>Feature sequence001 412 660 gene locus_tag LOCUS_00010 412 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1021 683 gene locus_tag LOCUS_00020 1021 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1770 1084 gene locus_tag LOCUS_00030 1770 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 1874 2080 gene locus_tag LOCUS_00040 1874 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3283 2087 gene locus_tag LOCUS_00050 3283 2087 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762266.1 protein_id gnl|my_center|LOCUS_00050 4881 3280 gene locus_tag LOCUS_00060 4881 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5279 4926 gene locus_tag LOCUS_00070 5279 4926 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_00070 5346 6482 gene locus_tag LOCUS_00080 5346 6482 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_00080 6721 6987 gene locus_tag LOCUS_00090 6721 6987 CDS product effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_00090 7038 9179 gene locus_tag LOCUS_00100 7038 9179 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846861.1 protein_id gnl|my_center|LOCUS_00100 9182 9478 gene locus_tag LOCUS_00110 9182 9478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10381 9494 gene locus_tag LOCUS_00120 10381 9494 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_00120 10497 11567 gene locus_tag LOCUS_00130 10497 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11570 11962 gene locus_tag LOCUS_00140 11570 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867794.1 protein_id gnl|my_center|LOCUS_00140 12047 12574 gene locus_tag LOCUS_00150 12047 12574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 12633 12830 gene locus_tag LOCUS_00160 12633 12830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12879 13136 gene locus_tag LOCUS_00170 12879 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 13195 13383 gene locus_tag LOCUS_00180 13195 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13927 13550 gene locus_tag LOCUS_00190 13927 13550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 14574 14080 gene locus_tag LOCUS_00200 14574 14080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_00200 15755 14586 gene locus_tag LOCUS_00210 15755 14586 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_00210 15854 16438 gene locus_tag LOCUS_00220 15854 16438 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_00220 16440 16628 gene locus_tag LOCUS_00230 16440 16628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 16673 17488 gene locus_tag LOCUS_00240 16673 17488 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_00240 17886 17485 gene locus_tag LOCUS_00250 17886 17485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 18807 17890 gene locus_tag LOCUS_00260 18807 17890 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA69 protein_id gnl|my_center|LOCUS_00260 19757 18939 gene locus_tag LOCUS_00270 gene nadX 19757 18939 CDS product L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_00270 20010 20801 gene locus_tag LOCUS_00280 20010 20801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 20798 22330 gene locus_tag LOCUS_00290 20798 22330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980185.1 protein_id gnl|my_center|LOCUS_00290 22330 23472 gene locus_tag LOCUS_00300 22330 23472 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980186.1 protein_id gnl|my_center|LOCUS_00300 23469 25538 gene locus_tag LOCUS_00310 23469 25538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 26073 25525 gene locus_tag LOCUS_00320 26073 25525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 26923 26114 gene locus_tag LOCUS_00330 26923 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 27404 26916 gene locus_tag LOCUS_00340 27404 26916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 27503 28168 gene locus_tag LOCUS_00350 27503 28168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 28739 28170 gene locus_tag LOCUS_00360 28739 28170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 29259 28741 gene locus_tag LOCUS_00370 29259 28741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 29489 30145 gene locus_tag LOCUS_00380 29489 30145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 30142 30657 gene locus_tag LOCUS_00390 30142 30657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 31445 30654 gene locus_tag LOCUS_00400 31445 30654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 32496 31564 gene locus_tag LOCUS_00410 32496 31564 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_00410 33970 32561 gene locus_tag LOCUS_00420 33970 32561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 34117 35478 gene locus_tag LOCUS_00430 gene ansB 34117 35478 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963597.1 protein_id gnl|my_center|LOCUS_00430 35482 36750 gene locus_tag LOCUS_00440 35482 36750 CDS product threonylcarbamoyladenosine tRNA methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_00440 36824 37771 gene locus_tag LOCUS_00450 36824 37771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 38058 37831 gene locus_tag LOCUS_00460 38058 37831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 >Feature sequence002 1697 717 gene locus_tag LOCUS_00470 gene bioB 1697 717 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MBZ3 protein_id gnl|my_center|LOCUS_00470 3052 1769 gene locus_tag LOCUS_00480 gene bioA 3052 1769 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_00480 3240 3392 gene locus_tag LOCUS_00490 3240 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 3911 3441 gene locus_tag LOCUS_00500 3911 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 4076 4762 gene locus_tag LOCUS_00510 gene bioD 4076 4762 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53558 protein_id gnl|my_center|LOCUS_00510 5318 4770 gene locus_tag LOCUS_00520 5318 4770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 6738 5344 gene locus_tag LOCUS_00530 6738 5344 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_00530 7544 6846 gene locus_tag LOCUS_00540 7544 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 7608 8672 gene locus_tag LOCUS_00550 7608 8672 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_00550 8859 8999 gene locus_tag LOCUS_00560 8859 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 10205 8952 gene locus_tag LOCUS_00570 10205 8952 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_00570 11690 10353 gene locus_tag LOCUS_00580 11690 10353 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_00580 11767 12165 gene locus_tag LOCUS_00590 11767 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 12779 12459 gene locus_tag LOCUS_00600 12779 12459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 13293 12844 gene locus_tag LOCUS_00610 13293 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 13883 13350 gene locus_tag LOCUS_00620 13883 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 14445 14666 gene locus_tag LOCUS_00630 14445 14666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 15021 15221 gene locus_tag LOCUS_00640 15021 15221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 15263 16096 gene locus_tag LOCUS_00650 15263 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 16391 16083 gene locus_tag LOCUS_00660 16391 16083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 17497 16388 gene locus_tag LOCUS_00670 17497 16388 CDS product 3-ketoacyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064582.1 protein_id gnl|my_center|LOCUS_00670 18336 17500 gene locus_tag LOCUS_00680 18336 17500 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027908.1 protein_id gnl|my_center|LOCUS_00680 18464 18712 gene locus_tag LOCUS_00690 18464 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 19392 18724 gene locus_tag LOCUS_00700 19392 18724 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_00700 19700 19440 gene locus_tag LOCUS_00710 19700 19440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 20230 19835 gene locus_tag LOCUS_00720 20230 19835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 20632 20330 gene locus_tag LOCUS_00730 20632 20330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 21275 21054 gene locus_tag LOCUS_00740 21275 21054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 21849 22139 gene locus_tag LOCUS_00750 21849 22139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 22495 22163 gene locus_tag LOCUS_00760 22495 22163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 23009 23191 gene locus_tag LOCUS_00770 23009 23191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 23912 23490 gene locus_tag LOCUS_00780 23912 23490 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_00780 24169 24693 gene locus_tag LOCUS_00790 24169 24693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 24946 24737 gene locus_tag LOCUS_00800 24946 24737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 25077 25451 gene locus_tag LOCUS_00810 25077 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 25861 26094 gene locus_tag LOCUS_00820 25861 26094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 26235 26465 gene locus_tag LOCUS_00830 26235 26465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26951 27208 gene locus_tag LOCUS_00840 26951 27208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 27814 27353 gene locus_tag LOCUS_00850 27814 27353 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355850.1 protein_id gnl|my_center|LOCUS_00850 27926 28357 gene locus_tag LOCUS_00860 27926 28357 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023217.1 protein_id gnl|my_center|LOCUS_00860 29214 28360 gene locus_tag LOCUS_00870 29214 28360 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876847.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence003 1153 605 gene locus_tag LOCUS_00880 1153 605 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 protein_id gnl|my_center|LOCUS_00880 1227 1961 gene locus_tag LOCUS_00890 1227 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4460 1962 gene locus_tag LOCUS_00900 4460 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00900 5454 4492 gene locus_tag LOCUS_00910 5454 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00910 5562 6662 gene locus_tag LOCUS_00920 5562 6662 CDS product multidrug efflux MFS transporter NorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830321.1 protein_id gnl|my_center|LOCUS_00920 7424 6666 gene locus_tag LOCUS_00930 7424 6666 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_00930 8194 7430 gene locus_tag LOCUS_00940 8194 7430 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_00940 9217 8195 gene locus_tag LOCUS_00950 9217 8195 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030652.1 protein_id gnl|my_center|LOCUS_00950 9341 10540 gene locus_tag LOCUS_00960 gene argG 9341 10540 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0N9 protein_id gnl|my_center|LOCUS_00960 10537 10704 gene locus_tag LOCUS_00970 10537 10704 CDS product sulfonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_00970 10704 11561 gene locus_tag LOCUS_00980 gene lysX 10704 11561 CDS product alpha-aminoadipate--LysW ligase LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SH23 protein_id gnl|my_center|LOCUS_00980 11590 12636 gene locus_tag LOCUS_00990 11590 12636 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_00990 12639 13442 gene locus_tag LOCUS_01000 12639 13442 CDS product acetylaminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_01000 13435 14616 gene locus_tag LOCUS_01010 gene argD 13435 14616 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH5 protein_id gnl|my_center|LOCUS_01010 14603 15022 gene locus_tag LOCUS_01020 14603 15022 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727656.1 protein_id gnl|my_center|LOCUS_01020 15140 16306 gene locus_tag LOCUS_01030 15140 16306 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_01030 16329 16496 gene locus_tag LOCUS_01040 16329 16496 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256239.1 protein_id gnl|my_center|LOCUS_01040 16493 17335 gene locus_tag LOCUS_01050 16493 17335 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_01050 17338 18465 gene locus_tag LOCUS_01060 gene lysK 17338 18465 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH3 protein_id gnl|my_center|LOCUS_01060 18465 19502 gene locus_tag LOCUS_01070 18465 19502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 19547 20164 gene locus_tag LOCUS_01080 19547 20164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 20844 20161 gene locus_tag LOCUS_01090 20844 20161 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020596.1 protein_id gnl|my_center|LOCUS_01090 21998 20853 gene locus_tag LOCUS_01100 21998 20853 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_01100 >Feature sequence004 996 451 gene locus_tag LOCUS_01110 996 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1215 2888 gene locus_tag LOCUS_01120 1215 2888 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980252.1 protein_id gnl|my_center|LOCUS_01120 2929 3405 gene locus_tag LOCUS_01130 2929 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 5116 3425 gene locus_tag LOCUS_01140 5116 3425 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211185.1 protein_id gnl|my_center|LOCUS_01140 5194 5517 gene locus_tag LOCUS_01150 5194 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 6605 6072 gene locus_tag LOCUS_01160 6605 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 7269 7015 gene locus_tag LOCUS_01170 7269 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 7395 7538 gene locus_tag LOCUS_01180 7395 7538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 7562 8164 gene locus_tag LOCUS_01190 7562 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 8195 8539 gene locus_tag LOCUS_01200 8195 8539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 8665 8814 gene locus_tag LOCUS_01210 8665 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 10015 8819 gene locus_tag LOCUS_01220 10015 8819 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064422.1 protein_id gnl|my_center|LOCUS_01220 10788 10012 gene locus_tag LOCUS_01230 10788 10012 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870432.1 protein_id gnl|my_center|LOCUS_01230 11827 10781 gene locus_tag LOCUS_01240 gene trpD 11827 10781 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZML2 protein_id gnl|my_center|LOCUS_01240 12414 11824 gene locus_tag LOCUS_01250 12414 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01250 13760 12411 gene locus_tag LOCUS_01260 13760 12411 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_01260 15226 14240 gene locus_tag LOCUS_01270 15226 14240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 16372 15764 gene locus_tag LOCUS_01280 16372 15764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 16487 16684 gene locus_tag LOCUS_01290 16487 16684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 16952 17374 gene locus_tag LOCUS_01300 16952 17374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 17915 17376 gene locus_tag LOCUS_01310 17915 17376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 18311 17961 gene locus_tag LOCUS_01320 18311 17961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 18317 18619 gene locus_tag LOCUS_01330 18317 18619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 19146 18751 gene locus_tag LOCUS_01340 19146 18751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 19992 19501 gene locus_tag LOCUS_01350 19992 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 20332 20661 gene locus_tag LOCUS_01360 20332 20661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 >Feature sequence005 838 2166 gene locus_tag LOCUS_01370 838 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2159 2587 gene locus_tag LOCUS_01380 2159 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2665 2589 gene locus_tag LOCUS_t00010 2665 2589 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2730 2993 gene locus_tag LOCUS_01390 2730 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 3494 2985 gene locus_tag LOCUS_01400 3494 2985 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_01400 3592 4155 gene locus_tag LOCUS_01410 3592 4155 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_01410 4808 4152 gene locus_tag LOCUS_01420 4808 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5576 5280 gene locus_tag LOCUS_01430 5576 5280 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947495.1 protein_id gnl|my_center|LOCUS_01430 6335 5838 gene locus_tag LOCUS_01440 6335 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 6469 6705 gene locus_tag LOCUS_01450 6469 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 7154 8023 gene locus_tag LOCUS_01460 7154 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 8549 8010 gene locus_tag LOCUS_01470 8549 8010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8657 10972 gene locus_tag LOCUS_01480 8657 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 11319 10981 gene locus_tag LOCUS_01490 11319 10981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 11512 12186 gene locus_tag LOCUS_01500 11512 12186 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_01500 13103 12183 gene locus_tag LOCUS_01510 gene ureD 13103 12183 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNC5 protein_id gnl|my_center|LOCUS_01510 13762 13106 gene locus_tag LOCUS_01520 gene ureG 13762 13106 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P69992 protein_id gnl|my_center|LOCUS_01520 14481 13780 gene locus_tag LOCUS_01530 14481 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 14944 14471 gene locus_tag LOCUS_01540 14944 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 15031 15336 gene locus_tag LOCUS_01550 gene ureA 15031 15336 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYE2 protein_id gnl|my_center|LOCUS_01550 15338 15706 gene locus_tag LOCUS_01560 gene ureB 15338 15706 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CND0 protein_id gnl|my_center|LOCUS_01560 15703 17415 gene locus_tag LOCUS_01570 gene ureC 15703 17415 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63RL3 protein_id gnl|my_center|LOCUS_01570 17552 19525 gene locus_tag LOCUS_01580 17552 19525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 19525 20049 gene locus_tag LOCUS_01590 19525 20049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20665 20591 gene locus_tag LOCUS_t00020 20665 20591 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence006 