>Feature sequence01 <1 704 gene locus_tag LOCUS_00010 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846725.1:histidine phosphatase family protein 763 1023 gene locus_tag LOCUS_00020 763 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1017 1457 gene locus_tag LOCUS_00030 1017 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00030 1498 3024 gene locus_tag LOCUS_00040 gene ctaD 1498 3024 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_00040 3034 4005 gene locus_tag LOCUS_00050 3034 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4019 4462 gene locus_tag LOCUS_00060 4019 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4892 4452 gene locus_tag LOCUS_00070 4892 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 5051 5671 gene locus_tag LOCUS_00080 5051 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 5730 5804 gene locus_tag LOCUS_t00010 5730 5804 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5914 6222 gene locus_tag LOCUS_00090 5914 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6225 6605 gene locus_tag LOCUS_00100 6225 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00100 7333 6758 gene locus_tag LOCUS_00110 7333 6758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 8472 7558 gene locus_tag LOCUS_00120 8472 7558 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061049.1 protein_id gnl|my_center|LOCUS_00120 8571 8777 gene locus_tag LOCUS_00130 8571 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 10344 8929 gene locus_tag LOCUS_00140 10344 8929 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MC0 protein_id gnl|my_center|LOCUS_00140 11406 10387 gene locus_tag LOCUS_00150 11406 10387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 11485 11561 gene locus_tag LOCUS_t00020 11485 11561 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11707 11937 gene locus_tag LOCUS_00160 11707 11937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 12514 12080 gene locus_tag LOCUS_00170 12514 12080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 12671 12799 gene locus_tag LOCUS_00180 12671 12799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 13026 12847 gene locus_tag LOCUS_00190 13026 12847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 13060 13743 gene locus_tag LOCUS_00200 13060 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 14148 13711 gene locus_tag LOCUS_00210 14148 13711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 14858 14172 gene locus_tag LOCUS_00220 14858 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 15075 15284 gene locus_tag LOCUS_00230 15075 15284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 16066 15464 gene locus_tag LOCUS_00240 gene drgA 16066 15464 CDS product NAD(P)H nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118380.1 protein_id gnl|my_center|LOCUS_00240 16513 16106 gene locus_tag LOCUS_00250 16513 16106 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_00250 16652 17014 gene locus_tag LOCUS_00260 16652 17014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 17074 18066 gene locus_tag LOCUS_00270 17074 18066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 18063 18200 gene locus_tag LOCUS_00280 18063 18200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 18197 18427 gene locus_tag LOCUS_00290 18197 18427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 18449 18712 gene locus_tag LOCUS_00300 18449 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 18740 19204 gene locus_tag LOCUS_00310 18740 19204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 19974 19201 gene locus_tag LOCUS_00320 19974 19201 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390794.1 protein_id gnl|my_center|LOCUS_00320 19913 20071 gene locus_tag LOCUS_00330 19913 20071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 20183 20341 gene locus_tag LOCUS_00340 20183 20341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 20511 20795 gene locus_tag LOCUS_00350 20511 20795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 20827 21270 gene locus_tag LOCUS_00360 20827 21270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 21260 21616 gene locus_tag LOCUS_00370 21260 21616 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868935.1 protein_id gnl|my_center|LOCUS_00370 21679 23775 gene locus_tag LOCUS_00380 21679 23775 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_00380 23848 25374 gene locus_tag LOCUS_00390 gene abfD 23848 25374 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_00390 26277 25573 gene locus_tag LOCUS_00400 26277 25573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 27077 26319 gene locus_tag LOCUS_00410 27077 26319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 27193 27519 gene locus_tag LOCUS_00420 gene trx 27193 27519 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72B01 protein_id gnl|my_center|LOCUS_00420 28483 27620 gene locus_tag LOCUS_00430 gene tfb 28483 27620 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_00430 28974 29498 gene locus_tag LOCUS_00440 28974 29498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 29891 29514 gene locus_tag LOCUS_00450 29891 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 29958 30575 gene locus_tag LOCUS_00460 29958 30575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 30827 30755 gene locus_tag LOCUS_t00030 30827 30755 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 31666 31403 gene locus_tag LOCUS_00470 31666 31403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 32091 33479 gene locus_tag LOCUS_00480 32091 33479 CDS product dihydroorotase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064334.1 protein_id gnl|my_center|LOCUS_00480 33577 33771 gene locus_tag LOCUS_00490 33577 33771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 33850 34032 gene locus_tag LOCUS_00500 33850 34032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 34731 34057 gene locus_tag LOCUS_00510 gene rpiA 34731 34057 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_00510 35697 34732 gene locus_tag LOCUS_00520 35697 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 36115 35876 gene locus_tag LOCUS_00530 36115 35876 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_00530 36893 36171 gene locus_tag LOCUS_00540 36893 36171 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972341.1 protein_id gnl|my_center|LOCUS_00540 37777 36899 gene locus_tag LOCUS_00550 37777 36899 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903430.1 protein_id gnl|my_center|LOCUS_00550 37880 37793 gene locus_tag LOCUS_t00040 37880 37793 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 37928 39277 gene locus_tag LOCUS_00560 37928 39277 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_00560 39340 39726 gene locus_tag LOCUS_00570 39340 39726 CDS product 50S ribosomal protein L7ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_00570 39723 39935 gene locus_tag LOCUS_00580 39723 39935 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762341.1 protein_id gnl|my_center|LOCUS_00580 39948 40148 gene locus_tag LOCUS_00590 39948 40148 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_00590 40151 40552 gene locus_tag LOCUS_00600 40151 40552 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_00600 40559 42340 gene locus_tag LOCUS_00610 40559 42340 CDS product translation initiation factor aIF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_00610 42741 42337 gene locus_tag LOCUS_00620 42741 42337 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846726.1 protein_id gnl|my_center|LOCUS_00620 43949 42978 gene locus_tag LOCUS_00630 43949 42978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 44483 44067 gene locus_tag LOCUS_00640 44483 44067 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249316.1 protein_id gnl|my_center|LOCUS_00640 45270 44539 gene locus_tag LOCUS_00650 45270 44539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 45715 45350 gene locus_tag LOCUS_00660 45715 45350 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021844.1 protein_id gnl|my_center|LOCUS_00660 45797 46096 gene locus_tag LOCUS_00670 45797 46096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 46179 46715 gene locus_tag LOCUS_00680 46179 46715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 47509 46718 gene locus_tag LOCUS_00690 47509 46718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_00690 47808 48041 gene locus_tag LOCUS_00700 47808 48041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 48170 48889 gene locus_tag LOCUS_00710 48170 48889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 48937 49275 gene locus_tag LOCUS_00720 48937 49275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 49395 50531 gene locus_tag LOCUS_00730 49395 50531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 50800 50528 gene locus_tag LOCUS_00740 50800 50528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 50828 51085 gene locus_tag LOCUS_00750 50828 51085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 51567 51139 gene locus_tag LOCUS_00760 51567 51139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 51940 52347 gene locus_tag LOCUS_00770 51940 52347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 52320 52667 gene locus_tag LOCUS_00780 52320 52667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 53924 52935 gene locus_tag LOCUS_00790 53924 52935 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_00790 54685 54299 gene locus_tag LOCUS_00800 54685 54299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 54783 56045 gene locus_tag LOCUS_00810 54783 56045 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250513.1 protein_id gnl|my_center|LOCUS_00810 56691 56026 gene locus_tag LOCUS_00820 56691 56026 CDS product translation initiation factor 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868639.1 protein_id gnl|my_center|LOCUS_00820 56802 57311 gene locus_tag LOCUS_00830 56802 57311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 57405 57953 gene locus_tag LOCUS_00840 57405 57953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 58040 58125 gene locus_tag LOCUS_t00050 58040 58125 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 59082 58132 gene locus_tag LOCUS_00850 gene rfc 59082 58132 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978451.1 protein_id gnl|my_center|LOCUS_00850 59276 59806 gene locus_tag LOCUS_00860 59276 59806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 59787 61874 gene locus_tag LOCUS_00870 59787 61874 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846340.1 protein_id gnl|my_center|LOCUS_00870 61871 64000 gene locus_tag LOCUS_00880 61871 64000 CDS product extensin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_00880 63997 64989 gene locus_tag LOCUS_00890 63997 64989 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_00890 64986 65216 gene locus_tag LOCUS_00900 64986 65216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 65689 65213 gene locus_tag LOCUS_00910 65689 65213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 65963 65694 gene locus_tag LOCUS_00920 65963 65694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_00920 66895 65960 gene locus_tag LOCUS_00930 66895 65960 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_00930 67813 66896 gene locus_tag LOCUS_00940 67813 66896 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099287.1 protein_id gnl|my_center|LOCUS_00940 68450 67848 gene locus_tag LOCUS_00950 68450 67848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 69347 68502 gene locus_tag LOCUS_00960 69347 68502 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554680.1 protein_id gnl|my_center|LOCUS_00960 69474 69549 gene locus_tag LOCUS_t00060 69474 69549 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 70092 69550 gene locus_tag LOCUS_00970 70092 69550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 70201 70491 gene locus_tag LOCUS_00980 70201 70491 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_00980 71380 70514 gene locus_tag LOCUS_00990 gene bcpA 71380 70514 CDS product carboxyvinyl-carboxyphosphonate phosphorylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808124.1 protein_id gnl|my_center|LOCUS_00990 71987 71478 gene locus_tag LOCUS_01000 71987 71478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 72083 73795 gene locus_tag LOCUS_01010 72083 73795 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_01010 73796 74227 gene locus_tag LOCUS_01020 73796 74227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 74229 74573 gene locus_tag LOCUS_01030 74229 74573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 74577 75344 gene locus_tag LOCUS_01040 74577 75344 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762424.1 protein_id gnl|my_center|LOCUS_01040 75697 75341 gene locus_tag LOCUS_01050 75697 75341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_01050 75714 77174 gene locus_tag LOCUS_01060 gene argH 75714 77174 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI1 protein_id gnl|my_center|LOCUS_01060 77267 77193 gene locus_tag LOCUS_t00070 77267 77193 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 77364 77441 gene locus_tag LOCUS_t00080 77364 77441 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 77584 78294 gene locus_tag LOCUS_01070 77584 78294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 78307 79383 gene locus_tag LOCUS_01080 78307 79383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 79556 79395 gene locus_tag LOCUS_01090 79556 79395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 80502 79660 gene locus_tag LOCUS_01100 80502 79660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 81435 80635 gene locus_tag LOCUS_01110 gene suhB 81435 80635 CDS product fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O33832 protein_id gnl|my_center|LOCUS_01110 81510 82631 gene locus_tag LOCUS_01120 81510 82631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 82640 83797 gene locus_tag LOCUS_01130 82640 83797 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_01130 83794 84105 gene locus_tag LOCUS_01140 83794 84105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 84211 85758 gene locus_tag LOCUS_01150 84211 85758 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_01150 85762 87252 gene locus_tag LOCUS_01160 gene accC1 85762 87252 CDS product biotin carboxylase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P49787 protein_id gnl|my_center|LOCUS_01160 87259 87771 gene locus_tag LOCUS_01170 87259 87771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 88250 87786 gene locus_tag LOCUS_01180 88250 87786 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979852.1 protein_id gnl|my_center|LOCUS_01180 88406 88738 gene locus_tag LOCUS_01190 gene nuoA 88406 88738 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL32 protein_id gnl|my_center|LOCUS_01190 88778 89302 gene locus_tag LOCUS_01200 88778 89302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01200 >Feature sequence02 2034 448 gene locus_tag LOCUS_01210 2034 448 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023256.1 protein_id gnl|my_center|LOCUS_01210 4850 2031 gene locus_tag LOCUS_01220 4850 2031 CDS product ABC-ATPase UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_01220 6792 4837 gene locus_tag LOCUS_01230 6792 4837 CDS product excinuclease ABC subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023255.1 protein_id gnl|my_center|LOCUS_01230 7474 6842 gene locus_tag LOCUS_01240 7474 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7536 7754 gene locus_tag LOCUS_01250 7536 7754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 7924 8391 gene locus_tag LOCUS_01260 7924 8391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 8623 8396 gene locus_tag LOCUS_01270 8623 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 9784 8669 gene locus_tag LOCUS_01280 9784 8669 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879898.1 protein_id gnl|my_center|LOCUS_01280 10822 9878 gene locus_tag LOCUS_01290 10822 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 10976 12247 gene locus_tag LOCUS_01300 10976 12247 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_01300 12442 12260 gene locus_tag LOCUS_01310 12442 12260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 12688 12924 gene locus_tag LOCUS_01320 12688 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 13879 12914 gene locus_tag LOCUS_01330 13879 12914 CDS product mRNA 3-end processing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762724.1 protein_id gnl|my_center|LOCUS_01330 14064 14756 gene locus_tag LOCUS_01340 14064 14756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 14838 15206 gene locus_tag LOCUS_01350 14838 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 16184 15270 gene locus_tag LOCUS_01360 16184 15270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 16152 16343 gene locus_tag LOCUS_01370 16152 16343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 16379 16954 gene locus_tag LOCUS_01380 gene purN 16379 16954 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU8 protein_id gnl|my_center|LOCUS_01380 17271 16951 gene locus_tag LOCUS_01390 17271 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53867 protein_id gnl|my_center|LOCUS_01390 17545 17273 gene locus_tag LOCUS_01400 17545 17273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 17650 18513 gene locus_tag LOCUS_01410 gene folD 17650 18513 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB4 protein_id gnl|my_center|LOCUS_01410 18503 19060 gene locus_tag LOCUS_01420 18503 19060 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97K31 protein_id gnl|my_center|LOCUS_01420 20307 19057 gene locus_tag LOCUS_01430 gene purD 20307 19057 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EJ4 protein_id gnl|my_center|LOCUS_01430 20406 23603 gene locus_tag LOCUS_01440 20406 23603 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876987.1 protein_id gnl|my_center|LOCUS_01440 23653 24240 gene locus_tag LOCUS_01450 23653 24240 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_01450 24345 24674 gene locus_tag LOCUS_01460 24345 24674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 24715 25821 gene locus_tag LOCUS_01470 gene sucC 24715 25821 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUY3 protein_id gnl|my_center|LOCUS_01470 25818 26735 gene locus_tag LOCUS_01480 25818 26735 CDS product succinyl-CoA synthetase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_01480 27185 26937 gene locus_tag LOCUS_01490 27185 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 27280 27374 gene locus_tag LOCUS_t00090 27280 27374 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27559 27981 gene locus_tag LOCUS_01500 27559 27981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 28069 28608 gene locus_tag LOCUS_01510 gene ppa 28069 28608 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ49 protein_id gnl|my_center|LOCUS_01510 28613 28870 gene locus_tag LOCUS_01520 28613 28870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022645.1 protein_id gnl|my_center|LOCUS_01520 29236 28886 gene locus_tag LOCUS_01530 29236 28886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 29327 31099 gene locus_tag LOCUS_01540 gene pepF 29327 31099 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_01540 31442 31215 gene locus_tag LOCUS_01550 31442 31215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 31336 31644 gene locus_tag LOCUS_01560 31336 31644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 31929 33080 gene locus_tag LOCUS_01570 31929 33080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 33632 33081 gene locus_tag LOCUS_01580 33632 33081 CDS product pyruvoyl-dependent arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023416.1 protein_id gnl|my_center|LOCUS_01580 33977 33744 gene locus_tag LOCUS_01590 33977 33744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 34100 34174 gene locus_tag LOCUS_t00100 34100 34174 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 34253 35059 gene locus_tag LOCUS_01600 34253 35059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 35141 36502 gene locus_tag LOCUS_01610 35141 36502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 36550 36783 gene locus_tag LOCUS_01620 36550 36783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 37159 36893 gene locus_tag LOCUS_01630 37159 36893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 37668 37432 gene locus_tag LOCUS_01640 37668 37432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 38058 38348 gene locus_tag LOCUS_01650 38058 38348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 38345 39034 gene locus_tag LOCUS_01660 38345 39034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 39527 39057 gene locus_tag LOCUS_01670 39527 39057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 39772 39524 gene locus_tag LOCUS_01680 39772 39524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 39986 40840 gene locus_tag LOCUS_01690 39986 40840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 41206 40844 gene locus_tag LOCUS_01700 41206 40844 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879391.1 protein_id gnl|my_center|LOCUS_01700 42902 41250 gene locus_tag LOCUS_01710 42902 41250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 43458 43003 gene locus_tag LOCUS_01720 43458 43003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 43536 43889 gene locus_tag LOCUS_01730 43536 43889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 44081 44401 gene locus_tag LOCUS_01740 44081 44401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 46425 44398 gene locus_tag LOCUS_01750 46425 44398 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948731.1 protein_id gnl|my_center|LOCUS_01750 46695 46462 gene locus_tag LOCUS_01760 46695 46462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 46769 47803 gene locus_tag LOCUS_01770 46769 47803 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583003.1 protein_id gnl|my_center|LOCUS_01770 48027 48260 gene locus_tag LOCUS_01780 48027 48260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 48648 48250 gene locus_tag LOCUS_01790 48648 48250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 48857 49105 gene locus_tag LOCUS_01800 48857 49105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 49741 49106 gene locus_tag LOCUS_01810 49741 49106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 49896 50105 gene locus_tag LOCUS_01820 49896 50105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 50332 50102 gene locus_tag LOCUS_01830 50332 50102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 51598 50402 gene locus_tag LOCUS_01840 51598 50402 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_01840 53148 51595 gene locus_tag LOCUS_01850 53148 51595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 53617 53243 gene locus_tag LOCUS_01860 53617 53243 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978149.1 