>Feature sequence001 69 2423 gene locus_tag LOCUS_00010 69 2423 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_00010 2717 2908 gene locus_tag LOCUS_00020 2717 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2886 3797 gene locus_tag LOCUS_00030 gene rpoD 2886 3797 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_00030 5811 3844 gene locus_tag LOCUS_00040 5811 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 7764 5821 gene locus_tag LOCUS_00050 7764 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 11014 7733 gene locus_tag LOCUS_00060 11014 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 11420 11154 gene locus_tag LOCUS_00070 11420 11154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 12930 11524 gene locus_tag LOCUS_00080 12930 11524 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_00080 14731 13004 gene locus_tag LOCUS_00090 14731 13004 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_00090 15805 14783 gene locus_tag LOCUS_00100 gene ruvB 15805 14783 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00100 17722 15941 gene locus_tag LOCUS_00110 gene ctaD 17722 15941 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_00110 18693 17749 gene locus_tag LOCUS_00120 gene ctaC 18693 17749 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_00120 20305 18800 gene locus_tag LOCUS_00130 gene actF 20305 18800 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_00130 20881 20333 gene locus_tag LOCUS_00140 gene actE 20881 20333 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_00140 21419 20892 gene locus_tag LOCUS_00150 gene actD 21419 20892 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_00150 22885 21422 gene locus_tag LOCUS_00160 gene actC 22885 21422 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_00160 25964 22908 gene locus_tag LOCUS_00170 gene actB 25964 22908 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_00170 27283 26057 gene locus_tag LOCUS_00180 gene actA 27283 26057 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_00180 27565 27933 gene locus_tag LOCUS_00190 27565 27933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 30915 28009 gene locus_tag LOCUS_00200 gene infB 30915 28009 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_00200 32235 30979 gene locus_tag LOCUS_00210 gene nusA 32235 30979 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 protein_id gnl|my_center|LOCUS_00210 32708 32247 gene locus_tag LOCUS_00220 gene rimP 32708 32247 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_00220 32885 33712 gene locus_tag LOCUS_00230 gene uspA 32885 33712 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_00230 33825 33637 gene locus_tag LOCUS_00240 33825 33637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 35417 33825 gene locus_tag LOCUS_00250 35417 33825 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115067.1 protein_id gnl|my_center|LOCUS_00250 36848 35586 gene locus_tag LOCUS_00260 gene ilvA 36848 35586 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_00260 38452 36977 gene locus_tag LOCUS_00270 gene ilvC 38452 36977 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_00270 38993 38463 gene locus_tag LOCUS_00280 gene ilvH 38993 38463 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_00280 40728 38995 gene locus_tag LOCUS_00290 gene ilvB 40728 38995 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_00290 42469 40793 gene locus_tag LOCUS_00300 gene ilvD 42469 40793 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 protein_id gnl|my_center|LOCUS_00300 43940 42819 gene locus_tag LOCUS_00310 gene leuB 43940 42819 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_00310 45173 43998 gene locus_tag LOCUS_00320 gene leuA 45173 43998 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 protein_id gnl|my_center|LOCUS_00320 45305 46870 gene locus_tag LOCUS_00330 45305 46870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 47190 49628 gene locus_tag LOCUS_00340 47190 49628 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_00340 49710 50633 gene locus_tag LOCUS_00350 gene thrB 49710 50633 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_00350 50702 51985 gene locus_tag LOCUS_00360 50702 51985 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_00360 52119 52047 gene locus_tag LOCUS_t00010 52119 52047 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 52290 55403 gene locus_tag LOCUS_00370 52290 55403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_00370 55784 55491 gene locus_tag LOCUS_00380 55784 55491 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_00380 57095 55872 gene locus_tag LOCUS_00390 57095 55872 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_00390 57253 58929 gene locus_tag LOCUS_00400 57253 58929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 61683 59044 gene locus_tag LOCUS_00410 gene cphA 61683 59044 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963250.1 protein_id gnl|my_center|LOCUS_00410 61793 62650 gene locus_tag LOCUS_00420 gene cphB 61793 62650 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963249.1 protein_id gnl|my_center|LOCUS_00420 63657 62728 gene locus_tag LOCUS_00430 gene iaaA 63657 62728 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_00430 63907 66753 gene locus_tag LOCUS_00440 gene polA 63907 66753 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_00440 66908 68728 gene locus_tag LOCUS_00450 66908 68728 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943579.1 protein_id gnl|my_center|LOCUS_00450 68836 69216 gene locus_tag LOCUS_00460 68836 69216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 69256 69666 gene locus_tag LOCUS_00470 69256 69666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 69680 71353 gene locus_tag LOCUS_00480 69680 71353 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263346.1 protein_id gnl|my_center|LOCUS_00480 71393 72355 gene locus_tag LOCUS_00490 71393 72355 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_00490 72603 73916 gene locus_tag LOCUS_00500 gene amaA 72603 73916 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_00500 76190 74382 gene locus_tag LOCUS_00510 76190 74382 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_00510 77499 76246 gene locus_tag LOCUS_00520 gene lysC 77499 76246 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_00520 77983 77501 gene locus_tag LOCUS_00530 77983 77501 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_00530 78181 79191 gene locus_tag LOCUS_00540 gene fbp 78181 79191 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_00540 79307 79915 gene locus_tag LOCUS_00550 gene sodA 79307 79915 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_00550 81913 80015 gene locus_tag LOCUS_00560 gene purF 81913 80015 