876 241 gene locus_tag LOCUS_01600 876 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2446 1109 gene locus_tag LOCUS_01610 2446 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 2591 4324 gene locus_tag LOCUS_01620 2591 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 4372 5250 gene locus_tag LOCUS_01630 4372 5250 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_01630 5250 6197 gene locus_tag LOCUS_01640 5250 6197 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870216.1 protein_id gnl|my_center|LOCUS_01640 6194 7093 gene locus_tag LOCUS_01650 gene rnz 6194 7093 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_01650 7511 7098 gene locus_tag LOCUS_01660 7511 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7990 7595 gene locus_tag LOCUS_01670 7990 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8538 7987 gene locus_tag LOCUS_01680 8538 7987 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_01680 8608 9147 gene locus_tag LOCUS_01690 8608 9147 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_01690 9147 10478 gene locus_tag LOCUS_01700 9147 10478 CDS product tRNA CCA-pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870623.1 protein_id gnl|my_center|LOCUS_01700 10453 11214 gene locus_tag LOCUS_01710 10453 11214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 11288 11215 gene locus_tag LOCUS_t00030 11288 11215 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11345 11560 gene locus_tag LOCUS_01720 11345 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12703 11555 gene locus_tag LOCUS_01730 12703 11555 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_01730 13445 12705 gene locus_tag LOCUS_01740 13445 12705 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_01740 13559 13780 gene locus_tag LOCUS_01750 13559 13780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 14068 13784 gene locus_tag LOCUS_01760 14068 13784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 14657 14100 gene locus_tag LOCUS_01770 14657 14100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 14711 16171 gene locus_tag LOCUS_01780 14711 16171 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_01780 16446 16168 gene locus_tag LOCUS_01790 16446 16168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 18228 16507 gene locus_tag LOCUS_01800 18228 16507 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_01800 18323 19645 gene locus_tag LOCUS_01810 18323 19645 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_01810 <20237 19648 gene locus_tag LOCUS_01820 <20237 19648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903745.1:intein-containing DNA polymerase II large subunit >Feature sequence007 1636 1019 gene locus_tag LOCUS_01830 1636 1019 CDS product ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_01830 1710 3809 gene locus_tag LOCUS_01840 1710 3809 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_01840 4577 3819 gene locus_tag LOCUS_01850 4577 3819 CDS product arsenite S-adenosylmethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_01850 5383 4610 gene locus_tag LOCUS_01860 5383 4610 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJI0 protein_id gnl|my_center|LOCUS_01860 7075 5513 gene locus_tag LOCUS_01870 7075 5513 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM12 protein_id gnl|my_center|LOCUS_01870 7206 7874 gene locus_tag LOCUS_01880 7206 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 7926 8963 gene locus_tag LOCUS_01890 gene ntpC 7926 8963 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380540.1 protein_id gnl|my_center|LOCUS_01890 8974 9210 gene locus_tag LOCUS_01900 8974 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 9244 9906 gene locus_tag LOCUS_01910 9244 9906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 10103 9951 gene locus_tag LOCUS_01920 10103 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 10737 10162 gene locus_tag LOCUS_01930 10737 10162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 10799 11149 gene locus_tag LOCUS_01940 10799 11149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 11836 11150 gene locus_tag LOCUS_01950 11836 11150 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_01950 13068 11833 gene locus_tag LOCUS_01960 13068 11833 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146536.1 protein_id gnl|my_center|LOCUS_01960 13667 13065 gene locus_tag LOCUS_01970 13667 13065 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_01970 13824 14000 gene locus_tag LOCUS_01980 13824 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 14013 14435 gene locus_tag LOCUS_01990 14013 14435 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742669.1 protein_id gnl|my_center|LOCUS_01990 15981 14437 gene locus_tag LOCUS_02000 15981 14437 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979711.1 protein_id gnl|my_center|LOCUS_02000 16369 15986 gene locus_tag LOCUS_02010 16369 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 16667 16479 gene locus_tag LOCUS_02020 16667 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 18130 16820 gene locus_tag LOCUS_02030 18130 16820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 18774 18130 gene locus_tag LOCUS_02040 18774 18130 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021673.1 protein_id gnl|my_center|LOCUS_02040 20038 18827 gene locus_tag LOCUS_02050 20038 18827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876334.1 protein_id gnl|my_center|LOCUS_02050 >Feature sequence008 921 148 gene locus_tag LOCUS_02060 921 148 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_02060 1591 962 gene locus_tag LOCUS_02070 1591 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2127 1633 gene locus_tag LOCUS_02080 2127 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082186.1 protein_id gnl|my_center|LOCUS_02080 2516 2166 gene locus_tag LOCUS_02090 2516 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 2645 3109 gene locus_tag LOCUS_02100 gene mntR 2645 3109 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y623 protein_id gnl|my_center|LOCUS_02100 4933 3110 gene locus_tag LOCUS_02110 4933 3110 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496860.1 protein_id gnl|my_center|LOCUS_02110 5231 6646 gene locus_tag LOCUS_02120 5231 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870510.1 protein_id gnl|my_center|LOCUS_02120 6648 7241 gene locus_tag LOCUS_02130 6648 7241 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_02130 7225 7782 gene locus_tag LOCUS_02140 7225 7782 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NH09 protein_id gnl|my_center|LOCUS_02140 7877 8500 gene locus_tag LOCUS_02150 7877 8500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 9246 8602 gene locus_tag LOCUS_02160 9246 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_02160 9364 9864 gene locus_tag LOCUS_02170 9364 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 9995 10369 gene locus_tag LOCUS_02180 9995 10369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10499 10786 gene locus_tag LOCUS_02190 10499 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11727 10789 gene locus_tag LOCUS_02200 11727 10789 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_02200 11810 12316 gene locus_tag LOCUS_02210 11810 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 12322 13608 gene locus_tag LOCUS_02220 12322 13608 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_02220 14340 13912 gene locus_tag LOCUS_02230 14340 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 14753 15007 gene locus_tag LOCUS_02240 14753 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 15807 15052 gene locus_tag LOCUS_02250 15807 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 17066 16053 gene locus_tag LOCUS_02260 17066 16053 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_02260 18706 17201 gene locus_tag LOCUS_02270 18706 17201 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_02270 19185 18703 gene locus_tag LOCUS_02280 19185 18703 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence009 1378 1073 gene locus_tag LOCUS_02290 gene ndhE 1378 1073 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_02290 1871 1359 gene locus_tag LOCUS_02300 gene ndhG 1871 1359 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_02300 2361 1864 gene locus_tag LOCUS_02310 2361 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3674 2361 gene locus_tag LOCUS_02320 3674 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4811 3675 gene locus_tag LOCUS_02330 4811 3675 CDS product NADH dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_02330 5392 4814 gene locus_tag LOCUS_02340 5392 4814 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846746.1 protein_id gnl|my_center|LOCUS_02340 5940 5392 gene locus_tag LOCUS_02350 gene nuoB 5940 5392 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0F5 protein_id gnl|my_center|LOCUS_02350 6288 5956 gene locus_tag LOCUS_02360 6288 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6445 6909 gene locus_tag LOCUS_02370 6445 6909 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_02370 7435 6920 gene locus_tag LOCUS_02380 7435 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 8936 7440 gene locus_tag LOCUS_02390 gene accC 8936 7440 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_02390 10480 8933 gene locus_tag LOCUS_02400 10480 8933 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_02400 10887 10564 gene locus_tag LOCUS_02410 10887 10564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 12041 10884 gene locus_tag LOCUS_02420 12041 10884 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_02420 13177 12050 gene locus_tag LOCUS_02430 13177 12050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 13254 14051 gene locus_tag LOCUS_02440 13254 14051 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876504.1 protein_id gnl|my_center|LOCUS_02440 14131 14973 gene locus_tag LOCUS_02450 14131 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 15047 15214 gene locus_tag LOCUS_02460 15047 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 16298 15222 gene locus_tag LOCUS_02470 16298 15222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 17032 16313 gene locus_tag LOCUS_02480 17032 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 17226 17149 gene locus_tag LOCUS_t00040 17226 17149 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 17323 17397 gene locus_tag LOCUS_t00050 17323 17397 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <18983 17800 gene locus_tag LOCUS_02490 <18983 17800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to E8T9L6:argininosuccinate lyase >Feature sequence010 <1 631 gene locus_tag LOCUS_02500 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867247.1:5'-methylthioadenosine phosphorylase 912 628 gene locus_tag LOCUS_02510 912 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1319 921 gene locus_tag LOCUS_02520 1319 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 1695 1342 gene locus_tag LOCUS_02530 1695 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1963 1742 gene locus_tag LOCUS_02540 1963 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 2122 2493 gene locus_tag LOCUS_02550 2122 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3624 2494 gene locus_tag LOCUS_02560 3624 2494 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_02560 5479 3605 gene locus_tag LOCUS_02570 5479 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6038 5466 gene locus_tag LOCUS_02580 6038 5466 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496497.1 protein_id gnl|my_center|LOCUS_02580 6813 6028 gene locus_tag LOCUS_02590 6813 6028 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060945.1 protein_id gnl|my_center|LOCUS_02590 7169 6873 gene locus_tag LOCUS_02600 7169 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7591 7169 gene locus_tag LOCUS_02610 7591 7169 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_02610 7812 7660 gene locus_tag LOCUS_02620 7812 7660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8067 8564 gene locus_tag LOCUS_02630 8067 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 8635 9780 gene locus_tag LOCUS_02640 8635 9780 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_02640 9859 10650 gene locus_tag LOCUS_02650 9859 10650 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_02650 10647 11066 gene locus_tag LOCUS_02660 10647 11066 CDS product diadenosine 5'5'''-P1,P4-tetraphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_02660 11786 11046 gene locus_tag LOCUS_02670 11786 11046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 12453 11767 gene locus_tag LOCUS_02680 12453 11767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 13504 12503 gene locus_tag LOCUS_02690 13504 12503 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_02690 13585 14046 gene locus_tag LOCUS_02700 13585 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14330 14043 gene locus_tag LOCUS_02710 14330 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 14402 14617 gene locus_tag LOCUS_02720 14402 14617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 14678 15325 gene locus_tag LOCUS_02730 14678 15325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 15429 15716 gene locus_tag LOCUS_02740 15429 15716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 >Feature sequence011 190 1176 gene locus_tag LOCUS_02750 190 1176 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709972.1 protein_id gnl|my_center|LOCUS_02750 1228 2313 gene locus_tag LOCUS_02760 1228 2313 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704109.1 protein_id gnl|my_center|LOCUS_02760 2310 2612 gene locus_tag LOCUS_02770 2310 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2908 2609 gene locus_tag LOCUS_02780 2908 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2949 3362 gene locus_tag LOCUS_02790 2949 3362 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031220.1 protein_id gnl|my_center|LOCUS_02790 3362 4066 gene locus_tag LOCUS_02800 3362 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4067 5347 gene locus_tag LOCUS_02810 4067 5347 CDS product glutamate-1-semialdehyde-2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496557.1 protein_id gnl|my_center|LOCUS_02810 5344 6279 gene locus_tag LOCUS_02820 gene hemC 5344 6279 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6X5 protein_id gnl|my_center|LOCUS_02820 6276 7016 gene locus_tag LOCUS_02830 6276 7016 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002025533.1 protein_id gnl|my_center|LOCUS_02830 7016 7816 gene locus_tag LOCUS_02840 7016 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 7893 9308 gene locus_tag LOCUS_02850 7893 9308 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976894.1 protein_id gnl|my_center|LOCUS_02850 9331 10731 gene locus_tag LOCUS_02860 9331 10731 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989989.1 protein_id gnl|my_center|LOCUS_02860 10737 11045 gene locus_tag LOCUS_02870 10737 11045 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_02870 11049 12293 gene locus_tag LOCUS_02880 11049 12293 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4M4 protein_id gnl|my_center|LOCUS_02880 12290 12733 gene locus_tag LOCUS_02890 12290 12733 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_02890 12735 13082 gene locus_tag LOCUS_02900 12735 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 14301 13075 gene locus_tag LOCUS_02910 14301 13075 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_02910 14490 15092 gene locus_tag LOCUS_02920 14490 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 15392 15081 gene locus_tag LOCUS_02930 15392 15081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence012 246 1370 gene locus_tag LOCUS_02940 246 1370 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KM3 protein_id gnl|my_center|LOCUS_02940 1588 2319 gene locus_tag LOCUS_02950 gene ccdA 1588 2319 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_02950 2316 3422 gene locus_tag LOCUS_02960 2316 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 3515 4165 gene locus_tag LOCUS_02970 3515 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_02970 4537 4187 gene locus_tag LOCUS_02980 4537 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 4970 4563 gene locus_tag LOCUS_02990 4970 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 5265 5101 gene locus_tag LOCUS_03000 5265 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5348 8014 gene locus_tag LOCUS_03010 5348 8014 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064577.1 protein_id gnl|my_center|LOCUS_03010 8011 8628 gene locus_tag LOCUS_03020 8011 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 9348 8932 gene locus_tag LOCUS_03030 9348 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869701.1 protein_id gnl|my_center|LOCUS_03030 9400 10137 gene locus_tag LOCUS_03040 gene psmA 9400 10137 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_03040 10170 10976 gene locus_tag LOCUS_03050 10170 10976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_03050 11188 12183 gene locus_tag LOCUS_03060 11188 12183 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_03060 12183 12995 gene locus_tag LOCUS_03070 12183 12995 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_03070 12992 13258 gene locus_tag LOCUS_03080 12992 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 13303 13698 gene locus_tag LOCUS_03090 13303 13698 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_03090 13704 14162 gene locus_tag LOCUS_03100 13704 14162 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_03100 14165 14950 gene locus_tag LOCUS_03110 14165 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 14947 15153 gene locus_tag LOCUS_03120 14947 15153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 15150 15416 gene locus_tag LOCUS_03130 15150 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 15413 15736 gene locus_tag LOCUS_03140 15413 15736 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence013 236 412 gene locus_tag LOCUS_03150 236 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 519 1214 gene locus_tag LOCUS_03160 519 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1544 1323 gene locus_tag LOCUS_03170 1544 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2192 1557 gene locus_tag LOCUS_03180 2192 1557 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 protein_id gnl|my_center|LOCUS_03180 2629 2174 gene locus_tag LOCUS_03190 2629 