protein_id gnl|my_center|LOCUS_01860 53678 54799 gene locus_tag LOCUS_01870 53678 54799 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_01870 55037 55318 gene locus_tag LOCUS_01880 55037 55318 CDS product effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_01880 55327 57495 gene locus_tag LOCUS_01890 55327 57495 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846861.1 protein_id gnl|my_center|LOCUS_01890 57498 57794 gene locus_tag LOCUS_01900 57498 57794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 58685 57798 gene locus_tag LOCUS_01910 58685 57798 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846973.1 protein_id gnl|my_center|LOCUS_01910 58804 59874 gene locus_tag LOCUS_01920 58804 59874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 59877 60266 gene locus_tag LOCUS_01930 59877 60266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 60657 60268 gene locus_tag LOCUS_01940 60657 60268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064546.1 protein_id gnl|my_center|LOCUS_01940 60733 61131 gene locus_tag LOCUS_01950 60733 61131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 61128 61454 gene locus_tag LOCUS_01960 61128 61454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 61524 61781 gene locus_tag LOCUS_01970 61524 61781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 61840 62022 gene locus_tag LOCUS_01980 61840 62022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 64058 62019 gene locus_tag LOCUS_01990 gene hppA 64058 62019 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_01990 <65646 64659 gene locus_tag LOCUS_02000 <65646 64659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000877935.1:oxidoreductase ion channel protein IolS >Feature sequence03 442 137 gene locus_tag LOCUS_02010 442 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 787 1179 gene locus_tag LOCUS_02020 787 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1478 1972 gene locus_tag LOCUS_02030 1478 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3364 1997 gene locus_tag LOCUS_02040 gene spsI 3364 1997 CDS product bifunctional IPC transferase and DIPP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67379 protein_id gnl|my_center|LOCUS_02040 4161 3364 gene locus_tag LOCUS_02050 4161 3364 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023274.1 protein_id gnl|my_center|LOCUS_02050 4369 4929 gene locus_tag LOCUS_02060 4369 4929 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762559.1 protein_id gnl|my_center|LOCUS_02060 4994 5896 gene locus_tag LOCUS_02070 gene tfb 4994 5896 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_02070 7809 6142 gene locus_tag LOCUS_02080 7809 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8712 7882 gene locus_tag LOCUS_02090 8712 7882 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100978.1 protein_id gnl|my_center|LOCUS_02090 11265 8755 gene locus_tag LOCUS_02100 11265 8755 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064577.1 protein_id gnl|my_center|LOCUS_02100 11348 12136 gene locus_tag LOCUS_02110 11348 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 12485 12138 gene locus_tag LOCUS_02120 12485 12138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 13703 12549 gene locus_tag LOCUS_02130 13703 12549 CDS product putative multi-drug resistance efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268780.1 protein_id gnl|my_center|LOCUS_02130 14389 13700 gene locus_tag LOCUS_02140 14389 13700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 15166 14441 gene locus_tag LOCUS_02150 gene psmA 15166 14441 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_02150 15277 15660 gene locus_tag LOCUS_02160 15277 15660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 15733 17007 gene locus_tag LOCUS_02170 15733 17007 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_02170 17387 17010 gene locus_tag LOCUS_02180 17387 17010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 17665 18348 gene locus_tag LOCUS_02190 17665 18348 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080220.1 protein_id gnl|my_center|LOCUS_02190 18391 20508 gene locus_tag LOCUS_02200 18391 20508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878688.1 protein_id gnl|my_center|LOCUS_02200 20545 21306 gene locus_tag LOCUS_02210 gene crt2 20545 21306 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861082.1 protein_id gnl|my_center|LOCUS_02210 21463 21831 gene locus_tag LOCUS_02220 21463 21831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573822.1 protein_id gnl|my_center|LOCUS_02220 21983 23125 gene locus_tag LOCUS_02230 21983 23125 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_02230 23134 23817 gene locus_tag LOCUS_02240 23134 23817 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020596.1 protein_id gnl|my_center|LOCUS_02240 24449 23814 gene locus_tag LOCUS_02250 24449 23814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 25509 24475 gene locus_tag LOCUS_02260 25509 24475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 26633 25509 gene locus_tag LOCUS_02270 gene lysK 26633 25509 CDS product N-acetyl-lysine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH3 protein_id gnl|my_center|LOCUS_02270 27488 26637 gene locus_tag LOCUS_02280 27488 26637 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_02280 27643 27476 gene locus_tag LOCUS_02290 27643 27476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 28883 27666 gene locus_tag LOCUS_02300 28883 27666 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_02300 29369 28950 gene locus_tag LOCUS_02310 29369 28950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 30537 29356 gene locus_tag LOCUS_02320 gene argD 30537 29356 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHH5 protein_id gnl|my_center|LOCUS_02320 31333 30530 gene locus_tag LOCUS_02330 31333 30530 CDS product acetylaminoadipate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_02330 32382 31336 gene locus_tag LOCUS_02340 32382 31336 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762032.1 protein_id gnl|my_center|LOCUS_02340 33268 32411 gene locus_tag LOCUS_02350 33268 32411 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_02350 33435 33268 gene locus_tag LOCUS_02360 33435 33268 CDS product sulfonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978131.1 protein_id gnl|my_center|LOCUS_02360 34631 33432 gene locus_tag LOCUS_02370 34631 33432 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061009.1 protein_id gnl|my_center|LOCUS_02370 34765 35790 gene locus_tag LOCUS_02380 34765 35790 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963433.1 protein_id gnl|my_center|LOCUS_02380 35791 36555 gene locus_tag LOCUS_02390 35791 36555 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963434.1 protein_id gnl|my_center|LOCUS_02390 36561 37319 gene locus_tag LOCUS_02400 36561 37319 CDS product sulfate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963435.1 protein_id gnl|my_center|LOCUS_02400 38426 37311 gene locus_tag LOCUS_02410 38426 37311 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024512.1 protein_id gnl|my_center|LOCUS_02410 38540 39502 gene locus_tag LOCUS_02420 38540 39502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02420 39535 42033 gene locus_tag LOCUS_02430 39535 42033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02430 42767 42030 gene locus_tag LOCUS_02440 42767 42030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 42843 43391 gene locus_tag LOCUS_02450 42843 43391 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179676.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence04 239 1171 gene locus_tag LOCUS_02460 239 1171 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146653.1 protein_id gnl|my_center|LOCUS_02460 1273 1746 gene locus_tag LOCUS_02470 1273 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 2258 1743 gene locus_tag LOCUS_02480 2258 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2908 2255 gene locus_tag LOCUS_02490 2908 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 3117 3581 gene locus_tag LOCUS_02500 3117 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 3583 4398 gene locus_tag LOCUS_02510 3583 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 5157 4492 gene locus_tag LOCUS_02520 5157 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 5253 5789 gene locus_tag LOCUS_02530 5253 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5894 6382 gene locus_tag LOCUS_02540 5894 6382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6375 7112 gene locus_tag LOCUS_02550 6375 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 9184 7109 gene locus_tag LOCUS_02560 9184 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 10323 9181 gene locus_tag LOCUS_02570 10323 9181 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980186.1 protein_id gnl|my_center|LOCUS_02570 11856 10324 gene locus_tag LOCUS_02580 11856 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980185.1 protein_id gnl|my_center|LOCUS_02580 12689 11853 gene locus_tag LOCUS_02590 12689 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 13512 12763 gene locus_tag LOCUS_02600 13512 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 13943 14761 gene locus_tag LOCUS_02610 gene nadX 13943 14761 CDS product L-aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_02610 15073 15486 gene locus_tag LOCUS_02620 15073 15486 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249829.1 protein_id gnl|my_center|LOCUS_02620 15419 15631 gene locus_tag LOCUS_02630 15419 15631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 15690 16379 gene locus_tag LOCUS_02640 15690 16379 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876071.1 protein_id gnl|my_center|LOCUS_02640 16372 17697 gene locus_tag LOCUS_02650 16372 17697 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_02650 17933 18862 gene locus_tag LOCUS_02660 17933 18862 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867968.1 protein_id gnl|my_center|LOCUS_02660 19083 19790 gene locus_tag LOCUS_02670 19083 19790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 20011 19826 gene locus_tag LOCUS_02680 20011 19826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 20505 20011 gene locus_tag LOCUS_02690 20505 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 20562 21122 gene locus_tag LOCUS_02700 20562 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762118.1 protein_id gnl|my_center|LOCUS_02700 22398 21106 gene locus_tag LOCUS_02710 22398 21106 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582434.1 protein_id gnl|my_center|LOCUS_02710 22626 23633 gene locus_tag LOCUS_02720 22626 23633 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_02720 23676 24116 gene locus_tag LOCUS_02730 23676 24116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 24550 24113 gene locus_tag LOCUS_02740 24550 24113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 25245 24553 gene locus_tag LOCUS_02750 25245 24553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 26617 25316 gene locus_tag LOCUS_02760 26617 25316 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868207.1 protein_id gnl|my_center|LOCUS_02760 26907 27125 gene locus_tag LOCUS_02770 26907 27125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 27347 28711 gene locus_tag LOCUS_02780 27347 28711 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979932.1 protein_id gnl|my_center|LOCUS_02780 29098 28694 gene locus_tag LOCUS_02790 29098 28694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 29959 29105 gene locus_tag LOCUS_02800 29959 29105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 31326 29956 gene locus_tag LOCUS_02810 gene aspC 31326 29956 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0Y2 protein_id gnl|my_center|LOCUS_02810 32428 31331 gene locus_tag LOCUS_02820 32428 31331 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496747.1 protein_id gnl|my_center|LOCUS_02820 33842 32574 gene locus_tag LOCUS_02830 gene aroA 33842 32574 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024417.1 protein_id gnl|my_center|LOCUS_02830 34686 33832 gene locus_tag LOCUS_02840 34686 33832 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870958.1 protein_id gnl|my_center|LOCUS_02840 35507 34686 gene locus_tag LOCUS_02850 gene aroE 35507 34686 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ55 protein_id gnl|my_center|LOCUS_02850 36230 35559 gene locus_tag LOCUS_02860 gene aroD 36230 35559 CDS product 3-dehydroquinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_02860 37293 36232 gene locus_tag LOCUS_02870 37293 36232 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060849.1 protein_id gnl|my_center|LOCUS_02870 38068 37286 gene locus_tag LOCUS_02880 38068 37286 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_02880 38227 39345 gene locus_tag LOCUS_02890 38227 39345 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763062.1 protein_id gnl|my_center|LOCUS_02890 40782 39340 gene locus_tag LOCUS_02900 40782 39340 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_02900 41281 40907 gene locus_tag LOCUS_02910 41281 40907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence05 1552 1112 gene locus_tag LOCUS_02920 1552 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2267 1647 gene locus_tag LOCUS_02930 gene sodA 2267 1647 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_02930 2345 4366 gene locus_tag LOCUS_02940 2345 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 5973 4369 gene locus_tag LOCUS_02950 5973 4369 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813680.1 protein_id gnl|my_center|LOCUS_02950 6120 6518 gene locus_tag LOCUS_02960 6120 6518 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_02960 6508 6963 gene locus_tag LOCUS_02970 6508 6963 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903252.1 protein_id gnl|my_center|LOCUS_02970 7259 6960 gene locus_tag LOCUS_02980 7259 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 8032 7256 gene locus_tag LOCUS_02990 8032 7256 CDS product D-tyrosyl-tRNA(Tyr) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878129.1 protein_id gnl|my_center|LOCUS_02990 8235 8753 gene locus_tag LOCUS_03000 8235 8753 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_03000 8793 9272 gene locus_tag LOCUS_03010 8793 9272 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869872.1 protein_id gnl|my_center|LOCUS_03010 9704 9273 gene locus_tag LOCUS_03020 9704 9273 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868810.1 protein_id gnl|my_center|LOCUS_03020 9895 10557 gene locus_tag LOCUS_03030 9895 10557 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878987.1 protein_id gnl|my_center|LOCUS_03030 10550 11416 gene locus_tag LOCUS_03040 10550 11416 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868902.1 protein_id gnl|my_center|LOCUS_03040 12524 11691 gene locus_tag LOCUS_03050 gene lipA 12524 11691 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZXI6 protein_id gnl|my_center|LOCUS_03050 12642 13652 gene locus_tag LOCUS_03060 12642 13652 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460676.1 protein_id gnl|my_center|LOCUS_03060 13690 14070 gene locus_tag LOCUS_03070 gene gcvH 13690 14070 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2E6 protein_id gnl|my_center|LOCUS_03070 14074 15327 gene locus_tag LOCUS_03080 gene gcvPA 14074 15327 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HDT7 protein_id gnl|my_center|LOCUS_03080 15324 16733 gene locus_tag LOCUS_03090 gene gcvPB 15324 16733 CDS product putative glycine dehydrogenase (decarboxylating) subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2E8 protein_id gnl|my_center|LOCUS_03090 16735 17040 gene locus_tag LOCUS_03100 16735 17040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 17037 17759 gene locus_tag LOCUS_03110 gene lipM 17037 17759 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54511 protein_id gnl|my_center|LOCUS_03110 17786 19105 gene locus_tag LOCUS_03120 17786 19105 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYL2 protein_id gnl|my_center|LOCUS_03120 19140 20066 gene locus_tag LOCUS_03130 19140 20066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 20068 21165 gene locus_tag LOCUS_03140 20068 21165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 21496 21182 gene locus_tag LOCUS_03150 21496 21182 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_03150 22047 21538 gene locus_tag LOCUS_03160 22047 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 22179 24848 gene locus_tag LOCUS_03170 22179 24848 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870068.1 protein_id gnl|my_center|LOCUS_03170 24853 27720 gene locus_tag LOCUS_03180 gene leuS 24853 27720 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_03180 28304 27822 gene locus_tag LOCUS_03190 28304 27822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 28401 28739 gene locus_tag LOCUS_03200 28401 28739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 28996 29556 gene locus_tag LOCUS_03210 28996 29556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 30171 29839 gene locus_tag LOCUS_03220 30171 29839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 30640 30428 gene locus_tag LOCUS_03230 30640 30428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 30903 30706 gene locus_tag LOCUS_03240 30903 30706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 31355 31507 gene locus_tag LOCUS_03250 31355 31507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 32189 32431 gene locus_tag LOCUS_03260 32189 32431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 32656 32468 gene locus_tag LOCUS_03270 32656 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_03270 32765 33475 gene locus_tag LOCUS_03280 32765 33475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 34104 33913 gene locus_tag LOCUS_03290 34104 33913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 34306 34118 gene locus_tag LOCUS_03300 34306 34118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 34568 34380 gene locus_tag LOCUS_03310 34568 34380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 35043 34867 gene locus_tag LOCUS_03320 35043 34867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 35426 35145 gene locus_tag LOCUS_03330 35426 35145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 36285 35983 gene locus_tag LOCUS_03340 36285 35983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 36443 37381 gene locus_tag LOCUS_03350 36443 37381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 38572 37943 gene locus_tag LOCUS_03360 38572 37943 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393986.1 protein_id gnl|my_center|LOCUS_03360 39106 39297 gene locus_tag LOCUS_03370 39106 39297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 39787 39398 gene locus_tag LOCUS_03380 39787 39398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence06 357 734 gene locus_tag LOCUS_03390 357 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 875 1327 gene locus_tag LOCUS_03400 875 1327 CDS product peptide-methionine (S)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_03400 1760 1329 gene locus_tag LOCUS_03410 gene uspA 1760 1329 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KFV2 protein_id gnl|my_center|LOCUS_03410 1893 2684 gene locus_tag LOCUS_03420 1893 2684 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091085.1 protein_id gnl|my_center|LOCUS_03420 2721 3152 gene locus_tag LOCUS_03430 2721 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 3149 3577 gene locus_tag LOCUS_03440 3149 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4675 3611 gene locus_tag LOCUS_03450 gene phbC 4675 3611 CDS product poly-beta-hydroxybutyrate polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_03450 5165 4665 gene locus_tag LOCUS_03460 5165 4665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5297 5689 gene locus_tag LOCUS_03470 5297 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5727 6137 gene locus_tag LOCUS_03480 5727 6137 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978531.1 protein_id gnl|my_center|LOCUS_03480 7054 6143 gene locus_tag LOCUS_03490 gene tfb 7054 6143 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_03490 8527 7154 gene locus_tag LOCUS_03500 8527 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 8719 9117 gene locus_tag LOCUS_03510 8719 9117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 10127 9120 gene locus_tag LOCUS_03520 10127 9120 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_03520 10670 10164 gene locus_tag LOCUS_03530 10670 10164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 10755 11168 gene locus_tag LOCUS_03540 10755 11168 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_03540 11132 11530 gene locus_tag LOCUS_03550 11132 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 11565 12776 gene locus_tag LOCUS_03560 gene ychF 11565 12776 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_03560 13757 12834 gene locus_tag LOCUS_03570 13757 12834 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_03570 13854 15014 gene locus_tag LOCUS_03580 13854 15014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_03580 15446 15165 gene locus_tag LOCUS_03590 15446 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 15813 15995 gene locus_tag LOCUS_03600 15813 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 16447 16818 gene locus_tag LOCUS_03610 16447 16818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 16999 17871 gene locus_tag LOCUS_03620 gene putA 16999 17871 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_03620 19424 17853 gene locus_tag LOCUS_03630 gene pruA 19424 17853 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259692.1 protein_id gnl|my_center|LOCUS_03630 20274 19426 gene locus_tag LOCUS_03640 20274 19426 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005393578.1 protein_id gnl|my_center|LOCUS_03640 21876 21310 gene locus_tag LOCUS_03650 21876 21310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 22123 21884 gene locus_tag LOCUS_03660 22123 21884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 22484 22624 gene locus_tag LOCUS_03670 22484 22624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 22631 22777 gene locus_tag LOCUS_03680 22631 22777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 23030 23953 gene locus_tag LOCUS_03690 gene tfb 23030 23953 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_03690 24875 24432 gene locus_tag LOCUS_03700 24875 24432 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_03700 24980 25690 gene locus_tag LOCUS_03710 24980 25690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 25701 26213 gene locus_tag LOCUS_03720 25701 26213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 26917 26753 gene locus_tag LOCUS_03730 26917 26753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 27132 27272 gene locus_tag LOCUS_03740 27132 27272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 29232 27844 gene locus_tag LOCUS_03750 gene cysS 29232 27844 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YID4 protein_id gnl|my_center|LOCUS_03750 30026 29235 gene locus_tag LOCUS_03760 30026 29235 CDS product NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_03760 30387 30085 gene locus_tag LOCUS_03770 gene hcaC 30387 30085 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_03770 30463 31704 gene locus_tag LOCUS_03780 30463 31704 CDS product S-adenosyl-L-homocysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_03780 31743 33401 gene locus_tag LOCUS_03790 31743 33401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 33530 34294 gene locus_tag LOCUS_03800 33530 34294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 34368 35288 gene locus_tag LOCUS_03810 34368 35288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_03810 35585 36340 gene locus_tag LOCUS_03820 35585 36340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 36473 37471 gene locus_tag LOCUS_03830 36473 37471 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496863.