>Feature sequence001 <1 979 gene locus_tag LOCUS_00010 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NG51:chromosome partition protein Smc 979 1986 gene locus_tag LOCUS_00020 979 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1979 2602 gene locus_tag LOCUS_00030 1979 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3899 2604 gene locus_tag LOCUS_00040 3899 2604 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_00040 4180 5979 gene locus_tag LOCUS_00050 4180 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5988 6278 gene locus_tag LOCUS_00060 5988 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902913.1 protein_id gnl|my_center|LOCUS_00060 6643 6275 gene locus_tag LOCUS_00070 6643 6275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7847 6648 gene locus_tag LOCUS_00080 7847 6648 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496772.1 protein_id gnl|my_center|LOCUS_00080 8406 7909 gene locus_tag LOCUS_00090 8406 7909 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_00090 9651 8482 gene locus_tag LOCUS_00100 9651 8482 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877024.1 protein_id gnl|my_center|LOCUS_00100 10842 9733 gene locus_tag LOCUS_00110 gene dph2 10842 9733 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_00110 11425 10847 gene locus_tag LOCUS_00120 11425 10847 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061024.1 protein_id gnl|my_center|LOCUS_00120 11977 11438 gene locus_tag LOCUS_00130 gene rplJ 11977 11438 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_00130 13002 12046 gene locus_tag LOCUS_00140 13002 12046 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832962.1 protein_id gnl|my_center|LOCUS_00140 14188 13004 gene locus_tag LOCUS_00150 gene aroA 14188 13004 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIU4 protein_id gnl|my_center|LOCUS_00150 15057 14233 gene locus_tag LOCUS_00160 15057 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15189 15103 gene locus_tag LOCUS_t00010 15189 15103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17928 15232 gene locus_tag LOCUS_00170 17928 15232 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815130.1 protein_id gnl|my_center|LOCUS_00170 19914 17938 gene locus_tag LOCUS_00180 gene gyrB 19914 17938 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P05652 protein_id gnl|my_center|LOCUS_00180 20111 20923 gene locus_tag LOCUS_00190 20111 20923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 21810 20920 gene locus_tag LOCUS_00200 21810 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 <23549 21813 gene locus_tag LOCUS_00210 <23549 21813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024196.1:cell surface protein >Feature sequence002 963 274 gene locus_tag LOCUS_00220 963 274 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_00220 1085 2203 gene locus_tag LOCUS_00230 1085 2203 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389065.1 protein_id gnl|my_center|LOCUS_00230 2983 4029 gene locus_tag LOCUS_00240 2983 4029 CDS product pantothenate metabolism flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876840.1 protein_id gnl|my_center|LOCUS_00240 4079 5599 gene locus_tag LOCUS_00250 4079 5599 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_00250 6451 5600 gene locus_tag LOCUS_00260 6451 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 7456 6503 gene locus_tag LOCUS_00270 7456 6503 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_00270 8268 7453 gene locus_tag LOCUS_00280 8268 7453 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421354.1 protein_id gnl|my_center|LOCUS_00280 9300 9614 gene locus_tag LOCUS_00290 9300 9614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 10007 10420 gene locus_tag LOCUS_00300 10007 10420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 12020 10467 gene locus_tag LOCUS_00310 12020 10467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 12860 12021 gene locus_tag LOCUS_00320 gene mqnD 12860 12021 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_00320 12966 13160 gene locus_tag LOCUS_00330 12966 13160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 13537 14409 gene locus_tag LOCUS_00340 13537 14409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 14482 15216 gene locus_tag LOCUS_00350 14482 15216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 15220 16008 gene locus_tag LOCUS_00360 15220 16008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 17071 16010 gene locus_tag LOCUS_00370 17071 16010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_00370 >Feature sequence003 <1 2481 gene locus_tag LOCUS_00380 <1 2481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein 2529 3005 gene locus_tag LOCUS_00390 2529 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 4083 3031 gene locus_tag LOCUS_00400 gene guaC 4083 3031 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KMW9 protein_id gnl|my_center|LOCUS_00400 4216 4139 gene locus_tag LOCUS_t00020 4216 4139 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4350 4625 gene locus_tag LOCUS_00410 4350 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 4625 4879 gene locus_tag LOCUS_00420 4625 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 4909 5826 gene locus_tag LOCUS_00430 4909 5826 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_00430 6786 5827 gene locus_tag LOCUS_00440 6786 5827 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_00440 7651 6773 gene locus_tag LOCUS_00450 7651 6773 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_00450 7744 10341 gene locus_tag LOCUS_00460 7744 10341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 10470 11336 gene locus_tag LOCUS_00470 10470 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 11311 11871 gene locus_tag LOCUS_00480 11311 11871 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870161.1 protein_id gnl|my_center|LOCUS_00480 11880 12857 gene locus_tag LOCUS_00490 11880 12857 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_00490 15429 13075 gene locus_tag LOCUS_00500 15429 13075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 15559 15633 gene locus_tag LOCUS_t00030 15559 15633 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 16273 15623 gene locus_tag LOCUS_00510 16273 15623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 16553 16320 gene locus_tag LOCUS_00520 16553 16320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 >Feature sequence004 859 167 gene locus_tag LOCUS_00530 859 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 937 1194 gene locus_tag LOCUS_00540 937 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 1250 1459 gene locus_tag LOCUS_00550 1250 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 1939 1460 gene locus_tag LOCUS_00560 1939 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 2057 2653 gene locus_tag LOCUS_00570 2057 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 2826 3707 gene locus_tag LOCUS_00580 2826 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 3829 6738 gene locus_tag LOCUS_00590 3829 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 6777 6854 gene locus_tag LOCUS_t00040 6777 6854 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7332 6856 gene locus_tag LOCUS_00600 7332 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 7483 8709 gene locus_tag LOCUS_00610 7483 8709 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903847.1 protein_id gnl|my_center|LOCUS_00610 8752 9180 gene locus_tag LOCUS_00620 8752 9180 CDS product cysteine desulfurization protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125301.1 protein_id gnl|my_center|LOCUS_00620 9190 9504 gene locus_tag LOCUS_00630 9190 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 10352 9501 gene locus_tag LOCUS_00640 gene folD 10352 9501 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_00640 10477 10401 gene locus_tag LOCUS_t00050 10477 10401 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10574 10981 gene locus_tag LOCUS_00650 10574 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 11023 12546 gene locus_tag LOCUS_00660 11023 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 14401 12470 gene locus_tag LOCUS_00670 14401 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 15578 14493 gene locus_tag LOCUS_00680 15578 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 16312 15581 gene locus_tag LOCUS_00690 16312 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 16866 16309 gene locus_tag LOCUS_00700 16866 16309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 >Feature sequence005 2154 2239 gene locus_tag LOCUS_t00060 2154 2239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2639 2241 gene locus_tag LOCUS_00710 2639 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3399 2644 gene locus_tag LOCUS_00720 3399 2644 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_00720 3503 4507 gene locus_tag LOCUS_00730 gene lipA 3503 4507 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLQ4 protein_id gnl|my_center|LOCUS_00730 4533 5771 gene locus_tag LOCUS_00740 gene bkdA1 4533 5771 CDS product 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523292.1 protein_id gnl|my_center|LOCUS_00740 5773 6783 gene locus_tag LOCUS_00750 5773 6783 CDS product 2-oxoisovalerate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067042.1 protein_id gnl|my_center|LOCUS_00750 6786 8048 gene locus_tag LOCUS_00760 6786 8048 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UDC8 protein_id gnl|my_center|LOCUS_00760 8057 9493 gene locus_tag LOCUS_00770 8057 9493 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TGW3 protein_id gnl|my_center|LOCUS_00770 9502 10176 gene locus_tag LOCUS_00780 9502 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 10173 11363 gene locus_tag LOCUS_00790 gene cefD 10173 11363 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_00790 11406 11984 gene locus_tag LOCUS_00800 gene ubiX 11406 11984 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP38 protein_id gnl|my_center|LOCUS_00800 12011 13669 gene locus_tag LOCUS_00810 12011 13669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 14115 13651 gene locus_tag LOCUS_00820 14115 13651 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_00820 15879 14140 gene locus_tag LOCUS_00830 gene argS 15879 14140 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DFK0 protein_id gnl|my_center|LOCUS_00830 >Feature sequence006 143 931 gene locus_tag LOCUS_00840 143 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1994 933 gene locus_tag LOCUS_00850 1994 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_00850 2830 4338 gene locus_tag LOCUS_00860 2830 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4869 4324 gene locus_tag LOCUS_00870 4869 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289427.1 protein_id gnl|my_center|LOCUS_00870 5080 4862 gene locus_tag LOCUS_00880 5080 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 5443 6681 gene locus_tag LOCUS_00890 5443 6681 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_00890 6728 7771 gene locus_tag LOCUS_00900 6728 7771 CDS product glutamate formiminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765436.1 protein_id gnl|my_center|LOCUS_00900 7755 8399 gene locus_tag LOCUS_00910 7755 8399 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583068.1 protein_id gnl|my_center|LOCUS_00910 8404 10410 gene locus_tag LOCUS_00920 gene hutU 8404 10410 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_00920 10447 11982 gene locus_tag LOCUS_00930 gene hutH 10447 11982 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZ06 protein_id gnl|my_center|LOCUS_00930 11983 12714 gene locus_tag LOCUS_00940 11983 12714 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403895.1 protein_id gnl|my_center|LOCUS_00940 12802 12727 gene locus_tag LOCUS_t00070 12802 12727 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14510 13263 gene locus_tag LOCUS_00950 gene hutI 14510 13263 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CL31 protein_id gnl|my_center|LOCUS_00950 14606 15607 gene locus_tag LOCUS_00960 14606 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence007 4508 3954 gene locus_tag LOCUS_00970 4508 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 8895 4510 gene locus_tag LOCUS_00980 8895 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 11362 8978 gene locus_tag LOCUS_00990 11362 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 11705 11466 gene locus_tag LOCUS_01000 11705 11466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 12357 11770 gene locus_tag LOCUS_01010 12357 11770 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870497.1 protein_id gnl|my_center|LOCUS_01010 12702 13817 gene locus_tag LOCUS_01020 gene ftsZ 12702 13817 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence008 1202 225 gene locus_tag LOCUS_01030 gene putA 1202 225 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_01030 2007 1246 gene locus_tag LOCUS_01040 2007 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 2248 3165 gene locus_tag LOCUS_01050 2248 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 3332 3150 gene locus_tag LOCUS_01060 3332 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3694 3329 gene locus_tag LOCUS_01070 3694 3329 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875906.1 protein_id gnl|my_center|LOCUS_01070 3925 3707 gene locus_tag LOCUS_01080 3925 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 4481 3927 gene locus_tag LOCUS_01090 4481 3927 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_01090 4480 4623 gene locus_tag LOCUS_01100 4480 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 4792 10326 gene locus_tag LOCUS_01110 4792 10326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 11061 10327 gene locus_tag LOCUS_01120 11061 10327 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_01120 11962 11054 gene locus_tag LOCUS_01130 gene ilvE2 11962 11054 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_01130 12915 11971 gene locus_tag LOCUS_01140 gene purC 12915 11971 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFN3 protein_id gnl|my_center|LOCUS_01140 13906 12935 gene locus_tag LOCUS_01150 13906 12935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence009 1181 327 gene locus_tag LOCUS_01160 1181 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 1633 1184 gene locus_tag LOCUS_01170 1633 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2445 1630 gene locus_tag LOCUS_01180 2445 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 2577 2900 gene locus_tag LOCUS_01190 2577 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 2938 3843 gene locus_tag LOCUS_01200 2938 3843 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_01200 3878 4189 gene locus_tag LOCUS_01210 3878 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 5561 4182 gene locus_tag LOCUS_01220 5561 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 5736 5811 gene locus_tag LOCUS_t00080 5736 5811 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5859 6446 gene locus_tag LOCUS_01230 5859 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6456 10172 gene locus_tag LOCUS_01240 6456 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 10169 13261 gene locus_tag LOCUS_01250 10169 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence010 2884 1163 gene locus_tag LOCUS_01260 2884 1163 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061155.1 protein_id gnl|my_center|LOCUS_01260 3076 8367 gene locus_tag LOCUS_01270 3076 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 9363 8359 gene locus_tag LOCUS_01280 9363 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 9379 9978 gene locus_tag LOCUS_01290 9379 9978 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259619.1 protein_id gnl|my_center|LOCUS_01290 9983 10621 gene locus_tag LOCUS_01300 9983 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 11884 12102 gene locus_tag LOCUS_01310 11884 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 12156 12386 gene locus_tag LOCUS_01320 12156 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 13732 12383 gene locus_tag LOCUS_01330 13732 12383 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_01330 >Feature sequence011 2156 27 gene locus_tag LOCUS_01340 2156 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 2249 3247 gene locus_tag LOCUS_01350 gene rimK 2249 3247 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFE0 protein_id gnl|my_center|LOCUS_01350 3384 4502 gene locus_tag LOCUS_01360 gene xerC 3384 4502 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WF35 protein_id gnl|my_center|LOCUS_01360 4697 4503 gene locus_tag LOCUS_01370 4697 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4777 5616 gene locus_tag LOCUS_01380 4777 