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 4223 2658 gene locus_tag LOCUS_03200 4223 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5871 4309 gene locus_tag LOCUS_03210 5871 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 6663 5872 gene locus_tag LOCUS_03220 6663 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8167 6704 gene locus_tag LOCUS_03230 8167 6704 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 protein_id gnl|my_center|LOCUS_03230 8777 8346 gene locus_tag LOCUS_03240 8777 8346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869709.1 protein_id gnl|my_center|LOCUS_03240 9413 8802 gene locus_tag LOCUS_03250 9413 8802 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_03250 10719 9454 gene locus_tag LOCUS_03260 10719 9454 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_03260 10961 10719 gene locus_tag LOCUS_03270 10961 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 12345 10924 gene locus_tag LOCUS_03280 12345 10924 CDS product recombinase RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_03280 12794 12345 gene locus_tag LOCUS_03290 12794 12345 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762532.1 protein_id gnl|my_center|LOCUS_03290 12918 13250 gene locus_tag LOCUS_03300 12918 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 13362 13631 gene locus_tag LOCUS_03310 13362 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 14303 13776 gene locus_tag LOCUS_03320 14303 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 15219 14650 gene locus_tag LOCUS_03330 15219 14650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence014 398 147 gene locus_tag LOCUS_03340 398 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1828 425 gene locus_tag LOCUS_03350 1828 425 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846244.1 protein_id gnl|my_center|LOCUS_03350 3273 1825 gene locus_tag LOCUS_03360 gene gatA2 3273 1825 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX8 protein_id gnl|my_center|LOCUS_03360 3536 3270 gene locus_tag LOCUS_03370 3536 3270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 4115 4546 gene locus_tag LOCUS_03380 4115 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142683.1 protein_id gnl|my_center|LOCUS_03380 5101 4727 gene locus_tag LOCUS_03390 5101 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5213 5638 gene locus_tag LOCUS_03400 5213 5638 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808355.1 protein_id gnl|my_center|LOCUS_03400 5643 5948 gene locus_tag LOCUS_03410 5643 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 6021 6350 gene locus_tag LOCUS_03420 6021 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 6746 6612 gene locus_tag LOCUS_03430 6746 6612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 7942 7037 gene locus_tag LOCUS_03440 7942 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9517 8222 gene locus_tag LOCUS_03450 9517 8222 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066482.1 protein_id gnl|my_center|LOCUS_03450 10081 9701 gene locus_tag LOCUS_03460 10081 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10798 10085 gene locus_tag LOCUS_03470 10798 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 11128 13248 gene locus_tag LOCUS_03480 11128 13248 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_03480 14285 13389 gene locus_tag LOCUS_03490 14285 13389 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878358.1 protein_id gnl|my_center|LOCUS_03490 14717 14301 gene locus_tag LOCUS_03500 gene uspA1 14717 14301 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW6 protein_id gnl|my_center|LOCUS_03500 15162 14728 gene locus_tag LOCUS_03510 gene uspA1 15162 14728 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KLW6 protein_id gnl|my_center|LOCUS_03510 15512 15162 gene locus_tag LOCUS_03520 15512 15162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence015 439 1632 gene locus_tag LOCUS_03530 gene purK 439 1632 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYS8 protein_id gnl|my_center|LOCUS_03530 2962 1763 gene locus_tag LOCUS_03540 2962 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3047 3433 gene locus_tag LOCUS_03550 3047 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3618 3430 gene locus_tag LOCUS_03560 3618 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4088 3924 gene locus_tag LOCUS_03570 4088 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 4060 5031 gene locus_tag LOCUS_03580 4060 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_03580 5028 5528 gene locus_tag LOCUS_03590 5028 5528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 6269 6021 gene locus_tag LOCUS_03600 6269 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 6975 6457 gene locus_tag LOCUS_03610 6975 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7074 7424 gene locus_tag LOCUS_03620 7074 7424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7459 8046 gene locus_tag LOCUS_03630 7459 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 8091 8474 gene locus_tag LOCUS_03640 8091 8474 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000199022.1 protein_id gnl|my_center|LOCUS_03640 8805 8632 gene locus_tag LOCUS_03650 8805 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 8922 9449 gene locus_tag LOCUS_03660 8922 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10447 9452 gene locus_tag LOCUS_03670 10447 9452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 12014 10614 gene locus_tag LOCUS_03680 12014 10614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 12402 12202 gene locus_tag LOCUS_03690 12402 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 13807 13520 gene locus_tag LOCUS_03700 13807 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 <14696 13889 gene locus_tag LOCUS_03710 <14696 13889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015887528.1:metal transporter >Feature sequence016 429 353 gene locus_tag LOCUS_t00060 429 353 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 1016 462 gene locus_tag LOCUS_03720 1016 462 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_03720 1096 1170 gene locus_tag LOCUS_t00070 1096 1170 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1476 2588 gene locus_tag LOCUS_03730 1476 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2622 3095 gene locus_tag LOCUS_03740 2622 3095 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_03740 3151 3480 gene locus_tag LOCUS_03750 3151 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3554 4321 gene locus_tag LOCUS_03760 3554 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4619 4338 gene locus_tag LOCUS_03770 4619 4338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5728 4616 gene locus_tag LOCUS_03780 5728 4616 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_03780 5780 7168 gene locus_tag LOCUS_03790 5780 7168 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_03790 7159 8808 gene locus_tag LOCUS_03800 7159 8808 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_03800 8986 8798 gene locus_tag LOCUS_03810 8986 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9321 9740 gene locus_tag LOCUS_03820 9321 9740 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_03820 9784 10023 gene locus_tag LOCUS_03830 9784 10023 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_03830 10042 10608 gene locus_tag LOCUS_03840 10042 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 11255 10623 gene locus_tag LOCUS_03850 11255 10623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 11412 13679 gene locus_tag LOCUS_03860 gene acn 11412 13679 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_03860 13762 13688 gene locus_tag LOCUS_t00080 13762 13688 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence017 1373 915 gene locus_tag LOCUS_03870 1373 915 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_03870 1494 2210 gene locus_tag LOCUS_03880 1494 2210 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377790.1 protein_id gnl|my_center|LOCUS_03880 2259 2696 gene locus_tag LOCUS_03890 2259 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 2689 3501 gene locus_tag LOCUS_03900 2689 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 3714 4274 gene locus_tag LOCUS_03910 3714 4274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4364 4439 gene locus_tag LOCUS_t00090 4364 4439 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4503 4898 gene locus_tag LOCUS_03920 4503 4898 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113682.1 protein_id gnl|my_center|LOCUS_03920 5324 4899 gene locus_tag LOCUS_03930 5324 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 5603 6157 gene locus_tag LOCUS_03940 gene tag 5603 6157 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_03940 6479 6168 gene locus_tag LOCUS_03950 6479 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6595 6963 gene locus_tag LOCUS_03960 6595 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 7152 6979 gene locus_tag LOCUS_03970 7152 6979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 7486 7187 gene locus_tag LOCUS_03980 7486 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 7875 8321 gene locus_tag LOCUS_03990 7875 8321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 9104 8316 gene locus_tag LOCUS_04000 9104 8316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9343 9143 gene locus_tag LOCUS_04010 9343 9143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10932 9346 gene locus_tag LOCUS_04020 gene lysS 10932 9346 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RX38 protein_id gnl|my_center|LOCUS_04020 12534 10942 gene locus_tag LOCUS_04030 12534 10942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_04030 <13648 12558 gene locus_tag LOCUS_04040 <13648 12558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963766.1:potassium transporter >Feature sequence018 914 405 gene locus_tag LOCUS_04050 914 405 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_04050 1254 907 gene locus_tag LOCUS_04060 1254 907 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_04060 1938 1303 gene locus_tag LOCUS_04070 1938 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2026 2712 gene locus_tag LOCUS_04080 2026 2712 CDS product rRNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_04080 2712 3392 gene locus_tag LOCUS_04090 2712 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3392 4126 gene locus_tag LOCUS_04100 3392 4126 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_04100 4129 4947 gene locus_tag LOCUS_04110 4129 4947 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053857.1 protein_id gnl|my_center|LOCUS_04110 4949 5161 gene locus_tag LOCUS_04120 4949 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 5145 5390 gene locus_tag LOCUS_04130 5145 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 5414 5809 gene locus_tag LOCUS_04140 5414 5809 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_04140 5863 6543 gene locus_tag LOCUS_04150 5863 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 6595 7413 gene locus_tag LOCUS_04160 gene pp26 6595 7413 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972105.1 protein_id gnl|my_center|LOCUS_04160 7901 7419 gene locus_tag LOCUS_04170 7901 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_04170 8706 7891 gene locus_tag LOCUS_04180 8706 7891 CDS product inorganic polyphosphate/ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_04180 8969 9916 gene locus_tag LOCUS_04190 8969 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 9967 12033 gene locus_tag LOCUS_04200 9967 12033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 <13269 12030 gene locus_tag LOCUS_04210 <13269 12030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583312.1:chromosome segregation protein SMC >Feature sequence019 393 282 gene locus_tag LOCUS_r00010 393 282 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 492 2279 gene locus_tag LOCUS_04220 492 2279 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_04220 2276 3112 gene locus_tag LOCUS_04230 2276 3112 CDS product tRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_04230 3335 3105 gene locus_tag LOCUS_04240 3335 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3875 3450 gene locus_tag LOCUS_04250 3875 3450 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_04250 4021 5127 gene locus_tag LOCUS_04260 4021 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 6201 5119 gene locus_tag LOCUS_04270 6201 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 6252 6857 gene locus_tag LOCUS_04280 6252 6857 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_04280 7044 6971 gene locus_tag LOCUS_t00100 7044 6971 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7718 7086 gene locus_tag LOCUS_04290 7718 7086 CDS product PqqC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O84616 protein_id gnl|my_center|LOCUS_04290 7799 7877 gene locus_tag LOCUS_t00110 7799 7877 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7918 8769 gene locus_tag LOCUS_04300 7918 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 10306 8822 gene locus_tag LOCUS_04310 10306 8822 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_04310 12392 10320 gene locus_tag LOCUS_04320 12392 10320 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_04320 <13017 12396 gene locus_tag LOCUS_04330 <13017 12396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939561.1:oxidoreductase note possible pseudo, internal stop codon >Feature sequence020 62 595 gene locus_tag LOCUS_04340 62 595 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_04340 622 1137 gene locus_tag LOCUS_04350 622 1137 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 protein_id gnl|my_center|LOCUS_04350 1487 1197 gene locus_tag LOCUS_04360 1487 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2047 1490 gene locus_tag LOCUS_04370 2047 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2436 2140 gene locus_tag LOCUS_04380 2436 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3129 2473 gene locus_tag LOCUS_04390 3129 2473 CDS product diaminohydroxyphosphoribosylaminopyrimidine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_04390 4306 3116 gene locus_tag LOCUS_04400 4306 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_04400 5052 4306 gene locus_tag LOCUS_04410 5052 4306 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_04410 5468 5049 gene locus_tag LOCUS_04420 5468 5049 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496458.1 protein_id gnl|my_center|LOCUS_04420 6133 5468 gene locus_tag LOCUS_04430 6133 5468 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_04430 6830 6207 gene locus_tag LOCUS_04440 gene ribE 6830 6207 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67604 protein_id gnl|my_center|LOCUS_04440 7558 6854 gene locus_tag LOCUS_04450 7558 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 8417 7563 gene locus_tag LOCUS_04460 8417 7563 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_04460 9504 8425 gene locus_tag LOCUS_04470 9504 8425 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_04470 9830 9546 gene locus_tag LOCUS_04480 9830 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_04480 10289 9837 gene locus_tag LOCUS_04490 10289 9837 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250227.1 protein_id gnl|my_center|LOCUS_04490 11893 10424 gene locus_tag LOCUS_04500 11893 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 12201 11938 gene locus_tag LOCUS_04510 12201 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 12363 12290 gene locus_tag LOCUS_t00120 12363 12290 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <12949 12386 gene locus_tag LOCUS_04520 <12949 12386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867891.1:16S rRNA methyltransferase >Feature sequence021 853 1413 gene locus_tag LOCUS_04530 853 1413 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_04530 1775 1446 gene locus_tag LOCUS_04540 1775 1446 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762104.1 protein_id gnl|my_center|LOCUS_04540 2010 1813 gene locus_tag LOCUS_04550 2010 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2140 2598 gene locus_tag LOCUS_04560 2140 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2603 3811 gene locus_tag LOCUS_04570 2603 3811 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_04570 3883 4095 gene locus_tag LOCUS_04580 3883 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4142 5272 gene locus_tag LOCUS_04590 4142 5272 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_04590 5316 6485 gene locus_tag LOCUS_04600 5316 6485 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496498.1 protein_id gnl|my_center|LOCUS_04600 6482 7741 gene locus_tag LOCUS_04610 6482 7741 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870949.1 protein_id gnl|my_center|LOCUS_04610 7742 9100 gene locus_tag LOCUS_04620 7742 9100 CDS product PmbA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_04620 10005 9115 gene locus_tag LOCUS_04630 gene yrbG 10005 9115 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_04630 10272 10616 gene locus_tag LOCUS_04640 10272 10616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10639 11364 gene locus_tag LOCUS_04650 10639 11364 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240307.1 protein_id gnl|my_center|LOCUS_04650 11414 12436 gene locus_tag LOCUS_04660 11414 12436 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence022 <1 865 gene locus_tag LOCUS_04670 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869821.1:elongation factor 1-alpha 876 1184 gene locus_tag LOCUS_04680 876 1184 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_04680 1224 1430 gene locus_tag LOCUS_04690 1224 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2050 1631 gene locus_tag LOCUS_04700 2050 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2274 2152 gene locus_tag LOCUS_04710 2274 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 2349 2858 gene locus_tag LOCUS_04720 2349 2858 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_04720 3987 2848 gene locus_tag LOCUS_04730 3987 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 4471 4638 gene locus_tag LOCUS_04740 4471 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4622 4918 gene locus_tag LOCUS_04750 4622 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4957 5364 gene locus_tag LOCUS_04760 4957 5364 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_04760 6029 5361 gene locus_tag LOCUS_04770 6029 