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence07 2691 1744 gene locus_tag LOCUS_03840 2691 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3040 2729 gene locus_tag LOCUS_03850 3040 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 3935 3042 gene locus_tag LOCUS_03860 3935 3042 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJI0 protein_id gnl|my_center|LOCUS_03860 3978 4793 gene locus_tag LOCUS_03870 3978 4793 CDS product inorganic polyphosphate/ATP-NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876505.1 protein_id gnl|my_center|LOCUS_03870 4783 5262 gene locus_tag LOCUS_03880 4783 5262 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_03880 5960 5277 gene locus_tag LOCUS_03890 5960 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 6369 6013 gene locus_tag LOCUS_03900 6369 6013 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_03900 6866 7027 gene locus_tag LOCUS_03910 6866 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 7090 7356 gene locus_tag LOCUS_03920 7090 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 7901 7656 gene locus_tag LOCUS_03930 7901 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 8097 7885 gene locus_tag LOCUS_03940 8097 7885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 8917 8099 gene locus_tag LOCUS_03950 8917 8099 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053857.1 protein_id gnl|my_center|LOCUS_03950 9656 8922 gene locus_tag LOCUS_03960 9656 8922 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_03960 10336 9656 gene locus_tag LOCUS_03970 10336 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 11031 10336 gene locus_tag LOCUS_03980 11031 10336 CDS product rRNA metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_03980 11110 11748 gene locus_tag LOCUS_03990 11110 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 11794 12141 gene locus_tag LOCUS_04000 11794 12141 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869688.1 protein_id gnl|my_center|LOCUS_04000 12134 12631 gene locus_tag LOCUS_04010 12134 12631 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_04010 12628 13077 gene locus_tag LOCUS_04020 12628 13077 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061175.1 protein_id gnl|my_center|LOCUS_04020 13081 13797 gene locus_tag LOCUS_04030 13081 13797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14359 13775 gene locus_tag LOCUS_04040 gene leuD 14359 13775 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94568 protein_id gnl|my_center|LOCUS_04040 15776 14361 gene locus_tag LOCUS_04050 gene leuC 15776 14361 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UIA7 protein_id gnl|my_center|LOCUS_04050 16269 15778 gene locus_tag LOCUS_04060 16269 15778 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_04060 17543 16269 gene locus_tag LOCUS_04070 gene leuC 17543 16269 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2X0 protein_id gnl|my_center|LOCUS_04070 17647 18393 gene locus_tag LOCUS_04080 gene cofE 17647 18393 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065736.1 protein_id gnl|my_center|LOCUS_04080 18424 18990 gene locus_tag LOCUS_04090 18424 18990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 19318 18992 gene locus_tag LOCUS_04100 19318 18992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 19418 19951 gene locus_tag LOCUS_04110 19418 19951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 20384 19944 gene locus_tag LOCUS_04120 20384 19944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 20937 21464 gene locus_tag LOCUS_04130 20937 21464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 22428 21466 gene locus_tag LOCUS_04140 22428 21466 CDS product 2-oxoacid ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_04140 24328 22418 gene locus_tag LOCUS_04150 24328 22418 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980386.1 protein_id gnl|my_center|LOCUS_04150 24524 24378 gene locus_tag LOCUS_04160 24524 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 24695 25549 gene locus_tag LOCUS_04170 24695 25549 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817430.1 protein_id gnl|my_center|LOCUS_04170 26145 25780 gene locus_tag LOCUS_04180 26145 25780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 26455 26186 gene locus_tag LOCUS_04190 26455 26186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 27780 26482 gene locus_tag LOCUS_04200 27780 26482 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107022.1 protein_id gnl|my_center|LOCUS_04200 27983 28897 gene locus_tag LOCUS_04210 gene tfb 27983 28897 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_04210 28906 29466 gene locus_tag LOCUS_04220 28906 29466 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_04220 29702 29514 gene locus_tag LOCUS_04230 29702 29514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 30379 29933 gene locus_tag LOCUS_04240 30379 29933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 31405 30389 gene locus_tag LOCUS_04250 31405 30389 CDS product rRNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060731.1 protein_id gnl|my_center|LOCUS_04250 31962 31402 gene locus_tag LOCUS_04260 31962 31402 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762154.1 protein_id gnl|my_center|LOCUS_04260 32591 31959 gene locus_tag LOCUS_04270 32591 31959 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867438.1 protein_id gnl|my_center|LOCUS_04270 33174 32596 gene locus_tag LOCUS_04280 33174 32596 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496506.1 protein_id gnl|my_center|LOCUS_04280 34591 33161 gene locus_tag LOCUS_04290 34591 33161 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867440.1 protein_id gnl|my_center|LOCUS_04290 35009 34584 gene locus_tag LOCUS_04300 35009 34584 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_04300 35478 35011 gene locus_tag LOCUS_04310 35478 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 36218 35484 gene locus_tag LOCUS_04320 36218 35484 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_04320 36702 36220 gene locus_tag LOCUS_04330 36702 36220 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869975.1 protein_id gnl|my_center|LOCUS_04330 37653 36739 gene locus_tag LOCUS_04340 gene argF 37653 36739 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023243.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence08 642 2357 gene locus_tag LOCUS_04350 642 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2391 2597 gene locus_tag LOCUS_04360 2391 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2599 4158 gene locus_tag LOCUS_04370 2599 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 4199 4975 gene locus_tag LOCUS_04380 4199 4975 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144247.1 protein_id gnl|my_center|LOCUS_04380 5009 5185 gene locus_tag LOCUS_04390 5009 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 5249 6055 gene locus_tag LOCUS_04400 5249 6055 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894754.1 protein_id gnl|my_center|LOCUS_04400 6503 6039 gene locus_tag LOCUS_04410 6503 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 6551 7714 gene locus_tag LOCUS_04420 6551 7714 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_04420 7716 8081 gene locus_tag LOCUS_04430 7716 8081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 8152 8313 gene locus_tag LOCUS_04440 8152 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 8419 10581 gene locus_tag LOCUS_04450 8419 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 10786 13434 gene locus_tag LOCUS_04460 10786 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 13547 14395 gene locus_tag LOCUS_04470 13547 14395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 14420 14566 gene locus_tag LOCUS_04480 14420 14566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 14604 15272 gene locus_tag LOCUS_04490 14604 15272 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867891.1 protein_id gnl|my_center|LOCUS_04490 15294 15369 gene locus_tag LOCUS_t00110 15294 15369 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15755 16207 gene locus_tag LOCUS_04500 15755 16207 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250227.1 protein_id gnl|my_center|LOCUS_04500 16215 16514 gene locus_tag LOCUS_04510 16215 16514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 16556 17635 gene locus_tag LOCUS_04520 16556 17635 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_04520 17643 18500 gene locus_tag LOCUS_04530 17643 18500 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391941.1 protein_id gnl|my_center|LOCUS_04530 18804 18956 gene locus_tag LOCUS_04540 18804 18956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 19030 19734 gene locus_tag LOCUS_04550 19030 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 19789 20373 gene locus_tag LOCUS_04560 gene ribE 19789 20373 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67604 protein_id gnl|my_center|LOCUS_04560 20453 21118 gene locus_tag LOCUS_04570 20453 21118 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869547.1 protein_id gnl|my_center|LOCUS_04570 21121 21534 gene locus_tag LOCUS_04580 21121 21534 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496458.1 protein_id gnl|my_center|LOCUS_04580 21534 22280 gene locus_tag LOCUS_04590 21534 22280 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876648.1 protein_id gnl|my_center|LOCUS_04590 22280 23470 gene locus_tag LOCUS_04600 22280 23470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_04600 23457 24113 gene locus_tag LOCUS_04610 23457 24113 CDS product diaminohydroxyphosphoribosylaminopyrimidine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_04610 24150 24425 gene locus_tag LOCUS_04620 24150 24425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 24525 25082 gene locus_tag LOCUS_04630 24525 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 25085 25387 gene locus_tag LOCUS_04640 25085 25387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 26799 25408 gene locus_tag LOCUS_04650 26799 25408 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021373.1 protein_id gnl|my_center|LOCUS_04650 27396 26881 gene locus_tag LOCUS_04660 27396 26881 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868546.1 protein_id gnl|my_center|LOCUS_04660 27956 27423 gene locus_tag LOCUS_04670 27956 27423 CDS product tRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870902.1 protein_id gnl|my_center|LOCUS_04670 29064 27946 gene locus_tag LOCUS_04680 29064 27946 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868200.1 protein_id gnl|my_center|LOCUS_04680 29448 29122 gene locus_tag LOCUS_04690 29448 29122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 29868 29527 gene locus_tag LOCUS_04700 29868 29527 CDS product NagC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_04700 30338 29865 gene locus_tag LOCUS_04710 30338 29865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_04710 30429 31472 gene locus_tag LOCUS_04720 30429 31472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_04720 31853 32317 gene locus_tag LOCUS_04730 31853 32317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 32365 32676 gene locus_tag LOCUS_04740 32365 32676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 32669 34000 gene locus_tag LOCUS_04750 32669 34000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877006.1 protein_id gnl|my_center|LOCUS_04750 34025 34546 gene locus_tag LOCUS_04760 34025 34546 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_04760 34599 35012 gene locus_tag LOCUS_04770 34599 35012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 35124 35792 gene locus_tag LOCUS_04780 35124 35792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 36483 35800 gene locus_tag LOCUS_04790 36483 35800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 36863 36483 gene locus_tag LOCUS_04800 36863 36483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979704.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence09 <1 654 gene locus_tag LOCUS_04810 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903745.1:intein-containing DNA polymerase II large subunit 1980 658 gene locus_tag LOCUS_04820 1980 658 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_04820 2084 3787 gene locus_tag LOCUS_04830 2084 3787 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879727.1 protein_id gnl|my_center|LOCUS_04830 3844 4122 gene locus_tag LOCUS_04840 3844 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 5597 4119 gene locus_tag LOCUS_04850 5597 4119 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_04850 5635 6192 gene locus_tag LOCUS_04860 5635 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6224 6508 gene locus_tag LOCUS_04870 6224 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6731 6513 gene locus_tag LOCUS_04880 6731 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6834 7574 gene locus_tag LOCUS_04890 6834 7574 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967172.1 protein_id gnl|my_center|LOCUS_04890 7576 8724 gene locus_tag LOCUS_04900 7576 8724 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932704.1 protein_id gnl|my_center|LOCUS_04900 8934 8719 gene locus_tag LOCUS_04910 8934 8719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 8990 9063 gene locus_tag LOCUS_t00120 8990 9063 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9378 9133 gene locus_tag LOCUS_04920 9378 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 9372 10172 gene locus_tag LOCUS_04930 9372 10172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 11150 10227 gene locus_tag LOCUS_04940 11150 10227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143161.1 protein_id gnl|my_center|LOCUS_04940 11104 11274 gene locus_tag LOCUS_04950 11104 11274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 12121 11360 gene locus_tag LOCUS_04960 12121 11360 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867963.1 protein_id gnl|my_center|LOCUS_04960 13427 12096 gene locus_tag LOCUS_04970 13427 12096 CDS product CCA-adding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762324.1 protein_id gnl|my_center|LOCUS_04970 13966 13424 gene locus_tag LOCUS_04980 13966 13424 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_04980 14069 14587 gene locus_tag LOCUS_04990 14069 14587 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146776.1 protein_id gnl|my_center|LOCUS_04990 14584 14982 gene locus_tag LOCUS_05000 14584 14982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876072.1 protein_id gnl|my_center|LOCUS_05000 15063 15461 gene locus_tag LOCUS_05010 15063 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 15660 15812 gene locus_tag LOCUS_05020 15660 15812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 16542 15814 gene locus_tag LOCUS_05030 gene cobB 16542 15814 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67919 protein_id gnl|my_center|LOCUS_05030 17438 16539 gene locus_tag LOCUS_05040 gene rnz 17438 16539 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_05040 18382 17435 gene locus_tag LOCUS_05050 18382 17435 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870216.1 protein_id gnl|my_center|LOCUS_05050 19263 18382 gene locus_tag LOCUS_05060 19263 18382 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_05060 21147 19402 gene locus_tag LOCUS_05070 21147 19402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 21305 22669 gene locus_tag LOCUS_05080 21305 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 22742 24187 gene locus_tag LOCUS_05090 22742 24187 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_05090 24313 25455 gene locus_tag LOCUS_05100 24313 25455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 25892 25593 gene locus_tag LOCUS_05110 25892 25593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 26593 25985 gene locus_tag LOCUS_05120 26593 25985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 26617 27768 gene locus_tag LOCUS_05130 26617 27768 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877001.1 protein_id gnl|my_center|LOCUS_05130 28020 27763 gene locus_tag LOCUS_05140 28020 27763 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_05140 28080 28736 gene locus_tag LOCUS_05150 28080 28736 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428771.1 protein_id gnl|my_center|LOCUS_05150 28791 29285 gene locus_tag LOCUS_05160 28791 29285 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249196.1 protein_id gnl|my_center|LOCUS_05160 29433 29287 gene locus_tag LOCUS_05170 29433 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 29596 29444 gene locus_tag LOCUS_05180 29596 29444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 30163 29627 gene locus_tag LOCUS_05190 30163 29627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 30216 30494 gene locus_tag LOCUS_05200 30216 30494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 30496 30810 gene locus_tag LOCUS_05210 30496 30810 CDS product DNA-directed RNA polymerase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870659.1 protein_id gnl|my_center|LOCUS_05210 30845 31591 gene locus_tag LOCUS_05220 30845 31591 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496904.1 protein_id gnl|my_center|LOCUS_05220 31627 33030 gene locus_tag LOCUS_05230 31627 33030 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_05230 33069 34532 gene locus_tag LOCUS_05240 33069 34532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 34581 35375 gene locus_tag LOCUS_05250 34581 35375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 36418 35372 gene locus_tag LOCUS_05260 36418 35372 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868088.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence10 405 863 gene locus_tag LOCUS_05270 405 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1988 864 gene locus_tag LOCUS_05280 1988 864 CDS product DNA topoisomerase VI subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876639.1 protein_id gnl|my_center|LOCUS_05280 3846 1975 gene locus_tag LOCUS_05290 3846 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4405 3833 gene locus_tag LOCUS_05300 4405 3833 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060946.1 protein_id gnl|my_center|LOCUS_05300 5181 4402 gene locus_tag LOCUS_05310 5181 4402 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_05310 5558 5262 gene locus_tag LOCUS_05320 5558 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5995 5558 gene locus_tag LOCUS_05330 5995 5558 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_05330 6201 6049 gene locus_tag LOCUS_05340 6201 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6454 6954 gene locus_tag LOCUS_05350 6454 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7025 8170 gene locus_tag LOCUS_05360 7025 8170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147160.1 protein_id gnl|my_center|LOCUS_05360 8275 9048 gene locus_tag LOCUS_05370 8275 9048 CDS product UDP diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870889.1 protein_id gnl|my_center|LOCUS_05370 9045 9461 gene locus_tag LOCUS_05380 9045 9461 CDS product diadenosine 5'5'''-P1,P4-tetraphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_05380 10184 9450 gene locus_tag LOCUS_05390 10184 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 10863 10165 gene locus_tag LOCUS_05400 10863 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 11902 10901 gene locus_tag LOCUS_05410 11902 10901 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496543.1 protein_id gnl|my_center|LOCUS_05410 11983 12444 gene locus_tag LOCUS_05420 11983 12444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 12663 12445 gene locus_tag LOCUS_05430 12663 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 12798 12959 gene locus_tag LOCUS_05440 12798 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 13074 13283 gene locus_tag LOCUS_05450 13074 13283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 13344 13985 gene locus_tag LOCUS_05460 13344 13985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 14095 14382 gene locus_tag LOCUS_05470 14095 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 14541 15137 gene locus_tag LOCUS_05480 14541 15137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 15134 15655 gene locus_tag LOCUS_05490 15134 15655 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146480.1 protein_id gnl|my_center|LOCUS_05490 16420 15647 gene locus_tag LOCUS_05500 16420 15647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 16844 16461 gene locus_tag LOCUS_05510 16844 16461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 17621 16875 gene locus_tag LOCUS_05520 gene yabD 17621 16875 CDS product putative metal-dependent hydrolase YabD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37545 protein_id gnl|my_center|LOCUS_05520 17717 17938 gene locus_tag LOCUS_05530 17717 17938 CDS product histone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869663.1 protein_id gnl|my_center|LOCUS_05530 17978 18050 gene locus_tag LOCUS_t00130 17978 18050 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 18456 18049 gene locus_tag LOCUS_05540 18456 18049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 18530 20281 gene locus_tag LOCUS_05550 18530 20281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 20429 20611 gene locus_tag LOCUS_05560 20429 20611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 21195 20608 gene locus_tag LOCUS_05570 21195 20608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 21300 21560 gene locus_tag LOCUS_05580 21300 21560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 21776 21564 gene locus_tag LOCUS_05590 21776 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 21838 22026 gene locus_tag LOCUS_05600 21838 22026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 22300 22227 gene locus_tag