5616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 5808 5617 gene locus_tag LOCUS_01390 5808 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 6239 5877 gene locus_tag LOCUS_01400 6239 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 6424 8043 gene locus_tag LOCUS_01410 6424 8043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8068 8586 gene locus_tag LOCUS_01420 8068 8586 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_01420 9111 8590 gene locus_tag LOCUS_01430 9111 8590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 9413 9114 gene locus_tag LOCUS_01440 9413 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 9538 10248 gene locus_tag LOCUS_01450 9538 10248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 10255 12573 gene locus_tag LOCUS_01460 10255 12573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 12570 13616 gene locus_tag LOCUS_01470 12570 13616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 >Feature sequence012 939 691 gene locus_tag LOCUS_01480 939 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 1054 1491 gene locus_tag LOCUS_01490 1054 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 1529 1606 gene locus_tag LOCUS_t00090 1529 1606 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1699 1890 gene locus_tag LOCUS_01500 1699 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 2695 1925 gene locus_tag LOCUS_01510 2695 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3672 2734 gene locus_tag LOCUS_01520 3672 2734 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_01520 3859 5019 gene locus_tag LOCUS_01530 gene pntaA 3859 5019 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813035.1 protein_id gnl|my_center|LOCUS_01530 5061 5336 gene locus_tag LOCUS_01540 5061 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404931.1 protein_id gnl|my_center|LOCUS_01540 5337 6764 gene locus_tag LOCUS_01550 gene pntB 5337 6764 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F962 protein_id gnl|my_center|LOCUS_01550 6784 7893 gene locus_tag LOCUS_01560 6784 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 8242 8012 gene locus_tag LOCUS_01570 8242 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 8124 9020 gene locus_tag LOCUS_01580 8124 9020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9046 11010 gene locus_tag LOCUS_01590 9046 11010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 12003 11011 gene locus_tag LOCUS_01600 12003 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 12148 13152 gene locus_tag LOCUS_01610 12148 13152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 >Feature sequence013 373 1170 gene locus_tag LOCUS_01620 gene aroA' 373 1170 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EV8 protein_id gnl|my_center|LOCUS_01620 1175 2122 gene locus_tag LOCUS_01630 1175 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 2119 2985 gene locus_tag LOCUS_01640 2119 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2976 4079 gene locus_tag LOCUS_01650 2976 4079 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_01650 5015 4080 gene locus_tag LOCUS_01660 5015 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6352 5027 gene locus_tag LOCUS_01670 6352 5027 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_01670 7444 6386 gene locus_tag LOCUS_01680 7444 6386 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_01680 9050 7464 gene locus_tag LOCUS_01690 9050 7464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 10160 9231 gene locus_tag LOCUS_01700 10160 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 11145 10162 gene locus_tag LOCUS_01710 11145 10162 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087966.1 protein_id gnl|my_center|LOCUS_01710 <13243 11145 gene locus_tag LOCUS_01720 <13243 11145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393458.1:xanthine dehydrogenase molybdenum-binding subunit XdhA >Feature sequence014 741 3050 gene locus_tag LOCUS_01730 gene maeB 741 3050 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_01730 4676 3075 gene locus_tag LOCUS_01740 gene pckA2 4676 3075 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_01740 4824 8552 gene locus_tag LOCUS_01750 4824 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 8656 9606 gene locus_tag LOCUS_01760 8656 9606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9647 10948 gene locus_tag LOCUS_01770 9647 10948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 11055 11516 gene locus_tag LOCUS_01780 11055 11516 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_01780 11526 12227 gene locus_tag LOCUS_01790 11526 12227 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_01790 12227 12607 gene locus_tag LOCUS_01800 12227 12607 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869686.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence015 5 5068 gene locus_tag LOCUS_01810 5 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 5139 5783 gene locus_tag LOCUS_01820 5139 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 6917 5784 gene locus_tag LOCUS_01830 6917 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_01830 7031 7543 gene locus_tag LOCUS_01840 7031 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 8713 7544 gene locus_tag LOCUS_01850 8713 7544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 9923 8757 gene locus_tag LOCUS_01860 9923 8757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 9995 10750 gene locus_tag LOCUS_01870 9995 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 12840 10747 gene locus_tag LOCUS_01880 12840 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence016 1020 568 gene locus_tag LOCUS_01890 1020 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 1184 2401 gene locus_tag LOCUS_01900 1184 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 2449 3621 gene locus_tag LOCUS_01910 gene gcdH 2449 3621 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_01910 3706 4461 gene locus_tag LOCUS_01920 gene etfB 3706 4461 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_01920 4471 5391 gene locus_tag LOCUS_01930 4471 5391 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267475.1 protein_id gnl|my_center|LOCUS_01930 6879 5392 gene locus_tag LOCUS_01940 6879 5392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 8428 6905 gene locus_tag LOCUS_01950 gene purF 8428 6905 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVV6 protein_id gnl|my_center|LOCUS_01950 8660 8475 gene locus_tag LOCUS_01960 8660 8475 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_01960 9081 8725 gene locus_tag LOCUS_01970 9081 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 9577 9071 gene locus_tag LOCUS_01980 9577 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 9749 10030 gene locus_tag LOCUS_01990 9749 10030 CDS product 50S ribosomal protein L44 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869747.1 protein_id gnl|my_center|LOCUS_01990 10228 11010 gene locus_tag LOCUS_02000 10228 11010 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061020.1 protein_id gnl|my_center|LOCUS_02000 11287 12051 gene locus_tag LOCUS_02010 11287 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence017 <1 2275 gene locus_tag LOCUS_02020 <1 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878013.1:iron-sulfur-binding protein 2501 2265 gene locus_tag LOCUS_02030 2501 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 2614 2955 gene locus_tag LOCUS_02040 2614 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2964 3257 gene locus_tag LOCUS_02050 2964 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3266 3763 gene locus_tag LOCUS_02060 3266 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5566 3764 gene locus_tag LOCUS_02070 5566 3764 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_02070 6436 5783 gene locus_tag LOCUS_02080 6436 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769002.1 protein_id gnl|my_center|LOCUS_02080 7324 6458 gene locus_tag LOCUS_02090 7324 6458 CDS product LAO/AO transport system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730150.1 protein_id gnl|my_center|LOCUS_02090 7746 7309 gene locus_tag LOCUS_02100 7746 7309 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_02100 7796 9412 gene locus_tag LOCUS_02110 7796 9412 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_02110 9422 9622 gene locus_tag LOCUS_02120 9422 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 9627 10034 gene locus_tag LOCUS_02130 9627 10034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 10076 10306 gene locus_tag LOCUS_02140 10076 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 10344 11567 gene locus_tag LOCUS_02150 10344 11567 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087545.1 protein_id gnl|my_center|LOCUS_02150 12226 11564 gene locus_tag LOCUS_02160 12226 11564 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903842.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence018 1325 456 gene locus_tag LOCUS_02170 1325 456 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112544.1 protein_id gnl|my_center|LOCUS_02170 1452 7169 gene locus_tag LOCUS_02180 1452 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 7200 7670 gene locus_tag LOCUS_02190 7200 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8003 7671 gene locus_tag LOCUS_02200 8003 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8090 9079 gene locus_tag LOCUS_02210 8090 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9531 9076 gene locus_tag LOCUS_02220 9531 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 9683 10402 gene locus_tag LOCUS_02230 9683 10402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 10451 11596 gene locus_tag LOCUS_02240 gene dnaJ 10451 11596 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H58 protein_id gnl|my_center|LOCUS_02240 >Feature sequence019 3247 1538 gene locus_tag LOCUS_02250 3247 1538 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_02250 4029 3295 gene locus_tag LOCUS_02260 4029 3295 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876654.1 protein_id gnl|my_center|LOCUS_02260 6758 4026 gene locus_tag LOCUS_02270 6758 4026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 6976 7179 gene locus_tag LOCUS_02280 6976 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 8941 7187 gene locus_tag LOCUS_02290 8941 7187 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_02290 10488 8950 gene locus_tag LOCUS_02300 10488 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 >Feature sequence020 <1 952 gene locus_tag LOCUS_02310 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434478.1:ABC transporter ATP-binding protein 2321 993 gene locus_tag LOCUS_02320 2321 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 2936 2427 gene locus_tag LOCUS_02330 gene dfrA 2936 2427 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJC6 protein_id gnl|my_center|LOCUS_02330 3740 2946 gene locus_tag LOCUS_02340 gene thyA 3740 2946 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6F1 protein_id gnl|my_center|LOCUS_02340 3902 4981 gene locus_tag LOCUS_02350 3902 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6043 4982 gene locus_tag LOCUS_02360 6043 4982 CDS product saccharopine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_02360 6142 7521 gene locus_tag LOCUS_02370 6142 7521 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_02370 7751 7518 gene locus_tag LOCUS_02380 7751 7518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8525 8112 gene locus_tag LOCUS_02390 8525 8112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8689 9315 gene locus_tag LOCUS_02400 gene psmB 8689 9315 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence021 2856 1915 gene locus_tag LOCUS_02410 gene ddaH 2856 1915 CDS product N(G),N(G)-dimethylarginine dimethylaminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X7M4 protein_id gnl|my_center|LOCUS_02410 2740 3507 gene locus_tag LOCUS_02420 2740 3507 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227246.1 protein_id gnl|my_center|LOCUS_02420 4337 3513 gene locus_tag LOCUS_02430 4337 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 4440 5471 gene locus_tag LOCUS_02440 4440 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393776.1 protein_id gnl|my_center|LOCUS_02440 5476 6084 gene locus_tag LOCUS_02450 5476 6084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 7158 6085 gene locus_tag LOCUS_02460 7158 6085 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 protein_id gnl|my_center|LOCUS_02460 8437 7217 gene locus_tag LOCUS_02470 8437 7217 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871132.1 protein_id gnl|my_center|LOCUS_02470 8522 9274 gene locus_tag LOCUS_02480 8522 9274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 10290 9343 gene locus_tag LOCUS_02490 10290 9343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 >Feature sequence022 1230 274 gene locus_tag LOCUS_02500 1230 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3047 1230 gene locus_tag LOCUS_02510 3047 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 3197 4444 gene locus_tag LOCUS_02520 3197 4444 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_02520 4467 6803 gene locus_tag LOCUS_02530 4467 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6887 7582 gene locus_tag LOCUS_02540 6887 7582 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879481.1 protein_id gnl|my_center|LOCUS_02540 7668 8288 gene locus_tag LOCUS_02550 7668 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8362 8976 gene locus_tag LOCUS_02560 8362 8976 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_02560 9039 9998 gene locus_tag LOCUS_02570 9039 9998 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM54 protein_id gnl|my_center|LOCUS_02570 9970 10398 gene locus_tag LOCUS_02580 9970 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923332.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence023 890 33 gene locus_tag LOCUS_02590 890 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 999 2522 gene locus_tag LOCUS_02600 999 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 2515 3171 gene locus_tag LOCUS_02610 2515 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3171 4736 gene locus_tag LOCUS_02620 3171 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4776 5762 gene locus_tag LOCUS_02630 4776 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6755 5763 gene locus_tag LOCUS_02640 6755 5763 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_02640 7085 6807 gene locus_tag LOCUS_02650 7085 6807 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931551.1 protein_id gnl|my_center|LOCUS_02650 7585 7148 gene locus_tag LOCUS_02660 7585 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 7724 8635 gene locus_tag LOCUS_02670 7724 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 8640 9392 gene locus_tag LOCUS_02680 8640 9392 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877204.1 protein_id gnl|my_center|LOCUS_02680 9368 9736 gene locus_tag LOCUS_02690 9368 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 9762 10157 gene locus_tag LOCUS_02700 9762 10157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence024 41 244 gene locus_tag LOCUS_02710 41 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 252 2753 gene locus_tag LOCUS_02720 252 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 4127 2754 gene locus_tag LOCUS_02730 4127 2754 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL33 protein_id gnl|my_center|LOCUS_02730 4242 4319 gene locus_tag LOCUS_t00100 4242 4319 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4450 5460 gene locus_tag LOCUS_02740 4450 5460 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_02740 6750 5449 gene locus_tag LOCUS_02750 6750 5449 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_02750 8504 6798 gene locus_tag LOCUS_02760 8504 6798 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_02760 8783 8514 gene locus_tag LOCUS_02770 8783 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9389 8820 gene locus_tag LOCUS_02780 9389 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 <10256 9423 gene locus_tag LOCUS_02790 <10256 9423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903767.1:DEAD/DEAH box helicase >Feature sequence025 511 3210 gene locus_tag LOCUS_02800 511 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4629 3211 gene locus_tag LOCUS_02810 gene cysS 4629 3211 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747A2 protein_id gnl|my_center|LOCUS_02810 5318 4629 gene locus_tag LOCUS_02820 5318 4629 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893951.1 protein_id gnl|my_center|LOCUS_02820 5720 5319 gene locus_tag LOCUS_02830 5720 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7770 5740 gene locus_tag LOCUS_02840 7770 