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6444 6082 gene locus_tag LOCUS_04780 6444 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_04780 6905 6450 gene locus_tag LOCUS_04790 6905 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 7025 7753 gene locus_tag LOCUS_04800 7025 7753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8569 7748 gene locus_tag LOCUS_04810 8569 7748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 8726 8607 gene locus_tag LOCUS_04820 8726 8607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 8808 9164 gene locus_tag LOCUS_04830 8808 9164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10478 9174 gene locus_tag LOCUS_04840 gene hemL 10478 9174 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_04840 10858 12322 gene locus_tag LOCUS_r00020 10858 12322 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence023 530 1471 gene locus_tag LOCUS_04850 530 1471 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865197.1 protein_id gnl|my_center|LOCUS_04850 1533 2396 gene locus_tag LOCUS_04860 1533 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2393 3754 gene locus_tag LOCUS_04870 2393 3754 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228459.1 protein_id gnl|my_center|LOCUS_04870 4167 3751 gene locus_tag LOCUS_04880 gene mhqP 4167 3751 CDS product putative oxidoreductase MhqP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96694 protein_id gnl|my_center|LOCUS_04880 4332 4928 gene locus_tag LOCUS_04890 4332 4928 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_04890 5443 4967 gene locus_tag LOCUS_04900 5443 4967 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763381.1 protein_id gnl|my_center|LOCUS_04900 6450 5440 gene locus_tag LOCUS_04910 6450 5440 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_04910 6990 6592 gene locus_tag LOCUS_04920 gene msrB 6990 6592 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885Q1 protein_id gnl|my_center|LOCUS_04920 8647 7028 gene locus_tag LOCUS_04930 8647 7028 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_04930 8973 8680 gene locus_tag LOCUS_04940 8973 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 9108 9986 gene locus_tag LOCUS_04950 9108 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 10042 11940 gene locus_tag LOCUS_04960 10042 11940 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459120.1 protein_id gnl|my_center|LOCUS_04960 12397 11942 gene locus_tag LOCUS_04970 12397 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence024 1480 1055 gene locus_tag LOCUS_04980 1480 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2185 1565 gene locus_tag LOCUS_04990 gene sodA 2185 1565 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_04990 2263 4290 gene locus_tag LOCUS_05000 2263 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5896 4292 gene locus_tag LOCUS_05010 gene pckA2 5896 4292 CDS product phosphoenolpyruvate carboxykinase [ATP] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH96 protein_id gnl|my_center|LOCUS_05010 6040 6444 gene locus_tag LOCUS_05020 6040 6444 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_05020 6428 6883 gene locus_tag LOCUS_05030 6428 6883 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_05030 7179 6880 gene locus_tag LOCUS_05040 7179 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7952 7176 gene locus_tag LOCUS_05050 7952 7176 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878129.1 protein_id gnl|my_center|LOCUS_05050 7992 8165 gene locus_tag LOCUS_05060 7992 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 8168 8626 gene locus_tag LOCUS_05070 8168 8626 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_05070 8661 9140 gene locus_tag LOCUS_05080 8661 9140 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_05080 9596 9141 gene locus_tag LOCUS_05090 9596 9141 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496594.1 protein_id gnl|my_center|LOCUS_05090 9754 10425 gene locus_tag LOCUS_05100 9754 10425 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_05100 10418 11284 gene locus_tag LOCUS_05110 10418 11284 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868902.1 protein_id gnl|my_center|LOCUS_05110 11919 11281 gene locus_tag LOCUS_05120 11919 11281 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_05120 12299 11997 gene locus_tag LOCUS_05130 12299 11997 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_05130 >Feature sequence025 283 900 gene locus_tag LOCUS_05140 283 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 901 1521 gene locus_tag LOCUS_05150 gene yedJ 901 1521 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261932.1 protein_id gnl|my_center|LOCUS_05150 1829 1518 gene locus_tag LOCUS_05160 1829 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 2806 1826 gene locus_tag LOCUS_05170 gene hemB 2806 1826 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW7 protein_id gnl|my_center|LOCUS_05170 4109 2838 gene locus_tag LOCUS_05180 4109 2838 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_05180 4753 4100 gene locus_tag LOCUS_05190 4753 4100 CDS product siroheme synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846218.1 protein_id gnl|my_center|LOCUS_05190 4848 5867 gene locus_tag LOCUS_05200 4848 5867 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_05200 6202 5864 gene locus_tag LOCUS_05210 6202 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 7208 6210 gene locus_tag LOCUS_05220 7208 6210 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_05220 7974 7300 gene locus_tag LOCUS_05230 7974 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_05230 8232 8023 gene locus_tag LOCUS_05240 8232 8023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 9032 8262 gene locus_tag LOCUS_05250 9032 8262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929160.1 protein_id gnl|my_center|LOCUS_05250 10082 9126 gene locus_tag LOCUS_05260 gene tfb 10082 9126 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_05260 10327 10079 gene locus_tag LOCUS_05270 10327 10079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 10722 10423 gene locus_tag LOCUS_05280 10722 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 11107 10724 gene locus_tag LOCUS_05290 11107 10724 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978126.1 protein_id gnl|my_center|LOCUS_05290 11749 11171 gene locus_tag LOCUS_05300 11749 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 >Feature sequence026 1373 1026 gene locus_tag LOCUS_05310 1373 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 1610 1819 gene locus_tag LOCUS_05320 1610 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 1825 2484 gene locus_tag LOCUS_05330 1825 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 2538 3236 gene locus_tag LOCUS_05340 2538 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3544 4419 gene locus_tag LOCUS_05350 3544 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6022 4577 gene locus_tag LOCUS_05360 6022 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 6156 6884 gene locus_tag LOCUS_05370 6156 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 6930 7709 gene locus_tag LOCUS_05380 6930 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 8552 9577 gene locus_tag LOCUS_05390 gene purP 8552 9577 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869629.1 protein_id gnl|my_center|LOCUS_05390 9591 9812 gene locus_tag LOCUS_05400 9591 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 10598 9834 gene locus_tag LOCUS_05410 10598 9834 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254058.1 protein_id gnl|my_center|LOCUS_05410 11448 10618 gene locus_tag LOCUS_05420 11448 10618 CDS product methionine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014748640.1 protein_id gnl|my_center|LOCUS_05420 <12142 11466 gene locus_tag LOCUS_05430 <12142 11466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016927.1:phosphonates-binding protein >Feature sequence027 366 638 gene locus_tag LOCUS_05440 366 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1246 635 gene locus_tag LOCUS_05450 1246 635 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_05450 1999 1283 gene locus_tag LOCUS_05460 1999 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3000 2032 gene locus_tag LOCUS_05470 3000 2032 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_05470 3083 4177 gene locus_tag LOCUS_05480 3083 4177 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_05480 4915 4178 gene locus_tag LOCUS_05490 4915 4178 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_05490 5112 8663 gene locus_tag LOCUS_05500 5112 8663 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_05500 10371 9400 gene locus_tag LOCUS_05510 10371 9400 CDS product oligopeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002677558.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence028 1703 1906 gene locus_tag LOCUS_05520 1703 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2493 1909 gene locus_tag LOCUS_05530 2493 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2578 2859 gene locus_tag LOCUS_05540 2578 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3078 2863 gene locus_tag LOCUS_05550 3078 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 3139 3327 gene locus_tag LOCUS_05560 3139 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3608 3534 gene locus_tag LOCUS_t00130 3608 3534 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3663 4961 gene locus_tag LOCUS_05570 3663 4961 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_05570 4945 5895 gene locus_tag LOCUS_05580 gene thiL 4945 5895 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57532 protein_id gnl|my_center|LOCUS_05580 6216 5896 gene locus_tag LOCUS_05590 6216 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 6333 6881 gene locus_tag LOCUS_05600 6333 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 7189 6878 gene locus_tag LOCUS_05610 7189 6878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7599 7186 gene locus_tag LOCUS_05620 7599 7186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 9044 7596 gene locus_tag LOCUS_05630 9044 7596 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_05630 9247 10608 gene locus_tag LOCUS_05640 9247 10608 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence029 570 1013 gene locus_tag LOCUS_05650 570 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_05650 1010 1351 gene locus_tag LOCUS_05660 1010 1351 CDS product NagC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_05660 1425 1760 gene locus_tag LOCUS_05670 1425 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2221 2042 gene locus_tag LOCUS_05680 2221 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2374 2234 gene locus_tag LOCUS_05690 2374 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2692 3120 gene locus_tag LOCUS_05700 2692 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3196 3498 gene locus_tag LOCUS_05710 3196 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3491 4822 gene locus_tag LOCUS_05720 3491 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496732.1 protein_id gnl|my_center|LOCUS_05720 4881 5369 gene locus_tag LOCUS_05730 4881 5369 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_05730 5424 5837 gene locus_tag LOCUS_05740 5424 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 6537 5857 gene locus_tag LOCUS_05750 6537 5857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 6917 6534 gene locus_tag LOCUS_05760 6917 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979704.1 protein_id gnl|my_center|LOCUS_05760 7224 6985 gene locus_tag LOCUS_05770 7224 6985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 7345 7938 gene locus_tag LOCUS_05780 7345 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8408 7902 gene locus_tag LOCUS_05790 8408 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 8509 8435 gene locus_tag LOCUS_t00140 8509 8435 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8554 9729 gene locus_tag LOCUS_05800 8554 9729 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_05800 10124 9723 gene locus_tag LOCUS_05810 10124 9723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 10341 10108 gene locus_tag LOCUS_05820 10341 10108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 >Feature sequence030 3502 689 gene locus_tag LOCUS_05830 gene uvrA 3502 689 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7B1 protein_id gnl|my_center|LOCUS_05830 5441 3492 gene locus_tag LOCUS_05840 5441 3492 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_05840 6127 5495 gene locus_tag LOCUS_05850 6127 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6226 6450 gene locus_tag LOCUS_05860 6226 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6657 7076 gene locus_tag LOCUS_05870 6657 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7378 7073 gene locus_tag LOCUS_05880 7378 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 8465 7350 gene locus_tag LOCUS_05890 8465 7350 CDS product N5,N10-methylene tetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878692.1 protein_id gnl|my_center|LOCUS_05890 9499 8555 gene locus_tag LOCUS_05900 9499 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 >Feature sequence031 247 876 gene locus_tag LOCUS_05910 247 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251227.1 protein_id gnl|my_center|LOCUS_05910 1148 909 gene locus_tag LOCUS_05920 1148 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 2730 1420 gene locus_tag LOCUS_05930 2730 1420 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875865.1 protein_id gnl|my_center|LOCUS_05930 2838 3032 gene locus_tag LOCUS_05940 2838 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3069 3278 gene locus_tag LOCUS_05950 3069 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 3552 3863 gene locus_tag LOCUS_05960 3552 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4084 3860 gene locus_tag LOCUS_05970 4084 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 4680 4090 gene locus_tag LOCUS_05980 4680 4090 CDS product oxetanocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_05980 4709 5260 gene locus_tag LOCUS_05990 4709 5260 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_05990 5288 5362 gene locus_tag LOCUS_t00150 5288 5362 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 5755 5576 gene locus_tag LOCUS_06000 5755 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5969 6910 gene locus_tag LOCUS_06010 5969 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 6910 8727 gene locus_tag LOCUS_06020 6910 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 8865 9128 gene locus_tag LOCUS_06030 8865 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 9128 9469 gene locus_tag LOCUS_06040 9128 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 9689 9895 gene locus_tag LOCUS_06050 9689 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence032 420 79 gene locus_tag LOCUS_06060 420 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 533 1963 gene locus_tag LOCUS_06070 533 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2069 2983 gene locus_tag LOCUS_06080 gene tfb 2069 2983 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_06080 3411 3001 gene locus_tag LOCUS_06090 3411 3001 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978531.1 protein_id gnl|my_center|LOCUS_06090 3842 3450 gene locus_tag LOCUS_06100 3842 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 3763 4512 gene locus_tag LOCUS_06110 3763 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 4502 5578 gene locus_tag LOCUS_06120 gene phbC 4502 5578 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_06120 6073 5657 gene locus_tag LOCUS_06130 6073 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6915 6109 gene locus_tag LOCUS_06140 6915 6109 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_06140 7000 7431 gene locus_tag LOCUS_06150 gene uspA 7000 7431 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFV2 protein_id gnl|my_center|LOCUS_06150 7889 7437 gene locus_tag LOCUS_06160 7889 7437 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_06160 8327 7944 gene locus_tag LOCUS_06170 8327 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9252 8413 gene locus_tag LOCUS_06180 9252 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 9371 9850 gene locus_tag LOCUS_06190 9371 9850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence033 1185 991 gene locus_tag LOCUS_06200 1185 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1431 1228 gene locus_tag LOCUS_06210 1431 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3422 1536 gene locus_tag LOCUS_06220 3422 1536 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_06220 4134 3424 gene locus_tag LOCUS_06230 4134 3424 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_06230 4244 5359 gene locus_tag LOCUS_06240 4244 5359 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061317.1 protein_id gnl|my_center|LOCUS_06240 5640 6002 gene locus_tag LOCUS_06250 5640 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7042 7592 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cctttgtcaccagttgcacc 8127 9251 gene locus_tag LOCUS_06260 8127 9251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 <9868 9253 gene locus_tag LOCUS_06270 <9868 9253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67668:sulfurtransferase >Feature sequence034 1307 2443 gene locus_tag LOCUS_06280 1307 2443 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_06280 2509 2919 gene locus_tag LOCUS_06290 2509 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 2957 4723 gene locus_tag LOCUS_06300 gene lig 2957 4723 CDS product putative DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67398 protein_id gnl|my_center|LOCUS_06300 4790 5443 gene locus_tag LOCUS_06310 4790 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 5533 6069 gene locus_tag LOCUS_06320 5533 6069 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_06320 6443 6066 gene locus_tag LOCUS_06330 6443 6066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 6682 6446 gene locus_tag LOCUS_06340 6682 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 6780 8552 gene locus_tag LOCUS_06350 6780 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 8555 8995 gene locus_tag LOCUS_06360 8555 8995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 9128 9280 gene locus_tag LOCUS_06370 9128 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence035 983 531 gene locus_tag LOCUS_06380 983 