LOCUS_t00140 22300 22227 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22354 23652 gene locus_tag LOCUS_05610 22354 23652 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877198.1 protein_id gnl|my_center|LOCUS_05610 23636 24586 gene locus_tag LOCUS_05620 gene thiL 23636 24586 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P57532 protein_id gnl|my_center|LOCUS_05620 24886 24587 gene locus_tag LOCUS_05630 24886 24587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 25021 25563 gene locus_tag LOCUS_05640 25021 25563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 25871 25560 gene locus_tag LOCUS_05650 25871 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 26281 25871 gene locus_tag LOCUS_05660 26281 25871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 27726 26278 gene locus_tag LOCUS_05670 27726 26278 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_05670 27867 28064 gene locus_tag LOCUS_05680 27867 28064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 28147 29508 gene locus_tag LOCUS_05690 28147 29508 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496668.1 protein_id gnl|my_center|LOCUS_05690 30262 29501 gene locus_tag LOCUS_05700 30262 29501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 30516 30686 gene locus_tag LOCUS_05710 30516 30686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 30764 31042 gene locus_tag LOCUS_05720 30764 31042 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABI2 protein_id gnl|my_center|LOCUS_05720 31100 31924 gene locus_tag LOCUS_05730 31100 31924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 31933 34251 gene locus_tag LOCUS_05740 31933 34251 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_05740 34879 34262 gene locus_tag LOCUS_05750 34879 34262 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence11 295 567 gene locus_tag LOCUS_05760 295 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 1181 564 gene locus_tag LOCUS_05770 1181 564 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_05770 1943 1230 gene locus_tag LOCUS_05780 1943 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 3175 2225 gene locus_tag LOCUS_05790 3175 2225 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_05790 3268 4362 gene locus_tag LOCUS_05800 3268 4362 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_05800 5100 4363 gene locus_tag LOCUS_05810 5100 4363 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359074.1 protein_id gnl|my_center|LOCUS_05810 5611 9135 gene locus_tag LOCUS_05820 5611 9135 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867481.1 protein_id gnl|my_center|LOCUS_05820 10098 9127 gene locus_tag LOCUS_05830 10098 9127 CDS product oligopeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080230.1 protein_id gnl|my_center|LOCUS_05830 10194 11216 gene locus_tag LOCUS_05840 gene egtD 10194 11216 CDS product histidine N-alpha-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8U6 protein_id gnl|my_center|LOCUS_05840 11335 11895 gene locus_tag LOCUS_05850 11335 11895 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_05850 13224 11914 gene locus_tag LOCUS_05860 13224 11914 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_05860 14712 13270 gene locus_tag LOCUS_05870 gene proS 14712 13270 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E028 protein_id gnl|my_center|LOCUS_05870 15052 14768 gene locus_tag LOCUS_05880 15052 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 15157 15801 gene locus_tag LOCUS_05890 15157 15801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 15836 16561 gene locus_tag LOCUS_05900 15836 16561 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259452.1 protein_id gnl|my_center|LOCUS_05900 16686 16922 gene locus_tag LOCUS_05910 16686 16922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877700.1 protein_id gnl|my_center|LOCUS_05910 16931 17923 gene locus_tag LOCUS_05920 16931 17923 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_05920 18400 17927 gene locus_tag LOCUS_05930 18400 17927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 18656 18432 gene locus_tag LOCUS_05940 18656 18432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 19654 18659 gene locus_tag LOCUS_05950 gene trxB 19654 18659 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52215 protein_id gnl|my_center|LOCUS_05950 20476 19706 gene locus_tag LOCUS_05960 20476 19706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 21318 20500 gene locus_tag LOCUS_05970 21318 20500 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903946.1 protein_id gnl|my_center|LOCUS_05970 21508 23310 gene locus_tag LOCUS_05980 21508 23310 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_05980 23307 24104 gene locus_tag LOCUS_05990 23307 24104 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903787.1 protein_id gnl|my_center|LOCUS_05990 25223 24105 gene locus_tag LOCUS_06000 25223 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 25328 26902 gene locus_tag LOCUS_06010 25328 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 27372 27199 gene locus_tag LOCUS_06020 27372 27199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 28781 27672 gene locus_tag LOCUS_06030 28781 27672 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_06030 28872 29567 gene locus_tag LOCUS_06040 28872 29567 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023459.1 protein_id gnl|my_center|LOCUS_06040 29569 31452 gene locus_tag LOCUS_06050 29569 31452 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_06050 31747 32925 gene locus_tag LOCUS_06060 31747 32925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 33525 33175 gene locus_tag LOCUS_06070 33525 33175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence12 469 275 gene locus_tag LOCUS_06080 469 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 957 463 gene locus_tag LOCUS_06090 957 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1151 954 gene locus_tag LOCUS_06100 1151 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1379 1191 gene locus_tag LOCUS_06110 1379 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3019 2468 gene locus_tag LOCUS_06120 3019 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 3244 3110 gene locus_tag LOCUS_06130 3244 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 3495 3247 gene locus_tag LOCUS_06140 3495 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3779 5233 gene locus_tag LOCUS_06150 3779 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5280 6350 gene locus_tag LOCUS_06160 5280 6350 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_06160 6827 6651 gene locus_tag LOCUS_06170 6827 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7051 8049 gene locus_tag LOCUS_06180 7051 8049 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_06180 8750 8046 gene locus_tag LOCUS_06190 8750 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8786 9106 gene locus_tag LOCUS_06200 8786 9106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 9153 9241 gene locus_tag LOCUS_t00150 9153 9241 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9864 9265 gene locus_tag LOCUS_06210 9864 9265 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_06210 10304 9867 gene locus_tag LOCUS_06220 10304 9867 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_06220 10772 10308 gene locus_tag LOCUS_06230 10772 10308 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876680.1 protein_id gnl|my_center|LOCUS_06230 11159 10833 gene locus_tag LOCUS_06240 11159 10833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 12651 11230 gene locus_tag LOCUS_06250 12651 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12605 12889 gene locus_tag LOCUS_06260 12605 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 13090 12860 gene locus_tag LOCUS_06270 13090 12860 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_06270 16908 13111 gene locus_tag LOCUS_06280 16908 13111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 20255 16908 gene locus_tag LOCUS_06290 20255 16908 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 protein_id gnl|my_center|LOCUS_06290 20507 20256 gene locus_tag LOCUS_06300 20507 20256 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_06300 20799 20578 gene locus_tag LOCUS_06310 20799 20578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 20687 21538 gene locus_tag LOCUS_06320 20687 21538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 21587 22468 gene locus_tag LOCUS_06330 21587 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 22532 23431 gene locus_tag LOCUS_06340 22532 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 23497 24300 gene locus_tag LOCUS_06350 23497 24300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 25466 24297 gene locus_tag LOCUS_06360 gene iscS 25466 24297 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZS1 protein_id gnl|my_center|LOCUS_06360 26260 25463 gene locus_tag LOCUS_06370 26260 25463 CDS product adenine nucleotide alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_06370 27483 26260 gene locus_tag LOCUS_06380 27483 26260 CDS product TIGR00299 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_06380 27573 28487 gene locus_tag LOCUS_06390 27573 28487 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762366.1 protein_id gnl|my_center|LOCUS_06390 28521 29294 gene locus_tag LOCUS_06400 28521 29294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869660.1 protein_id gnl|my_center|LOCUS_06400 29362 30942 gene locus_tag LOCUS_06410 29362 30942 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_06410 31358 31035 gene locus_tag LOCUS_06420 31358 31035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence13 679 1506 gene locus_tag LOCUS_06430 gene mqnD 679 1506 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66654 protein_id gnl|my_center|LOCUS_06430 1534 1827 gene locus_tag LOCUS_06440 1534 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1943 2224 gene locus_tag LOCUS_06450 1943 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2408 2638 gene locus_tag LOCUS_06460 2408 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 2845 3153 gene locus_tag LOCUS_06470 2845 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3563 3165 gene locus_tag LOCUS_06480 3563 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4717 3620 gene locus_tag LOCUS_06490 4717 3620 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240397.1 protein_id gnl|my_center|LOCUS_06490 5072 5206 gene locus_tag LOCUS_06500 5072 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 5416 5589 gene locus_tag LOCUS_06510 5416 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 6139 5576 gene locus_tag LOCUS_06520 6139 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 6499 6272 gene locus_tag LOCUS_06530 6499 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6628 7065 gene locus_tag LOCUS_06540 6628 7065 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867606.1 protein_id gnl|my_center|LOCUS_06540 7074 7628 gene locus_tag LOCUS_06550 7074 7628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8029 7625 gene locus_tag LOCUS_06560 8029 7625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 8202 9467 gene locus_tag LOCUS_06570 8202 9467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 9478 10929 gene locus_tag LOCUS_06580 9478 10929 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066616.1 protein_id gnl|my_center|LOCUS_06580 11035 11394 gene locus_tag LOCUS_06590 11035 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 12247 11873 gene locus_tag LOCUS_06600 12247 11873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12515 12360 gene locus_tag LOCUS_06610 12515 12360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12803 12576 gene locus_tag LOCUS_06620 12803 12576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12948 12739 gene locus_tag LOCUS_06630 12948 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 13624 13001 gene locus_tag LOCUS_06640 gene sodA 13624 13001 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54375 protein_id gnl|my_center|LOCUS_06640 14151 13912 gene locus_tag LOCUS_06650 14151 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 14257 14871 gene locus_tag LOCUS_06660 14257 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 15103 14891 gene locus_tag LOCUS_06670 15103 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 15707 15210 gene locus_tag LOCUS_06680 15707 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17453 15729 gene locus_tag LOCUS_06690 17453 15729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 17755 18096 gene locus_tag LOCUS_06700 17755 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 18142 18822 gene locus_tag LOCUS_06710 18142 18822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 19093 19974 gene locus_tag LOCUS_06720 19093 19974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 20346 20618 gene locus_tag LOCUS_06730 20346 20618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 20865 20620 gene locus_tag LOCUS_06740 20865 20620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 21043 22044 gene locus_tag LOCUS_06750 21043 22044 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868869.1 protein_id gnl|my_center|LOCUS_06750 22041 23408 gene locus_tag LOCUS_06760 22041 23408 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868868.1 protein_id gnl|my_center|LOCUS_06760 23731 23414 gene locus_tag LOCUS_06770 23731 23414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 24086 23742 gene locus_tag LOCUS_06780 24086 23742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 24580 24311 gene locus_tag LOCUS_06790 24580 24311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 25499 25101 gene locus_tag LOCUS_06800 25499 25101 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250213.1 protein_id gnl|my_center|LOCUS_06800 26811 25531 gene locus_tag LOCUS_06810 26811 25531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 27518 26868 gene locus_tag LOCUS_06820 27518 26868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 28147 28599 gene locus_tag LOCUS_06830 28147 28599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 28652 28978 gene locus_tag LOCUS_06840 28652 28978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 29250 29050 gene locus_tag LOCUS_06850 29250 29050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 29731 29498 gene locus_tag LOCUS_06860 29731 29498 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_06860 30429 29782 gene locus_tag LOCUS_06870 30429 29782 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence14 1188 811 gene locus_tag LOCUS_06880 1188 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1802 1455 gene locus_tag LOCUS_06890 1802 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1976 3643 gene locus_tag LOCUS_06900 1976 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 3640 4614 gene locus_tag LOCUS_06910 gene tklB 3640 4614 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_06910 4611 5276 gene locus_tag LOCUS_06920 4611 5276 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870474.1 protein_id gnl|my_center|LOCUS_06920 5596 5369 gene locus_tag LOCUS_06930 5596 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 6682 5660 gene locus_tag LOCUS_06940 gene corA 6682 5660 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLT7 protein_id gnl|my_center|LOCUS_06940 6934 7007 gene locus_tag LOCUS_t00160 6934 7007 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7311 7045 gene locus_tag LOCUS_06950 7311 7045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 7877 7530 gene locus_tag LOCUS_06960 7877 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8679 7918 gene locus_tag LOCUS_06970 8679 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 8974 8705 gene locus_tag LOCUS_06980 8974 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_06980 9317 9009 gene locus_tag LOCUS_06990 gene hcaC 9317 9009 CDS product bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229731.1 protein_id gnl|my_center|LOCUS_06990 9350 10138 gene locus_tag LOCUS_07000 9350 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11004 10135 gene locus_tag LOCUS_07010 11004 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_07010 12717 11011 gene locus_tag LOCUS_07020 12717 11011 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867608.1 protein_id gnl|my_center|LOCUS_07020 13717 12737 gene locus_tag LOCUS_07030 13717 12737 CDS product geranylgeranyl pyrophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980132.1 protein_id gnl|my_center|LOCUS_07030 14354 13704 gene locus_tag LOCUS_07040 14354 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 15099 14344 gene locus_tag LOCUS_07050 15099 14344 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_07050 16064 15123 gene locus_tag LOCUS_07060 16064 15123 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879778.1 protein_id gnl|my_center|LOCUS_07060 16711 16088 gene locus_tag LOCUS_07070 16711 16088 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875684.1 protein_id gnl|my_center|LOCUS_07070 17957 16719 gene locus_tag LOCUS_07080 17957 16719 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875683.1 protein_id gnl|my_center|LOCUS_07080 18246 17959 gene locus_tag LOCUS_07090 18246 17959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 18248 18333 gene locus_tag LOCUS_t00170 18248 18333 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18962 18348 gene locus_tag LOCUS_07100 18962 18348 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496416.1 protein_id gnl|my_center|LOCUS_07100 19035 19682 gene locus_tag LOCUS_07110 19035 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 19679 20287 gene locus_tag LOCUS_07120 19679 20287 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_07120 20295 21353 gene locus_tag LOCUS_07130 20295 21353 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877787.1 protein_id gnl|my_center|LOCUS_07130 23106 21346 gene locus_tag LOCUS_07140 23106 21346 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867349.1 protein_id gnl|my_center|LOCUS_07140 23725 23159 gene locus_tag LOCUS_07150 23725 23159 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_07150 24331 23735 gene locus_tag LOCUS_07160 24331 23735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 24678 24986 gene locus_tag LOCUS_07170 24678 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 25475 24978 gene locus_tag LOCUS_07180 25475 24978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 25616 26701 gene locus_tag LOCUS_07190 25616 26701 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887529.1 protein_id gnl|my_center|LOCUS_07190 26691 27899 gene locus_tag LOCUS_07200 26691 27899 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887528.1 protein_id gnl|my_center|LOCUS_07200 29254 27896 gene locus_tag LOCUS_07210 29254 27896 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085925.1 protein_id gnl|my_center|LOCUS_07210 29341 29877 gene locus_tag LOCUS_07220 29341 29877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence15 503 135 gene locus_tag LOCUS_07230 503 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1758 496 gene locus_tag LOCUS_07240 1758 496 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_07240 2200 1790 gene locus_tag LOCUS_07250 2200 1790 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_07250 2570 2397 gene locus_tag LOCUS_07260 2570 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 2623 2696 gene locus_tag LOCUS_t00180 2623 2696 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3659 2697 gene locus_tag LOCUS_07270 3659 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4236 3694 gene locus_tag LOCUS_07280 4236 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7098 4237 gene locus_tag LOCUS_07290 7098 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8261 7140 gene locus_tag LOCUS_07300 8261 7140 CDS product DNA primase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762192.1 protein_id gnl|my_center|LOCUS_07300 9289 8261 gene locus_tag LOCUS_07310 9289 8261 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903675.1 protein_id gnl|my_center|LOCUS_07310 9334 10215 gene locus_tag LOCUS_07320 gene nfo 9334 10215 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYJ7 protein_id gnl|my_center|LOCUS_07320 10247 11704 gene locus_tag LOCUS_07330 10247 11704 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869726.1 protein_id gnl|my_center|LOCUS_07330 11868 13034 gene locus_tag LOCUS_07340 11868 13034 CDS product dolichol monophosphate mannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_07340 13153 14310 gene locus_tag LOCUS_07350 13153 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 15100 14450 gene locus_tag LOCUS_07360 15100 14450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_07360 15206 15967 gene locus_tag LOCUS_07370 gene murI 15206 15967 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_07370 16724 15960 gene locus_tag LOCUS_07380 gene cbiF 16724 15960 CDS product cobalt-precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_07380 17439 16717 gene locus_tag LOCUS_07390 gene cbiL 17439 16717 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943625.1 protein_id gnl|my_center|LOCUS_07390 18066 17476 gene locus_tag LOCUS_07400 18066 17476 CDS product cobalt-precorrin-6Y C(15)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979887.1 protein_id gnl|my_center|LOCUS_07400 18574 18098 gene locus_tag LOCUS_07410 18574 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 18677 20623 gene locus_tag LOCUS_07420 18677 20623 CDS product fibronectin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867817.1 protein_id gnl|my_center|LOCUS_07420 20990 20601 gene locus_tag LOCUS_07430 20990 20601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 22141 20987 gene locus_tag LOCUS_07440 22141 20987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020303.1 protein_id gnl|my_center|LOCUS_07440 22174 22848 gene locus_tag LOCUS_07450 22174 22848 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876402.1 protein_id gnl|my_center|LOCUS_07450 23500 22832 gene locus_tag LOCUS_07460 23500 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 24673 23531 gene locus_tag LOCUS_07470 24673 23531 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_07470 25400 24684 gene locus_tag LOCUS_07480 25400 24684 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_07480 25484 26590 gene locus_tag LOCUS_07490 25484 26590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 26631 27866 gene locus_tag LOCUS_07500 26631 27866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496769.1 protein_id gnl|my_center|LOCUS_07500 >Feature sequence16 <1 1377 gene locus_tag LOCUS_07510 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877263.1:anthranilate synthase component I 1374 1976 gene locus_tag LOCUS_07520 gene pabA 1374 1976 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_07520 