LOCUS_00090 10540 12333 CDS product flagellar assembly protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902671.1 protein_id gnl|my_center|LOCUS_00090 12408 13733 gene locus_tag LOCUS_00100 12408 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 >Feature sequence002 2451 3251 gene locus_tag LOCUS_00110 2451 3251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_00110 3316 4350 gene locus_tag LOCUS_00120 3316 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 4347 6659 gene locus_tag LOCUS_00130 4347 6659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 6659 7129 gene locus_tag LOCUS_00140 6659 7129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 9654 7126 gene locus_tag LOCUS_00150 9654 7126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14118 9751 gene locus_tag LOCUS_00160 14118 9751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 <15499 14252 gene locus_tag LOCUS_00170 <15499 14252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O31788:serine protease AprX >Feature sequence003 1578 2303 gene locus_tag LOCUS_00180 1578 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_00180 2342 3604 gene locus_tag LOCUS_00190 gene purD 2342 3604 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGV0 protein_id gnl|my_center|LOCUS_00190 3741 13637 gene locus_tag LOCUS_00200 3741 13637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence004 <1 1752 gene locus_tag LOCUS_00210 <1 1752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67078:3-isopropylmalate dehydratase large subunit 1762 3852 gene locus_tag LOCUS_00220 1762 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 4013 6121 gene locus_tag LOCUS_00230 4013 6121 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878155.1 protein_id gnl|my_center|LOCUS_00230 6118 7224 gene locus_tag LOCUS_00240 6118 7224 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878440.1 protein_id gnl|my_center|LOCUS_00240 7262 8110 gene locus_tag LOCUS_00250 7262 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 8163 8915 gene locus_tag LOCUS_00260 8163 8915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 >Feature sequence005 2268 1012 gene locus_tag LOCUS_00270 2268 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 3305 2340 gene locus_tag LOCUS_00280 3305 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 3715 3461 gene locus_tag LOCUS_00290 3715 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 4826 3801 gene locus_tag LOCUS_00300 4826 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 6210 4861 gene locus_tag LOCUS_00310 6210 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 6361 6813 gene locus_tag LOCUS_00320 6361 6813 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_00320 11206 6776 gene locus_tag LOCUS_00330 11206 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00330 11335 11532 gene locus_tag LOCUS_00340 11335 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence006 281 2764 gene locus_tag LOCUS_00350 281 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 3027 2767 gene locus_tag LOCUS_00360 3027 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 3244 3017 gene locus_tag LOCUS_00370 3244 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4275 3319 gene locus_tag LOCUS_00380 gene soj 4275 3319 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048451.1 protein_id gnl|my_center|LOCUS_00380 5360 4368 gene locus_tag LOCUS_00390 5360 4368 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_00390 7288 5492 gene locus_tag LOCUS_00400 7288 5492 CDS product translation initiation factor aIF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878271.1 protein_id gnl|my_center|LOCUS_00400 7794 7339 gene locus_tag LOCUS_00410 gene ndk 7794 7339 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VEG3 protein_id gnl|my_center|LOCUS_00410 8064 7876 gene locus_tag LOCUS_00420 8064 7876 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875896.1 protein_id gnl|my_center|LOCUS_00420 8292 8074 gene locus_tag LOCUS_00430 8292 8074 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 protein_id gnl|my_center|LOCUS_00430 8694 8320 gene locus_tag LOCUS_00440 8694 8320 CDS product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061194.1 protein_id gnl|my_center|LOCUS_00440 9717 8779 gene locus_tag LOCUS_00450 9717 8779 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876421.1 protein_id gnl|my_center|LOCUS_00450 9861 9786 gene locus_tag LOCUS_t00010 9861 9786 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 10497 9910 gene locus_tag LOCUS_00460 10497 9910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 10817 12337 gene locus_tag LOCUS_00470 10817 12337 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_00470 12342 12827 gene locus_tag LOCUS_00480 12342 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence007 871 107 gene locus_tag LOCUS_00490 871 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 1385 873 gene locus_tag LOCUS_00500 1385 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1843 1385 gene locus_tag LOCUS_00510 1843 1385 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_00510 2466 1843 gene locus_tag LOCUS_00520 2466 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 3026 2478 gene locus_tag LOCUS_00530 3026 2478 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_00530 3426 3037 gene locus_tag LOCUS_00540 3426 3037 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_00540 4122 3595 gene locus_tag LOCUS_00550 4122 3595 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875658.1 protein_id gnl|my_center|LOCUS_00550 4817 4119 gene locus_tag LOCUS_00560 4817 4119 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_00560 5239 4814 gene locus_tag LOCUS_00570 5239 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5649 5251 gene locus_tag LOCUS_00580 5649 5251 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_00580 5978 5646 gene locus_tag LOCUS_00590 5978 5646 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875654.1 protein_id gnl|my_center|LOCUS_00590 6241 5981 gene locus_tag LOCUS_00600 6241 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 6427 6242 gene locus_tag LOCUS_00610 6427 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 6749 6549 gene locus_tag LOCUS_00620 6749 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 7849 6746 gene locus_tag LOCUS_00630 7849 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 8382 7849 gene locus_tag LOCUS_00640 8382 7849 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_00640 8917 8393 gene locus_tag LOCUS_00650 8917 8393 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_00650 9643 8924 gene locus_tag LOCUS_00660 9643 8924 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_00660 9947 9660 gene locus_tag LOCUS_00670 9947 9660 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_00670 10816 9953 gene locus_tag LOCUS_00680 10816 9953 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_00680 11836 10820 gene locus_tag LOCUS_00690 11836 10820 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_00690 >Feature sequence008 4764 5579 gene locus_tag LOCUS_00700 4764 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 5576 6091 gene locus_tag LOCUS_00710 5576 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 6097 6990 gene locus_tag LOCUS_00720 6097 6990 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_00720 7065 7856 gene locus_tag LOCUS_00730 7065 7856 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLI9 protein_id gnl|my_center|LOCUS_00730 >Feature sequence009 1551 733 gene locus_tag LOCUS_00740 gene panB 1551 733 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZX5 protein_id gnl|my_center|LOCUS_00740 3273 1615 gene locus_tag LOCUS_00750 3273 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 4901 3324 gene locus_tag LOCUS_00760 4901 3324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 5803 4898 gene locus_tag LOCUS_00770 5803 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 5882 6334 gene locus_tag LOCUS_00780 5882 6334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 7775 6324 gene locus_tag LOCUS_00790 7775 6324 CDS product 2-hydroxymuconic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229069.1 protein_id gnl|my_center|LOCUS_00790 8919 7768 gene locus_tag LOCUS_00800 8919 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 10132 8921 gene locus_tag LOCUS_00810 10132 8921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 10972 10133 gene locus_tag LOCUS_00820 10972 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 11377 10982 gene locus_tag LOCUS_00830 11377 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence010 3536 2445 gene locus_tag LOCUS_00840 3536 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 3723 4262 gene locus_tag LOCUS_00850 3723 4262 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_00850 4371 5807 gene locus_tag LOCUS_00860 4371 5807 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583878.1 protein_id gnl|my_center|LOCUS_00860 6035 6652 gene locus_tag LOCUS_00870 6035 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 6777 7367 gene locus_tag LOCUS_00880 6777 7367 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871179.1 protein_id gnl|my_center|LOCUS_00880 7427 8536 gene locus_tag LOCUS_00890 gene dph2 7427 8536 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_00890 8626 9798 gene locus_tag LOCUS_00900 8626 9798 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_00900 9890 10378 gene locus_tag LOCUS_00910 9890 10378 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence011 896 1159 gene locus_tag LOCUS_00920 896 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 1474 1097 gene locus_tag LOCUS_00930 1474 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 1704 2195 gene locus_tag LOCUS_00940 1704 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 2255 5698 gene locus_tag LOCUS_00950 2255 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5849 7207 gene locus_tag LOCUS_00960 gene gdhA 5849 7207 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_00960 7661 7212 gene locus_tag LOCUS_00970 7661 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 7915 7670 gene locus_tag LOCUS_00980 7915 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 8339 7935 gene locus_tag LOCUS_00990 8339 7935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 8622 8344 gene locus_tag LOCUS_01000 8622 8344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 10185 8632 gene locus_tag LOCUS_01010 10185 8632 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_01010 10235 10684 gene locus_tag LOCUS_01020 10235 10684 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869042.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence012 1003 29 gene locus_tag LOCUS_01030 1003 29 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876216.1 protein_id gnl|my_center|LOCUS_01030 1935 1045 gene locus_tag LOCUS_01040 1935 1045 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867654.1 protein_id gnl|my_center|LOCUS_01040 2336 1953 gene locus_tag LOCUS_01050 2336 1953 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_01050 3007 2336 gene locus_tag LOCUS_01060 3007 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3492 3025 gene locus_tag LOCUS_01070 3492 3025 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867651.1 protein_id gnl|my_center|LOCUS_01070 4862 3609 gene locus_tag LOCUS_01080 4862 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5831 4908 gene locus_tag LOCUS_01090 5831 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 10000 5942 gene locus_tag LOCUS_01100 10000 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 >Feature sequence013 1717 419 gene locus_tag LOCUS_01110 1717 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2468 2115 gene locus_tag LOCUS_01120 2468 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3390 2494 gene locus_tag LOCUS_01130 gene pyrD 3390 2494 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_01130 3663 4067 gene locus_tag LOCUS_01140 3663 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 4165 6480 gene locus_tag LOCUS_01150 gene topA 4165 6480 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4L5 protein_id gnl|my_center|LOCUS_01150 6527 7735 gene locus_tag LOCUS_01160 6527 7735 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_01160 7745 8869 gene locus_tag LOCUS_01170 7745 8869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 >Feature sequence014 1162 311 gene locus_tag LOCUS_01180 1162 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 2707 1172 gene locus_tag LOCUS_01190 gene purF 2707 1172 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51342 protein_id gnl|my_center|LOCUS_01190 2968 2783 gene locus_tag LOCUS_01200 2968 2783 CDS product 50S ribosomal protein L37 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023129.1 protein_id gnl|my_center|LOCUS_01200 3512 3042 gene locus_tag LOCUS_01210 3512 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 4314 3505 gene locus_tag LOCUS_01220 4314 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4460 4744 gene locus_tag LOCUS_01230 4460 4744 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_01230 4751 4933 gene locus_tag LOCUS_01240 4751 4933 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147173.1 protein_id gnl|my_center|LOCUS_01240 4951 5736 gene locus_tag LOCUS_01250 4951 5736 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_01250 5787 5996 gene locus_tag LOCUS_01260 5787 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5993 6745 gene locus_tag LOCUS_01270 5993 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6789 6874 gene locus_tag LOCUS_t00020 6789 6874 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6909 7109 gene locus_tag LOCUS_01280 6909 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8737 7106 gene locus_tag LOCUS_01290 8737 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence015 1399 2649 gene locus_tag LOCUS_01300 1399 2649 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_01300 2662 3909 gene locus_tag LOCUS_01310 2662 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 4170 3910 gene locus_tag LOCUS_01320 4170 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 7410 4180 gene locus_tag LOCUS_01330 7410 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 7718 7413 gene locus_tag LOCUS_01340 7718 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 8178 9014 gene locus_tag LOCUS_01350 8178 9014 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_01350 9491 9018 gene locus_tag LOCUS_01360 9491 9018 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904156.1 protein_id gnl|my_center|LOCUS_01360 <10441 9491 gene locus_tag LOCUS_01370 <10441 9491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064165.1:aspartate carbamoyltransferase >Feature sequence016 448 3180 gene locus_tag LOCUS_01380 448 3180 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_01380 3958 3167 gene locus_tag LOCUS_01390 3958 3167 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_01390 5188 3968 gene locus_tag LOCUS_01400 gene thl 5188 3968 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255689.1 protein_id gnl|my_center|LOCUS_01400 6382 5228 gene locus_tag LOCUS_01410 6382 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 7158 6379 gene locus_tag LOCUS_01420 7158 6379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 7234 7944 gene locus_tag LOCUS_01430 7234 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 8114 8509 gene locus_tag LOCUS_01440 8114 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8560 9876 gene locus_tag LOCUS_01450 8560 9876 CDS product carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870532.