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1072 1389 gene locus_tag LOCUS_06390 1072 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1993 1421 gene locus_tag LOCUS_06400 1993 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2885 2064 gene locus_tag LOCUS_06410 2885 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3279 2887 gene locus_tag LOCUS_06420 3279 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4619 3321 gene locus_tag LOCUS_06430 4619 3321 CDS product ammonia channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461712.1 protein_id gnl|my_center|LOCUS_06430 4733 5062 gene locus_tag LOCUS_06440 4733 5062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5201 5470 gene locus_tag LOCUS_06450 5201 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 6248 5604 gene locus_tag LOCUS_06460 6248 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 6330 6809 gene locus_tag LOCUS_06470 6330 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7171 6812 gene locus_tag LOCUS_06480 7171 6812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 8699 7236 gene locus_tag LOCUS_06490 8699 7236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 8886 9053 gene locus_tag LOCUS_06500 8886 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence036 489 73 gene locus_tag LOCUS_06510 489 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 597 1547 gene locus_tag LOCUS_06520 597 1547 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_06520 1658 2803 gene locus_tag LOCUS_06530 1658 2803 CDS product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146468.1 protein_id gnl|my_center|LOCUS_06530 2923 3450 gene locus_tag LOCUS_06540 2923 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 4252 3461 gene locus_tag LOCUS_06550 4252 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140685.1 protein_id gnl|my_center|LOCUS_06550 5179 4259 gene locus_tag LOCUS_06560 5179 4259 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_06560 5483 6763 gene locus_tag LOCUS_06570 5483 6763 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250513.1 protein_id gnl|my_center|LOCUS_06570 7415 6744 gene locus_tag LOCUS_06580 7415 6744 CDS product translation initiation factor 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868639.1 protein_id gnl|my_center|LOCUS_06580 7548 8057 gene locus_tag LOCUS_06590 7548 8057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 8128 8673 gene locus_tag LOCUS_06600 8128 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8746 8831 gene locus_tag LOCUS_t00160 8746 8831 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <9439 8832 gene locus_tag LOCUS_06610 <9439 8832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762410.1:ATPase AAA >Feature sequence037 1477 533 gene locus_tag LOCUS_06620 1477 533 CDS product asparagine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763183.1 protein_id gnl|my_center|LOCUS_06620 1585 2001 gene locus_tag LOCUS_06630 1585 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 2288 1998 gene locus_tag LOCUS_06640 2288 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 2846 2349 gene locus_tag LOCUS_06650 2846 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2934 3284 gene locus_tag LOCUS_06660 2934 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 3568 3266 gene locus_tag LOCUS_06670 3568 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3916 3746 gene locus_tag LOCUS_06680 3916 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4127 4354 gene locus_tag LOCUS_06690 4127 4354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 5439 4363 gene locus_tag LOCUS_06700 5439 4363 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_06700 5552 5887 gene locus_tag LOCUS_06710 5552 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5950 7818 gene locus_tag LOCUS_06720 5950 7818 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_06720 7826 8698 gene locus_tag LOCUS_06730 gene speB 7826 8698 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence038 1282 2226 gene locus_tag LOCUS_06740 1282 2226 CDS product daunorubicin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024091.1 protein_id gnl|my_center|LOCUS_06740 2210 2971 gene locus_tag LOCUS_06750 2210 2971 CDS product daunorubicin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061277.1 protein_id gnl|my_center|LOCUS_06750 3718 2981 gene locus_tag LOCUS_06760 3718 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3860 3786 gene locus_tag LOCUS_t00170 3860 3786 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4958 3930 gene locus_tag LOCUS_06770 4958 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876418.1 protein_id gnl|my_center|LOCUS_06770 5022 6161 gene locus_tag LOCUS_06780 5022 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 6188 6787 gene locus_tag LOCUS_06790 gene grpE 6188 6787 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DJM3 protein_id gnl|my_center|LOCUS_06790 6780 8708 gene locus_tag LOCUS_06800 gene dnaK 6780 8708 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX4 protein_id gnl|my_center|LOCUS_06800 >Feature sequence039 1565 873 gene locus_tag LOCUS_06810 gene menG 1565 873 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHX3 protein_id gnl|my_center|LOCUS_06810 2340 1615 gene locus_tag LOCUS_06820 2340 1615 CDS product proteasome endopeptidase complex,subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_06820 2579 3853 gene locus_tag LOCUS_06830 2579 3853 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_06830 4551 4378 gene locus_tag LOCUS_06840 4551 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 4627 5310 gene locus_tag LOCUS_06850 4627 5310 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080220.1 protein_id gnl|my_center|LOCUS_06850 5352 7469 gene locus_tag LOCUS_06860 5352 7469 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085943.1 protein_id gnl|my_center|LOCUS_06860 7506 8267 gene locus_tag LOCUS_06870 gene crt2 7506 8267 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_06870 8375 8725 gene locus_tag LOCUS_06880 gene sufA 8375 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32113 protein_id gnl|my_center|LOCUS_06880 >Feature sequence040 351 1016 gene locus_tag LOCUS_06890 gene tal 351 1016 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66520 protein_id gnl|my_center|LOCUS_06890 1302 1072 gene locus_tag LOCUS_06900 1302 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2520 1498 gene locus_tag LOCUS_06910 gene corA 2520 1498 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2H8 protein_id gnl|my_center|LOCUS_06910 2712 2784 gene locus_tag LOCUS_t00180 2712 2784 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3140 2793 gene locus_tag LOCUS_06920 3140 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3941 3183 gene locus_tag LOCUS_06930 3941 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4236 3967 gene locus_tag LOCUS_06940 4236 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_06940 4580 4272 gene locus_tag LOCUS_06950 gene hcaC 4580 4272 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_06950 4620 5399 gene locus_tag LOCUS_06960 4620 5399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 6265 5396 gene locus_tag LOCUS_06970 6265 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_06970 7981 6272 gene locus_tag LOCUS_06980 7981 6272 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_06980 <8608 8002 gene locus_tag LOCUS_06990 <8608 8002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980132.1:geranylgeranyl pyrophosphate synthase >Feature sequence041 824 1387 gene locus_tag LOCUS_07000 824 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1387 1878 gene locus_tag LOCUS_07010 1387 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1884 3077 gene locus_tag LOCUS_07020 1884 3077 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_07020 3282 4310 gene locus_tag LOCUS_07030 3282 4310 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 protein_id gnl|my_center|LOCUS_07030 4312 7554 gene locus_tag LOCUS_07040 4312 7554 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64SZ4 protein_id gnl|my_center|LOCUS_07040 7636 7938 gene locus_tag LOCUS_07050 7636 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 7987 8238 gene locus_tag LOCUS_07060 7987 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence042 623 177 gene locus_tag LOCUS_07070 623 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1651 650 gene locus_tag LOCUS_07080 1651 650 CDS product H/ACA RNA-protein complex protein Cbf5p inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877749.1 protein_id gnl|my_center|LOCUS_07080 2208 1648 gene locus_tag LOCUS_07090 2208 1648 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_07090 2837 2205 gene locus_tag LOCUS_07100 2837 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3395 2841 gene locus_tag LOCUS_07110 3395 2841 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_07110 4839 3406 gene locus_tag LOCUS_07120 4839 3406 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_07120 5299 4853 gene locus_tag LOCUS_07130 5299 4853 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_07130 5768 5301 gene locus_tag LOCUS_07140 5768 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6502 5774 gene locus_tag LOCUS_07150 6502 5774 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_07150 6986 6504 gene locus_tag LOCUS_07160 6986 6504 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879399.1 protein_id gnl|my_center|LOCUS_07160 7938 7015 gene locus_tag LOCUS_07170 7938 7015 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence043 1465 857 gene locus_tag LOCUS_07180 1465 857 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_07180 2118 1462 gene locus_tag LOCUS_07190 2118 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2184 2798 gene locus_tag LOCUS_07200 2184 2798 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496416.1 protein_id gnl|my_center|LOCUS_07200 2897 2811 gene locus_tag LOCUS_t00190 2897 2811 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2947 3183 gene locus_tag LOCUS_07210 2947 3183 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_07210 3185 4423 gene locus_tag LOCUS_07220 3185 4423 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_07220 4431 5054 gene locus_tag LOCUS_07230 4431 5054 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_07230 5074 6015 gene locus_tag LOCUS_07240 5074 6015 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870599.1 protein_id gnl|my_center|LOCUS_07240 6039 6791 gene locus_tag LOCUS_07250 6039 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_07250 6784 7434 gene locus_tag LOCUS_07260 6784 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence044 1002 841 gene locus_tag LOCUS_07270 1002 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 1437 1072 gene locus_tag LOCUS_07280 1437 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2602 1439 gene locus_tag LOCUS_07290 2602 1439 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_07290 2651 3127 gene locus_tag LOCUS_07300 2651 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3905 3108 gene locus_tag LOCUS_07310 3905 3108 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704731.1 protein_id gnl|my_center|LOCUS_07310 4254 4078 gene locus_tag LOCUS_07320 4254 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5080 4310 gene locus_tag LOCUS_07330 5080 4310 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_07330 5565 5849 gene locus_tag LOCUS_07340 5565 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7429 5861 gene locus_tag LOCUS_07350 7429 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7637 7431 gene locus_tag LOCUS_07360 7637 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 >Feature sequence045 1333 98 gene locus_tag LOCUS_07370 1333 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1451 1912 gene locus_tag LOCUS_07380 1451 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1965 2276 gene locus_tag LOCUS_07390 1965 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2509 2285 gene locus_tag LOCUS_07400 2509 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 3024 2848 gene locus_tag LOCUS_07410 3024 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 3275 3066 gene locus_tag LOCUS_07420 3275 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3559 3326 gene locus_tag LOCUS_07430 3559 3326 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_07430 4264 3611 gene locus_tag LOCUS_07440 4264 3611 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_07440 4499 4317 gene locus_tag LOCUS_07450 4499 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5241 4624 gene locus_tag LOCUS_07460 5241 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5718 5350 gene locus_tag LOCUS_07470 5718 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6130 5720 gene locus_tag LOCUS_07480 6130 5720 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_07480 6207 6734 gene locus_tag LOCUS_07490 6207 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6771 7769 gene locus_tag LOCUS_07500 6771 7769 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence046 89 616 gene locus_tag LOCUS_07510 gene nudF 89 616 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54570 protein_id gnl|my_center|LOCUS_07510 1578 643 gene locus_tag LOCUS_07520 1578 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_07520 1687 2580 gene locus_tag LOCUS_07530 1687 2580 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876216.1 protein_id gnl|my_center|LOCUS_07530 2589 3329 gene locus_tag LOCUS_07540 2589 3329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_07540 3322 4137 gene locus_tag LOCUS_07550 gene panB 3322 4137 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYW9 protein_id gnl|my_center|LOCUS_07550 4130 5371 gene locus_tag LOCUS_07560 4130 5371 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_07560 5368 6213 gene locus_tag LOCUS_07570 5368 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 6419 6228 gene locus_tag LOCUS_07580 6419 6228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7162 6509 gene locus_tag LOCUS_07590 7162 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence047 <1 1089 gene locus_tag LOCUS_07600 <1 1089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YID4:cysteine--tRNA ligase 1181 1459 gene locus_tag LOCUS_07610 1181 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2280 1456 gene locus_tag LOCUS_07620 2280 1456 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879043.1 protein_id gnl|my_center|LOCUS_07620 3041 2280 gene locus_tag LOCUS_07630 3041 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4058 3123 gene locus_tag LOCUS_07640 4058 3123 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_07640 4145 5302 gene locus_tag LOCUS_07650 4145 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867549.1 protein_id gnl|my_center|LOCUS_07650 5589 5347 gene locus_tag LOCUS_07660 5589 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6097 6014 gene locus_tag LOCUS_t00200 6097 6014 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6420 6142 gene locus_tag LOCUS_07670 6420 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence048 1021 593 gene locus_tag LOCUS_07680 1021 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1425 1057 gene locus_tag LOCUS_07690 1425 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2680 1418 gene locus_tag LOCUS_07700 2680 1418 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_07700 3110 2712 gene locus_tag LOCUS_07710 3110 2712 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_07710 3482 3309 gene locus_tag LOCUS_07720 3482 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3536 3609 gene locus_tag LOCUS_t00210 3536 3609 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4572 3610 gene locus_tag LOCUS_07730 4572 3610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5149 4607 gene locus_tag LOCUS_07740 5149 4607 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871100.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence049 <1 1440 gene locus_tag LOCUS_07750 <1 1440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979471.1:DNA polymerase I 1442 1729 gene locus_tag LOCUS_07760 1442 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 1764 2420 gene locus_tag LOCUS_07770 1764 2420 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871052.1 protein_id gnl|my_center|LOCUS_07770 2448 5126 gene locus_tag LOCUS_07780 2448 5126 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_07780 5206 5721 gene locus_tag LOCUS_07790 5206 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 6359 5754 gene locus_tag LOCUS_07800 gene drgA 6359 5754 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118380.1 protein_id gnl|my_center|LOCUS_07800 6513 6971 gene locus_tag LOCUS_07810 6513 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence050 1107 517 gene locus_tag LOCUS_07820 1107 517 CDS product cobalt-precorrin-6Y C(15)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979887.1 protein_id gnl|my_center|LOCUS_07820 1621 1139 gene locus_tag LOCUS_07830 1621 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 1717 3675 gene locus_tag LOCUS_07840 1717 3675 CDS product fibronectin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_07840 4042 3653 gene locus_tag LOCUS_07850 4042 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_07850 5193 4039 gene locus_tag LOCUS_07860 5193 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147112.1 protein_id gnl|my_center|LOCUS_07860 5248 5898 gene locus_tag LOCUS_07870 5248 5898 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876402.1 protein_id gnl|my_center|LOCUS_07870 6550 5882 gene locus_tag LOCUS_07880 6550 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 <7091 6581 gene locus_tag LOCUS_07890 <7091 6581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868287.1:sulfate adenylyltransferase >Feature sequence051 1169 516 gene locus_tag LOCUS_07900 1169 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1277 1522 gene locus_tag LOCUS_07910 1277 1522 CDS product Sm ribonucleo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_07910 1542 2711 gene locus_tag LOCUS_07920 gene metK 1542 2711 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_07920 3554 2685 gene locus_tag LOCUS_07930 3554 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3634 4737 gene locus_tag LOCUS_07940 gene cbiD 3634 4737 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP6 protein_id gnl|my_center|LOCUS_07940 4769 5821 gene locus_tag LOCUS_07950 gene cbiG 4769 5821 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 protein_id gnl|my_center|LOCUS_07950 5818 6570 gene locus_tag LOCUS_07960 5818 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence052 689 1780 gene locus_tag LOCUS_07970 689 1780 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023921.1 protein_id gnl|my_center|LOCUS_07970 2664 1792 gene locus_tag LOCUS_07980 2664 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3447 2962 gene locus_tag LOCUS_07990 3447 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4106 3447 gene locus_tag LOCUS_08000 4106 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 4335 4138 gene locus_tag LOCUS_08010 4335 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4791 4423 gene locus_tag LOCUS_08020 4791 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 4875 5261 gene locus_tag LOCUS_08030 4875 5261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 5283 6155 gene locus_tag LOCUS_08040 5283 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064924.