1994 2512 gene locus_tag LOCUS_07530 1994 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2509 3555 gene locus_tag LOCUS_07540 gene trpD 2509 3555 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P20574 protein_id gnl|my_center|LOCUS_07540 3548 4324 gene locus_tag LOCUS_07550 3548 4324 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870432.1 protein_id gnl|my_center|LOCUS_07550 4321 5508 gene locus_tag LOCUS_07560 gene trpB1 4321 5508 CDS product tryptophan synthase beta chain 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66923 protein_id gnl|my_center|LOCUS_07560 5495 6295 gene locus_tag LOCUS_07570 5495 6295 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_07570 7249 6479 gene locus_tag LOCUS_07580 7249 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 7405 8967 gene locus_tag LOCUS_07590 gene pyrG 7405 8967 CDS product CTP synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_07590 10012 9014 gene locus_tag LOCUS_07600 10012 9014 CDS product ATP-NAD/AcoX kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763693.1 protein_id gnl|my_center|LOCUS_07600 10247 10113 gene locus_tag LOCUS_07610 10247 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 11328 10459 gene locus_tag LOCUS_07620 11328 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 11592 11879 gene locus_tag LOCUS_07630 11592 11879 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762572.1 protein_id gnl|my_center|LOCUS_07630 12451 11876 gene locus_tag LOCUS_07640 12451 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_07640 13409 12537 gene locus_tag LOCUS_07650 gene speB 13409 12537 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_07650 15306 13414 gene locus_tag LOCUS_07660 15306 13414 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_07660 15404 15565 gene locus_tag LOCUS_07670 15404 15565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 15591 15779 gene locus_tag LOCUS_07680 15591 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 16109 15774 gene locus_tag LOCUS_07690 16109 15774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 16221 17312 gene locus_tag LOCUS_07700 16221 17312 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141047.1 protein_id gnl|my_center|LOCUS_07700 17521 17309 gene locus_tag LOCUS_07710 17521 17309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 17637 17936 gene locus_tag LOCUS_07720 17637 17936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 18304 17918 gene locus_tag LOCUS_07730 18304 17918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 18318 18842 gene locus_tag LOCUS_07740 18318 18842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 18900 19208 gene locus_tag LOCUS_07750 18900 19208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 19621 19205 gene locus_tag LOCUS_07760 19621 19205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 19727 20677 gene locus_tag LOCUS_07770 19727 20677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 21269 20865 gene locus_tag LOCUS_07780 21269 20865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 22396 21293 gene locus_tag LOCUS_07790 22396 21293 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880158.1 protein_id gnl|my_center|LOCUS_07790 23191 22832 gene locus_tag LOCUS_07800 23191 22832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 24105 23455 gene locus_tag LOCUS_07810 24105 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 24322 24474 gene locus_tag LOCUS_07820 24322 24474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 24643 24789 gene locus_tag LOCUS_07830 24643 24789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 25061 24786 gene locus_tag LOCUS_07840 25061 24786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 26084 25194 gene locus_tag LOCUS_07850 gene menA 26084 25194 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81BK6 protein_id gnl|my_center|LOCUS_07850 26170 26382 gene locus_tag LOCUS_07860 26170 26382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 26787 26386 gene locus_tag LOCUS_07870 26787 26386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227790.1 protein_id gnl|my_center|LOCUS_07870 27543 27379 gene locus_tag LOCUS_07880 27543 27379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence17 507 821 gene locus_tag LOCUS_07890 507 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1367 1603 gene locus_tag LOCUS_07900 1367 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1762 1604 gene locus_tag LOCUS_07910 1762 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1847 2398 gene locus_tag LOCUS_07920 1847 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3727 2417 gene locus_tag LOCUS_07930 3727 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3925 3728 gene locus_tag LOCUS_07940 3925 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4552 4130 gene locus_tag LOCUS_07950 4552 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 6630 4648 gene locus_tag LOCUS_07960 6630 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8467 6755 gene locus_tag LOCUS_07970 gene ureC 8467 6755 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89UG0 protein_id gnl|my_center|LOCUS_07970 8832 8464 gene locus_tag LOCUS_07980 gene ureB 8832 8464 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000612126.1 protein_id gnl|my_center|LOCUS_07980 9140 8829 gene locus_tag LOCUS_07990 gene ureA 9140 8829 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QYE2 protein_id gnl|my_center|LOCUS_07990 9226 9699 gene locus_tag LOCUS_08000 9226 9699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 9689 10390 gene locus_tag LOCUS_08010 9689 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 10408 11070 gene locus_tag LOCUS_08020 gene ureG 10408 11070 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JKE2 protein_id gnl|my_center|LOCUS_08020 11067 11990 gene locus_tag LOCUS_08030 gene ureD 11067 11990 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNC5 protein_id gnl|my_center|LOCUS_08030 12730 11987 gene locus_tag LOCUS_08040 12730 11987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 12828 13106 gene locus_tag LOCUS_08050 12828 13106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 13103 13501 gene locus_tag LOCUS_08060 13103 13501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 13685 13963 gene locus_tag LOCUS_08070 13685 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 14020 14295 gene locus_tag LOCUS_08080 14020 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 15800 14292 gene locus_tag LOCUS_08090 15800 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 16294 16127 gene locus_tag LOCUS_08100 16294 16127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 16433 16972 gene locus_tag LOCUS_08110 16433 16972 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421374.1 protein_id gnl|my_center|LOCUS_08110 16965 19592 gene locus_tag LOCUS_08120 16965 19592 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979471.1 protein_id gnl|my_center|LOCUS_08120 19594 19878 gene locus_tag LOCUS_08130 19594 19878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 19916 20572 gene locus_tag LOCUS_08140 19916 20572 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871052.1 protein_id gnl|my_center|LOCUS_08140 20600 23266 gene locus_tag LOCUS_08150 20600 23266 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583674.1 protein_id gnl|my_center|LOCUS_08150 23304 23861 gene locus_tag LOCUS_08160 23304 23861 CDS product inosine-5-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879609.1 protein_id gnl|my_center|LOCUS_08160 24873 24475 gene locus_tag LOCUS_08170 24873 24475 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_08170 26466 24874 gene locus_tag LOCUS_08180 26466 24874 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_08180 27385 26468 gene locus_tag LOCUS_08190 27385 26468 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_08190 27690 27550 gene locus_tag LOCUS_08200 27690 27550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 >Feature sequence18 945 529 gene locus_tag LOCUS_08210 945 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_08210 1188 979 gene locus_tag LOCUS_08220 1188 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1521 2258 gene locus_tag LOCUS_08230 gene psmA 1521 2258 CDS product proteasome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_08230 2287 3102 gene locus_tag LOCUS_08240 2287 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879419.1 protein_id gnl|my_center|LOCUS_08240 3308 4303 gene locus_tag LOCUS_08250 3308 4303 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 protein_id gnl|my_center|LOCUS_08250 4300 5115 gene locus_tag LOCUS_08260 4300 5115 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_08260 5112 5378 gene locus_tag LOCUS_08270 5112 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 5423 5818 gene locus_tag LOCUS_08280 5423 5818 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_08280 5824 6282 gene locus_tag LOCUS_08290 5824 6282 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_08290 6285 7190 gene locus_tag LOCUS_08300 6285 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 7187 7393 gene locus_tag LOCUS_08310 7187 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 7390 7656 gene locus_tag LOCUS_08320 7390 7656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 7653 7976 gene locus_tag LOCUS_08330 7653 7976 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_08330 7976 8398 gene locus_tag LOCUS_08340 7976 8398 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869966.1 protein_id gnl|my_center|LOCUS_08340 8403 8894 gene locus_tag LOCUS_08350 8403 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8894 9610 gene locus_tag LOCUS_08360 8894 9610 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762314.1 protein_id gnl|my_center|LOCUS_08360 9615 10136 gene locus_tag LOCUS_08370 9615 10136 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_08370 10136 10315 gene locus_tag LOCUS_08380 gene rps14P 10136 10315 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_08380 10322 10714 gene locus_tag LOCUS_08390 10322 10714 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_08390 10704 11261 gene locus_tag LOCUS_08400 gene rpl6p 10704 11261 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_08400 11280 11567 gene locus_tag LOCUS_08410 11280 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 11639 11713 gene locus_tag LOCUS_t00190 11639 11713 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 11958 12152 gene locus_tag LOCUS_08420 11958 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 12165 12392 gene locus_tag LOCUS_08430 12165 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 12519 12968 gene locus_tag LOCUS_08440 12519 12968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 13030 13176 gene locus_tag LOCUS_08450 13030 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 13753 14238 gene locus_tag LOCUS_08460 13753 14238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 14341 14697 gene locus_tag LOCUS_08470 14341 14697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 15186 14782 gene locus_tag LOCUS_08480 15186 14782 CDS product PPOX class F420-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_08480 15770 15186 gene locus_tag LOCUS_08490 15770 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 16891 16055 gene locus_tag LOCUS_08500 gene purC 16891 16055 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFN3 protein_id gnl|my_center|LOCUS_08500 17525 17247 gene locus_tag LOCUS_08510 17525 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259052.1 protein_id gnl|my_center|LOCUS_08510 19032 17563 gene locus_tag LOCUS_08520 gene purF 19032 17563 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CN7 protein_id gnl|my_center|LOCUS_08520 21190 19025 gene locus_tag LOCUS_08530 21190 19025 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868861.1 protein_id gnl|my_center|LOCUS_08530 21819 21187 gene locus_tag LOCUS_08540 gene purQ 21819 21187 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPA5 protein_id gnl|my_center|LOCUS_08540 22202 21942 gene locus_tag LOCUS_08550 22202 21942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846581.1 protein_id gnl|my_center|LOCUS_08550 22790 23254 gene locus_tag LOCUS_08560 22790 23254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 23282 24073 gene locus_tag LOCUS_08570 gene tatC 23282 24073 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKH3 protein_id gnl|my_center|LOCUS_08570 24039 24308 gene locus_tag LOCUS_08580 24039 24308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 24733 24305 gene locus_tag LOCUS_08590 24733 24305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 25295 24735 gene locus_tag LOCUS_08600 25295 24735 CDS product putative UbiX-like flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMA6 protein_id gnl|my_center|LOCUS_08600 25488 25345 gene locus_tag LOCUS_08610 25488 25345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 25586 26677 gene locus_tag LOCUS_08620 25586 26677 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846248.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence19 35 343 gene locus_tag LOCUS_08630 35 343 CDS product putative ferredoxin subunit of phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705094.1 protein_id gnl|my_center|LOCUS_08630 346 1590 gene locus_tag LOCUS_08640 gene csdB 346 1590 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F0D5 protein_id gnl|my_center|LOCUS_08640 1587 2030 gene locus_tag LOCUS_08650 1587 2030 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_08650 2032 2379 gene locus_tag LOCUS_08660 2032 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3517 2372 gene locus_tag LOCUS_08670 3517 2372 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496567.1 protein_id gnl|my_center|LOCUS_08670 3721 4389 gene locus_tag LOCUS_08680 3721 4389 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948131.1 protein_id gnl|my_center|LOCUS_08680 4689 4378 gene locus_tag LOCUS_08690 4689 4378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4826 5701 gene locus_tag LOCUS_08700 4826 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 5763 6371 gene locus_tag LOCUS_08710 5763 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 6722 6402 gene locus_tag LOCUS_08720 6722 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7303 7920 gene locus_tag LOCUS_08730 7303 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 7921 8541 gene locus_tag LOCUS_08740 gene yedJ 7921 8541 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261932.1 protein_id gnl|my_center|LOCUS_08740 8936 8625 gene locus_tag LOCUS_08750 8936 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 9913 8933 gene locus_tag LOCUS_08760 gene hemB 9913 8933 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJW7 protein_id gnl|my_center|LOCUS_08760 11210 9945 gene locus_tag LOCUS_08770 11210 9945 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_08770 11860 11207 gene locus_tag LOCUS_08780 11860 11207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 11964 12980 gene locus_tag LOCUS_08790 11964 12980 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_08790 13321 12977 gene locus_tag LOCUS_08800 13321 12977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14321 13323 gene locus_tag LOCUS_08810 14321 13323 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903488.1 protein_id gnl|my_center|LOCUS_08810 15112 14438 gene locus_tag LOCUS_08820 15112 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224514.1 protein_id gnl|my_center|LOCUS_08820 15369 15157 gene locus_tag LOCUS_08830 15369 15157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 16172 15402 gene locus_tag LOCUS_08840 gene sufC 16172 15402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000929158.1 protein_id gnl|my_center|LOCUS_08840 17220 16264 gene locus_tag LOCUS_08850 gene tfb 17220 16264 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876518.1 protein_id gnl|my_center|LOCUS_08850 17465 17217 gene locus_tag LOCUS_08860 17465 17217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 17859 17560 gene locus_tag LOCUS_08870 17859 17560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 18244 17861 gene locus_tag LOCUS_08880 18244 17861 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868249.1 protein_id gnl|my_center|LOCUS_08880 18889 18311 gene locus_tag LOCUS_08890 18889 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 19570 18896 gene locus_tag LOCUS_08900 19570 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 19665 20741 gene locus_tag LOCUS_08910 19665 20741 CDS product NAD-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085564.1 protein_id gnl|my_center|LOCUS_08910 20792 21268 gene locus_tag LOCUS_08920 20792 21268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 21767 21204 gene locus_tag LOCUS_08930 21767 21204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 21877 22188 gene locus_tag LOCUS_08940 21877 22188 CDS product translation initiation factor 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_08940 22256 22447 gene locus_tag LOCUS_08950 gene cspLB 22256 22447 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_08950 22776 23384 gene locus_tag LOCUS_08960 22776 23384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 23547 24128 gene locus_tag LOCUS_08970 23547 24128 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_08970 24416 24874 gene locus_tag LOCUS_08980 24416 24874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 25025 25981 gene locus_tag LOCUS_08990 25025 25981 CDS product quinolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA69 protein_id gnl|my_center|LOCUS_08990 25996 26388 gene locus_tag LOCUS_09000 25996 26388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence20 472 921 gene locus_tag LOCUS_09010 472 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1080 1295 gene locus_tag LOCUS_09020 1080 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1900 2130 gene locus_tag LOCUS_09030 1900 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 2346 2759 gene locus_tag LOCUS_09040 2346 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2848 3273 gene locus_tag LOCUS_09050 2848 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 4216 4533 gene locus_tag LOCUS_09060 4216 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 5205 4831 gene locus_tag LOCUS_09070 5205 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 5310 6647 gene locus_tag LOCUS_09080 5310 6647 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061193.1 protein_id gnl|my_center|LOCUS_09080 6799 8046 gene locus_tag LOCUS_09090 6799 8046 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_09090 9101 8049 gene locus_tag LOCUS_09100 9101 8049 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902020.1 protein_id gnl|my_center|LOCUS_09100 9786 9250 gene locus_tag LOCUS_09110 9786 9250 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_09110 9877 10410 gene locus_tag LOCUS_09120 9877 10410 CDS product oxetanocin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_09120 10419 10643 gene locus_tag LOCUS_09130 10419 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 10939 10646 gene locus_tag LOCUS_09140 10939 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 11019 11366 gene locus_tag LOCUS_09150 11019 11366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11424 12647 gene locus_tag LOCUS_09160 11424 12647 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_09160 14060 12702 gene locus_tag LOCUS_09170 14060 12702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 16092 14173 gene locus_tag LOCUS_09180 16092 14173 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878475.1 protein_id gnl|my_center|LOCUS_09180 16401 16138 gene locus_tag LOCUS_09190 16401 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 17807 16398 gene locus_tag LOCUS_09200 17807 16398 CDS product glutamyl-tRNA amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846244.1 protein_id gnl|my_center|LOCUS_09200 19249 17804 gene locus_tag LOCUS_09210 gene gatA 19249 17804 CDS product aspartyl/glutamyl-tRNA amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_09210 19515 19249 gene locus_tag LOCUS_09220 19515 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 19890 19681 gene locus_tag LOCUS_09230 19890 19681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09230 20069 19923 gene locus_tag LOCUS_09240 20069 19923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 20175 20498 gene locus_tag LOCUS_09250 20175 20498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 20686 20543 gene locus_tag LOCUS_09260 20686 20543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 20982 20755 gene locus_tag LOCUS_09270 20982 20755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 21119 20970 gene locus_tag LOCUS_09280 21119 20970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 21913 21602 gene locus_tag LOCUS_09290 21913 21602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 22340 22119 gene locus_tag LOCUS_09300 22340 22119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 22753 22544 gene locus_tag LOCUS_09310 22753 22544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 23161 22856 gene locus_tag LOCUS_09320 23161 22856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 23442 23272 gene locus_tag LOCUS_09330 23442 23272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 23801 23490 gene locus_tag LOCUS_09340 23801 23490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence21 1092 463 gene locus_tag LOCUS_09350 1092 463 CDS product phosphate transport regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816806.1 protein_id gnl|my_center|LOCUS_09350 1509 1234 gene locus_tag LOCUS_09360 1509 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3218 1641 gene locus_tag LOCUS_09370 3218 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4074 3289 gene locus_tag LOCUS_09380 4074 3289 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DYL8 protein_id gnl|my_center|LOCUS_09380 5069 4071 gene locus_tag LOCUS_09390 5069 4071 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_09390 5744 5292 gene locus_tag LOCUS_09400 5744 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5674 6153 gene locus_tag LOCUS_09410 5674 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 6216 8435 gene locus_tag LOCUS_09420 6216 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460248.1 protein_id gnl|my_center|LOCUS_09420 9084 8440 gene locus_tag LOCUS_09430 9084 8440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9257 9646 gene locus_tag LOCUS_09440 9257 9646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 10015 9656 gene locus_tag LOCUS_09450 10015 9656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11564 10065 gene locus_tag LOCUS_09460 11564 10065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11678 11845 gene locus_tag LOCUS_09470 11678 