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence017 3962 4648 gene locus_tag LOCUS_01460 3962 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4680 7271 gene locus_tag LOCUS_01470 4680 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7268 8515 gene locus_tag LOCUS_01480 7268 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 8520 9293 gene locus_tag LOCUS_01490 8520 9293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence018 981 532 gene locus_tag LOCUS_01500 981 532 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_01500 1751 978 gene locus_tag LOCUS_01510 gene queC 1751 978 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2G5 protein_id gnl|my_center|LOCUS_01510 2350 1751 gene locus_tag LOCUS_01520 gene queE 2350 1751 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q93 protein_id gnl|my_center|LOCUS_01520 2929 2360 gene locus_tag LOCUS_01530 gene folE 2929 2360 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89IW2 protein_id gnl|my_center|LOCUS_01530 3103 2930 gene locus_tag LOCUS_01540 3103 2930 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020114.1 protein_id gnl|my_center|LOCUS_01540 4394 3159 gene locus_tag LOCUS_01550 4394 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 5205 4387 gene locus_tag LOCUS_01560 5205 4387 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140056.1 protein_id gnl|my_center|LOCUS_01560 5632 5222 gene locus_tag LOCUS_01570 gene mceE 5632 5222 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_01570 7222 5642 gene locus_tag LOCUS_01580 7222 5642 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_01580 7818 7282 gene locus_tag LOCUS_01590 7818 7282 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q728N4 protein_id gnl|my_center|LOCUS_01590 8563 7823 gene locus_tag LOCUS_01600 8563 7823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9623 8628 gene locus_tag LOCUS_01610 9623 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence019 <1 1156 gene locus_tag LOCUS_01620 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902898.1:amino acid transporter 1219 2037 gene locus_tag LOCUS_01630 gene panB 1219 2037 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_01630 4481 2028 gene locus_tag LOCUS_01640 4481 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 7827 4486 gene locus_tag LOCUS_01650 7827 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 9734 7875 gene locus_tag LOCUS_01660 9734 7875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence020 2427 2125 gene locus_tag LOCUS_01670 gene nuoK1 2427 2125 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_01670 2699 2424 gene locus_tag LOCUS_01680 2699 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3004 2696 gene locus_tag LOCUS_01690 3004 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 3987 3007 gene locus_tag LOCUS_01700 3987 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5450 3993 gene locus_tag LOCUS_01710 5450 3993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 6583 5447 gene locus_tag LOCUS_01720 gene nuoD 6583 5447 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q814W9 protein_id gnl|my_center|LOCUS_01720 7242 6583 gene locus_tag LOCUS_01730 7242 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01730 7845 7252 gene locus_tag LOCUS_01740 7845 7252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8326 7856 gene locus_tag LOCUS_01750 gene nuoA 8326 7856 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEE0 protein_id gnl|my_center|LOCUS_01750 >Feature sequence021 <1 798 gene locus_tag LOCUS_01760 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189844.1:hydrolase 2126 801 gene locus_tag LOCUS_01770 2126 801 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118354.1 protein_id gnl|my_center|LOCUS_01770 2751 2167 gene locus_tag LOCUS_01780 2751 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2879 3091 gene locus_tag LOCUS_01790 gene cspA 2879 3091 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP90 protein_id gnl|my_center|LOCUS_01790 3499 3092 gene locus_tag LOCUS_01800 3499 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 3709 4434 gene locus_tag LOCUS_01810 3709 4434 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883133.1 protein_id gnl|my_center|LOCUS_01810 4584 5051 gene locus_tag LOCUS_01820 4584 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 5450 5052 gene locus_tag LOCUS_01830 5450 5052 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_01830 5569 5958 gene locus_tag LOCUS_01840 5569 5958 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875846.1 protein_id gnl|my_center|LOCUS_01840 6003 6449 gene locus_tag LOCUS_01850 6003 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7502 6450 gene locus_tag LOCUS_01860 gene ilvE 7502 6450 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CN74 protein_id gnl|my_center|LOCUS_01860 >Feature sequence022 3994 2765 gene locus_tag LOCUS_01870 3994 2765 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_01870 4153 4899 gene locus_tag LOCUS_01880 4153 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 5072 7402 gene locus_tag LOCUS_01890 5072 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 7402 8721 gene locus_tag LOCUS_01900 7402 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 >Feature sequence023 1130 1302 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgccggtggtgcttcaggaggttca 1544 2362 gene locus_tag LOCUS_01910 1544 2362 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_01910 2371 3324 gene locus_tag LOCUS_01920 gene argF 2371 3324 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HE32 protein_id gnl|my_center|LOCUS_01920 4211 3321 gene locus_tag LOCUS_01930 4211 3321 CDS product digeranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020999.1 protein_id gnl|my_center|LOCUS_01930 4516 4244 gene locus_tag LOCUS_01940 4516 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4884 4956 gene locus_tag LOCUS_t00030 4884 4956 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5067 6227 gene locus_tag LOCUS_01950 gene ivd 5067 6227 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_01950 6227 6679 gene locus_tag LOCUS_01960 6227 6679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 6749 6674 gene locus_tag LOCUS_t00040 6749 6674 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 841 1206 gene locus_tag LOCUS_01970 841 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1238 2221 gene locus_tag LOCUS_01980 1238 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2304 4151 gene locus_tag LOCUS_01990 2304 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5126 4152 gene locus_tag LOCUS_02000 5126 4152 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_02000 6480 5131 gene locus_tag LOCUS_02010 gene accC 6480 5131 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809797.1 protein_id gnl|my_center|LOCUS_02010 7810 6530 gene locus_tag LOCUS_02020 7810 6530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 7999 8721 gene locus_tag LOCUS_02030 7999 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 >Feature sequence025 907 1557 gene locus_tag LOCUS_02040 907 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 1606 3228 gene locus_tag LOCUS_02050 1606 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3288 4307 gene locus_tag LOCUS_02060 3288 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 4366 4605 gene locus_tag LOCUS_02070 4366 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 5592 4606 gene locus_tag LOCUS_02080 5592 4606 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867914.1 protein_id gnl|my_center|LOCUS_02080 5993 5643 gene locus_tag LOCUS_02090 5993 5643 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199372.1 protein_id gnl|my_center|LOCUS_02090 6501 5986 gene locus_tag LOCUS_02100 6501 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6580 7554 gene locus_tag LOCUS_02110 6580 7554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 7564 8319 gene locus_tag LOCUS_02120 7564 8319 CDS product putative S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB40 protein_id gnl|my_center|LOCUS_02120 8351 8740 gene locus_tag LOCUS_02130 8351 8740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 >Feature sequence026 69 2354 gene locus_tag LOCUS_02140 gene maeB 69 2354 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_02140 2422 2814 gene locus_tag LOCUS_02150 gene panD 2422 2814 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X4N0 protein_id gnl|my_center|LOCUS_02150 3248 2811 gene locus_tag LOCUS_02160 gene rlmH 3248 2811 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCH9 protein_id gnl|my_center|LOCUS_02160 3315 3665 gene locus_tag LOCUS_02170 3315 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3662 4405 gene locus_tag LOCUS_02180 3662 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4531 4752 gene locus_tag LOCUS_02190 4531 4752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4794 5432 gene locus_tag LOCUS_02200 4794 5432 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709194.1 protein_id gnl|my_center|LOCUS_02200 5842 5429 gene locus_tag LOCUS_02210 5842 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5932 6957 gene locus_tag LOCUS_02220 5932 6957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 7428 6946 gene locus_tag LOCUS_02230 7428 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 >Feature sequence027 <1 1555 gene locus_tag LOCUS_02240 <1 1555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080599.1:oligoendopeptidase F 2645 1626 gene locus_tag LOCUS_02250 gene radA 2645 1626 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_02250 2898 2821 gene locus_tag LOCUS_t00050 2898 2821 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2981 4333 gene locus_tag LOCUS_02260 2981 4333 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 protein_id gnl|my_center|LOCUS_02260 6757 4334 gene locus_tag LOCUS_02270 6757 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_02270 6866 7915 gene locus_tag LOCUS_02280 6866 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391757.1 protein_id gnl|my_center|LOCUS_02280 8532 7912 gene locus_tag LOCUS_02290 8532 7912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence028 1064 324 gene locus_tag LOCUS_02300 1064 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963188.1 protein_id gnl|my_center|LOCUS_02300 1792 1190 gene locus_tag LOCUS_02310 1792 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 2770 1961 gene locus_tag LOCUS_02320 gene mutM 2770 1961 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IY64 protein_id gnl|my_center|LOCUS_02320 3438 2770 gene locus_tag LOCUS_02330 3438 2770 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020399.1 protein_id gnl|my_center|LOCUS_02330 4429 3443 gene locus_tag LOCUS_02340 4429 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 4530 4880 gene locus_tag LOCUS_02350 4530 4880 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_02350 4861 5706 gene locus_tag LOCUS_02360 4861 5706 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_02360 5720 6817 gene locus_tag LOCUS_02370 5720 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7614 6814 gene locus_tag LOCUS_02380 7614 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8559 7618 gene locus_tag LOCUS_02390 8559 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 >Feature sequence029 744 7 gene locus_tag LOCUS_02400 744 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1199 747 gene locus_tag LOCUS_02410 1199 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_02410 2371 1196 gene locus_tag LOCUS_02420 2371 1196 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110193.1 protein_id gnl|my_center|LOCUS_02420 2517 3080 gene locus_tag LOCUS_02430 gene orn 2517 3080 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87L01 protein_id gnl|my_center|LOCUS_02430 3826 3053 gene locus_tag LOCUS_02440 3826 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 3825 4529 gene locus_tag LOCUS_02450 3825 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 6376 4532 gene locus_tag LOCUS_02460 6376 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6415 7422 gene locus_tag LOCUS_02470 6415 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 8079 7411 gene locus_tag LOCUS_02480 8079 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence030 418 717 gene locus_tag LOCUS_02490 418 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 2064 718 gene locus_tag LOCUS_02500 2064 718 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_02500 2789 2130 gene locus_tag LOCUS_02510 2789 2130 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_02510 3035 3760 gene locus_tag LOCUS_02520 gene psmA 3035 3760 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_02520 3769 4458 gene locus_tag LOCUS_02530 3769 4458 CDS product rRNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902925.1 protein_id gnl|my_center|LOCUS_02530 4534 5223 gene locus_tag LOCUS_02540 4534 5223 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_02540 5246 5968 gene locus_tag LOCUS_02550 5246 5968 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_02550 5968 6759 gene locus_tag LOCUS_02560 5968 6759 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878001.1 protein_id gnl|my_center|LOCUS_02560 6756 7121 gene locus_tag LOCUS_02570 6756 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 7102 7332 gene locus_tag LOCUS_02580 7102 7332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 7343 7654 gene locus_tag LOCUS_02590 7343 