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence053 676 1173 gene locus_tag LOCUS_08050 676 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 1245 1520 gene locus_tag LOCUS_08060 1245 1520 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABI2 protein_id gnl|my_center|LOCUS_08060 1589 2404 gene locus_tag LOCUS_08070 1589 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 2408 4726 gene locus_tag LOCUS_08080 2408 4726 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_08080 5365 4748 gene locus_tag LOCUS_08090 5365 4748 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_08090 6330 5362 gene locus_tag LOCUS_08100 6330 5362 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979488.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence054 659 150 gene locus_tag LOCUS_08110 659 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 740 3409 gene locus_tag LOCUS_08120 740 3409 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_08120 3414 6281 gene locus_tag LOCUS_08130 gene leuS 3414 6281 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence055 <1 2054 gene locus_tag LOCUS_08140 <1 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846867.1:DNA-directed RNA polymerase subunit A'' 2069 2299 gene locus_tag LOCUS_08150 2069 2299 CDS product small nuclear ribonucleoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013295846.1 protein_id gnl|my_center|LOCUS_08150 2344 3522 gene locus_tag LOCUS_08160 2344 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3617 3940 gene locus_tag LOCUS_08170 3617 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4005 4469 gene locus_tag LOCUS_08180 4005 4469 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_08180 4473 4910 gene locus_tag LOCUS_08190 4473 4910 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_08190 4913 5512 gene locus_tag LOCUS_08200 4913 5512 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_08200 5569 5657 gene locus_tag LOCUS_t00220 5569 5657 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 5985 5665 gene locus_tag LOCUS_08210 5985 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence056 1436 1254 gene locus_tag LOCUS_08220 1436 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 3202 1478 gene locus_tag LOCUS_08230 3202 1478 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_08230 4066 3254 gene locus_tag LOCUS_08240 4066 3254 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_08240 4961 4050 gene locus_tag LOCUS_08250 4961 4050 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence057 361 1281 gene locus_tag LOCUS_08260 361 1281 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_08260 1286 2890 gene locus_tag LOCUS_08270 1286 2890 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_08270 2891 3289 gene locus_tag LOCUS_08280 2891 3289 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_08280 3922 3308 gene locus_tag LOCUS_08290 3922 3308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3958 4590 gene locus_tag LOCUS_08300 gene sodA 3958 4590 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_08300 4681 4923 gene locus_tag LOCUS_08310 4681 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 5108 4950 gene locus_tag LOCUS_08320 5108 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 <6345 5213 gene locus_tag LOCUS_08330 <6345 5213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881148.1:lactate dehydrogenase >Feature sequence058 915 163 gene locus_tag LOCUS_08340 915 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2573 915 gene locus_tag LOCUS_08350 2573 915 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868104.1 protein_id gnl|my_center|LOCUS_08350 3853 2612 gene locus_tag LOCUS_08360 3853 2612 CDS product S-adenosyl-L-homocysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_08360 4476 3967 gene locus_tag LOCUS_08370 4476 3967 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_08370 4673 5008 gene locus_tag LOCUS_08380 4673 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5075 5866 gene locus_tag LOCUS_08390 5075 5866 CDS product NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence059 1239 208 gene locus_tag LOCUS_08400 1239 208 CDS product isocitrate/isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_08400 2015 1566 gene locus_tag LOCUS_08410 2015 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2115 2981 gene locus_tag LOCUS_08420 2115 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_08420 3211 2999 gene locus_tag LOCUS_08430 3211 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 3417 4610 gene locus_tag LOCUS_08440 3417 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 4617 5435 gene locus_tag LOCUS_08450 4617 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 5602 5432 gene locus_tag LOCUS_08460 5602 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5839 5678 gene locus_tag LOCUS_08470 5839 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5961 5875 gene locus_tag LOCUS_t00230 5961 5875 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence060 525 845 gene locus_tag LOCUS_08480 525 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 918 1718 gene locus_tag LOCUS_08490 918 1718 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_08490 1816 3381 gene locus_tag LOCUS_08500 gene pyrG 1816 3381 CDS product CTP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_08500 4399 3401 gene locus_tag LOCUS_08510 4399 3401 CDS product ATP-NAD/AcoX kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763693.1 protein_id gnl|my_center|LOCUS_08510 5309 4440 gene locus_tag LOCUS_08520 5309 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5561 5860 gene locus_tag LOCUS_08530 5561 5860 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence061 395 1780 gene locus_tag LOCUS_08540 395 1780 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_08540 1786 2418 gene locus_tag LOCUS_08550 gene atpD 1786 2418 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184E4 protein_id gnl|my_center|LOCUS_08550 2420 2551 gene locus_tag LOCUS_08560 2420 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2607 2912 gene locus_tag LOCUS_08570 2607 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3412 2951 gene locus_tag LOCUS_08580 3412 2951 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_08580 3454 4383 gene locus_tag LOCUS_08590 3454 4383 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_08590 4435 5145 gene locus_tag LOCUS_08600 4435 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 >Feature sequence062 39 716 gene locus_tag LOCUS_08610 39 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 823 1977 gene locus_tag LOCUS_08620 823 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 2456 2157 gene locus_tag LOCUS_08630 2456 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 3161 2559 gene locus_tag LOCUS_08640 3161 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 3188 4339 gene locus_tag LOCUS_08650 3188 4339 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877001.1 protein_id gnl|my_center|LOCUS_08650 4591 4334 gene locus_tag LOCUS_08660 4591 4334 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_08660 4818 5312 gene locus_tag LOCUS_08670 4818 5312 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_08670 5459 5313 gene locus_tag LOCUS_08680 5459 5313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 5622 5470 gene locus_tag LOCUS_08690 5622 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence063 672 436 gene locus_tag LOCUS_08700 672 436 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_08700 1451 729 gene locus_tag LOCUS_08710 1451 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704561.1 protein_id gnl|my_center|LOCUS_08710 2299 1457 gene locus_tag LOCUS_08720 2299 1457 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_08720 2438 2351 gene locus_tag LOCUS_t00240 2438 2351 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2486 3835 gene locus_tag LOCUS_08730 2486 3835 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_08730 3871 4257 gene locus_tag LOCUS_08740 3871 4257 CDS product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_08740 4254 4463 gene locus_tag LOCUS_08750 4254 4463 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762341.1 protein_id gnl|my_center|LOCUS_08750 4474 4674 gene locus_tag LOCUS_08760 4474 4674 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_08760 4677 5078 gene locus_tag LOCUS_08770 4677 5078 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence064 1165 3675 gene locus_tag LOCUS_08780 1165 3675 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064577.1 protein_id gnl|my_center|LOCUS_08780 3719 4549 gene locus_tag LOCUS_08790 3719 4549 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence065 1096 1371 gene locus_tag LOCUS_08800 1096 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1396 1770 gene locus_tag LOCUS_08810 1396 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2935 1967 gene locus_tag LOCUS_08820 2935 1967 CDS product D-glycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_08820 2988 3134 gene locus_tag LOCUS_08830 2988 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 3188 5098 gene locus_tag LOCUS_08840 3188 5098 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence066 730 233 gene locus_tag LOCUS_08850 730 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 812 1300 gene locus_tag LOCUS_08860 812 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1381 1307 gene locus_tag LOCUS_t00250 1381 1307 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1464 2168 gene locus_tag LOCUS_08870 1464 2168 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_08870 2344 2874 gene locus_tag LOCUS_08880 2344 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3540 3094 gene locus_tag LOCUS_08890 3540 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3867 3643 gene locus_tag LOCUS_08900 3867 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4048 4524 gene locus_tag LOCUS_08910 4048 4524 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence067 240 1022 gene locus_tag LOCUS_08920 240 1022 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_08920 1015 2076 gene locus_tag LOCUS_08930 1015 2076 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_08930 2078 2755 gene locus_tag LOCUS_08940 gene aroD 2078 2755 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CF39 protein_id gnl|my_center|LOCUS_08940 2791 3609 gene locus_tag LOCUS_08950 gene aroE 2791 3609 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ55 protein_id gnl|my_center|LOCUS_08950 3609 4463 gene locus_tag LOCUS_08960 3609 4463 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence068 432 103 gene locus_tag LOCUS_08970 432 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 777 562 gene locus_tag LOCUS_08980 777 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 935 1588 gene locus_tag LOCUS_08990 935 1588 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390997.1 protein_id gnl|my_center|LOCUS_08990 1638 2660 gene locus_tag LOCUS_09000 1638 2660 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146580.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09000 2697 2921 gene locus_tag LOCUS_09010 2697 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3321 2914 gene locus_tag LOCUS_09020 3321 2914 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_09020 3400 3996 gene locus_tag LOCUS_09030 3400 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4214 4005 gene locus_tag LOCUS_09040 4214 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 4536 4309 gene locus_tag LOCUS_09050 4536 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 5125 4868 gene locus_tag LOCUS_09060 5125 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence069 <1 635 gene locus_tag LOCUS_09070 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879232.1:3-hydroxy-3-methylglutaryl-CoA reductase 669 1652 gene locus_tag LOCUS_09080 gene hisG 669 1652 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ68 protein_id gnl|my_center|LOCUS_09080 1652 2923 gene locus_tag LOCUS_09090 1652 2923 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496833.1 protein_id gnl|my_center|LOCUS_09090 2920 3990 gene locus_tag LOCUS_09100 gene hisC 2920 3990 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2C4 protein_id gnl|my_center|LOCUS_09100 3987 4961 gene locus_tag LOCUS_09110 3987 4961 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence070 356 799 gene locus_tag LOCUS_09120 356 799 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_09120 799 1515 gene locus_tag LOCUS_09130 799 1515 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762314.1 protein_id gnl|my_center|LOCUS_09130 1520 2041 gene locus_tag LOCUS_09140 1520 2041 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_09140 2041 2220 gene locus_tag LOCUS_09150 gene rps14P 2041 2220 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_09150 2226 2618 gene locus_tag LOCUS_09160 2226 2618 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060728.1 protein_id gnl|my_center|LOCUS_09160 2602 3165 gene locus_tag LOCUS_09170 gene rpl6p 2602 3165 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_09170 3183 3473 gene locus_tag LOCUS_09180 3183 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3542 3616 gene locus_tag LOCUS_t00260 3542 3616 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3808 4056 gene locus_tag LOCUS_09190 3808 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 4069 4296 gene locus_tag LOCUS_09200 4069 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 4424 4873 gene locus_tag LOCUS_09210 4424 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence071 1831 728 gene locus_tag LOCUS_09220 gene sucC 1831 728 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUY3 protein_id gnl|my_center|LOCUS_09220 2201 1872 gene locus_tag LOCUS_09230 2201 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2898 2314 gene locus_tag LOCUS_09240 2898 2314 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144276.1 protein_id gnl|my_center|LOCUS_09240 <5194 2944 gene locus_tag LOCUS_09250 <5194 2944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876987.1:isoleucine--tRNA ligase >Feature sequence072 <1 593 gene locus_tag LOCUS_09260 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O66654:1,4-dihydroxy-6-naphtoate synthase 621 920 gene locus_tag LOCUS_09270 621 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1287 961 gene locus_tag LOCUS_09280 1287 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1513 1770 gene locus_tag LOCUS_09290 1513 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1886 2218 gene locus_tag LOCUS_09300 1886 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 2311 2631 gene locus_tag LOCUS_09310 2311 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2669 2974 gene locus_tag LOCUS_09320 2669 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496712.1 protein_id gnl|my_center|LOCUS_09320 4068 2971 gene locus_tag LOCUS_09330 4068 2971 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_09330 4143 4316 gene locus_tag LOCUS_09340 4143 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4890 4303 gene locus_tag LOCUS_09350 4890 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence073 1737 430 gene locus_tag LOCUS_09360 1737 430 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123294.1 protein_id gnl|my_center|LOCUS_09360 3237 1798 gene locus_tag LOCUS_09370 gene proS 3237 1798 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E028 protein_id gnl|my_center|LOCUS_09370 3586 3299 gene locus_tag LOCUS_09380 3586 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 4197 4844 gene locus_tag LOCUS_09390 4197 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence074 <1 813 gene locus_tag LOCUS_09400 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870777.1:phosphoribosylformylglycinamidine synthase 806 2245 gene locus_tag LOCUS_09410 gene purF 806 2245 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DLZ9 protein_id gnl|my_center|LOCUS_09410 4016 2406 gene locus_tag LOCUS_09420 4016 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 4646 4924 gene locus_tag LOCUS_09430 4646 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence075 878 318 gene locus_tag LOCUS_09440 878 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1134 1559 gene locus_tag LOCUS_09450 1134 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1779 2009 gene locus_tag LOCUS_09460 1779 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2157 2396 gene locus_tag LOCUS_09470 2157 2396 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_09470 2401 2925 gene locus_tag LOCUS_09480 2401 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3059 4114 gene locus_tag LOCUS_09490 3059 4114 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868869.