11845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 12025 11876 gene locus_tag LOCUS_09480 12025 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 12961 12071 gene locus_tag LOCUS_09490 12961 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13073 13147 gene locus_tag LOCUS_t00200 13073 13147 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 13227 13910 gene locus_tag LOCUS_09500 13227 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 13913 14302 gene locus_tag LOCUS_09510 13913 14302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 14328 14984 gene locus_tag LOCUS_09520 14328 14984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 15544 14981 gene locus_tag LOCUS_09530 15544 14981 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_09530 15642 16151 gene locus_tag LOCUS_09540 15642 16151 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870047.1 protein_id gnl|my_center|LOCUS_09540 16406 16143 gene locus_tag LOCUS_09550 16406 16143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 16470 16545 gene locus_tag LOCUS_t00210 16470 16545 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16978 16547 gene locus_tag LOCUS_09560 16978 16547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 18314 16971 gene locus_tag LOCUS_09570 18314 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 18730 20229 gene locus_tag LOCUS_09580 18730 20229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 20921 20226 gene locus_tag LOCUS_09590 20921 20226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 21322 20978 gene locus_tag LOCUS_09600 21322 20978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence22 875 2023 gene locus_tag LOCUS_09610 875 2023 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228346.1 protein_id gnl|my_center|LOCUS_09610 2085 2498 gene locus_tag LOCUS_09620 2085 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2537 4309 gene locus_tag LOCUS_09630 gene lig 2537 4309 CDS product putative DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67398 protein_id gnl|my_center|LOCUS_09630 4376 5029 gene locus_tag LOCUS_09640 4376 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5115 5651 gene locus_tag LOCUS_09650 5115 5651 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_09650 6028 5648 gene locus_tag LOCUS_09660 6028 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 6264 6028 gene locus_tag LOCUS_09670 6264 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6714 6962 gene locus_tag LOCUS_09680 6714 6962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09680 7204 7611 gene locus_tag LOCUS_09690 7204 7611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8081 7629 gene locus_tag LOCUS_09700 gene yccI 8081 7629 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129831.1 protein_id gnl|my_center|LOCUS_09700 8895 8110 gene locus_tag LOCUS_09710 8895 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 9117 8953 gene locus_tag LOCUS_09720 9117 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 9226 9756 gene locus_tag LOCUS_09730 9226 9756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 11669 9753 gene locus_tag LOCUS_09740 11669 9753 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 protein_id gnl|my_center|LOCUS_09740 12600 11725 gene locus_tag LOCUS_09750 12600 11725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 12848 13141 gene locus_tag LOCUS_09760 12848 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 13174 14790 gene locus_tag LOCUS_09770 13174 14790 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256261.1 protein_id gnl|my_center|LOCUS_09770 14787 15176 gene locus_tag LOCUS_09780 gene msrB 14787 15176 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066093.1 protein_id gnl|my_center|LOCUS_09780 15338 16348 gene locus_tag LOCUS_09790 15338 16348 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871127.1 protein_id gnl|my_center|LOCUS_09790 16345 16821 gene locus_tag LOCUS_09800 16345 16821 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870950.1 protein_id gnl|my_center|LOCUS_09800 17429 16833 gene locus_tag LOCUS_09810 17429 16833 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762506.1 protein_id gnl|my_center|LOCUS_09810 19293 17941 gene locus_tag LOCUS_09820 19293 17941 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256756.1 protein_id gnl|my_center|LOCUS_09820 20136 19300 gene locus_tag LOCUS_09830 20136 19300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 21099 20227 gene locus_tag LOCUS_09840 21099 20227 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence23 1 1356 gene locus_tag LOCUS_09850 1 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2316 1522 gene locus_tag LOCUS_09860 2316 1522 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_09860 2891 2358 gene locus_tag LOCUS_09870 2891 2358 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812393.1 protein_id gnl|my_center|LOCUS_09870 2977 4329 gene locus_tag LOCUS_09880 2977 4329 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_09880 4959 4318 gene locus_tag LOCUS_09890 gene cbiC 4959 4318 CDS product cobalt-precorrin-8 methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP7 protein_id gnl|my_center|LOCUS_09890 5701 4949 gene locus_tag LOCUS_09900 5701 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 6756 5698 gene locus_tag LOCUS_09910 gene cbiG 6756 5698 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828196.1 protein_id gnl|my_center|LOCUS_09910 7885 6782 gene locus_tag LOCUS_09920 gene cbiD 7885 6782 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EXP6 protein_id gnl|my_center|LOCUS_09920 7965 8834 gene locus_tag LOCUS_09930 7965 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 9977 8808 gene locus_tag LOCUS_09940 gene metK 9977 8808 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61946 protein_id gnl|my_center|LOCUS_09940 10239 9994 gene locus_tag LOCUS_09950 10239 9994 CDS product Sm ribonucleo inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_09950 10348 11007 gene locus_tag LOCUS_09960 10348 11007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 11106 13847 gene locus_tag LOCUS_09970 11106 13847 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020807.1 protein_id gnl|my_center|LOCUS_09970 15238 13844 gene locus_tag LOCUS_09980 15238 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 15438 16376 gene locus_tag LOCUS_09990 15438 16376 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582485.1 protein_id gnl|my_center|LOCUS_09990 16360 17121 gene locus_tag LOCUS_10000 16360 17121 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1C4 protein_id gnl|my_center|LOCUS_10000 17868 17131 gene locus_tag LOCUS_10010 17868 17131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 18009 17936 gene locus_tag LOCUS_t00220 18009 17936 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 19099 18068 gene locus_tag LOCUS_10020 19099 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876418.1 protein_id gnl|my_center|LOCUS_10020 19162 20301 gene locus_tag LOCUS_10030 19162 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence24 617 1198 gene locus_tag LOCUS_10040 617 1198 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_10040 1195 2430 gene locus_tag LOCUS_10050 1195 2430 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881249.1 protein_id gnl|my_center|LOCUS_10050 2427 3110 gene locus_tag LOCUS_10060 2427 3110 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_10060 3485 3117 gene locus_tag LOCUS_10070 3485 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3538 4089 gene locus_tag LOCUS_10080 3538 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 4995 4348 gene locus_tag LOCUS_10090 4995 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 5258 5028 gene locus_tag LOCUS_10100 5258 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 6306 5272 gene locus_tag LOCUS_10110 gene ntpC 6306 5272 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380540.1 protein_id gnl|my_center|LOCUS_10110 7032 6367 gene locus_tag LOCUS_10120 7032 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 7164 8549 gene locus_tag LOCUS_10130 7164 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10130 8804 9580 gene locus_tag LOCUS_10140 8804 9580 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979851.1 protein_id gnl|my_center|LOCUS_10140 9769 9903 gene locus_tag LOCUS_10150 9769 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 12099 9919 gene locus_tag LOCUS_10160 12099 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 12141 12740 gene locus_tag LOCUS_10170 12141 12740 CDS product ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903582.1 protein_id gnl|my_center|LOCUS_10170 12742 14520 gene locus_tag LOCUS_10180 12742 14520 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_10180 14517 15902 gene locus_tag LOCUS_10190 14517 15902 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_10190 15907 16542 gene locus_tag LOCUS_10200 gene atpD 15907 16542 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q184E4 protein_id gnl|my_center|LOCUS_10200 16539 16670 gene locus_tag LOCUS_10210 16539 16670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 16722 17036 gene locus_tag LOCUS_10220 16722 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17506 17063 gene locus_tag LOCUS_10230 17506 17063 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868441.1 protein_id gnl|my_center|LOCUS_10230 17566 18495 gene locus_tag LOCUS_10240 17566 18495 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_10240 18550 19260 gene locus_tag LOCUS_10250 18550 19260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence25 985 335 gene locus_tag LOCUS_10260 985 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_10260 2186 1080 gene locus_tag LOCUS_10270 2186 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 2988 2191 gene locus_tag LOCUS_10280 gene ccdA 2988 2191 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_10280 4257 3127 gene locus_tag LOCUS_10290 4257 3127 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KM3 protein_id gnl|my_center|LOCUS_10290 5037 5372 gene locus_tag LOCUS_10300 5037 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5446 5607 gene locus_tag LOCUS_10310 5446 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5822 6799 gene locus_tag LOCUS_10320 gene bioB 5822 6799 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I427 protein_id gnl|my_center|LOCUS_10320 8129 6846 gene locus_tag LOCUS_10330 gene bioA 8129 6846 CDS product adenosylmethionine-8-amino-7-oxononanoate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT9 protein_id gnl|my_center|LOCUS_10330 8235 8918 gene locus_tag LOCUS_10340 gene bioD 8235 8918 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53558 protein_id gnl|my_center|LOCUS_10340 9472 8924 gene locus_tag LOCUS_10350 9472 8924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 10867 9473 gene locus_tag LOCUS_10360 10867 9473 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903175.1 protein_id gnl|my_center|LOCUS_10360 11681 10977 gene locus_tag LOCUS_10370 11681 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 11840 11916 gene locus_tag LOCUS_t00230 11840 11916 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 12082 12285 gene locus_tag LOCUS_10380 12082 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 12320 12559 gene locus_tag LOCUS_10390 12320 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 12553 12771 gene locus_tag LOCUS_10400 12553 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 12806 13219 gene locus_tag LOCUS_10410 12806 13219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 13271 13723 gene locus_tag LOCUS_10420 13271 13723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 14124 13738 gene locus_tag LOCUS_10430 14124 13738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 14584 14201 gene locus_tag LOCUS_10440 14584 14201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 15672 14878 gene locus_tag LOCUS_10450 15672 14878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 15866 16717 gene locus_tag LOCUS_10460 15866 16717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 16901 18109 gene locus_tag LOCUS_10470 16901 18109 CDS product threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_10470 18198 18443 gene locus_tag LOCUS_10480 18198 18443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 19439 18864 gene locus_tag LOCUS_10490 19439 18864 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence26 1030 2 gene locus_tag LOCUS_10500 1030 2 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053822.1 protein_id gnl|my_center|LOCUS_10500 1143 1775 gene locus_tag LOCUS_10510 1143 1775 CDS product proteasome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876826.1 protein_id gnl|my_center|LOCUS_10510 1783 3723 gene locus_tag LOCUS_10520 1783 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146646.1 protein_id gnl|my_center|LOCUS_10520 3993 3715 gene locus_tag LOCUS_10530 3993 3715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5122 4067 gene locus_tag LOCUS_10540 5122 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_10540 5150 6214 gene locus_tag LOCUS_10550 5150 6214 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_10550 6693 6217 gene locus_tag LOCUS_10560 6693 6217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 7545 6703 gene locus_tag LOCUS_10570 7545 6703 CDS product ubiquinone/menaquinone biosynthesis methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090743.1 protein_id gnl|my_center|LOCUS_10570 7709 7542 gene locus_tag LOCUS_10580 7709 7542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 8956 7706 gene locus_tag LOCUS_10590 8956 7706 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_10590 9785 8946 gene locus_tag LOCUS_10600 gene panB 9785 8946 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYW9 protein_id gnl|my_center|LOCUS_10600 10542 9778 gene locus_tag LOCUS_10610 10542 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978509.1 protein_id gnl|my_center|LOCUS_10610 11464 10553 gene locus_tag LOCUS_10620 11464 10553 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876216.1 protein_id gnl|my_center|LOCUS_10620 11529 12509 gene locus_tag LOCUS_10630 11529 12509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_10630 13025 12510 gene locus_tag LOCUS_10640 gene nudF 13025 12510 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54570 protein_id gnl|my_center|LOCUS_10640 13953 13051 gene locus_tag LOCUS_10650 13953 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 14069 15256 gene locus_tag LOCUS_10660 14069 15256 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016502.1 protein_id gnl|my_center|LOCUS_10660 15405 15953 gene locus_tag LOCUS_10670 15405 15953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 15953 17248 gene locus_tag LOCUS_10680 15953 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 17281 17613 gene locus_tag LOCUS_10690 17281 17613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 17679 17861 gene locus_tag LOCUS_10700 17679 17861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 17915 18328 gene locus_tag LOCUS_10710 17915 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 18328 19872 gene locus_tag LOCUS_10720 18328 19872 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289376.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence27 761 294 gene locus_tag LOCUS_10730 761 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1080 1289 gene locus_tag LOCUS_10740 1080 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2213 1284 gene locus_tag LOCUS_10750 gene ctaB 2213 1284 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3MHJ3 protein_id gnl|my_center|LOCUS_10750 2683 2216 gene locus_tag LOCUS_10760 2683 2216 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496594.1 protein_id gnl|my_center|LOCUS_10760 3831 2755 gene locus_tag LOCUS_10770 3831 2755 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879003.1 protein_id gnl|my_center|LOCUS_10770 3915 4994 gene locus_tag LOCUS_10780 3915 4994 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016795.1 protein_id gnl|my_center|LOCUS_10780 4991 5830 gene locus_tag LOCUS_10790 4991 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5827 6798 gene locus_tag LOCUS_10800 5827 6798 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_10800 6791 7516 gene locus_tag LOCUS_10810 6791 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7513 8097 gene locus_tag LOCUS_10820 7513 8097 CDS product adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870628.1 protein_id gnl|my_center|LOCUS_10820 8277 8080 gene locus_tag LOCUS_10830 8277 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8537 8274 gene locus_tag LOCUS_10840 8537 8274 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_10840 8626 10389 gene locus_tag LOCUS_10850 gene ade3 8626 10389 CDS product adenine deaminase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92YE2 protein_id gnl|my_center|LOCUS_10850 10434 12056 gene locus_tag LOCUS_10860 10434 12056 CDS product thermosome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251253.1 protein_id gnl|my_center|LOCUS_10860 12090 12959 gene locus_tag LOCUS_10870 12090 12959 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704730.1 protein_id gnl|my_center|LOCUS_10870 13220 12960 gene locus_tag LOCUS_10880 13220 12960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 14817 13294 gene locus_tag LOCUS_10890 gene guaA 14817 13294 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHY9 protein_id gnl|my_center|LOCUS_10890 15394 14822 gene locus_tag LOCUS_10900 15394 14822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 16161 15430 gene locus_tag LOCUS_10910 16161 15430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868117.1 protein_id gnl|my_center|LOCUS_10910 16199 17050 gene locus_tag LOCUS_10920 16199 17050 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250112.1 protein_id gnl|my_center|LOCUS_10920 17095 18525 gene locus_tag LOCUS_10930 gene guaB 17095 18525 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67820 protein_id gnl|my_center|LOCUS_10930 18863 19333 gene locus_tag LOCUS_10940 18863 19333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 <19979 19330 gene locus_tag LOCUS_10950 <19979 19330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583989.1:prephenate dehydratase >Feature sequence28 <1 627 gene locus_tag LOCUS_10960 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846746.1:NADH-quinone oxidoreductase subunit C 642 1763 gene locus_tag LOCUS_10970 642 1763 CDS product NADH dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762086.1 protein_id gnl|my_center|LOCUS_10970 1764 3077 gene locus_tag LOCUS_10980 1764 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3077 3574 gene locus_tag LOCUS_10990 gene nuoI1 3077 3574 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA0 protein_id gnl|my_center|LOCUS_10990 3567 4076 gene locus_tag LOCUS_11000 gene ndhG 3567 4076 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_11000 4060 4362 gene locus_tag LOCUS_11010 gene ndhE 4060 4362 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_11010 4362 5915 gene locus_tag LOCUS_11020 4362 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 5919 8015 gene locus_tag LOCUS_11030 5919 8015 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_11030 8026 9510 gene locus_tag LOCUS_11040 8026 9510 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021520.1 protein_id gnl|my_center|LOCUS_11040 10378 9500 gene locus_tag LOCUS_11050 10378 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 10567 11199 gene locus_tag LOCUS_11060 10567 11199 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873942.1 protein_id gnl|my_center|LOCUS_11060 11241 11314 gene locus_tag LOCUS_t00240 11241 11314 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12031 11426 gene locus_tag LOCUS_11070 12031 11426 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870621.1 protein_id gnl|my_center|LOCUS_11070 12082 13164 gene locus_tag LOCUS_11080 12082 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 14262 13156 gene locus_tag LOCUS_11090 14262 13156 CDS product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250198.1 protein_id gnl|my_center|LOCUS_11090 14336 14833 gene locus_tag LOCUS_11100 14336 14833 CDS product ribosomal-protein-alanine N-acetyltransferase RimI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_11100 14871 15089 gene locus_tag LOCUS_11110 14871 15089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 15927 15091 gene locus_tag LOCUS_11120 15927 15091 CDS product tRNA (guanine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_11120 17711 15924 gene locus_tag LOCUS_11130 17711 15924 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_11130 17809 17920 gene locus_tag LOCUS_r00010 17809 17920 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 <18832 18102 gene locus_tag LOCUS_11140 <18832 18102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GB4:putative cytosol aminopeptidase >Feature sequence29 219 350 gene locus_tag LOCUS_11150 219 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 388 1809 gene locus_tag LOCUS_11160 388 1809 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867352.1 protein_id gnl|my_center|LOCUS_11160 1811 2404 gene locus_tag LOCUS_11170 1811 2404 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_11170 2388 2945 gene locus_tag LOCUS_11180 2388 2945 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EY6 protein_id gnl|my_center|LOCUS_11180 3580 2942 gene locus_tag LOCUS_11190 3580 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_11190 3804 4310 gene locus_tag LOCUS_11200 3804 4310 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970461.1 protein_id gnl|my_center|LOCUS_11200 4359 4745 gene locus_tag LOCUS_11210 4359 4745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6095 5160 gene locus_tag LOCUS_11220 6095 5160 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_11220 6178 6690 gene locus_tag LOCUS_11230 6178 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 6700 7986 gene locus_tag LOCUS_11240 6700 7986 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978146.1 protein_id gnl|my_center|LOCUS_11240 8062 8223 gene locus_tag LOCUS_11250 8062 8223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 8433 8702 gene locus_tag LOCUS_11260 8433 8702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 9812 8898 gene locus_tag LOCUS_11270 9812 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 10241 10014 gene locus_tag LOCUS_11280 10241 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10822 10442 gene locus_tag LOCUS_11290 10822 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 12027 11014 gene locus_tag LOCUS_11300 12027 11014 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978405.1 protein_id gnl|my_center|LOCUS_11300 12122 12454 gene locus_tag LOCUS_11310 gene glnB 12122 12454 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_11310 13974 12460 gene locus_tag LOCUS_11320 13974 12460 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877091.1 protein_id gnl|my_center|LOCUS_11320 14453 13971 gene locus_tag LOCUS_11330 14453 13971 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496411.1 protein_id gnl|my_center|LOCUS_11330 16159 14462 gene locus_tag LOCUS_11340 16159 14462 CDS product acetolactate synthase, large subunit, biosynthetic type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868462.1 protein_id gnl|my_center|LOCUS_11340 16383 16787 gene locus_tag LOCUS_11350 16383 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence30 957 97 gene locus_tag LOCUS_11360 957 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_11360 1233 1469 gene locus_tag LOCUS_11370 1233 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1497 2693 gene locus_tag LOCUS_11380 1497 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2697 3515 gene locus_tag LOCUS_11390 2697 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_11390 3682 3512 gene locus_tag LOCUS_11400 3682 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3917 3756 gene locus_tag LOCUS_11410 3917 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 4040 3954 gene locus_tag LOCUS_t00250 4040 3954 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4773 4117 gene locus_tag LOCUS_11420 4773 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5417 4863 gene locus_tag LOCUS_11430 5417 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11430 5608 5414 gene locus_tag LOCUS_11440 5608 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11440 5695 6747 gene locus_tag LOCUS_11450 5695 6747 CDS product isocitrate/isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024146.1 protein_id gnl|my_center|LOCUS_11450 7284 6748 gene locus_tag LOCUS_11460 7284 6748 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876942.1 protein_id gnl|my_center|LOCUS_11460 7966 7259 gene locus_tag LOCUS_11470 7966 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8529 7963 gene locus_tag LOCUS_11480 8529 7963 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_11480 8878 8552 gene locus_tag LOCUS_11490 8878 8552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 9180 8881 gene locus_tag LOCUS_11500 9180 8881 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762332.1 protein_id gnl|my_center|LOCUS_11500 10285 9221 gene locus_tag LOCUS_11510 gene rlmN 10285 9221 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0X3 protein_id gnl|my_center|LOCUS_11510 11631 10363 gene locus_tag LOCUS_11520 11631 10363 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_11520 11896 11714 gene locus_tag LOCUS_11530 11896 11714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 13661 11937 gene locus_tag LOCUS_11540 13661 11937 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_11540 14525 13713 gene locus_tag LOCUS_11550 14525 13713 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870966.1 protein_id gnl|my_center|LOCUS_11550 15366 14509 gene locus_tag LOCUS_11560 15366 14509 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146595.