7654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence031 1561 1097 gene locus_tag LOCUS_02600 1561 1097 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056590.1 protein_id gnl|my_center|LOCUS_02600 4548 1597 gene locus_tag LOCUS_02610 4548 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4696 7176 gene locus_tag LOCUS_02620 4696 7176 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_02620 <8054 7179 gene locus_tag LOCUS_02630 <8054 7179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HE18:DNA polymerase IV >Feature sequence032 1159 1521 gene locus_tag LOCUS_02640 1159 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1565 1795 gene locus_tag LOCUS_02650 1565 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2722 1796 gene locus_tag LOCUS_02660 2722 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 2808 3278 gene locus_tag LOCUS_02670 2808 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 4392 3283 gene locus_tag LOCUS_02680 4392 3283 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876526.1 protein_id gnl|my_center|LOCUS_02680 5766 4495 gene locus_tag LOCUS_02690 gene rimK 5766 4495 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNW8 protein_id gnl|my_center|LOCUS_02690 5875 7101 gene locus_tag LOCUS_02700 5875 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence033 4672 2279 gene locus_tag LOCUS_02710 4672 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 5827 4721 gene locus_tag LOCUS_02720 gene rnz 5827 4721 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U1N9 protein_id gnl|my_center|LOCUS_02720 6170 5907 gene locus_tag LOCUS_02730 6170 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 6728 6222 gene locus_tag LOCUS_02740 6728 6222 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence034 5164 4490 gene locus_tag LOCUS_02750 5164 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 >Feature sequence035 <1 1974 gene locus_tag LOCUS_02760 <1 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878013.1:iron-sulfur-binding protein 1971 2228 gene locus_tag LOCUS_02770 1971 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2244 2597 gene locus_tag LOCUS_02780 2244 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2632 2922 gene locus_tag LOCUS_02790 2632 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 4044 2911 gene locus_tag LOCUS_02800 4044 2911 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947573.1 protein_id gnl|my_center|LOCUS_02800 5807 4044 gene locus_tag LOCUS_02810 5807 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6025 5864 gene locus_tag LOCUS_02820 6025 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 6674 6033 gene locus_tag LOCUS_02830 6674 6033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769002.1 protein_id gnl|my_center|LOCUS_02830 <7222 6678 gene locus_tag LOCUS_02840 <7222 6678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888382.1:LAO/AO transport system kinase >Feature sequence036 <1 1072 gene locus_tag LOCUS_02850 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8FA30:DNA gyrase subunit B 1082 3862 gene locus_tag LOCUS_02860 gene gyrA 1082 3862 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94605 protein_id gnl|my_center|LOCUS_02860 3908 3994 gene locus_tag LOCUS_t00060 3908 3994 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence037 3058 1268 gene locus_tag LOCUS_02870 gene fadD 3058 1268 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_02870 3832 3113 gene locus_tag LOCUS_02880 gene smuG1 3832 3113 CDS product single-strand selective monofunctional uracil DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122744.1 protein_id gnl|my_center|LOCUS_02880 5484 3838 gene locus_tag LOCUS_02890 5484 3838 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_02890 <7089 5487 gene locus_tag LOCUS_02900 <7089 5487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249848.1:radical SAM protein >Feature sequence038 2280 562 gene locus_tag LOCUS_02910 2280 562 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_02910 3538 2285 gene locus_tag LOCUS_02920 3538 2285 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_02920 3642 4343 gene locus_tag LOCUS_02930 3642 4343 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867869.1 protein_id gnl|my_center|LOCUS_02930 4348 4668 gene locus_tag LOCUS_02940 4348 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4681 5259 gene locus_tag LOCUS_02950 4681 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 6543 5422 gene locus_tag LOCUS_02960 6543 5422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867947.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence039 1985 804 gene locus_tag LOCUS_02970 1985 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496755.1 protein_id gnl|my_center|LOCUS_02970 2217 2729 gene locus_tag LOCUS_02980 2217 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2716 3351 gene locus_tag LOCUS_02990 2716 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3389 3598 gene locus_tag LOCUS_03000 3389 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3607 4173 gene locus_tag LOCUS_03010 gene mobA 3607 4173 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMX1 protein_id gnl|my_center|LOCUS_03010 >Feature sequence040 1218 2351 gene locus_tag LOCUS_03020 1218 2351 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_03020 2396 3715 gene locus_tag LOCUS_03030 2396 3715 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_03030 3727 4656 gene locus_tag LOCUS_03040 3727 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 5991 4663 gene locus_tag LOCUS_03050 5991 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 <6918 5988 gene locus_tag LOCUS_03060 <6918 5988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020599.1:chorismate synthase >Feature sequence041 1795 410 gene locus_tag LOCUS_03070 1795 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2979 1894 gene locus_tag LOCUS_03080 2979 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 3142 3058 gene locus_tag LOCUS_t00070 3142 3058 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3553 3188 gene locus_tag LOCUS_03090 3553 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4740 3568 gene locus_tag LOCUS_03100 4740 3568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 <6886 4737 gene locus_tag LOCUS_03110 <6886 4737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P24010:cytochrome c oxidase subunit 1 >Feature sequence042 4217 1584 gene locus_tag LOCUS_03120 4217 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4330 5085 gene locus_tag LOCUS_03130 4330 5085 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908611.1 protein_id gnl|my_center|LOCUS_03130 <6816 5082 gene locus_tag LOCUS_03140 <6816 5082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence043 <1 2837 gene locus_tag LOCUS_03150 <1 2837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817388.1:ABC transporter permease 2970 6236 gene locus_tag LOCUS_03160 2970 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 >Feature sequence044 2729 156 gene locus_tag LOCUS_03170 2729 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2989 4773 gene locus_tag LOCUS_03180 2989 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4770 5522 gene locus_tag LOCUS_03190 4770 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6434 5523 gene locus_tag LOCUS_03200 6434 5523 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289466.1 protein_id gnl|my_center|LOCUS_03200 6668 6525 gene locus_tag LOCUS_03210 6668 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence045 <1 2936 gene locus_tag LOCUS_03220 <1 2936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070585.1:GlyGly-CTERM sorting domain-containing protein 3098 3277 gene locus_tag LOCUS_03230 3098 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4856 3336 gene locus_tag LOCUS_03240 4856 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 5919 4900 gene locus_tag LOCUS_03250 5919 4900 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence046 2398 1757 gene locus_tag LOCUS_03260 2398 1757 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_03260 2849 2409 gene locus_tag LOCUS_03270 2849 2409 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_03270 3089 4252 gene locus_tag LOCUS_03280 3089 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_03280 4348 5271 gene locus_tag LOCUS_03290 4348 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 5280 5681 gene locus_tag LOCUS_03300 5280 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6535 5663 gene locus_tag LOCUS_03310 6535 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence047 1186 8 gene locus_tag LOCUS_03320 1186 8 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_03320 1328 1795 gene locus_tag LOCUS_03330 gene gcvH 1328 1795 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2E6 protein_id gnl|my_center|LOCUS_03330 3120 1798 gene locus_tag LOCUS_03340 gene cca 3120 1798 CDS product CCA-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FKF0 protein_id gnl|my_center|LOCUS_03340 3198 3602 gene locus_tag LOCUS_03350 3198 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706415.1 protein_id gnl|my_center|LOCUS_03350 4826 3621 gene locus_tag LOCUS_03360 4826 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 5368 4838 gene locus_tag LOCUS_03370 5368 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence048 989 1765 gene locus_tag LOCUS_03380 989 1765 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948549.1 protein_id gnl|my_center|LOCUS_03380 1798 1881 gene locus_tag LOCUS_t00080 1798 1881 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1998 4952 gene locus_tag LOCUS_03390 1998 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence049 1118 1312 gene locus_tag LOCUS_03400 1118 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1325 2122 gene locus_tag LOCUS_03410 1325 2122 CDS product 3-dehydroquinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876205.1 protein_id gnl|my_center|LOCUS_03410 3091 2123 gene locus_tag LOCUS_03420 3091 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 <6422 3096 gene locus_tag LOCUS_03430 <6422 3096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021313.1:cell surface protein >Feature sequence050 1203 1128 gene locus_tag LOCUS_t00090 1203 1128 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2258 1233 gene locus_tag LOCUS_03440 2258 1233 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902508.1 protein_id gnl|my_center|LOCUS_03440 2482 3894 gene locus_tag LOCUS_03450 gene purA 2482 3894 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DW14 protein_id gnl|my_center|LOCUS_03450 3927 4220 gene locus_tag LOCUS_03460 3927 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5111 4362 gene locus_tag LOCUS_03470 5111 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5287 5460 gene locus_tag LOCUS_03480 5287 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5464 5961 gene locus_tag LOCUS_03490 5464 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence051 1327 50 gene locus_tag LOCUS_03500 1327 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 1442 2458 gene locus_tag LOCUS_03510 1442 2458 CDS product farnesyl-diphosphate farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188769.1 protein_id gnl|my_center|LOCUS_03510 2569 3837 gene locus_tag LOCUS_03520 2569 3837 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_03520 3925 5703 gene locus_tag LOCUS_03530 3925 5703 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_03530 >Feature sequence052 815 192 gene locus_tag LOCUS_03540 815 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146800.1 protein_id gnl|my_center|LOCUS_03540 1232 846 gene locus_tag LOCUS_03550 1232 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 1446 2072 gene locus_tag LOCUS_03560 gene psmB 1446 2072 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_03560 2163 4070 gene locus_tag LOCUS_03570 2163 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_03570 4348 4067 gene locus_tag LOCUS_03580 4348 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4399 5079 gene locus_tag LOCUS_03590 4399 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5217 5546 gene locus_tag LOCUS_03600 5217 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5585 5659 gene locus_tag LOCUS_t00100 5585 5659 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence053 1718 3091 gene locus_tag LOCUS_03610 gene folC 1718 3091 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881338.1 protein_id gnl|my_center|LOCUS_03610 3084 3572 gene locus_tag LOCUS_03620 3084 3572 CDS product cell division protein DedD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000624159.1 protein_id gnl|my_center|LOCUS_03620 4122 3553 gene locus_tag LOCUS_03630 4122 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5991 4138 gene locus_tag LOCUS_03640 5991 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence054 706 47 gene locus_tag LOCUS_03650 706 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1559 786 gene locus_tag LOCUS_03660 1559 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496422.1 protein_id gnl|my_center|LOCUS_03660 2602 1556 gene locus_tag LOCUS_03670 2602 1556 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_03670 2649 3734 gene locus_tag LOCUS_03680 2649 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 3964 3725 gene locus_tag LOCUS_03690 3964 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4052 4999 gene locus_tag LOCUS_03700 4052 4999 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888913.1 protein_id gnl|my_center|LOCUS_03700 4996 5850 gene locus_tag LOCUS_03710 4996 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 >Feature sequence055 878 4243 gene locus_tag LOCUS_03720 878 4243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4321 5946 gene locus_tag LOCUS_03730 4321 5946 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878948.