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_02840 7932 8852 gene locus_tag LOCUS_02850 7932 8852 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_02850 8940 9671 gene locus_tag LOCUS_02860 8940 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence026 405 1004 gene locus_tag LOCUS_02870 405 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1035 2912 gene locus_tag LOCUS_02880 gene dnaK 1035 2912 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_02880 4476 2914 gene locus_tag LOCUS_02890 gene pepA 4476 2914 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MT4 protein_id gnl|my_center|LOCUS_02890 5873 4533 gene locus_tag LOCUS_02900 5873 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 6756 5899 gene locus_tag LOCUS_02910 6756 5899 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771798.1 protein_id gnl|my_center|LOCUS_02910 6957 7370 gene locus_tag LOCUS_02920 6957 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence027 <1 1191 gene locus_tag LOCUS_02930 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9CKN2:sulfite reductase [NADPH] flavoprotein alpha-component 1242 2585 gene locus_tag LOCUS_02940 1242 2585 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173193.1 protein_id gnl|my_center|LOCUS_02940 2590 3552 gene locus_tag LOCUS_02950 2590 3552 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_02950 5241 3553 gene locus_tag LOCUS_02960 5241 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 6271 5324 gene locus_tag LOCUS_02970 6271 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 6806 6357 gene locus_tag LOCUS_02980 6806 6357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 6920 7720 gene locus_tag LOCUS_02990 6920 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7720 8247 gene locus_tag LOCUS_03000 7720 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 8252 9142 gene locus_tag LOCUS_03010 8252 9142 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024147.1 protein_id gnl|my_center|LOCUS_03010 9291 9124 gene locus_tag LOCUS_03020 9291 9124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 9450 9374 gene locus_tag LOCUS_t00110 9450 9374 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence028 323 2065 gene locus_tag LOCUS_03030 323 2065 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024046.1 protein_id gnl|my_center|LOCUS_03030 2079 3464 gene locus_tag LOCUS_03040 2079 3464 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024047.1 protein_id gnl|my_center|LOCUS_03040 3497 4114 gene locus_tag LOCUS_03050 3497 4114 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065914.1 protein_id gnl|my_center|LOCUS_03050 4192 6606 gene locus_tag LOCUS_03060 4192 6606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6606 7556 gene locus_tag LOCUS_03070 6606 7556 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902504.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence029 144 731 gene locus_tag LOCUS_03080 gene folE 144 731 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_03080 736 1365 gene locus_tag LOCUS_03090 gene queE 736 1365 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZC3 protein_id gnl|my_center|LOCUS_03090 1362 2144 gene locus_tag LOCUS_03100 gene queC 1362 2144 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6W2G5 protein_id gnl|my_center|LOCUS_03100 2141 2566 gene locus_tag LOCUS_03110 gene msrB 2141 2566 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65450 protein_id gnl|my_center|LOCUS_03110 2556 3005 gene locus_tag LOCUS_03120 2556 3005 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040017.1 protein_id gnl|my_center|LOCUS_03120 3792 3040 gene locus_tag LOCUS_03130 3792 3040 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496840.1 protein_id gnl|my_center|LOCUS_03130 4020 3829 gene locus_tag LOCUS_03140 4020 3829 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876438.1 protein_id gnl|my_center|LOCUS_03140 4286 4023 gene locus_tag LOCUS_03150 4286 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4926 4456 gene locus_tag LOCUS_03160 4926 4456 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877224.1 protein_id gnl|my_center|LOCUS_03160 5061 5858 gene locus_tag LOCUS_03170 5061 5858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6320 5859 gene locus_tag LOCUS_03180 6320 5859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 7045 6497 gene locus_tag LOCUS_03190 7045 6497 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_03190 7138 8898 gene locus_tag LOCUS_03200 7138 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 <9539 8886 gene locus_tag LOCUS_03210 <9539 8886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:formate dehydrogenase >Feature sequence030 180 2660 gene locus_tag LOCUS_03220 180 2660 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_03220 3669 2665 gene locus_tag LOCUS_03230 gene serA 3669 2665 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253655.1 protein_id gnl|my_center|LOCUS_03230 3737 4330 gene locus_tag LOCUS_03240 gene sodA 3737 4330 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_03240 4391 5467 gene locus_tag LOCUS_03250 4391 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6229 5459 gene locus_tag LOCUS_03260 6229 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 6761 6375 gene locus_tag LOCUS_03270 6761 6375 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143495.1 protein_id gnl|my_center|LOCUS_03270 6946 7686 gene locus_tag LOCUS_03280 gene fdhD 6946 7686 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZBW0 protein_id gnl|my_center|LOCUS_03280 >Feature sequence031 3938 3045 gene locus_tag LOCUS_03290 3938 3045 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_03290 3996 4709 gene locus_tag LOCUS_03300 3996 4709 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903567.1 protein_id gnl|my_center|LOCUS_03300 4752 5210 gene locus_tag LOCUS_03310 4752 5210 CDS product FAD synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251224.1 protein_id gnl|my_center|LOCUS_03310 5213 5818 gene locus_tag LOCUS_03320 5213 5818 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366888.1 protein_id gnl|my_center|LOCUS_03320 5815 6210 gene locus_tag LOCUS_03330 5815 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 7071 6211 gene locus_tag LOCUS_03340 7071 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388089.1 protein_id gnl|my_center|LOCUS_03340 <9187 7124 gene locus_tag LOCUS_03350 <9187 7124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67899:phosphoenolpyruvate synthase >Feature sequence032 <1 1005 gene locus_tag LOCUS_03360 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F9L0:fumarate hydratase class II 1274 1080 gene locus_tag LOCUS_03370 1274 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 1441 1271 gene locus_tag LOCUS_03380 1441 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1859 1614 gene locus_tag LOCUS_03390 1859 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3123 1975 gene locus_tag LOCUS_03400 3123 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 4519 3110 gene locus_tag LOCUS_03410 4519 3110 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_03410 5545 4664 gene locus_tag LOCUS_03420 5545 4664 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932511.1 protein_id gnl|my_center|LOCUS_03420 5650 7200 gene locus_tag LOCUS_03430 5650 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7409 7197 gene locus_tag LOCUS_03440 7409 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 7624 8301 gene locus_tag LOCUS_03450 gene ppe 7624 8301 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92WX4 protein_id gnl|my_center|LOCUS_03450 8350 8673 gene locus_tag LOCUS_03460 8350 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 8678 9007 gene locus_tag LOCUS_03470 gene ycf64 8678 9007 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 protein_id gnl|my_center|LOCUS_03470 >Feature sequence033 465 390 gene locus_tag LOCUS_t00120 465 390 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 552 6638 gene locus_tag LOCUS_03480 552 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6670 7518 gene locus_tag LOCUS_03490 gene hbd 6670 7518 CDS product putative 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RVG1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence034 1039 158 gene locus_tag LOCUS_03500 1039 158 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_03500 1562 1044 gene locus_tag LOCUS_03510 1562 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3304 1607 gene locus_tag LOCUS_03520 3304 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4902 3301 gene locus_tag LOCUS_03530 4902 3301 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021519.1 protein_id gnl|my_center|LOCUS_03530 7214 4899 gene locus_tag LOCUS_03540 gene ndhF1 7214 4899 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_03540 7526 7224 gene locus_tag LOCUS_03550 7526 7224 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021517.1 protein_id gnl|my_center|LOCUS_03550 7786 7523 gene locus_tag LOCUS_03560 7786 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 8050 7787 gene locus_tag LOCUS_03570 8050 7787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence035 525 1583 gene locus_tag LOCUS_03580 525 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 2863 1580 gene locus_tag LOCUS_03590 gene ahcY 2863 1580 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G6 protein_id gnl|my_center|LOCUS_03590 >Feature sequence036 2118 808 gene locus_tag LOCUS_03600 2118 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867967.1 protein_id gnl|my_center|LOCUS_03600 2369 2653 gene locus_tag LOCUS_03610 2369 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2664 3272 gene locus_tag LOCUS_03620 2664 3272 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_03620 3377 5584 gene locus_tag LOCUS_03630 3377 5584 CDS product translation elongation factor aEF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867400.1 protein_id gnl|my_center|LOCUS_03630 7273 5585 gene locus_tag LOCUS_03640 7273 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 8162 7344 gene locus_tag LOCUS_03650 8162 7344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_03650 >Feature sequence037 <1 530 gene locus_tag LOCUS_03660 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065995.1:UDP-glucose 4-epimerase 581 1330 gene locus_tag LOCUS_03670 581 1330 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_03670 1789 1337 gene locus_tag LOCUS_03680 1789 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2112 2378 gene locus_tag LOCUS_03690 2112 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3777 2380 gene locus_tag LOCUS_03700 3777 2380 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_03700 4048 3791 gene locus_tag LOCUS_03710 4048 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4157 6754 gene locus_tag LOCUS_03720 4157 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7345 6755 gene locus_tag LOCUS_03730 7345 6755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence038 398 1645 gene locus_tag LOCUS_03740 gene aspAT 398 1645 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J243 protein_id gnl|my_center|LOCUS_03740 2263 1649 gene locus_tag LOCUS_03750 2263 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2433 2990 gene locus_tag LOCUS_03760 2433 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3458 3114 gene locus_tag LOCUS_03770 3458 3114 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_03770 4122 3466 gene locus_tag LOCUS_03780 4122 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392965.1 protein_id gnl|my_center|LOCUS_03780 4732 4181 gene locus_tag LOCUS_03790 4732 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 6878 4770 gene locus_tag LOCUS_03800 6878 4770 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146615.1 protein_id gnl|my_center|LOCUS_03800 <8299 6910 gene locus_tag LOCUS_03810 <8299 6910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020726.1:ATPase AAA >Feature sequence039 3048 1831 gene locus_tag LOCUS_03820 3048 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 3218 3134 gene locus_tag LOCUS_t00130 3218 3134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3379 3295 gene locus_tag LOCUS_t00140 3379 3295 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3481 4488 gene locus_tag LOCUS_03830 gene gpsA 3481 4488 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RF18 protein_id gnl|my_center|LOCUS_03830 4535 4765 gene locus_tag LOCUS_03840 4535 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 5646 4762 gene locus_tag LOCUS_03850 5646 4762 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268390.1 protein_id gnl|my_center|LOCUS_03850 5718 7751 gene locus_tag LOCUS_03860 5718 7751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence040 1052 1630 gene locus_tag LOCUS_03870 1052 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 1681 1757 gene locus_tag LOCUS_t00150 1681 1757 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1930 1766 gene locus_tag LOCUS_03880 1930 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3041 1965 gene locus_tag LOCUS_03890 3041 1965 CDS product transcription initiation factor IIB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902188.1 protein_id gnl|my_center|LOCUS_03890 3186 4274 gene locus_tag LOCUS_03900 gene gcvT 3186 4274 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54378 protein_id gnl|my_center|LOCUS_03900 4343 6331 gene locus_tag LOCUS_03910 4343 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 7170 6325 gene locus_tag LOCUS_03920 7170 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence041 1546 782 gene locus_tag LOCUS_03930 1546 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2740 1604 gene locus_tag LOCUS_03940 2740 1604 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_03940 3028 3537 gene locus_tag LOCUS_03950 3028 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3534 4148 gene locus_tag LOCUS_03960 3534 4148 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_03960 6221 4149 gene locus_tag LOCUS_03970 6221 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7320 6259 gene locus_tag LOCUS_03980 7320 6259 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_03980 7817 7320 gene locus_tag LOCUS_03990 gene grpE 7817 7320 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y681 protein_id gnl|my_center|LOCUS_03990 >Feature sequence042 1703 501 gene locus_tag LOCUS_04000 1703 501 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_04000 1839 2309 gene locus_tag LOCUS_04010 1839 2309 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887249.1 protein_id gnl|my_center|LOCUS_04010 3367 2306 gene locus_tag LOCUS_04020 gene thrC2 3367 2306 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66740 protein_id gnl|my_center|LOCUS_04020 4066 3386 gene locus_tag LOCUS_04030 4066 3386 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222352.1 protein_id gnl|my_center|LOCUS_04030 5668 4220 gene locus_tag LOCUS_04040 5668 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5778 7151 gene locus_tag LOCUS_04050 5778 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7161 7946 gene locus_tag LOCUS_04060 7161 7946 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X264 protein_id gnl|my_center|LOCUS_04060 >Feature sequence043 <1 1289 gene locus_tag LOCUS_04070 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250144.1:CTP synthetase 2434 1286 gene locus_tag LOCUS_04080 2434 1286 CDS product ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_04080 2500 3396 gene locus_tag LOCUS_04090 gene arcC 2500 3396 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P13982 protein_id gnl|my_center|LOCUS_04090 3472 5424 gene locus_tag LOCUS_04100 gene thrS 3472 5424 CDS product threonine--tRNA ligase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18255 protein_id gnl|my_center|LOCUS_04100 5434 6252 gene locus_tag LOCUS_04110 5434 6252 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62IG1 protein_id gnl|my_center|LOCUS_04110 7823 6249 gene locus_tag LOCUS_04120 7823 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 >Feature sequence044 1851 127 gene locus_tag LOCUS_04130 1851 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2162 2247 gene locus_tag LOCUS_t00160 2162 2247 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4089 2248 gene locus_tag LOCUS_04140 4089 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 5282 4140 gene locus_tag LOCUS_04150 5282 4140 CDS product Fe-S protein, radical SAM family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146822.1 protein_id gnl|my_center|LOCUS_04150 5860 5279 gene locus_tag LOCUS_04160 5860 5279 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249171.1 protein_id gnl|my_center|LOCUS_04160 5780 7054 gene locus_tag LOCUS_04170 gene serC 5780 7054 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HZ66 protein_id gnl|my_center|LOCUS_04170 7063 7764 gene locus_tag LOCUS_04180 gene deoC 7063 7764 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667269.