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence31 1930 683 gene locus_tag LOCUS_11570 1930 683 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173522.1 protein_id gnl|my_center|LOCUS_11570 3027 2005 gene locus_tag LOCUS_11580 3027 2005 CDS product phosphoribosylaminoimidazole synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249163.1 protein_id gnl|my_center|LOCUS_11580 3802 3077 gene locus_tag LOCUS_11590 3802 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4257 3874 gene locus_tag LOCUS_11600 4257 3874 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879391.1 protein_id gnl|my_center|LOCUS_11600 4945 4589 gene locus_tag LOCUS_11610 4945 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 5160 6095 gene locus_tag LOCUS_11620 gene yrbG 5160 6095 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_11620 7542 6184 gene locus_tag LOCUS_11630 7542 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 8802 7543 gene locus_tag LOCUS_11640 8802 7543 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876455.1 protein_id gnl|my_center|LOCUS_11640 9968 8799 gene locus_tag LOCUS_11650 9968 8799 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496498.1 protein_id gnl|my_center|LOCUS_11650 11150 10011 gene locus_tag LOCUS_11660 11150 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12397 11189 gene locus_tag LOCUS_11670 12397 11189 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933643.1 protein_id gnl|my_center|LOCUS_11670 12841 12401 gene locus_tag LOCUS_11680 12841 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978769.1 protein_id gnl|my_center|LOCUS_11680 12991 13188 gene locus_tag LOCUS_11690 12991 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 13229 13558 gene locus_tag LOCUS_11700 13229 13558 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762104.1 protein_id gnl|my_center|LOCUS_11700 13673 14794 gene locus_tag LOCUS_11710 13673 14794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_11710 14791 14970 gene locus_tag LOCUS_11720 14791 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 16006 15110 gene locus_tag LOCUS_11730 16006 15110 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_11730 16095 16171 gene locus_tag LOCUS_t00260 16095 16171 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence32 301 843 gene locus_tag LOCUS_11740 301 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 881 1396 gene locus_tag LOCUS_11750 gene cysC 881 1396 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CR04 protein_id gnl|my_center|LOCUS_11750 2203 1388 gene locus_tag LOCUS_11760 gene cysQ 2203 1388 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_11760 2419 2213 gene locus_tag LOCUS_11770 2419 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 3203 2460 gene locus_tag LOCUS_11780 gene fabG 3203 2460 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X248 protein_id gnl|my_center|LOCUS_11780 3899 3468 gene locus_tag LOCUS_11790 3899 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4057 4698 gene locus_tag LOCUS_11800 4057 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_11800 5176 4709 gene locus_tag LOCUS_11810 5176 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5918 5280 gene locus_tag LOCUS_11820 5918 5280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 6241 6492 gene locus_tag LOCUS_11830 6241 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 6496 7521 gene locus_tag LOCUS_11840 6496 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 7518 8333 gene locus_tag LOCUS_11850 7518 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 8374 8568 gene locus_tag LOCUS_11860 8374 8568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 8610 9323 gene locus_tag LOCUS_11870 8610 9323 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877948.1 protein_id gnl|my_center|LOCUS_11870 9383 9940 gene locus_tag LOCUS_11880 9383 9940 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018211558.1 protein_id gnl|my_center|LOCUS_11880 9983 10231 gene locus_tag LOCUS_11890 9983 10231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 10908 10234 gene locus_tag LOCUS_11900 10908 10234 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 protein_id gnl|my_center|LOCUS_11900 11844 10915 gene locus_tag LOCUS_11910 11844 10915 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496725.1 protein_id gnl|my_center|LOCUS_11910 12602 11844 gene locus_tag LOCUS_11920 12602 11844 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_11920 12746 13762 gene locus_tag LOCUS_11930 12746 13762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 13798 14592 gene locus_tag LOCUS_11940 13798 14592 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_11940 15002 14601 gene locus_tag LOCUS_11950 15002 14601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 15326 15015 gene locus_tag LOCUS_11960 15326 15015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence33 <1 618 gene locus_tag LOCUS_11970 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:cell envelope biogenesis protein OmpA 662 1624 gene locus_tag LOCUS_11980 gene dusB 662 1624 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181F5 protein_id gnl|my_center|LOCUS_11980 1764 2003 gene locus_tag LOCUS_11990 1764 2003 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_11990 2501 2154 gene locus_tag LOCUS_12000 2501 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2621 2797 gene locus_tag LOCUS_12010 2621 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2902 3537 gene locus_tag LOCUS_12020 2902 3537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 4130 3534 gene locus_tag LOCUS_12030 4130 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 4407 4186 gene locus_tag LOCUS_12040 4407 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 4992 4432 gene locus_tag LOCUS_12050 4992 4432 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_12050 5499 5059 gene locus_tag LOCUS_12060 5499 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7060 5519 gene locus_tag LOCUS_12070 7060 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 8698 7136 gene locus_tag LOCUS_12080 8698 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9493 8699 gene locus_tag LOCUS_12090 9493 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10991 9534 gene locus_tag LOCUS_12100 10991 9534 CDS product geranylgeranyl hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_12100 11610 11182 gene locus_tag LOCUS_12110 11610 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869709.1 protein_id gnl|my_center|LOCUS_12110 12249 11638 gene locus_tag LOCUS_12120 12249 11638 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_12120 13556 12291 gene locus_tag LOCUS_12130 13556 12291 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_12130 13798 13556 gene locus_tag LOCUS_12140 13798 13556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 <14302 13761 gene locus_tag LOCUS_12150 <14302 13761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064974.1:recombinase RecJ >Feature sequence34 919 152 gene locus_tag LOCUS_12160 919 152 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_12160 2106 961 gene locus_tag LOCUS_12170 2106 961 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870473.1 protein_id gnl|my_center|LOCUS_12170 2640 2146 gene locus_tag LOCUS_12180 2640 2146 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_12180 2703 3728 gene locus_tag LOCUS_12190 2703 3728 CDS product RNA 3'-phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869517.1 protein_id gnl|my_center|LOCUS_12190 4205 3708 gene locus_tag LOCUS_12200 4205 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4272 4778 gene locus_tag LOCUS_12210 4272 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 4859 4785 gene locus_tag LOCUS_t00270 4859 4785 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4941 5651 gene locus_tag LOCUS_12220 4941 5651 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_12220 6296 6126 gene locus_tag LOCUS_12230 6296 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6545 6324 gene locus_tag LOCUS_12240 6545 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6858 6628 gene locus_tag LOCUS_12250 6858 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 7090 7566 gene locus_tag LOCUS_12260 7090 7566 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_12260 7616 8047 gene locus_tag LOCUS_12270 7616 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 8038 8454 gene locus_tag LOCUS_12280 8038 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8596 8838 gene locus_tag LOCUS_12290 8596 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 9300 8824 gene locus_tag LOCUS_12300 9300 8824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9432 9878 gene locus_tag LOCUS_12310 9432 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 9890 10783 gene locus_tag LOCUS_12320 9890 10783 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_12320 10823 11170 gene locus_tag LOCUS_12330 10823 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 11643 11167 gene locus_tag LOCUS_12340 11643 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 12722 11640 gene locus_tag LOCUS_12350 12722 11640 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_12350 12805 13377 gene locus_tag LOCUS_12360 12805 13377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 13455 13643 gene locus_tag LOCUS_12370 13455 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 13862 13647 gene locus_tag LOCUS_12380 13862 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence35 295 1881 gene locus_tag LOCUS_12390 295 1881 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_12390 1891 3480 gene locus_tag LOCUS_12400 gene lysS 1891 3480 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8GXH3 protein_id gnl|my_center|LOCUS_12400 3483 3683 gene locus_tag LOCUS_12410 3483 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3721 4500 gene locus_tag LOCUS_12420 3721 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 4959 4513 gene locus_tag LOCUS_12430 4959 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 5181 5324 gene locus_tag LOCUS_12440 5181 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5353 5652 gene locus_tag LOCUS_12450 5353 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 5687 5860 gene locus_tag LOCUS_12460 5687 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6464 6132 gene locus_tag LOCUS_12470 6464 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 7022 6507 gene locus_tag LOCUS_12480 7022 6507 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0L2 protein_id gnl|my_center|LOCUS_12480 7588 7112 gene locus_tag LOCUS_12490 7588 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 8081 7710 gene locus_tag LOCUS_12500 8081 7710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 8666 8112 gene locus_tag LOCUS_12510 gene tag 8666 8112 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263635.1 protein_id gnl|my_center|LOCUS_12510 8712 9137 gene locus_tag LOCUS_12520 8712 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 9488 9138 gene locus_tag LOCUS_12530 9488 9138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 9857 9782 gene locus_tag LOCUS_t00280 9857 9782 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10717 9896 gene locus_tag LOCUS_12540 10717 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 11150 10710 gene locus_tag LOCUS_12550 11150 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 11906 11190 gene locus_tag LOCUS_12560 11906 11190 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_12560 12009 12467 gene locus_tag LOCUS_12570 12009 12467 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854561.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence36 2388 202 gene locus_tag LOCUS_12580 2388 202 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_12580 2486 3220 gene locus_tag LOCUS_12590 2486 3220 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_12590 3270 3548 gene locus_tag LOCUS_12600 3270 3548 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_12600 3877 3545 gene locus_tag LOCUS_12610 3877 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5170 4256 gene locus_tag LOCUS_12620 5170 4256 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250772.1 protein_id gnl|my_center|LOCUS_12620 5717 5220 gene locus_tag LOCUS_12630 5717 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6111 5749 gene locus_tag LOCUS_12640 6111 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6336 7142 gene locus_tag LOCUS_12650 6336 7142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 7222 7383 gene locus_tag LOCUS_12660 7222 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 7847 7509 gene locus_tag LOCUS_12670 7847 7509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 8861 7914 gene locus_tag LOCUS_12680 8861 7914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 10203 8935 gene locus_tag LOCUS_12690 10203 8935 CDS product threonylcarbamoyladenosine tRNA methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_12690 11586 10207 gene locus_tag LOCUS_12700 gene aspA 11586 10207 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence37 288 752 gene locus_tag LOCUS_12710 288 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1099 749 gene locus_tag LOCUS_12720 1099 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 1216 1140 gene locus_tag LOCUS_t00290 1216 1140 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2091 1249 gene locus_tag LOCUS_12730 2091 1249 CDS product 8-oxoguanine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023475.1 protein_id gnl|my_center|LOCUS_12730 3358 2093 gene locus_tag LOCUS_12740 3358 2093 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_12740 3469 3681 gene locus_tag LOCUS_12750 3469 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3858 4073 gene locus_tag LOCUS_12760 3858 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4211 4513 gene locus_tag LOCUS_12770 4211 4513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 6065 4554 gene locus_tag LOCUS_12780 6065 4554 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_12780 6644 6096 gene locus_tag LOCUS_12790 6644 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 6708 7904 gene locus_tag LOCUS_12800 gene ychF 6708 7904 CDS product translation-associated GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_12800 7906 8889 gene locus_tag LOCUS_12810 7906 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 9208 8879 gene locus_tag LOCUS_12820 9208 8879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 9249 9860 gene locus_tag LOCUS_12830 9249 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9844 10392 gene locus_tag LOCUS_12840 9844 10392 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_12840 11398 10370 gene locus_tag LOCUS_12850 11398 10370 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761845.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence38 1524 550 gene locus_tag LOCUS_12860 1524 550 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903949.1 protein_id gnl|my_center|LOCUS_12860 2591 1521 gene locus_tag LOCUS_12870 gene hisC 2591 1521 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C70 protein_id gnl|my_center|LOCUS_12870 3859 2588 gene locus_tag LOCUS_12880 3859 2588 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496833.1 protein_id gnl|my_center|LOCUS_12880 4842 3859 gene locus_tag LOCUS_12890 gene hisG 4842 3859 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJ68 protein_id gnl|my_center|LOCUS_12890 6133 4877 gene locus_tag LOCUS_12900 6133 4877 CDS product 3-hydroxy-3-methylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879232.1 protein_id gnl|my_center|LOCUS_12900 7236 6136 gene locus_tag LOCUS_12910 7236 6136 CDS product glucose sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957530.1 protein_id gnl|my_center|LOCUS_12910 7319 7394 gene locus_tag LOCUS_t00300 7319 7394 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8723 7395 gene locus_tag LOCUS_12920 8723 7395 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496722.1 protein_id gnl|my_center|LOCUS_12920 8807 9802 gene locus_tag LOCUS_12930 8807 9802 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_12930 10402 9803 gene locus_tag LOCUS_12940 10402 9803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 11485 10409 gene locus_tag LOCUS_12950 11485 10409 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_12950 11573 12124 gene locus_tag LOCUS_12960 11573 12124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence39 2750 1740 gene locus_tag LOCUS_12970 2750 1740 CDS product carbamoyl phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979553.1 protein_id gnl|my_center|LOCUS_12970 4163 2970 gene locus_tag LOCUS_12980 4163 2970 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_12980 4664 4173 gene locus_tag LOCUS_12990 4664 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 5224 4661 gene locus_tag LOCUS_13000 5224 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5382 6542 gene locus_tag LOCUS_13010 5382 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6569 7024 gene locus_tag LOCUS_13020 6569 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969255.1 protein_id gnl|my_center|LOCUS_13020 7119 7403 gene locus_tag LOCUS_13030 7119 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8421 8536 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tctttttagttgttttttta 8790 8599 gene locus_tag LOCUS_13040 8790 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8909 10072 gene locus_tag LOCUS_13050 8909 10072 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_13050 10344 10075 gene locus_tag LOCUS_13060 10344 10075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 10651 10463 gene locus_tag LOCUS_13070 10651 10463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence40 2422 155 gene locus_tag LOCUS_13080 2422 155 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203425.1 protein_id gnl|my_center|LOCUS_13080 2578 3210 gene locus_tag LOCUS_13090 2578 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 3779 3207 gene locus_tag LOCUS_13100 3779 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 4037 3798 gene locus_tag LOCUS_13110 4037 3798 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_13110 4501 4082 gene locus_tag LOCUS_13120 4501 4082 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_13120 4823 5083 gene locus_tag LOCUS_13130 4823 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6697 5054 gene locus_tag LOCUS_13140 6697 5054 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_13140 8076 6688 gene locus_tag LOCUS_13150 8076 6688 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_13150 8127 9239 gene locus_tag LOCUS_13160 8127 9239 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978108.1 protein_id gnl|my_center|LOCUS_13160 9236 9517 gene locus_tag LOCUS_13170 9236 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 10597 9668 gene locus_tag LOCUS_13180 10597 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11000 10671 gene locus_tag LOCUS_13190 11000 10671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence41 643 1932 gene locus_tag LOCUS_13200 gene hemL 643 1932 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_13200 2291 1929 gene locus_tag LOCUS_13210 2291 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2308 2490 gene locus_tag LOCUS_13220 2308 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2529 3350 gene locus_tag LOCUS_13230 2529 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 4049 3345 gene locus_tag LOCUS_13240 4049 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 4131 4514 gene locus_tag LOCUS_13250 4131 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4516 4971 gene locus_tag LOCUS_13260 4516 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4977 