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence056 2033 726 gene locus_tag LOCUS_03740 2033 726 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_03740 3277 2042 gene locus_tag LOCUS_03750 gene icd 3277 2042 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I0L5 protein_id gnl|my_center|LOCUS_03750 3304 3735 gene locus_tag LOCUS_03760 3304 3735 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969495.1 protein_id gnl|my_center|LOCUS_03760 4037 3732 gene locus_tag LOCUS_03770 4037 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4990 4520 gene locus_tag LOCUS_03780 4990 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 5504 4995 gene locus_tag LOCUS_03790 5504 4995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence057 3430 4314 gene locus_tag LOCUS_03800 3430 4314 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_03800 4602 4315 gene locus_tag LOCUS_03810 4602 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5523 4684 gene locus_tag LOCUS_03820 5523 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence058 <1 1047 gene locus_tag LOCUS_03830 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024425.1:DNA polymerase II 2025 1048 gene locus_tag LOCUS_03840 2025 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 2759 2022 gene locus_tag LOCUS_03850 2759 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_03850 2907 3953 gene locus_tag LOCUS_03860 2907 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 5072 3957 gene locus_tag LOCUS_03870 5072 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_03870 5533 5141 gene locus_tag LOCUS_03880 5533 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence059 1059 349 gene locus_tag LOCUS_03890 1059 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1196 1516 gene locus_tag LOCUS_03900 1196 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_03900 1506 1985 gene locus_tag LOCUS_03910 1506 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4865 1986 gene locus_tag LOCUS_03920 4865 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5362 4919 gene locus_tag LOCUS_03930 5362 4919 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence060 <1 1209 gene locus_tag LOCUS_03940 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496860.1:ATPase 1262 2818 gene locus_tag LOCUS_03950 1262 2818 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876429.1 protein_id gnl|my_center|LOCUS_03950 2873 4540 gene locus_tag LOCUS_03960 gene purH 2873 4540 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FJ9 protein_id gnl|my_center|LOCUS_03960 4549 5049 gene locus_tag LOCUS_03970 4549 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence061 248 1204 gene locus_tag LOCUS_03980 248 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1264 2106 gene locus_tag LOCUS_03990 1264 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 2119 2565 gene locus_tag LOCUS_04000 2119 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2837 5722 gene locus_tag LOCUS_04010 2837 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence062 1031 1789 gene locus_tag LOCUS_04020 1031 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 1930 5904 gene locus_tag LOCUS_04030 1930 5904 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053701.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence063 3146 441 gene locus_tag LOCUS_04040 3146 441 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726709.1 protein_id gnl|my_center|LOCUS_04040 5040 3139 gene locus_tag LOCUS_04050 gene nuoF 5040 3139 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085921.1 protein_id gnl|my_center|LOCUS_04050 5893 5123 gene locus_tag LOCUS_04060 gene fdhD 5893 5123 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_04060 >Feature sequence064 <1 1110 gene locus_tag LOCUS_04070 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871086.1:membrane protein 1664 1107 gene locus_tag LOCUS_04080 1664 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 1805 3073 gene locus_tag LOCUS_04090 1805 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3146 3361 gene locus_tag LOCUS_04100 3146 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 3376 4803 gene locus_tag LOCUS_04110 gene cshA 3376 4803 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96614 protein_id gnl|my_center|LOCUS_04110 5724 4804 gene locus_tag LOCUS_04120 5724 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence065 1476 76 gene locus_tag LOCUS_04130 1476 76 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289363.1 protein_id gnl|my_center|LOCUS_04130 3379 1661 gene locus_tag LOCUS_04140 3379 1661 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878416.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence066 1477 218 gene locus_tag LOCUS_04150 1477 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2524 1577 gene locus_tag LOCUS_04160 2524 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3670 2591 gene locus_tag LOCUS_04170 3670 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3795 3720 gene locus_tag LOCUS_t00110 3795 3720 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5089 3830 gene locus_tag LOCUS_04180 5089 3830 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548899.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence067 1609 2244 gene locus_tag LOCUS_04190 1609 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2246 4129 gene locus_tag LOCUS_04200 gene dnaK 2246 4129 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_04200 5608 4130 gene locus_tag LOCUS_04210 gene pepA 5608 4130 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MT4 protein_id gnl|my_center|LOCUS_04210 >Feature sequence068 111 184 gene locus_tag LOCUS_t00120 111 184 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 350 1690 gene locus_tag LOCUS_04220 350 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1860 3362 gene locus_tag LOCUS_04230 1860 3362 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941895.1 protein_id gnl|my_center|LOCUS_04230 3362 4693 gene locus_tag LOCUS_04240 3362 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence069 1136 462 gene locus_tag LOCUS_04250 1136 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3897 1201 gene locus_tag LOCUS_04260 gene citB 3897 1201 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_04260 4952 3963 gene locus_tag LOCUS_04270 4952 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence070 3854 315 gene locus_tag LOCUS_04280 3854 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5017 3893 gene locus_tag LOCUS_04290 gene gcvT 5017 3893 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY54 protein_id gnl|my_center|LOCUS_04290 >Feature sequence071 4039 5304 gene locus_tag LOCUS_04300 gene ahcY 4039 5304 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G6 protein_id gnl|my_center|LOCUS_04300 5606 5319 gene locus_tag LOCUS_04310 5606 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence072 198 1514 gene locus_tag LOCUS_04320 198 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1544 1617 gene locus_tag LOCUS_t00130 1544 1617 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4353 1639 gene locus_tag LOCUS_04330 4353 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5513 4386 gene locus_tag LOCUS_04340 5513 4386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence073 2546 237 gene locus_tag LOCUS_04350 2546 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 3133 2627 gene locus_tag LOCUS_04360 3133 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 3528 3142 gene locus_tag LOCUS_04370 3528 3142 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870740.1 protein_id gnl|my_center|LOCUS_04370 4481 3633 gene locus_tag LOCUS_04380 gene hbd 4481 3633 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVG1 protein_id gnl|my_center|LOCUS_04380 <5581 4528 gene locus_tag LOCUS_04390 <5581 4528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA >Feature sequence074 2073 349 gene locus_tag LOCUS_04400 2073 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 3239 2172 gene locus_tag LOCUS_04410 3239 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 3327 4307 gene locus_tag LOCUS_04420 gene ispB 3327 4307 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_04420 4300 5400 gene locus_tag LOCUS_04430 4300 5400 CDS product bacteriochlorophyll synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence075 934 206 gene locus_tag LOCUS_04440 934 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1509 994 gene locus_tag LOCUS_04450 1509 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2121 1741 gene locus_tag LOCUS_04460 2121 1741 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_04460 3043 2084 gene locus_tag LOCUS_04470 3043 2084 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_04470 3738 3094 gene locus_tag LOCUS_04480 3738 3094 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_04480 4075 3797 gene locus_tag LOCUS_04490 4075 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5176 4145 gene locus_tag LOCUS_04500 5176 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5468 5193 gene locus_tag LOCUS_04510 5468 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence076 1590 22 gene locus_tag LOCUS_04520 1590 22 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812211.1 protein_id gnl|my_center|LOCUS_04520 3017 1593 gene locus_tag LOCUS_04530 gene trkA 3017 1593 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389371.1 protein_id gnl|my_center|LOCUS_04530 4529 3066 gene locus_tag LOCUS_04540 4529 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 5464 4688 gene locus_tag LOCUS_04550 5464 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence077 1495 521 gene locus_tag LOCUS_04560 1495 521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439447.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04560 1562 1804 gene locus_tag LOCUS_04570 1562 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1801 2628 gene locus_tag LOCUS_04580 1801 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2729 3328 gene locus_tag LOCUS_04590 2729 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5464 3329 gene locus_tag LOCUS_04600 5464 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence078 554 165 gene locus_tag LOCUS_04610 554 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 501 1220 gene locus_tag LOCUS_04620 501 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 1301 3439 gene locus_tag LOCUS_04630 gene hppA 1301 3439 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B616 protein_id gnl|my_center|LOCUS_04630 3476 4438 gene locus_tag LOCUS_04640 3476 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4447 5043 gene locus_tag LOCUS_04650 4447 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5024 5335 gene locus_tag LOCUS_04660 5024 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence079 3 1586 gene locus_tag LOCUS_04670 3 1586 CDS product tRNA-guanine(15) transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060763.1 protein_id gnl|my_center|LOCUS_04670 1670 2674 gene locus_tag LOCUS_04680 1670 2674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_04680 2671 3786 gene locus_tag LOCUS_04690 2671 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3783 4775 gene locus_tag LOCUS_04700 3783 4775 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence080 1494 4571 gene locus_tag LOCUS_04710 1494 4571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4626 4700 gene locus_tag LOCUS_t00140 4626 4700 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5070 4702 gene locus_tag LOCUS_04720 5070 4702 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_04720 >Feature sequence081 3 980 gene locus_tag LOCUS_04730 3 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 977 1762 gene locus_tag LOCUS_04740 977 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 1772 3112 gene locus_tag LOCUS_04750 1772 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3952 3113 gene locus_tag LOCUS_04760 3952 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4055 4753 gene locus_tag LOCUS_04770 4055 4753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 4885 4808 gene locus_tag LOCUS_t00150 4885 4808 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence082 733 101 gene locus_tag LOCUS_04780 733 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1404 733 gene locus_tag LOCUS_04790 1404 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2771 1425 gene locus_tag LOCUS_04800 2771 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4297 2792 gene locus_tag LOCUS_04810 4297 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4926 4315 gene locus_tag LOCUS_04820 gene purN 4926 4315 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7M0 protein_id gnl|my_center|LOCUS_04820 >Feature sequence083 534 61 gene locus_tag LOCUS_04830 534 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 1070 597 gene locus_tag LOCUS_04840 1070 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1603 1070 gene locus_tag LOCUS_04850 1603 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 3160 1628 gene locus_tag LOCUS_04860 3160 1628 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240506.1 protein_id gnl|my_center|LOCUS_04860 4919 3210 gene locus_tag LOCUS_04870 4919 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence084 531 698 gene locus_tag LOCUS_04880 531 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2145 700 gene locus_tag LOCUS_04890 gene pntB 2145 700 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 protein_id gnl|my_center|LOCUS_04890 2470 2147 gene locus_tag LOCUS_04900 2470 2147 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_04900 3630 2467 gene locus_tag LOCUS_04910 gene pntaA 3630 2467 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_04910 4453 3740 gene locus_tag LOCUS_04920 4453 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 >Feature sequence085 1274 216 gene locus_tag LOCUS_04930 1274 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1356 3071 gene locus_tag LOCUS_04940 gene fhs 1356 3071 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9U6 protein_id gnl|my_center|LOCUS_04940 3081 4550 gene locus_tag LOCUS_04950 3081 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 >Feature sequence086 391 2154 gene locus_tag LOCUS_04960 391 2154 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence087 <1 2469 gene locus_tag LOCUS_04970 <1 2469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein 3609 2470 gene locus_tag LOCUS_04980 3609 2470 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096991.1 protein_id gnl|my_center|LOCUS_04980 4736 3636 gene locus_tag LOCUS_04990 4736 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence088 <1 2294 gene locus_tag LOCUS_05000 <1 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020155.1:Hef nuclease 3151 2291 gene locus_tag LOCUS_05010 3151 2291 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870378.1 protein_id gnl|my_center|LOCUS_05010 5055 3151 gene locus_tag LOCUS_05020 5055 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence089 <1 1852 gene locus_tag LOCUS_05030 <1 1852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879381.1:DNA-directed RNA polymerase subunit A' 1852 3426 gene locus_tag LOCUS_05040 1852 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3470 3769 gene locus_tag LOCUS_05050 3470 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3842 4795 gene locus_tag LOCUS_05060 3842 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence090 683 171 gene locus_tag LOCUS_05070 683 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3310 755 gene locus_tag LOCUS_05080 3310 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3397 4128 gene locus_tag LOCUS_05090 3397 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence091 >Feature sequence092 >Feature sequence093 2549 2477 gene locus_tag LOCUS_t00160 2549 2477 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2665 2749 gene locus_tag LOCUS_t00170 2665 2749 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2839 4041 gene locus_tag LOCUS_05100 2839 4041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence094 226 1200 gene locus_tag LOCUS_05110 226 1200 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259581.1 protein_id gnl|my_center|LOCUS_05110 1205 3445 gene locus_tag LOCUS_05120 1205 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence095 <1 564 gene locus_tag LOCUS_05130 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q92LT7:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex 574 1992 gene locus_tag LOCUS_05140 574 1992 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 protein_id gnl|my_center|LOCUS_05140 2454 1993 gene locus_tag LOCUS_05150 2454 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2523 3164 gene locus_tag LOCUS_05160 gene lipB 2523 3164 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D030 protein_id gnl|my_center|LOCUS_05160 3151 3930 gene locus_tag LOCUS_05170 3151 3930 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence096 657 3596 gene locus_tag LOCUS_05180 657 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3622 4164 gene locus_tag LOCUS_05190 gene apt 3622 4164 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NII9 protein_id gnl|my_center|LOCUS_05190 4255 4710 gene locus_tag LOCUS_05200 4255 4710 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869527.