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence076 1550 1272 gene locus_tag LOCUS_09500 1550 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2634 1624 gene locus_tag LOCUS_09510 2634 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_09510 2706 3770 gene locus_tag LOCUS_09520 2706 3770 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_09520 4255 3773 gene locus_tag LOCUS_09530 4255 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 4888 4451 gene locus_tag LOCUS_09540 4888 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence077 <1 840 gene locus_tag LOCUS_09550 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020190.1:aspartate kinase 899 2338 gene locus_tag LOCUS_09560 899 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2387 3181 gene locus_tag LOCUS_09570 2387 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 4227 3178 gene locus_tag LOCUS_09580 4227 3178 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868088.1 protein_id gnl|my_center|LOCUS_09580 4322 4513 gene locus_tag LOCUS_09590 4322 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 4727 4539 gene locus_tag LOCUS_09600 4727 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence078 1449 1 gene locus_tag LOCUS_09610 1449 1 CDS product DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_09610 1596 2060 gene locus_tag LOCUS_09620 1596 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2786 2070 gene locus_tag LOCUS_09630 2786 2070 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_09630 3280 2789 gene locus_tag LOCUS_09640 3280 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence079 296 1327 gene locus_tag LOCUS_09650 296 1327 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761845.1 protein_id gnl|my_center|LOCUS_09650 1844 1287 gene locus_tag LOCUS_09660 1844 1287 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_09660 2457 1837 gene locus_tag LOCUS_09670 2457 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2495 2833 gene locus_tag LOCUS_09680 2495 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3810 2827 gene locus_tag LOCUS_09690 3810 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 <4660 3812 gene locus_tag LOCUS_09700 <4660 3812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978424.1:translation-associated GTPase >Feature sequence080 274 1080 gene locus_tag LOCUS_09710 274 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 1139 2032 gene locus_tag LOCUS_09720 1139 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2700 2047 gene locus_tag LOCUS_09730 2700 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence081 554 916 gene locus_tag LOCUS_09740 554 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1680 913 gene locus_tag LOCUS_09750 1680 913 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_09750 2027 1683 gene locus_tag LOCUS_09760 2027 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2460 2029 gene locus_tag LOCUS_09770 2460 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 4173 2461 gene locus_tag LOCUS_09780 4173 2461 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence082 482 955 gene locus_tag LOCUS_09790 482 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_09790 3395 933 gene locus_tag LOCUS_09800 3395 933 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_09800 3495 4130 gene locus_tag LOCUS_09810 3495 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4479 4114 gene locus_tag LOCUS_09820 4479 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence083 773 1402 gene locus_tag LOCUS_09830 773 1402 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_09830 3170 1764 gene locus_tag LOCUS_09840 3170 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3270 4190 gene locus_tag LOCUS_09850 3270 4190 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence084 285 1187 gene locus_tag LOCUS_09860 285 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1212 1727 gene locus_tag LOCUS_09870 gene nudF 1212 1727 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54570 protein_id gnl|my_center|LOCUS_09870 2738 1761 gene locus_tag LOCUS_09880 2738 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979533.1 protein_id gnl|my_center|LOCUS_09880 2805 3698 gene locus_tag LOCUS_09890 2805 3698 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876216.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence085 308 1066 gene locus_tag LOCUS_09900 308 1066 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_09900 1067 1990 gene locus_tag LOCUS_09910 1067 1990 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496725.1 protein_id gnl|my_center|LOCUS_09910 2003 2677 gene locus_tag LOCUS_09920 2003 2677 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 protein_id gnl|my_center|LOCUS_09920 2932 2687 gene locus_tag LOCUS_09930 2932 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 3532 2975 gene locus_tag LOCUS_09940 3532 2975 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_09940 4308 3595 gene locus_tag LOCUS_09950 4308 3595 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877948.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence086 247 1305 gene locus_tag LOCUS_09960 247 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1741 1343 gene locus_tag LOCUS_09970 1741 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2016 1738 gene locus_tag LOCUS_09980 2016 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2112 2255 gene locus_tag LOCUS_09990 2112 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2481 2290 gene locus_tag LOCUS_10000 2481 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2703 3116 gene locus_tag LOCUS_10010 2703 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_10010 3326 3120 gene locus_tag LOCUS_10020 3326 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3325 4296 gene locus_tag LOCUS_10030 gene menA 3325 4296 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BK6 protein_id gnl|my_center|LOCUS_10030 >Feature sequence087 308 829 gene locus_tag LOCUS_10040 308 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1594 821 gene locus_tag LOCUS_10050 1594 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 2008 1637 gene locus_tag LOCUS_10060 2008 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2794 2039 gene locus_tag LOCUS_10070 2794 2039 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_10070 2891 3112 gene locus_tag LOCUS_10080 2891 3112 CDS product histone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_10080 3152 3223 gene locus_tag LOCUS_t00270 3152 3223 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3634 3224 gene locus_tag LOCUS_10090 3634 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence088 629 399 gene locus_tag LOCUS_10100 629 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 889 662 gene locus_tag LOCUS_10110 889 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 1103 957 gene locus_tag LOCUS_10120 1103 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3348 1156 gene locus_tag LOCUS_10130 3348 1156 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846316.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence089 2406 739 gene locus_tag LOCUS_10140 2406 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 2482 2859 gene locus_tag LOCUS_10150 2482 2859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence090 365 1258 gene locus_tag LOCUS_10160 365 1258 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_10160 1299 1643 gene locus_tag LOCUS_10170 1299 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2808 1723 gene locus_tag LOCUS_10180 2808 1723 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_10180 2888 3451 gene locus_tag LOCUS_10190 2888 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 3544 3732 gene locus_tag LOCUS_10200 3544 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence091 851 1369 gene locus_tag LOCUS_10210 851 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1362 3449 gene locus_tag LOCUS_10220 1362 3449 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence092 245 1300 gene locus_tag LOCUS_10230 gene rlmN 245 1300 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0X3 protein_id gnl|my_center|LOCUS_10230 1356 1655 gene locus_tag LOCUS_10240 1356 1655 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762332.1 protein_id gnl|my_center|LOCUS_10240 1658 1984 gene locus_tag LOCUS_10250 1658 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2005 2571 gene locus_tag LOCUS_10260 2005 2571 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249851.1 protein_id gnl|my_center|LOCUS_10260 2568 3272 gene locus_tag LOCUS_10270 2568 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence093 268 1020 gene locus_tag LOCUS_10280 268 1020 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_10280 2086 1022 gene locus_tag LOCUS_10290 2086 1022 CDS product glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_10290 2162 2794 gene locus_tag LOCUS_10300 2162 2794 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence094 162 410 gene locus_tag LOCUS_10310 162 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 693 415 gene locus_tag LOCUS_10320 693 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 982 1116 gene locus_tag LOCUS_10330 982 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1793 1113 gene locus_tag LOCUS_10340 1793 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence095 373 564 gene locus_tag LOCUS_10350 373 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 847 629 gene locus_tag LOCUS_10360 847 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 3019 878 gene locus_tag LOCUS_10370 3019 878 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_10370 3544 3047 gene locus_tag LOCUS_10380 3544 3047 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence096 869 531 gene locus_tag LOCUS_10390 869 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 1042 1266 gene locus_tag LOCUS_10400 1042 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1332 1541 gene locus_tag LOCUS_10410 1332 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1576 1815 gene locus_tag LOCUS_10420 1576 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1809 2027 gene locus_tag LOCUS_10430 1809 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2407 2751 gene locus_tag LOCUS_10440 2407 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence097 <1 717 gene locus_tag LOCUS_10450 <1 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980384.1:2-oxoacid ferredoxin oxidoreductase subunit beta 1254 706 gene locus_tag LOCUS_10460 1254 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 1352 1684 gene locus_tag LOCUS_10470 1352 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 2307 1753 gene locus_tag LOCUS_10480 2307 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3094 2333 gene locus_tag LOCUS_10490 gene cofE 3094 2333 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065736.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence098 <1 1312 gene locus_tag LOCUS_10500 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878271.1:translation initiation factor aIF-2 1710 1309 gene locus_tag LOCUS_10510 1710 1309 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846726.1 protein_id gnl|my_center|LOCUS_10510 1914 1756 gene locus_tag LOCUS_10520 1914 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2937 1951 gene locus_tag LOCUS_10530 2937 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence099 939 1727 gene locus_tag LOCUS_10540 939 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 1891 1748 gene locus_tag LOCUS_10550 1891 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2029 2409 gene locus_tag LOCUS_10560 2029 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2475 2861 gene locus_tag LOCUS_10570 2475 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3095 3352 gene locus_tag LOCUS_10580 3095 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence100 1166 1621 gene locus_tag LOCUS_10590 1166 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 2179 1829 gene locus_tag LOCUS_10600 2179 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2296 2221 gene locus_tag LOCUS_t00280 2296 2221 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3173 2322 gene locus_tag LOCUS_10610 3173 2322 CDS product 8-oxoguanine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence101 79 999 gene locus_tag LOCUS_10620 gene tfb 79 999 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878796.1 protein_id gnl|my_center|LOCUS_10620 1011 1571 gene locus_tag LOCUS_10630 1011 1571 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_10630 1600 1875 gene locus_tag LOCUS_10640 1600 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 1892 2167 gene locus_tag LOCUS_10650 1892 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 <3306 2164 gene locus_tag LOCUS_10660 <3306 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146523.1:DEAD/DEAH box helicase >Feature sequence102 1369 248 gene locus_tag LOCUS_10670 1369 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 <3292 1416 gene locus_tag LOCUS_10680 <3292 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879160.1:ribonucleotide-diphosphate reductase subunit alpha >Feature sequence103 1182 154 gene locus_tag LOCUS_10690 1182 154 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_10690 1269 2108 gene locus_tag LOCUS_10700 gene nfo 1269 2108 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WII8 protein_id gnl|my_center|LOCUS_10700 >Feature sequence104 <3225 373 gene locus_tag LOCUS_10710 <3225 373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762428.1:peptidase S8 >Feature sequence105 1627 599 gene locus_tag LOCUS_10720 1627 599 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_10720 1958 1665 gene locus_tag LOCUS_10730 1958 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2046 2342 gene locus_tag LOCUS_10740 2046 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2598 2347 gene locus_tag LOCUS_10750 2598 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 2949 2647 gene locus_tag LOCUS_10760 2949 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence106 567 1073 gene locus_tag LOCUS_10770 567 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1376 1065 gene locus_tag LOCUS_10780 1376 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1463 1615 gene locus_tag LOCUS_10790 1463 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1743 2297 gene locus_tag LOCUS_10800 1743 2297 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 protein_id gnl|my_center|LOCUS_10800 2307 2927 gene locus_tag LOCUS_10810 2307 2927 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence107 <1 1524 gene locus_tag LOCUS_10820 <1 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7W0D3:virginiamycin B lyase 2332 1514 gene locus_tag LOCUS_10830 2332 1514 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943613.1 protein_id gnl|my_center|LOCUS_10830 3057 2335 gene locus_tag LOCUS_10840 3057 2335 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence108 1528 773 gene locus_tag LOCUS_10850 1528 773 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_10850 1573 2688 gene locus_tag LOCUS_10860 1573 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence109 281 21 gene locus_tag LOCUS_10870 281 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1502 339 gene locus_tag LOCUS_10880 1502 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1593 2063 gene locus_tag LOCUS_10890 1593 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 2132 2923 gene locus_tag LOCUS_10900 2132 2923 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811176.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence110 67 153 gene locus_tag LOCUS_t00290 67 153 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2066 159 gene locus_tag LOCUS_10910 2066 159 CDS product glutamyl-tRNA(Gln) amidotransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_10910 <3076 2079 gene locus_tag LOCUS_10920 <3076 2079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867819.1:glutamyl-tRNA(Gln) amidotransferase subunit D >Feature sequence111 1796 438 gene locus_tag LOCUS_10930 1796 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 <3025 1899 gene locus_tag LOCUS_10940 <3025 1899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878475.1:AMP-dependent synthetase >Feature sequence112 826 518 gene locus_tag LOCUS_10950 826 518 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_10950 904 1254 gene locus_tag LOCUS_10960 904 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1293 1457 gene locus_tag LOCUS_10970 1293 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence113 >Feature sequence114 >Feature sequence115 60 254 gene locus_tag LOCUS_10980 60 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 956 282 gene locus_tag LOCUS_10990 956 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 1111 1638 gene locus_tag LOCUS_11000 1111 1638 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence116 927 1499 gene locus_tag LOCUS_11010 927 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1670 2128 gene locus_tag LOCUS_11020 1670 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 <2967 2166 gene locus_tag LOCUS_11030 <2967 2166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000662799.1:oligoendopeptidase F >Feature sequence117 386 1816 gene locus_tag LOCUS_11040 gene guaB 386 1816 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X168 protein_id gnl|my_center|LOCUS_11040 1852 2322 gene locus_tag LOCUS_11050 1852 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 <2964 2319 gene locus_tag LOCUS_11060 <2964 2319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583989.1:prephenate dehydratase >Feature sequence118 1367 438 gene locus_tag LOCUS_11070 gene tfb 1367 438 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_11070 1662 1378 gene locus_tag LOCUS_11080 1662 1378 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869708.1 protein_id gnl|my_center|LOCUS_11080 1857 2279 gene locus_tag LOCUS_11090 1857 2279 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence119 632 1960 gene locus_tag LOCUS_11100 632 1960 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249508.1 protein_id gnl|my_center|LOCUS_11100 2036 1961 gene locus_tag LOCUS_t00300 2036 1961 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence120 1313 342 gene locus_tag LOCUS_11110 1313 342 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_11110 2149 1310 gene locus_tag LOCUS_11120 2149 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 <2883 2146 gene locus_tag LOCUS_11130 <2883 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392618.1:threonine-phosphate decarboxylase >Feature sequence121 672 136 gene locus_tag LOCUS_11140 672 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 720 992 gene locus_tag LOCUS_11150 720 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 999 1316 gene locus_tag LOCUS_11160 999 1316 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_11160 1351 2097 gene locus_tag LOCUS_11170 1351 2097 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence122 650 1243 gene locus_tag LOCUS_11180 