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence045 2187 577 gene locus_tag LOCUS_04190 2187 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3125 2187 gene locus_tag LOCUS_04200 3125 2187 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974985.1 protein_id gnl|my_center|LOCUS_04200 4138 3122 gene locus_tag LOCUS_04210 4138 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 5129 4131 gene locus_tag LOCUS_04220 5129 4131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974987.1 protein_id gnl|my_center|LOCUS_04220 7361 5217 gene locus_tag LOCUS_04230 7361 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 >Feature sequence046 135 425 gene locus_tag LOCUS_04240 135 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 439 1164 gene locus_tag LOCUS_04250 439 1164 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903237.1 protein_id gnl|my_center|LOCUS_04250 1166 1666 gene locus_tag LOCUS_04260 1166 1666 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_04260 1677 2201 gene locus_tag LOCUS_04270 1677 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2211 2987 gene locus_tag LOCUS_04280 2211 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2988 3188 gene locus_tag LOCUS_04290 2988 3188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3194 3493 gene locus_tag LOCUS_04300 3194 3493 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_04300 3494 3751 gene locus_tag LOCUS_04310 3494 3751 CDS product ribonuclease P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879410.1 protein_id gnl|my_center|LOCUS_04310 3753 4085 gene locus_tag LOCUS_04320 3753 4085 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869965.1 protein_id gnl|my_center|LOCUS_04320 4082 4480 gene locus_tag LOCUS_04330 4082 4480 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_04330 4491 4928 gene locus_tag LOCUS_04340 4491 4928 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903245.1 protein_id gnl|my_center|LOCUS_04340 4921 5616 gene locus_tag LOCUS_04350 4921 5616 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875657.1 protein_id gnl|my_center|LOCUS_04350 5613 6140 gene locus_tag LOCUS_04360 5613 6140 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869969.1 protein_id gnl|my_center|LOCUS_04360 6146 6298 gene locus_tag LOCUS_04370 6146 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6309 6698 gene locus_tag LOCUS_04380 6309 6698 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869971.1 protein_id gnl|my_center|LOCUS_04380 6712 7263 gene locus_tag LOCUS_04390 6712 7263 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869972.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence047 <1 1525 gene locus_tag LOCUS_04400 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8F3P1:vitamin B12-dependent ribonucleotide reductase 2467 1535 gene locus_tag LOCUS_04410 gene tfb 2467 1535 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_04410 2647 4644 gene locus_tag LOCUS_04420 2647 4644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4727 6799 gene locus_tag LOCUS_04430 4727 6799 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_04430 >Feature sequence048 2228 1653 gene locus_tag LOCUS_04440 2228 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2514 2439 gene locus_tag LOCUS_t00170 2514 2439 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2580 3572 gene locus_tag LOCUS_04450 2580 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3975 3577 gene locus_tag LOCUS_04460 3975 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706415.1 protein_id gnl|my_center|LOCUS_04460 4064 5302 gene locus_tag LOCUS_04470 gene cca 4064 5302 CDS product CCA-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88W02 protein_id gnl|my_center|LOCUS_04470 5802 5299 gene locus_tag LOCUS_04480 5802 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5916 7094 gene locus_tag LOCUS_04490 5916 7094 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence049 <1 928 gene locus_tag LOCUS_04500 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9AAR4:D-mannonate dehydratase CC0532 1145 3436 gene locus_tag LOCUS_04510 1145 3436 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527977.1 protein_id gnl|my_center|LOCUS_04510 3561 5159 gene locus_tag LOCUS_04520 3561 5159 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088817.1 protein_id gnl|my_center|LOCUS_04520 5156 5551 gene locus_tag LOCUS_04530 5156 5551 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527982.1 protein_id gnl|my_center|LOCUS_04530 5548 6381 gene locus_tag LOCUS_04540 5548 6381 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence050 13 86 gene locus_tag LOCUS_t00180 13 86 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1368 85 gene locus_tag LOCUS_04550 1368 85 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876673.1 protein_id gnl|my_center|LOCUS_04550 1457 2710 gene locus_tag LOCUS_04560 1457 2710 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933799.1 protein_id gnl|my_center|LOCUS_04560 2712 3230 gene locus_tag LOCUS_04570 2712 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3725 3558 gene locus_tag LOCUS_04580 3725 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4033 3734 gene locus_tag LOCUS_04590 4033 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5134 4043 gene locus_tag LOCUS_04600 5134 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 6126 5236 gene locus_tag LOCUS_04610 gene rsmA 6126 5236 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89MU0 protein_id gnl|my_center|LOCUS_04610 6712 6140 gene locus_tag LOCUS_04620 6712 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7146 6784 gene locus_tag LOCUS_04630 7146 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence051 568 720 gene locus_tag LOCUS_04640 568 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 730 1344 gene locus_tag LOCUS_04650 730 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 3395 1329 gene locus_tag LOCUS_04660 3395 1329 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877796.1 protein_id gnl|my_center|LOCUS_04660 3479 6124 gene locus_tag LOCUS_04670 3479 6124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6124 7239 gene locus_tag LOCUS_04680 6124 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence052 85 9 gene locus_tag LOCUS_t00190 85 9 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 196 1746 gene locus_tag LOCUS_04690 196 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 1756 3411 gene locus_tag LOCUS_04700 1756 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021968.1 protein_id gnl|my_center|LOCUS_04700 3499 6255 gene locus_tag LOCUS_04710 3499 6255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence053 216 1043 gene locus_tag LOCUS_04720 216 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 1045 1854 gene locus_tag LOCUS_04730 1045 1854 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879287.1 protein_id gnl|my_center|LOCUS_04730 3324 1855 gene locus_tag LOCUS_04740 3324 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3444 3632 gene locus_tag LOCUS_04750 3444 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4213 3629 gene locus_tag LOCUS_04760 4213 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4935 4258 gene locus_tag LOCUS_04770 4935 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5002 5235 gene locus_tag LOCUS_04780 5002 5235 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_04780 5351 5614 gene locus_tag LOCUS_04790 5351 5614 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023527.1 protein_id gnl|my_center|LOCUS_04790 6453 5695 gene locus_tag LOCUS_04800 6453 5695 CDS product putative succinate dehydrogenase, iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705147.1 protein_id gnl|my_center|LOCUS_04800 <7243 6453 gene locus_tag LOCUS_04810 <7243 6453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705146.1:putative succinate dehydrogenase, flavoprotein subunit >Feature sequence054 1524 2618 gene locus_tag LOCUS_04820 1524 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3938 2844 gene locus_tag LOCUS_04830 3938 2844 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 protein_id gnl|my_center|LOCUS_04830 6182 4050 gene locus_tag LOCUS_04840 6182 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence055 291 1130 gene locus_tag LOCUS_04850 291 1130 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_04850 2363 1122 gene locus_tag LOCUS_04860 gene eno 2363 1122 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRS1 protein_id gnl|my_center|LOCUS_04860 2847 2413 gene locus_tag LOCUS_04870 2847 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 3060 3413 gene locus_tag LOCUS_04880 3060 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3896 3429 gene locus_tag LOCUS_04890 3896 3429 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404799.1 protein_id gnl|my_center|LOCUS_04890 6312 4012 gene locus_tag LOCUS_04900 6312 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence056 827 327 gene locus_tag LOCUS_04910 827 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2389 836 gene locus_tag LOCUS_04920 2389 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3261 2392 gene locus_tag LOCUS_04930 3261 2392 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_04930 4825 3266 gene locus_tag LOCUS_04940 4825 3266 CDS product acetyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229661.1 protein_id gnl|my_center|LOCUS_04940 6183 4894 gene locus_tag LOCUS_04950 6183 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 <6968 6227 gene locus_tag LOCUS_04960 <6968 6227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249751.1:RNA-processing protein >Feature sequence057 272 1159 gene locus_tag LOCUS_04970 272 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1156 1905 gene locus_tag LOCUS_04980 1156 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 1920 3260 gene locus_tag LOCUS_04990 1920 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4016 3267 gene locus_tag LOCUS_05000 4016 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4041 4892 gene locus_tag LOCUS_05010 4041 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 6173 5070 gene locus_tag LOCUS_05020 6173 5070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 <6880 6188 gene locus_tag LOCUS_05030 <6880 6188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001118827.1:Fe-S cluster assembly protein SufB >Feature sequence058 857 432 gene locus_tag LOCUS_05040 gene hit 857 432 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004981.1 protein_id gnl|my_center|LOCUS_05040 2319 859 gene locus_tag LOCUS_05050 gene sdhA 2319 859 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK47 protein_id gnl|my_center|LOCUS_05050 3817 2366 gene locus_tag LOCUS_05060 3817 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 3925 4001 gene locus_tag LOCUS_t00200 3925 4001 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5146 4007 gene locus_tag LOCUS_05070 5146 4007 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020715.1 protein_id gnl|my_center|LOCUS_05070 5525 5187 gene locus_tag LOCUS_05080 5525 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 6093 5500 gene locus_tag LOCUS_05090 6093 5500 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249145.1 protein_id gnl|my_center|LOCUS_05090 6172 6247 gene locus_tag LOCUS_t00210 6172 6247 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence059 1567 314 gene locus_tag LOCUS_05100 gene metK 1567 314 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F85 protein_id gnl|my_center|LOCUS_05100 1692 2357 gene locus_tag LOCUS_05110 1692 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2363 2602 gene locus_tag LOCUS_05120 2363 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 3620 2592 gene locus_tag LOCUS_05130 3620 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 3647 4642 gene locus_tag LOCUS_05140 3647 4642 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249173.1 protein_id gnl|my_center|LOCUS_05140 4626 5411 gene locus_tag LOCUS_05150 4626 5411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496422.1 protein_id gnl|my_center|LOCUS_05150 6602 5412 gene locus_tag LOCUS_05160 gene leuB 6602 5412 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089061.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence060 667 320 gene locus_tag LOCUS_05170 667 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2399 822 gene locus_tag LOCUS_05180 2399 822 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_05180 2990 2409 gene locus_tag LOCUS_05190 2990 2409 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877893.1 protein_id gnl|my_center|LOCUS_05190 3512 3063 gene locus_tag LOCUS_05200 gene dut 3512 3063 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O68992 protein_id gnl|my_center|LOCUS_05200 3603 4013 gene locus_tag LOCUS_05210 3603 4013 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250572.1 protein_id gnl|my_center|LOCUS_05210 4082 4411 gene locus_tag LOCUS_05220 4082 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5428 4412 gene locus_tag LOCUS_05230 gene fadB5 5428 4412 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_05230 5743 5429 gene locus_tag LOCUS_05240 5743 5429 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522937.1 protein_id gnl|my_center|LOCUS_05240 6078 5752 gene locus_tag LOCUS_05250 6078 5752 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFI4 protein_id gnl|my_center|LOCUS_05250 6534 6082 gene locus_tag LOCUS_05260 6534 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence061 31 255 gene locus_tag LOCUS_05270 31 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1148 147 gene locus_tag LOCUS_05280 1148 147 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021969.1 protein_id gnl|my_center|LOCUS_05280 2471 1239 gene locus_tag LOCUS_05290 2471 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3751 2483 gene locus_tag LOCUS_05300 3751 2483 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868401.1 protein_id gnl|my_center|LOCUS_05300 5412 3754 gene locus_tag LOCUS_05310 5412 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5746 5504 gene locus_tag LOCUS_05320 5746 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 <6673 5756 gene locus_tag LOCUS_05330 <6673 5756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879589.1:ATPase >Feature sequence062 1187 843 gene locus_tag LOCUS_05340 1187 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1307 2410 gene locus_tag LOCUS_05350 gene pyrD 1307 2410 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NC99 protein_id gnl|my_center|LOCUS_05350 2519 2833 gene locus_tag LOCUS_05360 2519 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2914 3069 gene locus_tag LOCUS_05370 2914 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 3655 3200 gene locus_tag LOCUS_05380 3655 3200 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056590.1 protein_id gnl|my_center|LOCUS_05380 <6523 3709 gene locus_tag LOCUS_05390 <6523 3709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868797.1:MFS transporter >Feature sequence063 379 1089 gene locus_tag LOCUS_05400 gene psmA 379 1089 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_05400 1129 1818 gene locus_tag LOCUS_05410 1129 1818 CDS product RNA-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_05410 1848 2552 gene locus_tag LOCUS_05420 1848 2552 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_05420 2552 3268 gene locus_tag LOCUS_05430 2552 3268 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_05430 3268 4062 gene locus_tag LOCUS_05440 3268 4062 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_05440 4062 4427 gene locus_tag LOCUS_05450 4062 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4408 4641 gene locus_tag LOCUS_05460 4408 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4638 4961 gene locus_tag LOCUS_05470 4638 4961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5296 5799 gene locus_tag LOCUS_05480 5296 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6161 5763 gene locus_tag LOCUS_05490 6161 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence064 693 133 gene locus_tag LOCUS_05500 693 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1855 713 gene locus_tag LOCUS_05510 1855 713 CDS product benzoyl-CoA oxygenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230333.1 protein_id gnl|my_center|LOCUS_05510 2783 1926 gene locus_tag LOCUS_05520 2783 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 4063 2837 gene locus_tag LOCUS_05530 4063 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4144 4566 gene locus_tag LOCUS_05540 4144 4566 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_05540 5913 4567 gene locus_tag LOCUS_05550 5913 4567 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_05550 6183 5923 gene locus_tag LOCUS_05560 6183 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence065 190 267 gene locus_tag LOCUS_t00220 190 267 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 403 2499 gene locus_tag LOCUS_05570 gene ligA 403 2499 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P26996 protein_id gnl|my_center|LOCUS_05570 3296 2496 gene locus_tag LOCUS_05580 3296 2496 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867248.1 protein_id gnl|my_center|LOCUS_05580 3472 4515 gene locus_tag LOCUS_05590 3472 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5079 4501 gene locus_tag LOCUS_05600 5079 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5104 6348 gene locus_tag LOCUS_05610 5104 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence066 <1 963 gene locus_tag LOCUS_05620 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173524.1:rhomboid family intramembrane serine protease 1034 5803 gene locus_tag LOCUS_05630 1034 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence067 297 88 gene locus_tag LOCUS_05640 297 88 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_05640 748 305 gene locus_tag LOCUS_05650 748 305 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902818.1 protein_id gnl|my_center|LOCUS_05650 1235 750 gene locus_tag LOCUS_05660 1235 750 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902817.1 protein_id gnl|my_center|LOCUS_05660 1593 1228 gene locus_tag LOCUS_05670 1593 1228 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875679.