5342 gene locus_tag LOCUS_13270 4977 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_13270 5348 6064 gene locus_tag LOCUS_13280 5348 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 6474 6067 gene locus_tag LOCUS_13290 6474 6067 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903622.1 protein_id gnl|my_center|LOCUS_13290 6788 6513 gene locus_tag LOCUS_13300 6788 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 6957 6790 gene locus_tag LOCUS_13310 6957 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7511 8650 gene locus_tag LOCUS_13320 7511 8650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 8750 9025 gene locus_tag LOCUS_13330 8750 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 9524 9015 gene locus_tag LOCUS_13340 9524 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence42 169 402 gene locus_tag LOCUS_13350 169 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1843 533 gene locus_tag LOCUS_13360 1843 533 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496866.1 protein_id gnl|my_center|LOCUS_13360 2012 2221 gene locus_tag LOCUS_13370 2012 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2250 3275 gene locus_tag LOCUS_13380 gene purP 2250 3275 CDS product 5-formaminoimidazole-4-carboxamide-1-(beta)-D- ribofuranosyl 5'-monophosphate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060989.1 protein_id gnl|my_center|LOCUS_13380 4076 3291 gene locus_tag LOCUS_13390 gene phnE 4076 3291 CDS product phosphonate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_13390 4890 4060 gene locus_tag LOCUS_13400 4890 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 5996 4908 gene locus_tag LOCUS_13410 5996 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 6459 6109 gene locus_tag LOCUS_13420 6459 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 6797 6465 gene locus_tag LOCUS_13430 6797 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 7595 6864 gene locus_tag LOCUS_13440 7595 6864 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228806.1 protein_id gnl|my_center|LOCUS_13440 7823 7608 gene locus_tag LOCUS_13450 7823 7608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 7943 8587 gene locus_tag LOCUS_13460 7943 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 8635 9918 gene locus_tag LOCUS_13470 8635 9918 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence43 1 213 gene locus_tag LOCUS_13480 1 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 249 2066 gene locus_tag LOCUS_13490 249 2066 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496860.1 protein_id gnl|my_center|LOCUS_13490 2517 2053 gene locus_tag LOCUS_13500 gene mntR 2517 2053 CDS product transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y623 protein_id gnl|my_center|LOCUS_13500 2635 3003 gene locus_tag LOCUS_13510 2635 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 3040 3531 gene locus_tag LOCUS_13520 3040 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 3574 4200 gene locus_tag LOCUS_13530 3574 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 4241 5026 gene locus_tag LOCUS_13540 gene yunE 4241 5026 CDS product UPF0721 transmembrane protein YunE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32134 protein_id gnl|my_center|LOCUS_13540 5145 5408 gene locus_tag LOCUS_13550 5145 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7237 5465 gene locus_tag LOCUS_13560 7237 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 8382 7360 gene locus_tag LOCUS_13570 8382 7360 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867862.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence44 2001 787 gene locus_tag LOCUS_13580 2001 787 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_13580 2263 2054 gene locus_tag LOCUS_13590 2263 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3286 2525 gene locus_tag LOCUS_13600 3286 2525 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_13600 4226 3348 gene locus_tag LOCUS_13610 4226 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064924.1 protein_id gnl|my_center|LOCUS_13610 4640 4254 gene locus_tag LOCUS_13620 4640 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 4724 5095 gene locus_tag LOCUS_13630 4724 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 5163 5360 gene locus_tag LOCUS_13640 5163 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5392 6054 gene locus_tag LOCUS_13650 5392 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 6055 6534 gene locus_tag LOCUS_13660 6055 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 6840 7727 gene locus_tag LOCUS_13670 6840 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 8805 7711 gene locus_tag LOCUS_13680 8805 7711 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023921.1 protein_id gnl|my_center|LOCUS_13680 8878 9126 gene locus_tag LOCUS_13690 8878 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence45 <1 1434 gene locus_tag LOCUS_13700 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404982.1:cation:proton antiporter 1754 1455 gene locus_tag LOCUS_13710 1754 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1915 2187 gene locus_tag LOCUS_13720 1915 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2418 2188 gene locus_tag LOCUS_13730 2418 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2739 2425 gene locus_tag LOCUS_13740 2739 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 2648 2842 gene locus_tag LOCUS_13750 2648 2842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2939 3130 gene locus_tag LOCUS_13760 2939 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3614 3219 gene locus_tag LOCUS_13770 3614 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3883 3665 gene locus_tag LOCUS_13780 3883 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 6066 3913 gene locus_tag LOCUS_13790 6066 3913 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_13790 6582 6094 gene locus_tag LOCUS_13800 6582 6094 CDS product heat-shock protein Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762292.1 protein_id gnl|my_center|LOCUS_13800 6692 7357 gene locus_tag LOCUS_13810 6692 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 7417 8775 gene locus_tag LOCUS_13820 7417 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence46 1221 916 gene locus_tag LOCUS_13830 1221 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1415 2059 gene locus_tag LOCUS_13840 1415 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_13840 2599 2267 gene locus_tag LOCUS_13850 2599 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2704 3012 gene locus_tag LOCUS_13860 2704 3012 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903930.1 protein_id gnl|my_center|LOCUS_13860 3019 4008 gene locus_tag LOCUS_13870 3019 4008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 4749 4111 gene locus_tag LOCUS_13880 4749 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 5671 4751 gene locus_tag LOCUS_13890 5671 4751 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878417.1 protein_id gnl|my_center|LOCUS_13890 5800 7185 gene locus_tag LOCUS_13900 5800 7185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7424 7260 gene locus_tag LOCUS_13910 7424 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 8172 7543 gene locus_tag LOCUS_13920 8172 7543 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963888.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence47 455 243 gene locus_tag LOCUS_13930 455 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 523 693 gene locus_tag LOCUS_13940 523 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 746 1219 gene locus_tag LOCUS_13950 746 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_13950 3670 1211 gene locus_tag LOCUS_13960 3670 1211 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762664.1 protein_id gnl|my_center|LOCUS_13960 3759 4034 gene locus_tag LOCUS_13970 3759 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 4101 4736 gene locus_tag LOCUS_13980 4101 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6465 4720 gene locus_tag LOCUS_13990 6465 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 6643 6473 gene locus_tag LOCUS_14000 6643 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 7180 6824 gene locus_tag LOCUS_14010 7180 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7201 7362 gene locus_tag LOCUS_14020 7201 7362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence48 854 1153 gene locus_tag LOCUS_14030 854 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2052 1387 gene locus_tag LOCUS_14040 2052 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2518 2102 gene locus_tag LOCUS_14050 2518 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3010 2783 gene locus_tag LOCUS_14060 3010 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3060 3257 gene locus_tag LOCUS_14070 3060 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 3389 3661 gene locus_tag LOCUS_14080 3389 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3892 3692 gene locus_tag LOCUS_14090 3892 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 4320 4129 gene locus_tag LOCUS_14100 4320 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4440 4820 gene locus_tag LOCUS_14110 gene cheY44H 4440 4820 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943816.1 protein_id gnl|my_center|LOCUS_14110 5286 4843 gene locus_tag LOCUS_14120 5286 4843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 5542 5351 gene locus_tag LOCUS_14130 5542 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 5692 7041 gene locus_tag LOCUS_14140 5692 7041 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877263.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence49 279 743 gene locus_tag LOCUS_14150 279 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 853 1227 gene locus_tag LOCUS_14160 853 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1776 2036 gene locus_tag LOCUS_14170 1776 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2434 2051 gene locus_tag LOCUS_14180 2434 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2642 2845 gene locus_tag LOCUS_14190 2642 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3054 2818 gene locus_tag LOCUS_14200 3054 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 3542 3105 gene locus_tag LOCUS_14210 3542 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3669 5522 gene locus_tag LOCUS_14220 3669 5522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 5559 6389 gene locus_tag LOCUS_14230 5559 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6389 6622 gene locus_tag LOCUS_14240 6389 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 6638 7204 gene locus_tag LOCUS_14250 6638 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence50 142 540 gene locus_tag LOCUS_14260 142 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 548 832 gene locus_tag LOCUS_14270 548 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 1620 829 gene locus_tag LOCUS_14280 1620 829 CDS product 5'-methylthioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_14280 2132 1620 gene locus_tag LOCUS_14290 gene apt 2132 1620 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 protein_id gnl|my_center|LOCUS_14290 4330 2171 gene locus_tag LOCUS_14300 4330 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 6498 4405 gene locus_tag LOCUS_14310 6498 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6603 7061 gene locus_tag LOCUS_14320 6603 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence51 1145 330 gene locus_tag LOCUS_14330 1145 330 CDS product nicotinate-nucleotide pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877434.1 protein_id gnl|my_center|LOCUS_14330 1375 1187 gene locus_tag LOCUS_14340 1375 1187 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869895.1 protein_id gnl|my_center|LOCUS_14340 1973 1377 gene locus_tag LOCUS_14350 1973 1377 CDS product DNA-directed RNA polymerase subunit E' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_14350 2119 3291 gene locus_tag LOCUS_14360 2119 3291 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_14360 3297 3791 gene locus_tag LOCUS_14370 3297 3791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978341.1 protein_id gnl|my_center|LOCUS_14370 3936 4286 gene locus_tag LOCUS_14380 3936 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4801 4505 gene locus_tag LOCUS_14390 4801 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 5144 4851 gene locus_tag LOCUS_14400 5144 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 6747 5302 gene locus_tag LOCUS_14410 6747 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence52 <1 997 gene locus_tag LOCUS_14420 <1 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000044941.1:ATP-dependent helicase DinG 1345 1019 gene locus_tag LOCUS_14430 1345 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2109 1711 gene locus_tag LOCUS_14440 2109 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2589 2185 gene locus_tag LOCUS_14450 2589 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5168 3480 gene locus_tag LOCUS_14460 5168 3480 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980252.1 protein_id gnl|my_center|LOCUS_14460 5355 5561 gene locus_tag LOCUS_14470 5355 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 6162 5566 gene locus_tag LOCUS_14480 6162 5566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6362 6769 gene locus_tag LOCUS_14490 6362 6769 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence53 574 1776 gene locus_tag LOCUS_14500 574 1776 CDS product cell division control protein Cdc6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_14500 3233 1779 gene locus_tag LOCUS_14510 3233 1779 CDS product DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_14510 3368 3832 gene locus_tag LOCUS_14520 3368 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 4777 4061 gene locus_tag LOCUS_14530 4777 4061 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903145.1 protein_id gnl|my_center|LOCUS_14530 5270 4779 gene locus_tag LOCUS_14540 5270 4779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence54 516 40 gene locus_tag LOCUS_14550 516 40 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061166.1 protein_id gnl|my_center|LOCUS_14550 1308 616 gene locus_tag LOCUS_14560 1308 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2473 1403 gene locus_tag LOCUS_14570 2473 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2841 2767 gene locus_tag LOCUS_t00310 2841 2767 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2922 3476 gene locus_tag LOCUS_14580 2922 3476 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902490.1 protein_id gnl|my_center|LOCUS_14580 3509 3585 gene locus_tag LOCUS_t00320 3509 3585 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 4484 3591 gene locus_tag LOCUS_14590 4484 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 4602 4988 gene locus_tag LOCUS_14600 4602 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 5207 5280 gene locus_tag LOCUS_t00330 5207 5280 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6142 5282 gene locus_tag LOCUS_14610 6142 5282 CDS product site-specific DNA-methyltransferase (adenine-specific) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHQ1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence55 592 975 gene locus_tag LOCUS_14620 592 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 1143 982 gene locus_tag LOCUS_14630 1143 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1889 1272 gene locus_tag LOCUS_14640 1889 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2360 1998 gene locus_tag LOCUS_14650 2360 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 2425 3177 gene locus_tag LOCUS_14660 2425 3177 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence56 505 5 gene locus_tag LOCUS_14670 505 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1152 790 gene locus_tag LOCUS_14680 1152 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1837 1274 gene locus_tag LOCUS_14690 1837 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2091 2660 gene locus_tag LOCUS_14700 2091 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 2818 3336 gene locus_tag LOCUS_14710 2818 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 3703 3434 gene locus_tag LOCUS_14720 3703 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 4143 3808 gene locus_tag LOCUS_14730 4143 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4256 4717 gene locus_tag LOCUS_14740 4256 4717 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762532.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence57 2098 767 gene locus_tag LOCUS_14750 2098 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 3314 2100 gene locus_tag LOCUS_14760 gene thrC1 3314 2100 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66864 protein_id gnl|my_center|LOCUS_14760 3582 4082 gene locus_tag LOCUS_14770 3582 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 4413 4084 gene locus_tag LOCUS_14780 4413 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 5240 4437 gene locus_tag LOCUS_14790 5240 4437 CDS product imidazole glycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869910.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence58 1957 929 gene locus_tag LOCUS_14800 1957 929 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_14800 2292 1999 gene locus_tag LOCUS_14810 2292 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 2382 2678 gene locus_tag LOCUS_14820 2382 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 2878 2684 gene locus_tag LOCUS_14830 2878 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3276 2974 gene locus_tag LOCUS_14840 3276 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3312 4061 gene locus_tag LOCUS_14850 3312 4061 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020802.1 protein_id gnl|my_center|LOCUS_14850 <5592 4080 gene locus_tag LOCUS_14860 <5592 4080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8AAA8:carbamoyl-phosphate synthase (glutamine-hydrolyzing) >Feature sequence59 116 478 gene locus_tag LOCUS_14870 116 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 801 502 gene locus_tag LOCUS_14880 801 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1354 1010 gene locus_tag LOCUS_14890 1354 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1430 2098 gene locus_tag LOCUS_14900 1430 2098 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_14900 2256 2110 gene locus_tag LOCUS_14910 2256 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 2613 3452 gene locus_tag LOCUS_14920 2613 3452 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_14920 3452 4561 gene locus_tag LOCUS_14930 3452 4561 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_14930 4558 4866 gene locus_tag LOCUS_14940 4558 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence60 412 1083 gene locus_tag LOCUS_14950 412 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_14950 1100 1333 gene locus_tag LOCUS_14960 1100 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1317 1718 gene locus_tag LOCUS_14970 1317 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2944 1712 gene locus_tag LOCUS_14980 2944 1712 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867946.1 protein_id gnl|my_center|LOCUS_14980 2932 3006 gene locus_tag LOCUS_t00340 2932 3006 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3050 3541 gene locus_tag LOCUS_14990 3050 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 4098 3505 gene locus_tag LOCUS_15000 4098 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 4216 4455 gene locus_tag LOCUS_15010 4216 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence61 1432 644 gene locus_tag LOCUS_15020 1432 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 2889 1696 gene locus_tag LOCUS_15030 2889 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 3157 3390 gene locus_tag LOCUS_15040 3157 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence62 191 2686 gene locus_tag LOCUS_15050 191 2686 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978604.1 protein_id gnl|my_center|LOCUS_15050 2688 3095 gene locus_tag LOCUS_15060 2688 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence63 <1 1305 gene locus_tag LOCUS_15070 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940752.1:NADH-binding protein 1919 1356 gene locus_tag LOCUS_15080 1919 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence64 119 1003 gene locus_tag LOCUS_15090 119 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1646 1017 gene locus_tag LOCUS_15100 1646 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence65 >Feature sequence66 296 1369 gene locus_tag LOCUS_15110 296 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435528.1 protein_id gnl|my_center|LOCUS_15110 1658 1422 gene locus_tag LOCUS_15120 1658 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence67 349 161 gene locus_tag LOCUS_15130 349 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 530 342 gene locus_tag LOCUS_15140 530 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 1107 673 gene locus_tag LOCUS_15150 1107 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 1274 1104 gene locus_tag LOCUS_15160 1274 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1462 1271 gene locus_tag LOCUS_15170 1462 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1656 1459 gene locus_tag LOCUS_15180 1656 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence68 1087 614 gene locus_tag LOCUS_15190 1087 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1250 1807 gene locus_tag LOCUS_15200 1250 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence69 16 1416 gene locus_tag LOCUS_15210 gene sufB 16 1416 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074405.1 protein_id gnl|my_center|LOCUS_15210 1422 1730 gene locus_tag LOCUS_15220 1422 1730 CDS product putative ferredoxin subunit of phenylpropionate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705094.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence70 676 1248 gene locus_tag LOCUS_15230 676 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence71 <1 1038 gene locus_tag LOCUS_15240 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976894.1:Fe-S cluster assembly protein SufB >Feature sequence72 334 540 gene locus_tag LOCUS_15250 334 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 739 542 gene locus_tag LOCUS_15260 739 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1086 778 gene locus_tag LOCUS_15270 1086 778 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876685.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence73 1100 567 gene locus_tag LOCUS_15280 1100 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence74 42 824 gene locus_tag LOCUS_15290 42 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence75 >Feature sequence76 <1 584 gene locus_tag LOCUS_15300 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879805.1:radical SAM protein