650 1243 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870893.1 protein_id gnl|my_center|LOCUS_11180 2381 1233 gene locus_tag LOCUS_11190 2381 1233 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence123 897 91 gene locus_tag LOCUS_11200 897 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1012 2733 gene locus_tag LOCUS_11210 1012 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence124 453 142 gene locus_tag LOCUS_11220 453 142 CDS product translation initiation factor 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_11220 545 1111 gene locus_tag LOCUS_11230 545 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2203 1151 gene locus_tag LOCUS_11240 2203 1151 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence125 537 139 gene locus_tag LOCUS_11250 537 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 687 2399 gene locus_tag LOCUS_11260 687 2399 CDS product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence126 685 479 gene locus_tag LOCUS_11270 685 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 801 1691 gene locus_tag LOCUS_11280 801 1691 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_11280 1732 1893 gene locus_tag LOCUS_11290 1732 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1938 2495 gene locus_tag LOCUS_11300 1938 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2616 2542 gene locus_tag LOCUS_t00310 2616 2542 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence127 1072 152 gene locus_tag LOCUS_11310 gene znuA 1072 152 CDS product high-affinity zinc uptake system binding-protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34966 protein_id gnl|my_center|LOCUS_11310 1163 1546 gene locus_tag LOCUS_11320 1163 1546 CDS product nickel-responsive regulator 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence128 1173 400 gene locus_tag LOCUS_11330 1173 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869660.1 protein_id gnl|my_center|LOCUS_11330 2121 1207 gene locus_tag LOCUS_11340 2121 1207 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence129 102 539 gene locus_tag LOCUS_11350 102 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 976 536 gene locus_tag LOCUS_11360 976 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2035 1019 gene locus_tag LOCUS_11370 2035 1019 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence130 799 1185 gene locus_tag LOCUS_11380 799 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1276 1190 gene locus_tag LOCUS_t00320 1276 1190 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1367 1440 gene locus_tag LOCUS_t00330 1367 1440 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2302 1442 gene locus_tag LOCUS_11390 2302 1442 CDS product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence131 740 18 gene locus_tag LOCUS_11400 740 18 CDS product zinc ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059661.1 protein_id gnl|my_center|LOCUS_11400 1933 734 gene locus_tag LOCUS_11410 1933 734 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_11410 2024 2407 gene locus_tag LOCUS_11420 2024 2407 CDS product nickel-responsive regulator 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876242.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence132 2095 761 gene locus_tag LOCUS_11430 2095 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence133 747 349 gene locus_tag LOCUS_11440 747 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1072 761 gene locus_tag LOCUS_11450 1072 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2461 1226 gene locus_tag LOCUS_11460 2461 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496769.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence134 97 1260 gene locus_tag LOCUS_11470 97 1260 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_11470 1440 1264 gene locus_tag LOCUS_11480 1440 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1547 1924 gene locus_tag LOCUS_11490 1547 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence135 265 1890 gene locus_tag LOCUS_11500 265 1890 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867141.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence136 1373 375 gene locus_tag LOCUS_11510 1373 375 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_11510 2108 1959 gene locus_tag LOCUS_11520 2108 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence137 80 1078 gene locus_tag LOCUS_11530 80 1078 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_11530 1075 1860 gene locus_tag LOCUS_11540 1075 1860 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYL8 protein_id gnl|my_center|LOCUS_11540 >Feature sequence138 <1 503 gene locus_tag LOCUS_11550 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943629.1:precorrin-8X methylmutase 1847 492 gene locus_tag LOCUS_11560 1847 492 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_11560 1933 2466 gene locus_tag LOCUS_11570 1933 2466 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence139 1565 2407 gene locus_tag LOCUS_11580 1565 2407 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence140 1900 2412 gene locus_tag LOCUS_11590 gene apt 1900 2412 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GU0 protein_id gnl|my_center|LOCUS_11590 >Feature sequence141 140 69 gene locus_tag LOCUS_t00340 140 69 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 397 200 gene locus_tag LOCUS_11600 397 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 472 1869 gene locus_tag LOCUS_11610 472 1869 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_11610 <2477 1862 gene locus_tag LOCUS_11620 <2477 1862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021687.1:ribose-5-phosphate isomerase >Feature sequence142 976 1470 gene locus_tag LOCUS_11630 976 1470 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence143 388 194 gene locus_tag LOCUS_11640 388 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1247 441 gene locus_tag LOCUS_11650 1247 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2251 1244 gene locus_tag LOCUS_11660 2251 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence144 140 1231 gene locus_tag LOCUS_11670 140 1231 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846248.1 protein_id gnl|my_center|LOCUS_11670 1806 1243 gene locus_tag LOCUS_11680 1806 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence145 411 860 gene locus_tag LOCUS_11690 411 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1864 866 gene locus_tag LOCUS_11700 1864 866 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence146 358 594 gene locus_tag LOCUS_11710 358 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 795 619 gene locus_tag LOCUS_11720 795 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 972 850 gene locus_tag LOCUS_11730 972 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1134 1391 gene locus_tag LOCUS_11740 1134 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1388 2077 gene locus_tag LOCUS_11750 1388 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence147 90 893 gene locus_tag LOCUS_11760 90 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 >Feature sequence148 839 1882 gene locus_tag LOCUS_11770 839 1882 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence149 49 1167 gene locus_tag LOCUS_11780 49 1167 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763062.1 protein_id gnl|my_center|LOCUS_11780 <2168 1162 gene locus_tag LOCUS_11790 <2168 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877720.1:menaquinone biosynthesis decarboxylase >Feature sequence150 206 1030 gene locus_tag LOCUS_11800 gene purC 206 1030 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NMH6 protein_id gnl|my_center|LOCUS_11800 1385 1888 gene locus_tag LOCUS_11810 1385 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence151 291 524 gene locus_tag LOCUS_11820 291 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence152 2042 894 gene locus_tag LOCUS_11830 2042 894 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876935.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence153 >Feature sequence154 1690 1142 gene locus_tag LOCUS_11840 1690 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence155 115 699 gene locus_tag LOCUS_11850 115 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 879 682 gene locus_tag LOCUS_11860 879 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1157 876 gene locus_tag LOCUS_11870 1157 876 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868833.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence156 612 391 gene locus_tag LOCUS_11880 612 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 989 1192 gene locus_tag LOCUS_11890 989 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1237 1686 gene locus_tag LOCUS_11900 1237 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence157 519 199 gene locus_tag LOCUS_11910 519 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 590 1333 gene locus_tag LOCUS_11920 590 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 1522 1668 gene locus_tag LOCUS_11930 1522 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence158 428 1204 gene locus_tag LOCUS_11940 428 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1552 1208 gene locus_tag LOCUS_11950 1552 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence159 46 621 gene locus_tag LOCUS_11960 46 621 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_11960 939 691 gene locus_tag LOCUS_11970 939 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1332 1189 gene locus_tag LOCUS_11980 1332 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1441 1599 gene locus_tag LOCUS_11990 1441 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 1833 1639 gene locus_tag LOCUS_12000 1833 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence160 546 1151 gene locus_tag LOCUS_12010 546 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence161 569 108 gene locus_tag LOCUS_12020 569 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 789 658 gene locus_tag LOCUS_12030 789 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1186 866 gene locus_tag LOCUS_12040 1186 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1342 1650 gene locus_tag LOCUS_12050 1342 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence162 95 499 gene locus_tag LOCUS_12060 95 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1045 491 gene locus_tag LOCUS_12070 1045 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1499 1056 gene locus_tag LOCUS_12080 1499 1056 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_12080 1617 1844 gene locus_tag LOCUS_12090 1617 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence163 <1 583 gene locus_tag LOCUS_12100 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P39640:dihydroanticapsin 7-dehydrogenase 623 829 gene locus_tag LOCUS_12110 623 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 840 1655 gene locus_tag LOCUS_12120 840 1655 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142637.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence164 <1 1109 gene locus_tag LOCUS_12130 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762192.1:DNA primase small subunit >Feature sequence165 1547 21 gene locus_tag LOCUS_12140 gene abfD 1547 21 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence166 1698 718 gene locus_tag LOCUS_12150 1698 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 1852 1776 gene locus_tag LOCUS_t00350 1852 1776 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence167 9 1217 gene locus_tag LOCUS_12160 9 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1507 1214 gene locus_tag LOCUS_12170 1507 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1798 1568 gene locus_tag LOCUS_12180 1798 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence168 <1 1401 gene locus_tag LOCUS_12190 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249122.1:radical SAM protein 1749 1426 gene locus_tag LOCUS_12200 1749 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence169 337 215 gene locus_tag LOCUS_12210 337 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 450 659 gene locus_tag LOCUS_12220 450 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence170 113 1321 gene locus_tag LOCUS_12230 113 1321 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_12230 1680 1847 gene locus_tag LOCUS_12240 1680 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence171 <1868 195 gene locus_tag LOCUS_12250 <1868 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867349.1:glutamine--fructose-6-phosphate aminotransferase >Feature sequence172 559 308 gene locus_tag LOCUS_12260 559 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 747 1301 gene locus_tag LOCUS_12270 747 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence173 65 781 gene locus_tag LOCUS_12280 65 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1343 759 gene locus_tag LOCUS_12290 gene leuD 1343 759 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F4E5 protein_id gnl|my_center|LOCUS_12290 <1858 1345 gene locus_tag LOCUS_12300 <1858 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KP81:3-isopropylmalate dehydratase large subunit >Feature sequence174 >Feature sequence175 >Feature sequence176 <1 690 gene locus_tag LOCUS_12310 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876650.1:F420-0--gamma-glutamyl ligase 810 1046 gene locus_tag LOCUS_12320 810 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_12320 1522 1049 gene locus_tag LOCUS_12330 1522 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence177 1415 1041 gene locus_tag LOCUS_12340 1415 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence178 1396 194 gene locus_tag LOCUS_12350 1396 194 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence179 1 597 gene locus_tag LOCUS_12360 1 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 594 773 gene locus_tag LOCUS_12370 594 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 857 1414 gene locus_tag LOCUS_12380 857 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence180 >Feature sequence181 409 224 gene locus_tag LOCUS_12390 409 224 CDS product 30S ribosomal protein S27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869892.1 protein_id gnl|my_center|LOCUS_12390 810 409 gene locus_tag LOCUS_12400 810 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 905 1453 gene locus_tag LOCUS_12410 905 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence182 1184 1411 gene locus_tag LOCUS_12420 1184 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence183 >Feature sequence184 52 1068 gene locus_tag LOCUS_12430 52 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence185 <1 1196 gene locus_tag LOCUS_12440 <1 1196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979932.1:phosphomethylpyrimidine synthase 1583 1179 gene locus_tag LOCUS_12450 1583 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence186 <1681 128 gene locus_tag LOCUS_12460 <1681 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:ATPase AAA >Feature sequence187 549 247 gene locus_tag LOCUS_12470 549 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 898 686 gene locus_tag LOCUS_12480 898 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence188 1467 652 gene locus_tag LOCUS_12490 gene panB 1467 652 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYW9 protein_id gnl|my_center|LOCUS_12490 >Feature sequence189 >Feature sequence190 1 120 gene locus_tag LOCUS_12500 1 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 144 920 gene locus_tag LOCUS_12510 144 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence191 633 382 gene locus_tag LOCUS_12520 gene rpoH 633 382 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870552.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence192 239 742 gene locus_tag LOCUS_12530 239 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 849 1496 gene locus_tag LOCUS_12540 849 1496 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887468.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence193 1026 472 gene locus_tag LOCUS_12550 1026 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence194 377 1141 gene locus_tag LOCUS_12560 gene cbiF 377 1141 CDS product cobalt-precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence195 >Feature sequence196 <1 1293 gene locus_tag LOCUS_12570 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057661.1:acetolactate synthase >Feature sequence197 300 1034 gene locus_tag LOCUS_12580 300 1034 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_12580 1079 1363 gene locus_tag LOCUS_12590 1079 1363 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence198 <1604 157 gene locus_tag LOCUS_12600 <1604 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHY9:GMP synthase [glutamine-hydrolyzing] >Feature sequence199 252 641 gene locus_tag LOCUS_12610 252 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1490 879 gene locus_tag LOCUS_12620 1490 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence200 <1589 446 gene locus_tag LOCUS_12630 <1589 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023256.1:excinuclease ABC subunit C >Feature sequence201 <1561 845 gene locus_tag LOCUS_12640 <1561 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250771.1:metalloprotease >Feature sequence202 288 701 gene locus_tag LOCUS_12650 288 701 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249829.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence203 >Feature sequence204 812 189 gene locus_tag LOCUS_12660 812 189 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846725.1 protein_id gnl|my_center|LOCUS_12660 863 1534 gene locus_tag LOCUS_12670 863 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence205 1353 190 gene locus_tag LOCUS_12680 1353 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence206 1351 182 gene locus_tag LOCUS_12690 gene iscS 1351 182 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence207 819 94 gene locus_tag LOCUS_12700 819 94 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_12700 1513 812 gene locus_tag LOCUS_12710 1513 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence208 837 238 gene locus_tag LOCUS_12720 837 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 <1501 840 gene locus_tag LOCUS_12730 <1501 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809024.1:alcohol dehydrogenase >Feature sequence209 1113 16 gene locus_tag LOCUS_12740 1113 16 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061243.1 protein_id gnl|my_center|LOCUS_12740