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence068 <1 4114 gene locus_tag LOCUS_05680 <1 4114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3XZV9:ATP-dependent helicase/nuclease subunit A 4136 5572 gene locus_tag LOCUS_05690 gene dapE 4136 5572 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946545.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence069 113 3259 gene locus_tag LOCUS_05700 113 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3337 5391 gene locus_tag LOCUS_05710 3337 5391 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877871.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence070 27 1016 gene locus_tag LOCUS_05720 27 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1042 1434 gene locus_tag LOCUS_05730 1042 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 1537 2628 gene locus_tag LOCUS_05740 1537 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2709 2903 gene locus_tag LOCUS_05750 gene cspA 2709 2903 CDS product cold-shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085446.1 protein_id gnl|my_center|LOCUS_05750 3817 2909 gene locus_tag LOCUS_05760 3817 2909 CDS product chromosome partitioning protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731642.1 protein_id gnl|my_center|LOCUS_05760 4844 3864 gene locus_tag LOCUS_05770 4844 3864 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_05770 <6102 4933 gene locus_tag LOCUS_05780 <6102 4933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878271.1:translation initiation factor aIF-2 >Feature sequence071 >Feature sequence072 <1 1224 gene locus_tag LOCUS_05790 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229661.1:acetyl-CoA carboxylase subunit beta 1229 2098 gene locus_tag LOCUS_05800 1229 2098 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257438.1 protein_id gnl|my_center|LOCUS_05800 2101 3654 gene locus_tag LOCUS_05810 2101 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 3663 4163 gene locus_tag LOCUS_05820 3663 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 4206 4793 gene locus_tag LOCUS_05830 4206 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_05830 6067 4787 gene locus_tag LOCUS_05840 6067 4787 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence073 1732 893 gene locus_tag LOCUS_05850 1732 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 2257 1802 gene locus_tag LOCUS_05860 2257 1802 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_05860 3091 2327 gene locus_tag LOCUS_05870 3091 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence074 992 390 gene locus_tag LOCUS_05880 992 390 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053883.1 protein_id gnl|my_center|LOCUS_05880 1576 1001 gene locus_tag LOCUS_05890 1576 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3525 1585 gene locus_tag LOCUS_05900 3525 1585 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118571.1 protein_id gnl|my_center|LOCUS_05900 3794 4840 gene locus_tag LOCUS_05910 3794 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4925 5467 gene locus_tag LOCUS_05920 4925 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence075 2330 753 gene locus_tag LOCUS_05930 2330 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3471 2335 gene locus_tag LOCUS_05940 gene nuoD1 3471 2335 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MEX8 protein_id gnl|my_center|LOCUS_05940 4140 3481 gene locus_tag LOCUS_05950 4140 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4748 4152 gene locus_tag LOCUS_05960 4748 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5204 4758 gene locus_tag LOCUS_05970 gene nuoA 5204 4758 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEE0 protein_id gnl|my_center|LOCUS_05970 >Feature sequence076 >Feature sequence077 <1 1264 gene locus_tag LOCUS_05980 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44881:Xaa-Pro aminopeptidase 1341 2444 gene locus_tag LOCUS_05990 gene mqnC 1341 2444 CDS product cyclic dehypoxanthine futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJC2 protein_id gnl|my_center|LOCUS_05990 3371 2436 gene locus_tag LOCUS_06000 3371 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 4727 3519 gene locus_tag LOCUS_06010 4727 3519 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_06010 <5933 4784 gene locus_tag LOCUS_06020 <5933 4784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CSU3:DNA topoisomerase 1 >Feature sequence078 228 410 gene locus_tag LOCUS_06030 228 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 528 1148 gene locus_tag LOCUS_06040 528 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2047 1286 gene locus_tag LOCUS_06050 2047 1286 CDS product phosphatidylcholine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119944.1 protein_id gnl|my_center|LOCUS_06050 3192 2062 gene locus_tag LOCUS_06060 3192 2062 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_06060 3283 3825 gene locus_tag LOCUS_06070 3283 3825 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_06070 3828 4502 gene locus_tag LOCUS_06080 3828 4502 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020322.1 protein_id gnl|my_center|LOCUS_06080 4590 5708 gene locus_tag LOCUS_06090 gene ftsZ 4590 5708 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence079 157 2352 gene locus_tag LOCUS_06100 157 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2582 2349 gene locus_tag LOCUS_06110 2582 2349 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_06110 2818 2585 gene locus_tag LOCUS_06120 2818 2585 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878901.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence080 1 615 gene locus_tag LOCUS_06130 1 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 625 1224 gene locus_tag LOCUS_06140 625 1224 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268298.1 protein_id gnl|my_center|LOCUS_06140 2925 1225 gene locus_tag LOCUS_06150 2925 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3815 2970 gene locus_tag LOCUS_06160 3815 2970 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870787.1 protein_id gnl|my_center|LOCUS_06160 3784 5007 gene locus_tag LOCUS_06170 3784 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence081 135 1106 gene locus_tag LOCUS_06180 135 1106 CDS product fructose-bisphosphatase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214469.1 protein_id gnl|my_center|LOCUS_06180 1148 2167 gene locus_tag LOCUS_06190 1148 2167 CDS product putative fructose-bisphosphate aldolase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5Z7 protein_id gnl|my_center|LOCUS_06190 2419 2168 gene locus_tag LOCUS_06200 2419 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 2695 2420 gene locus_tag LOCUS_06210 2695 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2950 5571 gene locus_tag LOCUS_06220 2950 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence082 1902 2693 gene locus_tag LOCUS_06230 1902 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2703 5141 gene locus_tag LOCUS_06240 2703 5141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 >Feature sequence083 96 1274 gene locus_tag LOCUS_06250 gene kbl 96 1274 CDS product 8-amino-7-oxononanoate synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31777 protein_id gnl|my_center|LOCUS_06250 1284 1508 gene locus_tag LOCUS_06260 1284 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 1501 1938 gene locus_tag LOCUS_06270 1501 1938 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480116.1 protein_id gnl|my_center|LOCUS_06270 2582 1935 gene locus_tag LOCUS_06280 2582 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 2720 3889 gene locus_tag LOCUS_06290 2720 3889 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYC6 protein_id gnl|my_center|LOCUS_06290 4996 3890 gene locus_tag LOCUS_06300 4996 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 >Feature sequence084 <1 3382 gene locus_tag LOCUS_06310 <1 3382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256298.1:CSLREA domain-containing protein 4120 3383 gene locus_tag LOCUS_06320 4120 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 4210 4503 gene locus_tag LOCUS_06330 4210 4503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 5184 4504 gene locus_tag LOCUS_06340 5184 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence085 1814 2446 gene locus_tag LOCUS_06350 1814 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_06350 2498 3766 gene locus_tag LOCUS_06360 gene purD 2498 3766 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65894 protein_id gnl|my_center|LOCUS_06360 >Feature sequence086 1034 135 gene locus_tag LOCUS_06370 1034 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1102 1377 gene locus_tag LOCUS_06380 1102 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1695 1378 gene locus_tag LOCUS_06390 1695 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1805 3745 gene locus_tag LOCUS_06400 1805 3745 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000867537.1 protein_id gnl|my_center|LOCUS_06400 3780 3983 gene locus_tag LOCUS_06410 3780 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3985 4632 gene locus_tag LOCUS_06420 gene nth 3985 4632 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UGP4 protein_id gnl|my_center|LOCUS_06420 4674 5156 gene locus_tag LOCUS_06430 gene bcp 4674 5156 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001292536.1 protein_id gnl|my_center|LOCUS_06430 5156 5383 gene locus_tag LOCUS_06440 5156 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 >Feature sequence087 961 302 gene locus_tag LOCUS_06450 961 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 1569 973 gene locus_tag LOCUS_06460 1569 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2025 1579 gene locus_tag LOCUS_06470 gene nuoA 2025 1579 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEE0 protein_id gnl|my_center|LOCUS_06470 4810 2117 gene locus_tag LOCUS_06480 4810 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 >Feature sequence088 573 307 gene locus_tag LOCUS_06490 573 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 897 1349 gene locus_tag LOCUS_06500 897 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2105 1356 gene locus_tag LOCUS_06510 2105 1356 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877375.1 protein_id gnl|my_center|LOCUS_06510 3097 2156 gene locus_tag LOCUS_06520 3097 2156 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065995.1 protein_id gnl|my_center|LOCUS_06520 3719 3153 gene locus_tag LOCUS_06530 3719 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 4396 3719 gene locus_tag LOCUS_06540 4396 3719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 >Feature sequence089 2607 1360 gene locus_tag LOCUS_06550 2607 1360 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_06550 2713 3402 gene locus_tag LOCUS_06560 2713 3402 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_06560 3399 3716 gene locus_tag LOCUS_06570 3399 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3745 4335 gene locus_tag LOCUS_06580 3745 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5532 4501 gene locus_tag LOCUS_06590 5532 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence090 1146 2063 gene locus_tag LOCUS_06600 1146 2063 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060988.1 protein_id gnl|my_center|LOCUS_06600 2073 2759 gene locus_tag LOCUS_06610 2073 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3416 2880 gene locus_tag LOCUS_06620 gene orn 3416 2880 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83C93 protein_id gnl|my_center|LOCUS_06620 3484 4749 gene locus_tag LOCUS_06630 3484 4749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117066.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence091 3590 2412 gene locus_tag LOCUS_06640 3590 2412 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_06640 4567 3638 gene locus_tag LOCUS_06650 gene trxB 4567 3638 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_06650 >Feature sequence092 477 1571 gene locus_tag LOCUS_06660 477 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 1605 4331 gene locus_tag LOCUS_06670 gene citB 1605 4331 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_06670 4384 5052 gene locus_tag LOCUS_06680 4384 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 >Feature sequence093 5147 360 gene locus_tag LOCUS_06690 5147 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5391 5224 gene locus_tag LOCUS_06700 5391 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence094 >Feature sequence095 469 1449 gene locus_tag LOCUS_06710 469 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 1917 1450 gene locus_tag LOCUS_06720 1917 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence096 4536 3055 gene locus_tag LOCUS_06730 4536 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 5231 4584 gene locus_tag LOCUS_06740 5231 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence097 82 663 gene locus_tag LOCUS_06750 82 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1697 657 gene locus_tag LOCUS_06760 1697 657 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_06760 2751 1702 gene locus_tag LOCUS_06770 2751 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3717 2962 gene locus_tag LOCUS_06780 3717 2962 CDS product heme exporter protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532296.1 protein_id gnl|my_center|LOCUS_06780 <5222 3714 gene locus_tag LOCUS_06790 <5222 3714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731520.1:ABC transporter ATP-binding protein >Feature sequence098 <1 2541 gene locus_tag LOCUS_06800 <1 2541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HXZ6:isoleucine--tRNA ligase 3873 2542 gene locus_tag LOCUS_06810 3873 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence099 2564 1314 gene locus_tag LOCUS_06820 2564 1314 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_06820 3707 2676 gene locus_tag LOCUS_06830 3707 2676 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009971342.1 protein_id gnl|my_center|LOCUS_06830 4654 3725 gene locus_tag LOCUS_06840 gene sucD 4654 3725 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEY0 protein_id gnl|my_center|LOCUS_06840 <5189 4654 gene locus_tag LOCUS_06850 <5189 4654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UKI3:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence100 201 530 gene locus_tag LOCUS_06860 201 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 2114 531 gene locus_tag LOCUS_06870 2114 531 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878342.1 protein_id gnl|my_center|LOCUS_06870 3535 2117 gene locus_tag LOCUS_06880 3535 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 4414 3626 gene locus_tag LOCUS_06890 4414 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence101 1258 11 gene locus_tag LOCUS_06900 1258 11 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_06900 1518 3041 gene locus_tag LOCUS_06910 1518 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3041 4396 gene locus_tag LOCUS_06920 3041 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence102 2075 1506 gene locus_tag LOCUS_06930 2075 1506 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969634.1 protein_id gnl|my_center|LOCUS_06930 2742 2131 gene locus_tag LOCUS_06940 2742 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4042 2822 gene locus_tag LOCUS_06950 4042 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 4160 4570 gene locus_tag LOCUS_06960 4160 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 <5125 4559 gene locus_tag LOCUS_06970 <5125 4559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393502.1:sulfurylase large subunit, molybdopterin cytosine dinucleotide biosynthesis >Feature sequence103 18 620 gene locus_tag LOCUS_06980 18 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1399 617 gene locus_tag LOCUS_06990 1399 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2690 1461 gene locus_tag LOCUS_07000 2690 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2930 2715 gene locus_tag LOCUS_07010 2930 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2862 3827 gene locus_tag LOCUS_07020 2862 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3842 4576 gene locus_tag LOCUS_07030 3842 4576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194759.