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence097 590 518 gene locus_tag LOCUS_t00180 590 518 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 680 868 gene locus_tag LOCUS_05210 680 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1626 865 gene locus_tag LOCUS_05220 1626 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 <4857 1664 gene locus_tag LOCUS_05230 <4857 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071759.1:type I polyketide synthase >Feature sequence098 165 536 gene locus_tag LOCUS_05240 165 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 536 703 gene locus_tag LOCUS_05250 536 703 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013748365.1 protein_id gnl|my_center|LOCUS_05250 1711 704 gene locus_tag LOCUS_05260 1711 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1756 2712 gene locus_tag LOCUS_05270 1756 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2773 3747 gene locus_tag LOCUS_05280 gene putA 2773 3747 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence099 2117 1071 gene locus_tag LOCUS_05290 2117 1071 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM54 protein_id gnl|my_center|LOCUS_05290 2808 2140 gene locus_tag LOCUS_05300 2808 2140 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_05300 2918 4135 gene locus_tag LOCUS_05310 2918 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4657 4136 gene locus_tag LOCUS_05320 4657 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence100 892 308 gene locus_tag LOCUS_05330 892 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2719 968 gene locus_tag LOCUS_05340 2719 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4335 2716 gene locus_tag LOCUS_05350 4335 2716 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence101 1837 2730 gene locus_tag LOCUS_05360 1837 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 3074 2745 gene locus_tag LOCUS_05370 3074 2745 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_05370 4403 3114 gene locus_tag LOCUS_05380 gene tuf 4403 3114 CDS product elongation factor 1-alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021277.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence102 114 1430 gene locus_tag LOCUS_05390 114 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 1483 3093 gene locus_tag LOCUS_05400 gene mccB 1483 3093 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973074.1 protein_id gnl|my_center|LOCUS_05400 3107 3964 gene locus_tag LOCUS_05410 3107 3964 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence103 2817 502 gene locus_tag LOCUS_05420 2817 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2938 3435 gene locus_tag LOCUS_05430 2938 3435 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_05430 3441 4424 gene locus_tag LOCUS_05440 3441 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 >Feature sequence104 <4663 67 gene locus_tag LOCUS_05450 <4663 67 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393841.1:peptidase S8 >Feature sequence105 2104 575 gene locus_tag LOCUS_05460 2104 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 <4659 2185 gene locus_tag LOCUS_05470 <4659 2185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence106 546 409 gene locus_tag LOCUS_05480 546 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 843 556 gene locus_tag LOCUS_05490 843 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1276 863 gene locus_tag LOCUS_05500 1276 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2169 1582 gene locus_tag LOCUS_05510 2169 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3299 2208 gene locus_tag LOCUS_05520 3299 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4316 3447 gene locus_tag LOCUS_05530 4316 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence107 1671 796 gene locus_tag LOCUS_05540 1671 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2123 1674 gene locus_tag LOCUS_05550 2123 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2938 2120 gene locus_tag LOCUS_05560 2938 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3099 3404 gene locus_tag LOCUS_05570 3099 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3445 4377 gene locus_tag LOCUS_05580 3445 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence108 1681 578 gene locus_tag LOCUS_05590 1681 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2412 1771 gene locus_tag LOCUS_05600 2412 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 2938 2486 gene locus_tag LOCUS_05610 2938 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3068 3211 gene locus_tag LOCUS_05620 3068 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 <4591 3301 gene locus_tag LOCUS_05630 <4591 3301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978008.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence109 731 240 gene locus_tag LOCUS_05640 731 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1743 724 gene locus_tag LOCUS_05650 1743 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 2552 1740 gene locus_tag LOCUS_05660 2552 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence110 804 1493 gene locus_tag LOCUS_05670 804 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 1566 1493 gene locus_tag LOCUS_t00190 1566 1493 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1646 2701 gene locus_tag LOCUS_05680 1646 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2795 3724 gene locus_tag LOCUS_05690 2795 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3721 4446 gene locus_tag LOCUS_05700 gene pepE 3721 4446 CDS product peptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RZ5 protein_id gnl|my_center|LOCUS_05700 >Feature sequence111 1586 114 gene locus_tag LOCUS_05710 gene arsB 1586 114 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181903.1 protein_id gnl|my_center|LOCUS_05710 3472 1658 gene locus_tag LOCUS_05720 3472 1658 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_05720 3807 3538 gene locus_tag LOCUS_05730 3807 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence112 >Feature sequence113 1731 607 gene locus_tag LOCUS_05740 1731 607 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence114 456 2429 gene locus_tag LOCUS_05750 456 2429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 3991 2432 gene locus_tag LOCUS_05760 gene crtI 3991 2432 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122696.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence115 1636 350 gene locus_tag LOCUS_05770 gene ychF 1636 350 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_05770 3240 1639 gene locus_tag LOCUS_05780 3240 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3525 3253 gene locus_tag LOCUS_05790 3525 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 <4469 3627 gene locus_tag LOCUS_05800 <4469 3627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878512.1:TIGR01210 family radical SAM protein >Feature sequence116 839 1948 gene locus_tag LOCUS_05810 839 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 2007 4118 gene locus_tag LOCUS_05820 2007 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence117 455 1474 gene locus_tag LOCUS_05830 455 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1467 2108 gene locus_tag LOCUS_05840 1467 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3404 2109 gene locus_tag LOCUS_05850 3404 2109 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence118 <1 515 gene locus_tag LOCUS_05860 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081423243.1:secretion system protein E 556 1641 gene locus_tag LOCUS_05870 556 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1654 3213 gene locus_tag LOCUS_05880 1654 3213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3217 3678 gene locus_tag LOCUS_05890 3217 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3678 4112 gene locus_tag LOCUS_05900 3678 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence119 <1 1602 gene locus_tag LOCUS_05910 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889584.1:N-glycosidase F 2800 1616 gene locus_tag LOCUS_05920 gene mqnC 2800 1616 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJC2 protein_id gnl|my_center|LOCUS_05920 4147 2810 gene locus_tag LOCUS_05930 gene pepP 4147 2810 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence120 <1 1552 gene locus_tag LOCUS_05940 <1 1552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903698.1:alanine--tRNA ligase 2219 1578 gene locus_tag LOCUS_05950 2219 1578 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197988.1 protein_id gnl|my_center|LOCUS_05950 3785 2229 gene locus_tag LOCUS_05960 3785 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence121 736 1956 gene locus_tag LOCUS_05970 736 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1977 2657 gene locus_tag LOCUS_05980 1977 2657 CDS product cytochrome c-type biogenesis heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886993.1 protein_id gnl|my_center|LOCUS_05980 2617 2814 gene locus_tag LOCUS_05990 2617 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2854 3246 gene locus_tag LOCUS_06000 2854 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence122 <1 813 gene locus_tag LOCUS_06010 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867382.1:KaiC domain-containing protein 806 1393 gene locus_tag LOCUS_06020 806 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1407 2228 gene locus_tag LOCUS_06030 1407 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3582 2578 gene locus_tag LOCUS_06040 3582 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3664 3939 gene locus_tag LOCUS_06050 3664 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147166.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence123 809 36 gene locus_tag LOCUS_06060 809 36 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_06060 2140 809 gene locus_tag LOCUS_06070 2140 809 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_06070 <4244 2178 gene locus_tag LOCUS_06080 <4244 2178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023222.1:ATP-dependent protease LonB >Feature sequence124 847 1722 gene locus_tag LOCUS_06090 847 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence125 1211 42 gene locus_tag LOCUS_06100 1211 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1444 3237 gene locus_tag LOCUS_06110 1444 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 <4218 3197 gene locus_tag LOCUS_06120 <4218 3197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:RNA-binding protein >Feature sequence126 <1 2998 gene locus_tag LOCUS_06130 <1 2998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583045.1:glycoside hydrolase family 57 <4179 2995 gene locus_tag LOCUS_06140 <4179 2995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066045.1:DNA polymerase II >Feature sequence127 524 608 gene locus_tag LOCUS_t00200 524 608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 705 3395 gene locus_tag LOCUS_06150 705 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3456 3926 gene locus_tag LOCUS_06160 3456 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence128 245 1492 gene locus_tag LOCUS_06170 245 1492 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_06170 1558 2091 gene locus_tag LOCUS_06180 1558 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 3114 2092 gene locus_tag LOCUS_06190 3114 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence129 660 1487 gene locus_tag LOCUS_06200 660 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1543 1770 gene locus_tag LOCUS_06210 1543 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1770 2378 gene locus_tag LOCUS_06220 1770 2378 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_06220 2476 3816 gene locus_tag LOCUS_06230 2476 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence130 2 3754 gene locus_tag LOCUS_06240 2 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence131 430 101 gene locus_tag LOCUS_06250 430 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 580 2439 gene locus_tag LOCUS_06260 gene polX 580 2439 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94544 protein_id gnl|my_center|LOCUS_06260 2444 2650 gene locus_tag LOCUS_06270 2444 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2650 2856 gene locus_tag LOCUS_06280 2650 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2853 3497 gene locus_tag LOCUS_06290 gene nth 2853 3497 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_06290 3494 4021 gene locus_tag LOCUS_06300 3494 4021 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence132 2640 580 gene locus_tag LOCUS_06310 2640 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 3511 2654 gene locus_tag LOCUS_06320 3511 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence133 <1 666 gene locus_tag LOCUS_06330 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012774950.1:mevalonate kinase 745 1362 gene locus_tag LOCUS_06340 745 1362 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890411.1 protein_id gnl|my_center|LOCUS_06340 1372 1752 gene locus_tag LOCUS_06350 1372 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 1757 2110 gene locus_tag LOCUS_06360 1757 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence134 622 59 gene locus_tag LOCUS_06370 gene grpE 622 59 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88VL9 protein_id gnl|my_center|LOCUS_06370 1692 622 gene locus_tag LOCUS_06380 1692 622 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_06380 2282 1689 gene locus_tag LOCUS_06390 2282 1689 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875829.1 protein_id gnl|my_center|LOCUS_06390 3307 2312 gene locus_tag LOCUS_06400 gene serC 3307 2312 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_06400 >Feature sequence135 >Feature sequence136 2384 1095 gene locus_tag LOCUS_06410 gene malQ 2384 1095 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DY3 protein_id gnl|my_center|LOCUS_06410 >Feature sequence137 45 3575 gene locus_tag LOCUS_06420 gene ypdB 45 3575 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906004.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence138 <1 817 gene locus_tag LOCUS_06430 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083149.1:ABC transporter ATP-binding protein 810 1643 gene locus_tag LOCUS_06440 810 1643 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_06440 1741 2832 gene locus_tag LOCUS_06450 1741 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2919 3581 gene locus_tag LOCUS_06460 gene phnC 2919 3581 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XDV7 protein_id gnl|my_center|LOCUS_06460 >Feature sequence139 <1 564 gene locus_tag LOCUS_06470 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259329.1:molybdenum cofactor biosynthesis protein MoeB 626 1627 gene locus_tag LOCUS_06480 626 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1630 2412 gene locus_tag LOCUS_06490 1630 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 >Feature sequence140 1106 792 gene locus_tag LOCUS_06500 gene cutA 1106 792 CDS product divalent cation tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226991.1 protein_id gnl|my_center|LOCUS_06500 1188 2516 gene locus_tag LOCUS_06510 1188 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2526 3314 gene locus_tag LOCUS_06520 2526 3314 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X264 protein_id gnl|my_center|LOCUS_06520 >Feature sequence141 881 2161 gene locus_tag LOCUS_06530 881 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 3045 2122 gene locus_tag LOCUS_06540 3045 2122 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_06540 3385 3056 gene locus_tag LOCUS_06550 3385 3056 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDL4 protein_id gnl|my_center|LOCUS_06550 3717 3388 gene locus_tag LOCUS_06560 3717 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence142 <1 501 gene locus_tag LOCUS_06570 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902736.1:CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase 590 3799 gene locus_tag LOCUS_06580 590 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence143 <1 3252 gene locus_tag LOCUS_06590 <1 3252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence144 88 1230 gene locus_tag LOCUS_06600 88 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2409 1231 gene locus_tag LOCUS_06610 2409 1231 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_06610 2511 2969 gene locus_tag LOCUS_06620 2511 2969 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869889.1 protein_id gnl|my_center|LOCUS_06620 3816 2974 gene locus_tag LOCUS_06630 3816 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence145 1821 976 gene locus_tag LOCUS_06640 1821 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3770 1824 gene locus_tag LOCUS_06650 3770 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 >Feature sequence146 1 537 gene locus_tag LOCUS_06660 1 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 527 1801 gene locus_tag LOCUS_06670 gene deoA 527 1801 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964854.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence147 1733 990 gene locus_tag LOCUS_06680 1733 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence148 >Feature sequence149 >Feature sequence150 <1 1308 gene locus_tag LOCUS_06690 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222945.1:aminopeptidase 1313 1612 gene locus_tag LOCUS_06700 1313 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1622 1990 gene locus_tag LOCUS_06710 gene folB 1622 1990 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DJU5 protein_id gnl|my_center|LOCUS_06710 2488 1991 gene locus_tag LOCUS_06720 2488 1991 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_06720 2509 2796 gene locus_tag LOCUS_06730 2509 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2839 3396 gene locus_tag LOCUS_06740 2839 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence151 847 467 gene locus_tag LOCUS_06750 847 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1491 910 gene locus_tag LOCUS_06760 1491 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1527 2561 gene locus_tag LOCUS_06770 1527 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2971 2558 gene locus_tag LOCUS_06780 2971 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence152 1028 264 gene locus_tag LOCUS_06790 1028 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 1106 2053 gene locus_tag LOCUS_06800 1106 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2056 2598 gene locus_tag LOCUS_06810 2056 2598 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868267.1 protein_id gnl|my_center|LOCUS_06810 2595 3566 gene locus_tag LOCUS_06820 2595 3566 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence153 501 1337 gene locus_tag LOCUS_06830 501 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1926 1321 gene locus_tag LOCUS_06840 1926 1321 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837561.1 protein_id gnl|my_center|LOCUS_06840 >Feature sequence154 659 210 gene locus_tag LOCUS_06850 659 210 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_06850 1078 656 gene locus_tag LOCUS_06860 1078 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 1171 1431 gene locus_tag LOCUS_06870 1171 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 1441 2787 gene locus_tag LOCUS_06880 1441 2787 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251109.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence155 175 897 gene locus_tag LOCUS_06890 175 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1717 884 gene locus_tag LOCUS_06900 gene psd 1717 884 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBK6 protein_id gnl|my_center|LOCUS_06900 2388 1723 gene locus_tag LOCUS_06910 2388 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 <3697 2489 gene locus_tag LOCUS_06920 <3697 2489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037909.1:succinyl-diaminopimelate desuccinylase >Feature sequence156 <1 623 gene locus_tag LOCUS_06930 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869627.1:tRNA methyltransferase <3688 625 gene locus_tag LOCUS_06940 <3688 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:aggregation factor core protein MAFp3, isoform C >Feature sequence157 609 28 gene locus_tag LOCUS_06950 609 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1009 665 gene locus_tag LOCUS_06960 1009 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1325 1047 gene locus_tag LOCUS_06970 1325 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1398 1856 gene locus_tag LOCUS_06980 1398 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1950 1864 gene locus_tag LOCUS_t00210 1950 1864 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2019 3050 gene locus_tag LOCUS_06990 gene gpsA 2019 3050 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RND0 protein_id gnl|my_center|LOCUS_06990 3084 3305 gene locus_tag LOCUS_07000 3084 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence158 2680 974 gene locus_tag LOCUS_07010 2680 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence159 381 2375 gene locus_tag LOCUS_07020 381 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence160 481 2133 gene locus_tag LOCUS_07030 gene pyrG 481 2133 CDS product CTP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_07030 3232 2138 gene locus_tag LOCUS_07040 3232 2138 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence161 1670 498 gene locus_tag LOCUS_07050 1670 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 1751 2548 gene locus_tag LOCUS_07060 1751 2548 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250847.1 protein_id gnl|my_center|LOCUS_07060 <3583 2539 gene locus_tag LOCUS_07070 <3583 2539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P26996:DNA ligase >Feature sequence162 499 1725 gene locus_tag LOCUS_07080 gene bkdA1 499 1725 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 protein_id gnl|my_center|LOCUS_07080 1725 2738 gene locus_tag LOCUS_07090 gene bkdAb 1725 2738 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970298.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence163 229 645 gene locus_tag LOCUS_07100 229 645 CDS product UPF0145 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMH9 protein_id gnl|my_center|LOCUS_07100 655 1146 gene locus_tag LOCUS_07110 655 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1158 1553 gene locus_tag LOCUS_07120 1158 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1618 3114 gene locus_tag LOCUS_07130 1618 3114 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence164 93 515 gene locus_tag LOCUS_07140 93 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 528 980 gene locus_tag LOCUS_07150 528 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 1099 3087 gene locus_tag LOCUS_07160 1099 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence165 1386 385 gene locus_tag LOCUS_07170 1386 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1412 1867 gene locus_tag LOCUS_07180 1412 1867 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_07180 1908 2150 gene locus_tag LOCUS_07190 1908 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2192 3361 gene locus_tag LOCUS_07200 2192 3361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence166 >Feature sequence167 1367 3130 gene locus_tag LOCUS_07210 1367 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence168 1750 770 gene locus_tag LOCUS_07220 1750 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2754 1786 gene locus_tag LOCUS_07230 2754 1786 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_07230 <3488 2754 gene locus_tag LOCUS_07240 <3488 2754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:nicotinate dehydrogenase medium molybdopterin subunit >Feature sequence169 1461 658 gene locus_tag LOCUS_07250 1461 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence170 1092 79 gene locus_tag LOCUS_07260 1092 79 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_07260 2377 1118 gene locus_tag LOCUS_07270 2377 1118 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_07270 2518 3045 gene locus_tag LOCUS_07280 2518 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3246 3049 gene locus_tag LOCUS_07290 3246 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence171 672 1307 gene locus_tag LOCUS_07300 672 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1598 1308 gene locus_tag LOCUS_07310 1598 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2601 1681 gene locus_tag LOCUS_07320 2601 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2642 3439 gene locus_tag LOCUS_07330 gene rlmE 2642 3439 CDS product ribosomal RNA large subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7DDL2 protein_id gnl|my_center|LOCUS_07330 >Feature sequence172 219 1259 gene locus_tag LOCUS_07340 219 1259 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_07340 1858 1253 gene locus_tag LOCUS_07350 1858 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence173 >Feature sequence174 2113 875 gene locus_tag LOCUS_07360 2113 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence175 1117 14 gene locus_tag LOCUS_07370 1117 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence176 1659 7 gene locus_tag LOCUS_07380 1659 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2097 1732 gene locus_tag LOCUS_07390 2097 1732 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_07390 2862 2098 gene locus_tag LOCUS_07400 2862 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence177 724 245 gene locus_tag LOCUS_07410 724 245 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_07410 1082 717 gene locus_tag LOCUS_07420 1082 717 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902816.1 protein_id gnl|my_center|LOCUS_07420 1240 1662 gene locus_tag LOCUS_07430 1240 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2093 1647 gene locus_tag LOCUS_07440 2093 1647 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070434.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence178 1080 1940 gene locus_tag LOCUS_07450 1080 1940 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_07450 2823 1927 gene locus_tag LOCUS_07460 2823 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence179 492 343 gene locus_tag LOCUS_07470 492 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 1153 560 gene locus_tag LOCUS_07480 1153 560 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_07480 2232 1195 gene locus_tag LOCUS_07490 2232 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2296 2371 gene locus_tag LOCUS_t00220 2296 2371 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 <3326 2383 gene locus_tag LOCUS_07500 <3326 2383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877475.1:SAM-dependent methyltransferase >Feature sequence180 2018 3001 gene locus_tag LOCUS_07510 2018 3001 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037668.