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence104 <1 1595 gene locus_tag LOCUS_07040 <1 1595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA 1815 3035 gene locus_tag LOCUS_07050 1815 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3061 3642 gene locus_tag LOCUS_07060 3061 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4676 3636 gene locus_tag LOCUS_07070 4676 3636 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence105 802 1662 gene locus_tag LOCUS_07080 802 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1722 3863 gene locus_tag LOCUS_07090 1722 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903100.1 protein_id gnl|my_center|LOCUS_07090 4363 3860 gene locus_tag LOCUS_07100 4363 3860 CDS product ribosomal-protein-L7/L12-serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704795.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence106 31 106 gene locus_tag LOCUS_t00230 31 106 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 1788 1012 gene locus_tag LOCUS_07110 gene rph 1788 1012 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7URE2 protein_id gnl|my_center|LOCUS_07110 2420 1869 gene locus_tag LOCUS_07120 gene mogA 2420 1869 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_07120 2659 4347 gene locus_tag LOCUS_07130 2659 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence107 160 1878 gene locus_tag LOCUS_07140 gene fhs 160 1878 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B9U6 protein_id gnl|my_center|LOCUS_07140 1891 2949 gene locus_tag LOCUS_07150 1891 2949 CDS product mRNA surveillance protein Pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869669.1 protein_id gnl|my_center|LOCUS_07150 2985 3659 gene locus_tag LOCUS_07160 2985 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence108 637 32 gene locus_tag LOCUS_07170 637 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 716 1507 gene locus_tag LOCUS_07180 716 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2784 1447 gene locus_tag LOCUS_07190 2784 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 3990 2845 gene locus_tag LOCUS_07200 3990 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4155 4070 gene locus_tag LOCUS_t00240 4155 4070 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4253 4327 gene locus_tag LOCUS_t00250 4253 4327 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence109 1049 546 gene locus_tag LOCUS_07210 1049 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1396 1082 gene locus_tag LOCUS_07220 1396 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2436 1414 gene locus_tag LOCUS_07230 2436 1414 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877288.1 protein_id gnl|my_center|LOCUS_07230 3077 2433 gene locus_tag LOCUS_07240 3077 2433 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_07240 3409 3131 gene locus_tag LOCUS_07250 3409 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4368 3496 gene locus_tag LOCUS_07260 4368 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4642 4379 gene locus_tag LOCUS_07270 4642 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence110 135 668 gene locus_tag LOCUS_07280 135 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 718 1599 gene locus_tag LOCUS_07290 718 1599 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_07290 1589 2041 gene locus_tag LOCUS_07300 1589 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 2072 2446 gene locus_tag LOCUS_07310 2072 2446 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_07310 2867 2628 gene locus_tag LOCUS_07320 2867 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2784 3965 gene locus_tag LOCUS_07330 gene algC 2784 3965 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038932.1 protein_id gnl|my_center|LOCUS_07330 4499 3966 gene locus_tag LOCUS_07340 4499 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4582 4655 gene locus_tag LOCUS_t00260 4582 4655 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence111 <1 831 gene locus_tag LOCUS_07350 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8PBB3:tryptophan 2,3-dioxygenase-like protein 890 2050 gene locus_tag LOCUS_07360 890 2050 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887715.1 protein_id gnl|my_center|LOCUS_07360 2126 2380 gene locus_tag LOCUS_07370 2126 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2447 3487 gene locus_tag LOCUS_07380 2447 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3477 4517 gene locus_tag LOCUS_07390 gene ctaB 3477 4517 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8T814 protein_id gnl|my_center|LOCUS_07390 >Feature sequence112 1273 488 gene locus_tag LOCUS_07400 1273 488 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J5Z3 protein_id gnl|my_center|LOCUS_07400 1300 2508 gene locus_tag LOCUS_07410 1300 2508 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227717.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence113 125 478 gene locus_tag LOCUS_07420 125 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 530 606 gene locus_tag LOCUS_t00270 530 606 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 669 745 gene locus_tag LOCUS_t00280 669 745 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 791 1207 gene locus_tag LOCUS_07430 791 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1594 1208 gene locus_tag LOCUS_07440 1594 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2137 1604 gene locus_tag LOCUS_07450 2137 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 2268 3038 gene locus_tag LOCUS_07460 2268 3038 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876917.1 protein_id gnl|my_center|LOCUS_07460 3604 3041 gene locus_tag LOCUS_07470 gene nfuA 3604 3041 CDS product Fe/S biogenesis protein NfuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FT82 protein_id gnl|my_center|LOCUS_07470 >Feature sequence114 847 20 gene locus_tag LOCUS_07480 847 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1570 848 gene locus_tag LOCUS_07490 1570 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1660 2793 gene locus_tag LOCUS_07500 1660 2793 CDS product TIGR01210 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_07500 2880 3158 gene locus_tag LOCUS_07510 2880 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence115 275 1543 gene locus_tag LOCUS_07520 275 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1589 3388 gene locus_tag LOCUS_07530 1589 3388 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence116 2379 1138 gene locus_tag LOCUS_07540 2379 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3193 2393 gene locus_tag LOCUS_07550 3193 2393 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_07550 3972 3202 gene locus_tag LOCUS_07560 3972 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 <4481 3969 gene locus_tag LOCUS_07570 <4481 3969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878420.1:aspartate--tRNA(Asn) ligase >Feature sequence117 135 1607 gene locus_tag LOCUS_07580 gene rtcB 135 1607 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHE5 protein_id gnl|my_center|LOCUS_07580 2101 1604 gene locus_tag LOCUS_07590 2101 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2153 2782 gene locus_tag LOCUS_07600 2153 2782 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204031.1 protein_id gnl|my_center|LOCUS_07600 2965 2783 gene locus_tag LOCUS_07610 2965 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence118 641 564 gene locus_tag LOCUS_t00290 641 564 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1282 695 gene locus_tag LOCUS_07620 1282 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1557 3074 gene locus_tag LOCUS_07630 1557 3074 CDS product L-lysine 6-aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_07630 3082 3762 gene locus_tag LOCUS_07640 3082 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3946 3764 gene locus_tag LOCUS_07650 3946 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence119 223 1200 gene locus_tag LOCUS_07660 223 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1264 2154 gene locus_tag LOCUS_07670 1264 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3093 2155 gene locus_tag LOCUS_07680 3093 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3472 3176 gene locus_tag LOCUS_07690 3472 3176 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012981234.1 protein_id gnl|my_center|LOCUS_07690 <4366 3486 gene locus_tag LOCUS_07700 <4366 3486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879382.1:DNA-directed RNA polymerase subunit A'' >Feature sequence120 >Feature sequence121 2476 1160 gene locus_tag LOCUS_07710 2476 1160 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249495.1 protein_id gnl|my_center|LOCUS_07710 2660 3028 gene locus_tag LOCUS_07720 2660 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence122 <1 939 gene locus_tag LOCUS_07730 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HZ66:phosphoserine aminotransferase 948 1649 gene locus_tag LOCUS_07740 gene deoC 948 1649 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJ09 protein_id gnl|my_center|LOCUS_07740 1725 1650 gene locus_tag LOCUS_t00300 1725 1650 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1825 3270 gene locus_tag LOCUS_07750 1825 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence123 189 1100 gene locus_tag LOCUS_07760 gene surE 189 1100 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ6 protein_id gnl|my_center|LOCUS_07760 1708 1097 gene locus_tag LOCUS_07770 1708 1097 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903455.1 protein_id gnl|my_center|LOCUS_07770 3041 1683 gene locus_tag LOCUS_07780 3041 1683 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_07780 3118 3906 gene locus_tag LOCUS_07790 3118 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence124 58 939 gene locus_tag LOCUS_07800 58 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 974 2500 gene locus_tag LOCUS_07810 974 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2563 3999 gene locus_tag LOCUS_07820 2563 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence125 >Feature sequence126 1181 363 gene locus_tag LOCUS_07830 gene pfaS 1181 363 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121938.1 protein_id gnl|my_center|LOCUS_07830 4172 1185 gene locus_tag LOCUS_07840 gene purSL 4172 1185 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN9 protein_id gnl|my_center|LOCUS_07840 >Feature sequence127 117 1097 gene locus_tag LOCUS_07850 gene dnaJ 117 1097 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNE7 protein_id gnl|my_center|LOCUS_07850 >Feature sequence128 1770 1336 gene locus_tag LOCUS_07860 1770 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1826 2731 gene locus_tag LOCUS_07870 1826 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 2741 3667 gene locus_tag LOCUS_07880 2741 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence129 2 1789 gene locus_tag LOCUS_07890 2 1789 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389064.1 protein_id gnl|my_center|LOCUS_07890 1799 3604 gene locus_tag LOCUS_07900 1799 3604 CDS product acyl-CoA dehydrogenase oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526128.1 protein_id gnl|my_center|LOCUS_07900 3604 3873 gene locus_tag LOCUS_07910 3604 3873 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_07910 >Feature sequence130 90 842 gene locus_tag LOCUS_07920 90 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 846 1331 gene locus_tag LOCUS_07930 gene slyD 846 1331 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB16 protein_id gnl|my_center|LOCUS_07930 1470 2960 gene locus_tag LOCUS_07940 1470 2960 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_07940 2962 3372 gene locus_tag LOCUS_07950 2962 3372 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978533.1 protein_id gnl|my_center|LOCUS_07950 3407 3709 gene locus_tag LOCUS_07960 3407 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence131 2673 2335 gene locus_tag LOCUS_07970 2673 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 2849 3172 gene locus_tag LOCUS_07980 2849 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3177 3893 gene locus_tag LOCUS_07990 3177 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence132 <1 3643 gene locus_tag LOCUS_08000 <1 3643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391163.1:branched-chain amino acid ABC transporter permease >Feature sequence133 2222 27 gene locus_tag LOCUS_08010 2222 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence134 1 2214 gene locus_tag LOCUS_08020 1 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2216 3208 gene locus_tag LOCUS_08030 2216 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 <3924 3205 gene locus_tag LOCUS_08040 <3924 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250622.1:4-demethylwyosine synthase TYW1 >Feature sequence135 1775 2851 gene locus_tag LOCUS_08050 1775 2851 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_08050 2856 3734 gene locus_tag LOCUS_08060 2856 3734 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903235.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence136 1100 2059 gene locus_tag LOCUS_08070 1100 2059 CDS product putative sugar-phosphate nucleotidyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704340.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence137 60 674 gene locus_tag LOCUS_08080 60 674 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_08080 1784 669 gene locus_tag LOCUS_08090 1784 669 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980220.1 protein_id gnl|my_center|LOCUS_08090 2104 1829 gene locus_tag LOCUS_08100 2104 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147166.1 protein_id gnl|my_center|LOCUS_08100 2958 2164 gene locus_tag LOCUS_08110 2958 2164 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_08110 3874 2966 gene locus_tag LOCUS_08120 3874 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence138 1928 666 gene locus_tag LOCUS_08130 1928 666 CDS product N-ethylammeline chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877115.1 protein_id gnl|my_center|LOCUS_08130 3001 1967 gene locus_tag LOCUS_08140 3001 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3668 3051 gene locus_tag LOCUS_08150 3668 3051 CDS product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868512.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence139 3254 3730 gene locus_tag LOCUS_08160 3254 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence140 300 2459 gene locus_tag LOCUS_08170 300 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence141 294 443 gene locus_tag LOCUS_08180 294 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1472 444 gene locus_tag LOCUS_08190 gene bcaT 1472 444 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A068 protein_id gnl|my_center|LOCUS_08190 >Feature sequence142 2171 2096 gene locus_tag LOCUS_t00310 2171 2096 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3159 2212 gene locus_tag LOCUS_08200 3159 2212 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_08200 3637 3164 gene locus_tag LOCUS_08210 3637 3164 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence143 711 22 gene locus_tag LOCUS_08220 711 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1553 756 gene locus_tag LOCUS_08230 1553 756 CDS product dimethylargininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868883.1 protein_id gnl|my_center|LOCUS_08230 1638 2084 gene locus_tag LOCUS_08240 1638 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_08240 2074 2208 gene locus_tag LOCUS_08250 2074 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 2235 2861 gene locus_tag LOCUS_08260 2235 2861 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87FS8 protein_id gnl|my_center|LOCUS_08260 2938 2862 gene locus_tag LOCUS_t00320 2938 2862 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence144 2399 2806 gene locus_tag LOCUS_08270 2399 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 2842 3657 gene locus_tag LOCUS_08280 2842 3657 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060841.