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence181 >Feature sequence182 <1 2064 gene locus_tag LOCUS_07520 <1 2064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E2L1:phosphate transporter <3315 2067 gene locus_tag LOCUS_07530 <3315 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123275.1:phospholipid-binding protein >Feature sequence183 1 138 gene locus_tag LOCUS_07540 1 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1407 139 gene locus_tag LOCUS_07550 1407 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3086 1470 gene locus_tag LOCUS_07560 3086 1470 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_07560 3307 3098 gene locus_tag LOCUS_07570 3307 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence184 1157 1864 gene locus_tag LOCUS_07580 1157 1864 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_07580 1882 2346 gene locus_tag LOCUS_07590 1882 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2346 2936 gene locus_tag LOCUS_07600 2346 2936 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366888.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence185 151 750 gene locus_tag LOCUS_07610 151 750 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence186 578 1591 gene locus_tag LOCUS_07620 578 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2863 1577 gene locus_tag LOCUS_07630 2863 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence187 1177 2106 gene locus_tag LOCUS_07640 1177 2106 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_07640 2112 2525 gene locus_tag LOCUS_07650 2112 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence188 718 95 gene locus_tag LOCUS_07660 gene pyrE 718 95 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89BL4 protein_id gnl|my_center|LOCUS_07660 >Feature sequence189 586 245 gene locus_tag LOCUS_07670 586 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 677 1792 gene locus_tag LOCUS_07680 677 1792 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_07680 1861 3132 gene locus_tag LOCUS_07690 1861 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence190 >Feature sequence191 >Feature sequence192 <1 2877 gene locus_tag LOCUS_07700 <1 2877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083081.1:cytosine deaminase >Feature sequence193 865 1263 gene locus_tag LOCUS_07710 865 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 1336 1264 gene locus_tag LOCUS_t00230 1336 1264 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1928 1338 gene locus_tag LOCUS_07720 1928 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence194 1699 1148 gene locus_tag LOCUS_07730 gene rnhA 1699 1148 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM24 protein_id gnl|my_center|LOCUS_07730 2085 1702 gene locus_tag LOCUS_07740 gene gcvH 2085 1702 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGD7 protein_id gnl|my_center|LOCUS_07740 2194 2598 gene locus_tag LOCUS_07750 2194 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <3159 2600 gene locus_tag LOCUS_07760 <3159 2600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67322:nucleoside-triphosphatase THEP1 >Feature sequence195 831 316 gene locus_tag LOCUS_07770 831 316 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_07770 1365 850 gene locus_tag LOCUS_07780 1365 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 2546 1362 gene locus_tag LOCUS_07790 2546 1362 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence196 2578 146 gene locus_tag LOCUS_07800 2578 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 <3151 2599 gene locus_tag LOCUS_07810 <3151 2599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878518.1:macrolide ABC transporter ATP-binding protein >Feature sequence197 601 1911 gene locus_tag LOCUS_07820 601 1911 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022483.1 protein_id gnl|my_center|LOCUS_07820 1959 2258 gene locus_tag LOCUS_07830 1959 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 3017 2259 gene locus_tag LOCUS_07840 3017 2259 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Z3 protein_id gnl|my_center|LOCUS_07840 >Feature sequence198 <1 947 gene locus_tag LOCUS_07850 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256158.1:pyruvate ferredoxin oxidoreductase 944 1978 gene locus_tag LOCUS_07860 944 1978 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_07860 2597 1980 gene locus_tag LOCUS_07870 2597 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence199 <1 969 gene locus_tag LOCUS_07880 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876987.1:isoleucine--tRNA ligase 1305 1378 gene locus_tag LOCUS_t00240 1305 1378 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1397 1472 gene locus_tag LOCUS_t00250 1397 1472 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1945 2688 gene locus_tag LOCUS_07890 1945 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2699 2896 gene locus_tag LOCUS_07900 2699 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence200 857 285 gene locus_tag LOCUS_07910 857 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2917 899 gene locus_tag LOCUS_07920 2917 899 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249133.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence201 1753 242 gene locus_tag LOCUS_07930 1753 242 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_07930 2251 1808 gene locus_tag LOCUS_07940 2251 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence202 >Feature sequence203 1126 1635 gene locus_tag LOCUS_07950 1126 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2501 1632 gene locus_tag LOCUS_07960 2501 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2959 2498 gene locus_tag LOCUS_07970 2959 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence204 >Feature sequence205 <1 649 gene locus_tag LOCUS_07980 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762130.1:asparagine--tRNA ligase 659 901 gene locus_tag LOCUS_07990 659 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1715 894 gene locus_tag LOCUS_08000 1715 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1811 2704 gene locus_tag LOCUS_08010 1811 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence206 889 1872 gene locus_tag LOCUS_08020 gene ribD 889 1872 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66534 protein_id gnl|my_center|LOCUS_08020 2201 1857 gene locus_tag LOCUS_08030 2201 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2325 2399 gene locus_tag LOCUS_t00260 2325 2399 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 <3009 2396 gene locus_tag LOCUS_08040 <3009 2396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876363.1:tRNA (guanine-N2)-dimethyltransferase >Feature sequence207 365 727 gene locus_tag LOCUS_08050 365 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 736 1194 gene locus_tag LOCUS_08060 736 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1427 1191 gene locus_tag LOCUS_08070 1427 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1786 1487 gene locus_tag LOCUS_08080 1786 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_08080 2816 1779 gene locus_tag LOCUS_08090 2816 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence208 <2992 2029 gene locus_tag LOCUS_08100 <2992 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72A88:iron-sulfur cluster carrier protein >Feature sequence209 <1 1621 gene locus_tag LOCUS_08110 <1 1621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021285.1:DNA-directed RNA polymerase subunit B >Feature sequence210 1212 181 gene locus_tag LOCUS_08120 1212 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 1325 2257 gene locus_tag LOCUS_08130 gene trxB 1325 2257 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231058.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence211 947 2236 gene locus_tag LOCUS_08140 947 2236 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence212 1009 2541 gene locus_tag LOCUS_08150 gene rtcB 1009 2541 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X178 protein_id gnl|my_center|LOCUS_08150 2715 2542 gene locus_tag LOCUS_08160 2715 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence213 2109 43 gene locus_tag LOCUS_08170 2109 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 <2915 2166 gene locus_tag LOCUS_08180 <2915 2166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064918.1:glutamate--tRNA ligase >Feature sequence214 >Feature sequence215 1417 2457 gene locus_tag LOCUS_08190 1417 2457 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence216 1080 103 gene locus_tag LOCUS_08200 1080 103 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_08200 2881 1133 gene locus_tag LOCUS_08210 2881 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence217 1463 840 gene locus_tag LOCUS_08220 1463 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1763 1482 gene locus_tag LOCUS_08230 1763 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2157 1753 gene locus_tag LOCUS_08240 2157 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2138 2404 gene locus_tag LOCUS_08250 2138 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence218 1228 71 gene locus_tag LOCUS_08260 1228 71 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023596.1 protein_id gnl|my_center|LOCUS_08260 2126 1233 gene locus_tag LOCUS_08270 2126 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence219 >Feature sequence220 <1 946 gene locus_tag LOCUS_08280 <1 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878420.1:aspartate--tRNA(Asn) ligase 943 1470 gene locus_tag LOCUS_08290 943 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1510 2235 gene locus_tag LOCUS_08300 1510 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence221 >Feature sequence222 1241 693 gene locus_tag LOCUS_08310 gene mogA 1241 693 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_08310 2237 1272 gene locus_tag LOCUS_08320 2237 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2728 2312 gene locus_tag LOCUS_08330 2728 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence223 2753 609 gene locus_tag LOCUS_08340 2753 609 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence224 165 668 gene locus_tag LOCUS_08350 165 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1417 662 gene locus_tag LOCUS_08360 1417 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1553 2185 gene locus_tag LOCUS_08370 1553 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2361 2182 gene locus_tag LOCUS_08380 2361 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence225 186 740 gene locus_tag LOCUS_08390 186 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 750 1946 gene locus_tag LOCUS_08400 750 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence226 >Feature sequence227 2025 964 gene locus_tag LOCUS_08410 2025 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence228 2577 2104 gene locus_tag LOCUS_08420 2577 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2744 2671 gene locus_tag LOCUS_t00270 2744 2671 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence229 <1 870 gene locus_tag LOCUS_08430 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2X1:L-aspartate oxidase 1826 867 gene locus_tag LOCUS_08440 1826 867 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF76 protein_id gnl|my_center|LOCUS_08440 >Feature sequence230 139 64 gene locus_tag LOCUS_t00280 139 64 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1448 186 gene locus_tag LOCUS_08450 1448 186 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_08450 1527 2735 gene locus_tag LOCUS_08460 1527 2735 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933799.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence231 <2740 4 gene locus_tag LOCUS_08470 <2740 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022129.1:carbamoyl phosphate synthase large subunit >Feature sequence232 142 1239 gene locus_tag LOCUS_08480 gene aroA 142 1239 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBA4 protein_id gnl|my_center|LOCUS_08480 <2730 1230 gene locus_tag LOCUS_08490 <2730 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P49850:DNA mismatch repair protein MutL >Feature sequence233 <2729 1473 gene locus_tag LOCUS_08500 <2729 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870036.1:digeranylgeranylglycerophospholipid reductase >Feature sequence234 2590 1811 gene locus_tag LOCUS_08510 2590 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence235 >Feature sequence236 <1 1575 gene locus_tag LOCUS_08520 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871086.1:membrane protein 1568 1897 gene locus_tag LOCUS_08530 1568 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence237 317 2323 gene locus_tag LOCUS_08540 317 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence238 108 794 gene locus_tag LOCUS_08550 108 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2408 795 gene locus_tag LOCUS_08560 2408 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence239 2354 1584 gene locus_tag LOCUS_08570 2354 1584 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence240 2042 1425 gene locus_tag LOCUS_08580 2042 1425 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065914.1 protein_id gnl|my_center|LOCUS_08580 <2634 2079 gene locus_tag LOCUS_08590 <2634 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024047.1:V-type ATP synthase subunit B >Feature sequence241 660 1115 gene locus_tag LOCUS_08600 660 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_08600 1425 1147 gene locus_tag LOCUS_08610 1425 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1704 1477 gene locus_tag LOCUS_08620 1704 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1758 2456 gene locus_tag LOCUS_08630 1758 2456 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865188.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence242 111 1166 gene locus_tag LOCUS_08640 111 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence243 2011 1463 gene locus_tag LOCUS_08650 2011 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence244 >Feature sequence245 >Feature sequence246 688 206 gene locus_tag LOCUS_08660 688 206 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_08660 1365 688 gene locus_tag LOCUS_08670 1365 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 <2586 1378 gene locus_tag LOCUS_08680 <2586 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964024.1:flagellar motor protein MotB >Feature sequence247 >Feature sequence248 <1 902 gene locus_tag LOCUS_08690 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419731.1:MBL fold metallo-hydrolase 956 1795 gene locus_tag LOCUS_08700 956 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 1780 2565 gene locus_tag LOCUS_08710 1780 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence249 1375 299 gene locus_tag LOCUS_08720 gene nadA 1375 299 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H2F3 protein_id gnl|my_center|LOCUS_08720 1429 2055 gene locus_tag LOCUS_08730 1429 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2405 2052 gene locus_tag LOCUS_08740 gene crcB 2405 2052 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UFC8 protein_id gnl|my_center|LOCUS_08740 >Feature sequence250 403 2031 gene locus_tag LOCUS_08750 403 2031 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228252.