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence145 21 617 gene locus_tag LOCUS_08290 21 617 CDS product nucleoside-triphosphatase THEP1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WXP3 protein_id gnl|my_center|LOCUS_08290 668 1042 gene locus_tag LOCUS_08300 668 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 1091 1474 gene locus_tag LOCUS_08310 gene gcvH 1091 1474 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKW9 protein_id gnl|my_center|LOCUS_08310 1477 2013 gene locus_tag LOCUS_08320 1477 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2430 2014 gene locus_tag LOCUS_08330 2430 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2508 3458 gene locus_tag LOCUS_08340 2508 3458 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_08340 3552 3479 gene locus_tag LOCUS_t00330 3552 3479 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 59 934 gene locus_tag LOCUS_08350 59 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 988 2313 gene locus_tag LOCUS_08360 988 2313 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390254.1 protein_id gnl|my_center|LOCUS_08360 2634 2305 gene locus_tag LOCUS_08370 2634 2305 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_08370 <3649 2654 gene locus_tag LOCUS_08380 <3649 2654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876684.1:elongation factor 1-alpha >Feature sequence147 105 180 gene locus_tag LOCUS_t00340 105 180 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 368 189 gene locus_tag LOCUS_08390 368 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 1128 373 gene locus_tag LOCUS_08400 gene ara1 1128 373 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060166.1 protein_id gnl|my_center|LOCUS_08400 1290 2840 gene locus_tag LOCUS_08410 1290 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence148 755 1222 gene locus_tag LOCUS_08420 755 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1230 1886 gene locus_tag LOCUS_08430 1230 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1912 2121 gene locus_tag LOCUS_08440 1912 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2126 2689 gene locus_tag LOCUS_08450 2126 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_08450 3313 2681 gene locus_tag LOCUS_08460 gene purN 3313 2681 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7M0 protein_id gnl|my_center|LOCUS_08460 >Feature sequence149 1900 788 gene locus_tag LOCUS_08470 1900 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3106 1904 gene locus_tag LOCUS_08480 3106 1904 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence150 320 2089 gene locus_tag LOCUS_08490 320 2089 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_08490 2086 2505 gene locus_tag LOCUS_08500 2086 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2680 2892 gene locus_tag LOCUS_08510 2680 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2903 3172 gene locus_tag LOCUS_08520 2903 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence151 2335 1265 gene locus_tag LOCUS_08530 2335 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <3598 2332 gene locus_tag LOCUS_08540 <3598 2332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583823.1:pyrimidine-nucleoside phosphorylase >Feature sequence152 2102 180 gene locus_tag LOCUS_08550 2102 180 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_08550 2515 2108 gene locus_tag LOCUS_08560 2515 2108 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064745.1 protein_id gnl|my_center|LOCUS_08560 2995 2525 gene locus_tag LOCUS_08570 2995 2525 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875666.1 protein_id gnl|my_center|LOCUS_08570 <3581 2992 gene locus_tag LOCUS_08580 <3581 2992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061173.1:30S ribosomal protein S5 >Feature sequence153 461 1345 gene locus_tag LOCUS_08590 461 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1388 1894 gene locus_tag LOCUS_08600 1388 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1904 3175 gene locus_tag LOCUS_08610 1904 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence154 >Feature sequence155 >Feature sequence156 1170 1643 gene locus_tag LOCUS_08620 1170 1643 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence157 1318 458 gene locus_tag LOCUS_08630 1318 458 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142939.1 protein_id gnl|my_center|LOCUS_08630 3288 1318 gene locus_tag LOCUS_08640 3288 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3519 3391 gene locus_tag LOCUS_08650 3519 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence158 <1 1245 gene locus_tag LOCUS_08660 <1 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877091.1:2-isopropylmalate synthase >Feature sequence159 2 2863 gene locus_tag LOCUS_08670 2 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence160 1148 555 gene locus_tag LOCUS_08680 1148 555 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_08680 1813 1157 gene locus_tag LOCUS_08690 1813 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 1835 2974 gene locus_tag LOCUS_08700 gene nadA 1835 2974 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A4C4 protein_id gnl|my_center|LOCUS_08700 >Feature sequence161 2809 1190 gene locus_tag LOCUS_08710 gene pruA 2809 1190 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_08710 3315 3028 gene locus_tag LOCUS_08720 3315 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence162 337 421 gene locus_tag LOCUS_t00350 337 421 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1148 429 gene locus_tag LOCUS_08730 1148 429 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876695.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence163 637 314 gene locus_tag LOCUS_08740 637 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2064 694 gene locus_tag LOCUS_08750 2064 694 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437980.1 protein_id gnl|my_center|LOCUS_08750 2319 2137 gene locus_tag LOCUS_08760 2319 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2742 2428 gene locus_tag LOCUS_08770 2742 2428 CDS product ribonuclease P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902407.1 protein_id gnl|my_center|LOCUS_08770 <3283 2735 gene locus_tag LOCUS_08780 <3283 2735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B7NIF6:adenylate kinase >Feature sequence164 >Feature sequence165 1278 733 gene locus_tag LOCUS_08790 1278 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1402 2616 gene locus_tag LOCUS_08800 1402 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3196 2597 gene locus_tag LOCUS_08810 gene gpmA 3196 2597 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q036I8 protein_id gnl|my_center|LOCUS_08810 >Feature sequence166 364 1935 gene locus_tag LOCUS_08820 364 1935 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence167 >Feature sequence168 <3141 525 gene locus_tag LOCUS_08830 <3141 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q59637:pyruvate dehydrogenase E1 component >Feature sequence169 867 1970 gene locus_tag LOCUS_08840 867 1970 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence170 618 37 gene locus_tag LOCUS_08850 618 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2045 627 gene locus_tag LOCUS_08860 2045 627 CDS product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527142.1 protein_id gnl|my_center|LOCUS_08860 2132 2575 gene locus_tag LOCUS_08870 2132 2575 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338695.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence171 143 2278 gene locus_tag LOCUS_08880 143 2278 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024041.1 protein_id gnl|my_center|LOCUS_08880 2314 2640 gene locus_tag LOCUS_08890 2314 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence172 356 1423 gene locus_tag LOCUS_08900 356 1423 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705678.1 protein_id gnl|my_center|LOCUS_08900 1543 2397 gene locus_tag LOCUS_08910 1543 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence173 1701 1069 gene locus_tag LOCUS_08920 1701 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 >Feature sequence174 <1 2154 gene locus_tag LOCUS_08930 <1 2154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NJH7:UvrABC system protein B >Feature sequence175 435 2771 gene locus_tag LOCUS_08940 435 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence176 2 607 gene locus_tag LOCUS_08950 2 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 681 2663 gene locus_tag LOCUS_08960 681 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence177 140 952 gene locus_tag LOCUS_08970 gene trmI 140 952 CDS product tRNA (adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WFZ1 protein_id gnl|my_center|LOCUS_08970 957 1262 gene locus_tag LOCUS_08980 957 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1283 1777 gene locus_tag LOCUS_08990 1283 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence178 1554 580 gene locus_tag LOCUS_09000 1554 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2721 1654 gene locus_tag LOCUS_09010 2721 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence179 954 64 gene locus_tag LOCUS_09020 954 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2506 995 gene locus_tag LOCUS_09030 gene gcvPB 2506 995 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH49 protein_id gnl|my_center|LOCUS_09030 >Feature sequence180 <1 1559 gene locus_tag LOCUS_09040 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022880.1:anion permease 2345 1560 gene locus_tag LOCUS_09050 2345 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence181 <2754 1845 gene locus_tag LOCUS_09060 <2754 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984862.1:ATP-binding protein >Feature sequence182 >Feature sequence183 390 1265 gene locus_tag LOCUS_09070 390 1265 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020266.1 protein_id gnl|my_center|LOCUS_09070 1692 1258 gene locus_tag LOCUS_09080 1692 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2393 1737 gene locus_tag LOCUS_09090 2393 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence184 1645 941 gene locus_tag LOCUS_09100 1645 941 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence185 1567 164 gene locus_tag LOCUS_09110 gene purA 1567 164 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DKP2 protein_id gnl|my_center|LOCUS_09110 1785 2399 gene locus_tag LOCUS_09120 1785 2399 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943404.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence186 >Feature sequence187 190 1947 gene locus_tag LOCUS_09130 190 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence188 736 302 gene locus_tag LOCUS_09140 gene rlmH 736 302 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZI5 protein_id gnl|my_center|LOCUS_09140 816 1139 gene locus_tag LOCUS_09150 816 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1144 1860 gene locus_tag LOCUS_09160 1144 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1888 2496 gene locus_tag LOCUS_09170 1888 2496 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970094.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence189 <1 867 gene locus_tag LOCUS_09180 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964015.1:3-hydroxybutyryl-CoA dehydrogenase 864 1193 gene locus_tag LOCUS_09190 864 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1273 1196 gene locus_tag LOCUS_t00360 1273 1196 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1406 1332 gene locus_tag LOCUS_t00370 1406 1332 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1756 1412 gene locus_tag LOCUS_09200 1756 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1912 1838 gene locus_tag LOCUS_t00380 1912 1838 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2318 1959 gene locus_tag LOCUS_09210 2318 1959 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249794.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence190 1410 343 gene locus_tag LOCUS_09220 1410 343 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705678.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence191 <1 1844 gene locus_tag LOCUS_09230 <1 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389064.1:3-hydroxyacyl-CoA dehydrogenase >Feature sequence192 157 1137 gene locus_tag LOCUS_09240 gene ispB 157 1137 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381308.1 protein_id gnl|my_center|LOCUS_09240 1142 2239 gene locus_tag LOCUS_09250 1142 2239 CDS product bacteriochlorophyll synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023790.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence193 <2598 1834 gene locus_tag LOCUS_09260 <2598 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249483.1:serine hydroxymethyltransferase >Feature sequence194 1134 466 gene locus_tag LOCUS_09270 1134 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1244 2029 gene locus_tag LOCUS_09280 1244 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence195 1043 711 gene locus_tag LOCUS_09290 1043 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 <2578 1052 gene locus_tag LOCUS_09300 <2578 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NE01:leucine--tRNA ligase >Feature sequence196 1224 217 gene locus_tag LOCUS_09310 1224 217 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023899.1 protein_id gnl|my_center|LOCUS_09310 1314 2444 gene locus_tag LOCUS_09320 1314 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2472 2548 gene locus_tag LOCUS_t00390 2472 2548 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence197 85 1335 gene locus_tag LOCUS_09330 85 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1915 1316 gene locus_tag LOCUS_09340 gene gpmA2 1915 1316 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q88T35 protein_id gnl|my_center|LOCUS_09340 <2522 1925 gene locus_tag LOCUS_09350 <2522 1925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807926.1:mechanosensitive ion channel protein >Feature sequence198 <1 1278 gene locus_tag LOCUS_09360 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948368.1:ATP-dependent RNA helicase RhlE 1669 1331 gene locus_tag LOCUS_09370 1669 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence199 1278 532 gene locus_tag LOCUS_09380 1278 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1350 1814 gene locus_tag LOCUS_09390 1350 1814 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence200 <1 969 gene locus_tag LOCUS_09400 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878948.1:thermosome subunit >Feature sequence201 >Feature sequence202 1164 259 gene locus_tag LOCUS_09410 1164 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1285 1360 gene locus_tag LOCUS_t00400 1285 1360 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2464 1364 gene locus_tag LOCUS_09420 2464 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence203 <1 1371 gene locus_tag LOCUS_09430 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to C3MGQ8:inosine-5'-monophosphate dehydrogenase 1376 1897 gene locus_tag LOCUS_09440 gene msrA 1376 1897 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VUN8 protein_id gnl|my_center|LOCUS_09440 >Feature sequence204 746 249 gene locus_tag LOCUS_09450 746 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 824 1618 gene locus_tag LOCUS_09460 824 1618 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228949.