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence251 1791 1045 gene locus_tag LOCUS_08760 1791 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2375 1791 gene locus_tag LOCUS_08770 2375 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence252 >Feature sequence253 <1 783 gene locus_tag LOCUS_08780 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003856236.1:helicase 1095 793 gene locus_tag LOCUS_08790 1095 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1676 1188 gene locus_tag LOCUS_08800 1676 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1771 2382 gene locus_tag LOCUS_08810 gene purN 1771 2382 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C8S7 protein_id gnl|my_center|LOCUS_08810 >Feature sequence254 1741 776 gene locus_tag LOCUS_08820 1741 776 CDS product dolichyl-phosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_08820 2122 1850 gene locus_tag LOCUS_08830 2122 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence255 >Feature sequence256 >Feature sequence257 310 1878 gene locus_tag LOCUS_08840 310 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence258 537 277 gene locus_tag LOCUS_08850 537 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence259 1404 922 gene locus_tag LOCUS_08860 1404 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2487 1795 gene locus_tag LOCUS_08870 2487 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence260 298 161 gene locus_tag LOCUS_08880 298 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 1693 371 gene locus_tag LOCUS_08890 1693 371 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_08890 2395 1745 gene locus_tag LOCUS_08900 2395 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence261 >Feature sequence262 >Feature sequence263 311 1399 gene locus_tag LOCUS_08910 311 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1415 2017 gene locus_tag LOCUS_08920 gene gpmA 1415 2017 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UEW3 protein_id gnl|my_center|LOCUS_08920 >Feature sequence264 >Feature sequence265 200 1756 gene locus_tag LOCUS_08930 200 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence266 778 1950 gene locus_tag LOCUS_08940 gene ftsZ 778 1950 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence267 102 335 gene locus_tag LOCUS_08950 102 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 346 2166 gene locus_tag LOCUS_08960 gene glmS 346 2166 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DG23 protein_id gnl|my_center|LOCUS_08960 >Feature sequence268 >Feature sequence269 1212 394 gene locus_tag LOCUS_08970 1212 394 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_08970 1285 1611 gene locus_tag LOCUS_08980 1285 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence270 667 1704 gene locus_tag LOCUS_08990 667 1704 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249716.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence271 <1 818 gene locus_tag LOCUS_09000 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763536.1:glutamate synthase >Feature sequence272 459 977 gene locus_tag LOCUS_09010 459 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 987 1382 gene locus_tag LOCUS_09020 987 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2006 1383 gene locus_tag LOCUS_09030 2006 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence273 597 115 gene locus_tag LOCUS_09040 597 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1802 717 gene locus_tag LOCUS_09050 1802 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence274 324 1967 gene locus_tag LOCUS_09060 324 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence275 635 1750 gene locus_tag LOCUS_09070 635 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1805 2155 gene locus_tag LOCUS_09080 1805 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence276 >Feature sequence277 >Feature sequence278 <1 1272 gene locus_tag LOCUS_09090 <1 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976894.1:Fe-S cluster assembly protein SufB >Feature sequence279 >Feature sequence280 <1 816 gene locus_tag LOCUS_09100 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258686.1:3-methylcrotonoyl-CoA carboxylase subunit alpha 828 1295 gene locus_tag LOCUS_09110 828 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2237 1329 gene locus_tag LOCUS_09120 2237 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence281 133 1917 gene locus_tag LOCUS_09130 133 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence282 <2204 474 gene locus_tag LOCUS_09140 <2204 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868797.1:MFS transporter >Feature sequence283 >Feature sequence284 >Feature sequence285 1301 381 gene locus_tag LOCUS_09150 1301 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence286 <2174 1059 gene locus_tag LOCUS_09160 <2174 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057022.1:NAD+ synthase >Feature sequence287 512 189 gene locus_tag LOCUS_09170 512 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1353 538 gene locus_tag LOCUS_09180 1353 538 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63VX9 protein_id gnl|my_center|LOCUS_09180 2096 1356 gene locus_tag LOCUS_09190 2096 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence288 >Feature sequence289 <1 1237 gene locus_tag LOCUS_09200 <1 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence290 59 1384 gene locus_tag LOCUS_09210 59 1384 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454678.1 protein_id gnl|my_center|LOCUS_09210 1394 2065 gene locus_tag LOCUS_09220 1394 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence291 1085 147 gene locus_tag LOCUS_09230 1085 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence292 1418 1927 gene locus_tag LOCUS_09240 1418 1927 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence293 682 23 gene locus_tag LOCUS_09250 682 23 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_09250 1591 692 gene locus_tag LOCUS_09260 gene etfA 1591 692 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336943.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence294 >Feature sequence295 <1 1589 gene locus_tag LOCUS_09270 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:methylmalonyl-CoA carboxyltransferase >Feature sequence296 672 1748 gene locus_tag LOCUS_09280 672 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence297 124 495 gene locus_tag LOCUS_09290 124 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 548 1192 gene locus_tag LOCUS_09300 548 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1488 1189 gene locus_tag LOCUS_09310 1488 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence298 377 304 gene locus_tag LOCUS_t00290 377 304 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 451 1803 gene locus_tag LOCUS_09320 451 1803 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence299 759 64 gene locus_tag LOCUS_09330 759 64 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762843.1 protein_id gnl|my_center|LOCUS_09330 1991 849 gene locus_tag LOCUS_09340 1991 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence300 257 922 gene locus_tag LOCUS_09350 257 922 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_09350 1791 919 gene locus_tag LOCUS_09360 1791 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence301 >Feature sequence302 876 1979 gene locus_tag LOCUS_09370 876 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence303 755 1465 gene locus_tag LOCUS_09380 755 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence304 729 304 gene locus_tag LOCUS_09390 729 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 1469 699 gene locus_tag LOCUS_09400 1469 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1573 1498 gene locus_tag LOCUS_t00300 1573 1498 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence305 51 299 gene locus_tag LOCUS_09410 51 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1921 296 gene locus_tag LOCUS_09420 1921 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence306 453 157 gene locus_tag LOCUS_09430 453 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence307 >Feature sequence308 1105 449 gene locus_tag LOCUS_09440 1105 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1851 1183 gene locus_tag LOCUS_09450 1851 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence309 <1 849 gene locus_tag LOCUS_09460 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UNN9:bifunctional protein FolD 1154 852 gene locus_tag LOCUS_09470 gene paaD 1154 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395580.1 protein_id gnl|my_center|LOCUS_09470 1573 1154 gene locus_tag LOCUS_09480 1573 1154 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406280.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence310 >Feature sequence311 >Feature sequence312 1872 352 gene locus_tag LOCUS_09490 gene cysS 1872 352 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_09490 >Feature sequence313 1283 1356 gene locus_tag LOCUS_t00310 1283 1356 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <1900 1358 gene locus_tag LOCUS_09500 <1900 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9JZ78:GTP cyclohydrolase-2 >Feature sequence314 >Feature sequence315 1511 588 gene locus_tag LOCUS_09510 gene sucD 1511 588 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JZP3 protein_id gnl|my_center|LOCUS_09510 >Feature sequence316 >Feature sequence317 622 1161 gene locus_tag LOCUS_09520 622 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence318 >Feature sequence319 7 657 gene locus_tag LOCUS_09530 gene aroA' 7 657 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67506 protein_id gnl|my_center|LOCUS_09530 666 1709 gene locus_tag LOCUS_09540 666 1709 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence320 >Feature sequence321 1823 381 gene locus_tag LOCUS_09550 1823 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence322 232 690 gene locus_tag LOCUS_09560 232 690 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095038.1 protein_id gnl|my_center|LOCUS_09560 <1835 941 gene locus_tag LOCUS_09570 <1835 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UHA8:homoserine kinase >Feature sequence323 1 927 gene locus_tag LOCUS_09580 1 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1503 874 gene locus_tag LOCUS_09590 1503 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 >Feature sequence324 >Feature sequence325 <1 559 gene locus_tag LOCUS_09600 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023864.1:geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase 1730 579 gene locus_tag LOCUS_09610 1730 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence326 >Feature sequence327 >Feature sequence328 <1 834 gene locus_tag LOCUS_09620 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114002.1:acyl-CoA thiolase >Feature sequence329 <1808 950 gene locus_tag LOCUS_09630 <1808 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3IYI5:DNA mismatch repair protein MutS >Feature sequence330 449 1108 gene locus_tag LOCUS_09640 449 1108 CDS product bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359835.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence331 100 1023 gene locus_tag LOCUS_09650 100 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878718.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence332 >Feature sequence333 >Feature sequence334 797 255 gene locus_tag LOCUS_09660 797 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence335 612 322 gene locus_tag LOCUS_09670 612 322 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_09670 1771 698 gene locus_tag LOCUS_09680 1771 698 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence336 <1765 599 gene locus_tag LOCUS_09690 <1765 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024460.1:signal recognition particle protein >Feature sequence337 1663 389 gene locus_tag LOCUS_09700 1663 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence338 466 969 gene locus_tag LOCUS_09710 466 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 <1747 966 gene locus_tag LOCUS_09720 <1747 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020721.1:bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor >Feature sequence339 >Feature sequence340 >Feature sequence341 >Feature sequence342 >Feature sequence343 1047 292 gene locus_tag LOCUS_09730 gene sufC 1047 292 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000136057.1 protein_id gnl|my_center|LOCUS_09730 1163 1612 gene locus_tag LOCUS_09740 1163 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence344 >Feature sequence345 566 111 gene locus_tag LOCUS_09750 566 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence346 1266 379 gene locus_tag LOCUS_09760 gene truA 1266 379 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y457 protein_id gnl|my_center|LOCUS_09760 >Feature sequence347 321 869 gene locus_tag LOCUS_09770 321 869 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_09770 875 1249 gene locus_tag LOCUS_09780 875 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1263 1634 gene locus_tag LOCUS_09790 1263 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence348 >Feature sequence349 352 173 gene locus_tag LOCUS_09800 352 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence350 <1 1081 gene locus_tag LOCUS_09810 <1 1081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527142.1:betaine-aldehyde dehydrogenase >Feature sequence351 <1 993 gene locus_tag LOCUS_09820 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846716.1:tyrosine--tRNA ligase >Feature sequence352 193 1521 gene locus_tag LOCUS_09830 193 1521 CDS product glutamyl-tRNA(Gln) amidotransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence353 <1 807 gene locus_tag LOCUS_09840 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879138.1:histidine--tRNA ligase >Feature sequence354 94 1005 gene locus_tag LOCUS_09850 94 1005 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence355 <1554 88 gene locus_tag LOCUS_09860 <1554 88 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875690.1:serralysin >Feature sequence356 <1 834 gene locus_tag LOCUS_09870 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868460.1:DNA repair helicase 843 1364 gene locus_tag LOCUS_09880 843 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880