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence205 1035 79 gene locus_tag LOCUS_09470 1035 79 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_09470 1913 1101 gene locus_tag LOCUS_09480 gene panB 1913 1101 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZX5 protein_id gnl|my_center|LOCUS_09480 >Feature sequence206 53 138 gene locus_tag LOCUS_t00410 53 138 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1016 141 gene locus_tag LOCUS_09490 1016 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704613.1 protein_id gnl|my_center|LOCUS_09490 942 1205 gene locus_tag LOCUS_09500 942 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1259 2317 gene locus_tag LOCUS_09510 1259 2317 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_09510 2394 2318 gene locus_tag LOCUS_t00420 2394 2318 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence207 2236 824 gene locus_tag LOCUS_09520 2236 824 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence208 1707 520 gene locus_tag LOCUS_09530 1707 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence209 <1 631 gene locus_tag LOCUS_09540 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250852.1:cell division control protein Cdc6 687 1220 gene locus_tag LOCUS_09550 687 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 2237 1221 gene locus_tag LOCUS_09560 2237 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence210 >Feature sequence211 <1 813 gene locus_tag LOCUS_09570 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T806:homoserine kinase 879 1361 gene locus_tag LOCUS_09580 879 1361 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_09580 1387 2253 gene locus_tag LOCUS_09590 1387 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2307 2391 gene locus_tag LOCUS_t00430 2307 2391 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence212 1623 742 gene locus_tag LOCUS_09600 1623 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 <2380 1861 gene locus_tag LOCUS_09610 <2380 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061017.1:type II methionyl aminopeptidase >Feature sequence213 1264 197 gene locus_tag LOCUS_09620 1264 197 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_09620 <2361 1266 gene locus_tag LOCUS_09630 <2361 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932339.1:ABC transporter ATP-binding protein >Feature sequence214 2137 902 gene locus_tag LOCUS_09640 2137 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence215 2219 1176 gene locus_tag LOCUS_09650 2219 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence216 <1 712 gene locus_tag LOCUS_09660 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289301.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase 720 1193 gene locus_tag LOCUS_09670 720 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 >Feature sequence217 1413 490 gene locus_tag LOCUS_09680 1413 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1721 1476 gene locus_tag LOCUS_09690 1721 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence218 365 1180 gene locus_tag LOCUS_09700 365 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence219 >Feature sequence220 287 1177 gene locus_tag LOCUS_09710 287 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 2121 1174 gene locus_tag LOCUS_09720 2121 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence221 >Feature sequence222 249 1178 gene locus_tag LOCUS_09730 249 1178 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_09730 1178 1645 gene locus_tag LOCUS_09740 1178 1645 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence223 >Feature sequence224 2216 393 gene locus_tag LOCUS_09750 2216 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence225 824 1501 gene locus_tag LOCUS_09760 824 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 <2215 1502 gene locus_tag LOCUS_09770 <2215 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978424.1:translation-associated GTPase >Feature sequence226 809 234 gene locus_tag LOCUS_09780 809 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876073.1 protein_id gnl|my_center|LOCUS_09780 1662 829 gene locus_tag LOCUS_09790 1662 829 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence227 190 1695 gene locus_tag LOCUS_09800 190 1695 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence228 46 1947 gene locus_tag LOCUS_09810 46 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence229 >Feature sequence230 176 1963 gene locus_tag LOCUS_09820 gene fadD 176 1963 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224318.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence231 >Feature sequence232 92 1369 gene locus_tag LOCUS_09830 92 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence233 232 885 gene locus_tag LOCUS_09840 232 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 942 2021 gene locus_tag LOCUS_09850 942 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence234 342 746 gene locus_tag LOCUS_09860 342 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1577 735 gene locus_tag LOCUS_09870 1577 735 CDS product xanthine dehydrogenase accessory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_09870 2143 1619 gene locus_tag LOCUS_09880 2143 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence235 >Feature sequence236 >Feature sequence237 185 847 gene locus_tag LOCUS_09890 185 847 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868855.1 protein_id gnl|my_center|LOCUS_09890 1741 821 gene locus_tag LOCUS_09900 1741 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2036 1960 gene locus_tag LOCUS_t00440 2036 1960 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence238 <2091 414 gene locus_tag LOCUS_09910 <2091 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:calcium-binding protein >Feature sequence239 <1 1528 gene locus_tag LOCUS_09920 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870512.1:thermosome subunit <2064 1519 gene locus_tag LOCUS_09930 <2064 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962368.1:L-threonine 3-dehydrogenase >Feature sequence240 >Feature sequence241 <1 601 gene locus_tag LOCUS_09940 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003588846.1:NADH-dependent flavin oxidoreductase >Feature sequence242 <2056 826 gene locus_tag LOCUS_09950 <2056 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:phosphoenolpyruvate synthase >Feature sequence243 1541 1257 gene locus_tag LOCUS_09960 1541 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence244 <1 517 gene locus_tag LOCUS_09970 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031395.1:membrane protein 683 1108 gene locus_tag LOCUS_09980 683 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1542 1105 gene locus_tag LOCUS_09990 1542 1105 CDS product deoxycytidylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035384.1 protein_id gnl|my_center|LOCUS_09990 1866 1555 gene locus_tag LOCUS_10000 1866 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence245 1086 1520 gene locus_tag LOCUS_10010 1086 1520 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903746.1 protein_id gnl|my_center|LOCUS_10010 1984 1523 gene locus_tag LOCUS_10020 1984 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence246 <1939 1291 gene locus_tag LOCUS_10030 <1939 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846716.1:tyrosine--tRNA ligase >Feature sequence247 370 294 gene locus_tag LOCUS_t00450 370 294 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 424 969 gene locus_tag LOCUS_10040 424 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 997 1800 gene locus_tag LOCUS_10050 997 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1824 1900 gene locus_tag LOCUS_t00460 1824 1900 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence248 839 513 gene locus_tag LOCUS_10060 839 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence249 >Feature sequence250 >Feature sequence251 1734 955 gene locus_tag LOCUS_10070 1734 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence252 <1 1496 gene locus_tag LOCUS_10080 <1 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031209.1:MFS transporter >Feature sequence253 1543 1677 gene locus_tag LOCUS_10090 1543 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence254 >Feature sequence255 <1 1480 gene locus_tag LOCUS_10100 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256158.1:pyruvate ferredoxin oxidoreductase >Feature sequence256 <1 1100 gene locus_tag LOCUS_10110 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878768.1:carbamoyl phosphate synthase small subunit >Feature sequence257 <1796 830 gene locus_tag LOCUS_10120 <1796 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762130.1:asparagine--tRNA ligase >Feature sequence258 <1 1147 gene locus_tag LOCUS_10130 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000190761.1:amino acid ABC transporter permease >Feature sequence259 954 574 gene locus_tag LOCUS_10140 954 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence260 >Feature sequence261 427 903 gene locus_tag LOCUS_10150 427 903 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_10150 903 1409 gene locus_tag LOCUS_10160 903 1409 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875664.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence262 <1 1208 gene locus_tag LOCUS_10170 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump >Feature sequence263 >Feature sequence264 924 1676 gene locus_tag LOCUS_10180 924 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence265 1134 175 gene locus_tag LOCUS_10190 1134 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence266 610 134 gene locus_tag LOCUS_10200 610 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 <1715 681 gene locus_tag LOCUS_10210 <1715 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804928.1:FAD-linked oxidoreductase >Feature sequence267 >Feature sequence268 809 1162 gene locus_tag LOCUS_10220 809 1162 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence269 1378 164 gene locus_tag LOCUS_10230 1378 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence270 <1673 1125 gene locus_tag LOCUS_10240 <1673 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889182.1:hydrolase >Feature sequence271 528 1087 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcatccgagttgtctcccactccgtcatcgtc >Feature sequence272 <1 1500 gene locus_tag LOCUS_10250 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289223.1:phospholipase >Feature sequence273 >Feature sequence274 >Feature sequence275 >Feature sequence276 >Feature sequence277 674 24 gene locus_tag LOCUS_10260 674 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 <1617 707 gene locus_tag LOCUS_10270 <1617 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869512.1:glutamyl-tRNA(Gln) amidotransferase subunit D >Feature sequence278 1535 111 gene locus_tag LOCUS_10280 1535 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence279 >Feature sequence280 >Feature sequence281 <1592 842 gene locus_tag LOCUS_10290 <1592 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877838.1:conjugal transfer protein TraB >Feature sequence282 426 1379 gene locus_tag LOCUS_10300 426 1379 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence283 108 992 gene locus_tag LOCUS_10310 108 992 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813139.1 protein_id gnl|my_center|LOCUS_10310 <1554 989 gene locus_tag LOCUS_10320 <1554 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942108.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB >Feature sequence284 >Feature sequence285 <1 538 gene locus_tag LOCUS_10330 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q1WSM5:glutamate dehydrogenase 1380 613 gene locus_tag LOCUS_10340 gene glnQ 1380 613 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence286 1302 910 gene locus_tag LOCUS_10350 1302 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148883.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence287 >Feature sequence288 <1 1115 gene locus_tag LOCUS_10360 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870898.1:carbamoyl phosphate synthase large subunit >Feature sequence289 >Feature sequence290 <1 744 gene locus_tag LOCUS_10370 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671452.1:xanthine/uracil permease 825 1367 gene locus_tag LOCUS_10380 gene apt 825 1367 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NII9 protein_id gnl|my_center|LOCUS_10380 >Feature sequence291 1357 791 gene locus_tag LOCUS_10390 1357 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence292 >Feature sequence293 885 184 gene locus_tag LOCUS_10400 885 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence294 >Feature sequence295 >Feature sequence296 1173 463 gene locus_tag LOCUS_10410 gene rlmB 1173 463 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942108.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence297 935 225 gene locus_tag LOCUS_10420 gene menG 935 225 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_10420 1059 1376 gene locus_tag LOCUS_10430 1059 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence298 >Feature sequence299 <1387 533 gene locus_tag LOCUS_10440 <1387 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902142.1:sugar kinase >Feature sequence300 265 1332 gene locus_tag LOCUS_10450 265 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence301 >Feature sequence302 >Feature sequence303 395 694 gene locus_tag LOCUS_10460 395 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 790 641 gene locus_tag LOCUS_10470 790 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 909 1205 gene locus_tag LOCUS_10480 909 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence304 34 690 gene locus_tag LOCUS_10490 34 690 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902392.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence305 >Feature sequence306 >Feature sequence307 1088 486 gene locus_tag LOCUS_10500 1088 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence308 <1333 187 gene locus_tag LOCUS_10510 <1333 187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005785160.1:flotillin >Feature sequence309 1236 376 gene locus_tag LOCUS_10520 1236 376 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022831.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence310 >Feature sequence311 >Feature sequence312 1230 1146 gene locus_tag LOCUS_t00470 1230 1146 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence313 <1283 49 gene locus_tag LOCUS_10530 <1283 49 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141076.1:folylpolyglutamate synthase >Feature sequence314 >Feature sequence315 <1 708 gene locus_tag LOCUS_10540 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DGG0:aminotransferase 744 1118 gene locus_tag LOCUS_10550 gene speD 744 1118 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DBG3 protein_id gnl|my_center|LOCUS_10550 >Feature sequence316 >Feature sequence317 1131 73 gene locus_tag LOCUS_10560 1131 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065870.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence318 >Feature sequence319 10 85 gene locus_tag LOCUS_t00480 10 85 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence320 >Feature sequence321 >Feature sequence322 >Feature sequence323 >Feature sequence324 465 232 gene locus_tag LOCUS_10570 465 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 994 467 gene locus_tag LOCUS_10580 994 467 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121177.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence325 >Feature sequence326 >Feature sequence327 >Feature sequence328 >Feature sequence329 156 884 gene locus_tag LOCUS_10590 gene rpiA 156 884 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81CG8 protein_id gnl|my_center|LOCUS_10590 931 1007 gene locus_tag LOCUS_t00490 931 1007 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence330 <1155 60 gene locus_tag LOCUS_10600 <1155 60 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to K0MEK0:bifunctional purine biosynthesis protein PurH >Feature sequence331 >Feature sequence332 >Feature sequence333 >Feature sequence334 15 728 gene locus_tag LOCUS_10610 15 728 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249138.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence335 477 142 gene locus_tag LOCUS_10620 477 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence336 1 219 gene locus_tag LOCUS_10630 1 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 305 847 gene locus_tag LOCUS_10640 305 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence337 <1096 316 gene locus_tag LOCUS_10650 <1096 316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66911:UvrABC system protein A >Feature sequence338 >Feature sequence339 346 816 gene locus_tag LOCUS_10660 346 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence340 >Feature sequence341 624 355 gene locus_tag LOCUS_10670 624 355 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255973.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence342 <1069 326 gene locus_tag LOCUS_10680 <1069 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061017.1:type II methionyl aminopeptidase >Feature sequence343 >Feature sequence344 >Feature sequence345 >Feature sequence346 >Feature sequence347 <1042 182 gene locus_tag LOCUS_10690 <1042 182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9I0L5:isocitrate dehydrogenase [NADP] >Feature sequence348 701 922 gene locus_tag LOCUS_10700 701 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence349 >Feature sequence350 >Feature sequence351 48 124 gene locus_tag LOCUS_t00500 48 124 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence352 <1 935 gene locus_tag LOCUS_10710 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259581.1:GHMP kinase >Feature sequence353 >Feature sequence354 >Feature sequence355