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_00560 82921 81995 gene locus_tag LOCUS_00570 82921 81995 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_00570 83105 83530 gene locus_tag LOCUS_00580 gene sufE 83105 83530 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_00580 83543 83863 gene locus_tag LOCUS_00590 83543 83863 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_00590 83994 84503 gene locus_tag LOCUS_00600 83994 84503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_00600 84555 85421 gene locus_tag LOCUS_00610 84555 85421 CDS product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 protein_id gnl|my_center|LOCUS_00610 85461 86378 gene locus_tag LOCUS_00620 85461 86378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 86462 87577 gene locus_tag LOCUS_00630 86462 87577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_00630 89051 87840 gene locus_tag LOCUS_00640 gene hflX 89051 87840 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_00640 89670 89431 gene locus_tag LOCUS_00650 89670 89431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 89877 90782 gene locus_tag LOCUS_00660 89877 90782 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 protein_id gnl|my_center|LOCUS_00660 92639 90864 gene locus_tag LOCUS_00670 92639 90864 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 protein_id gnl|my_center|LOCUS_00670 93349 92642 gene locus_tag LOCUS_00680 93349 92642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 95208 93454 gene locus_tag LOCUS_00690 gene aspS 95208 93454 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_00690 95390 95749 gene locus_tag LOCUS_00700 95390 95749 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_00700 95756 96427 gene locus_tag LOCUS_00710 gene rsmI 95756 96427 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_00710 96559 97149 gene locus_tag LOCUS_00720 96559 97149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_00720 97212 97637 gene locus_tag LOCUS_00730 97212 97637 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_00730 97630 99201 gene locus_tag LOCUS_00740 97630 99201 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_00740 99217 99978 gene locus_tag LOCUS_00750 gene lpxH 99217 99978 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_00750 100508 99975 gene locus_tag LOCUS_00760 100508 99975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 101892 101050 gene locus_tag LOCUS_00770 101892 101050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 102773 101898 gene locus_tag LOCUS_00780 102773 101898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 105608 102786 gene locus_tag LOCUS_00790 gene bfeA 105608 102786 CDS product ferric enterobactin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405132.1 protein_id gnl|my_center|LOCUS_00790 105909 106898 gene locus_tag LOCUS_00800 105909 106898 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_00800 107014 107883 gene locus_tag LOCUS_00810 107014 107883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_00810 107969 108973 gene locus_tag LOCUS_00820 107969 108973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 108957 109967 gene locus_tag LOCUS_00830 gene batA 108957 109967 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_00830 109969 111015 gene locus_tag LOCUS_00840 gene batB 109969 111015 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_00840 111055 111819 gene locus_tag LOCUS_00850 111055 111819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 111950 113731 gene locus_tag LOCUS_00860 gene batD 111950 113731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_00860 113733 114491 gene locus_tag LOCUS_00870 gene batE 113733 114491 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_00870 114670 114861 gene locus_tag LOCUS_00880 114670 114861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 114949 116541 gene locus_tag LOCUS_00890 114949 116541 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_00890 116548 117336 gene locus_tag LOCUS_00900 116548 117336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 117351 117980 gene locus_tag LOCUS_00910 117351 117980 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_00910 118589 120451 gene locus_tag LOCUS_00920 118589 120451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 120405 121106 gene locus_tag LOCUS_00930 120405 121106 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPH7 protein_id gnl|my_center|LOCUS_00930 121641 121129 gene locus_tag LOCUS_00940 121641 121129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 121714 122082 gene locus_tag LOCUS_00950 121714 122082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_00950 122873 122079 gene locus_tag LOCUS_00960 122873 122079 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_00960 122976 124346 gene locus_tag LOCUS_00970 122976 124346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 124712 124350 gene locus_tag LOCUS_00980 124712 124350 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_00980 125658 124714 gene locus_tag LOCUS_00990 125658 124714 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 protein_id gnl|my_center|LOCUS_00990 126280 125681 gene locus_tag LOCUS_01000 126280 125681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 126440 128521 gene locus_tag LOCUS_01010 gene metG 126440 128521 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_01010 128521 129423 gene locus_tag LOCUS_01020 128521 129423 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_01020 130582 129878 gene locus_tag LOCUS_01030 130582 129878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 >Feature sequence002 978 346 gene locus_tag LOCUS_01040 gene pnuC 978 346 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_01040 1722 1096 gene locus_tag LOCUS_01050 gene sfp 1722 1096 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_01050 1784 3100 gene locus_tag LOCUS_01060 gene ahcY 1784 3100 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_01060 3401 4831 gene locus_tag LOCUS_01070 3401 4831 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_01070 5629 5132 gene locus_tag LOCUS_01080 5629 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5797 5642 gene locus_tag LOCUS_01090 5797 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 6588 6364 gene locus_tag LOCUS_01100 6588 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6533 8221 gene locus_tag LOCUS_01110 gene sglT 6533 8221 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_01110 9831 8233 gene locus_tag LOCUS_01120 9831 8233 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_01120 12363 9859 gene locus_tag LOCUS_01130 gene ppc 12363 9859 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_01130 14997 13030 gene locus_tag LOCUS_01140 gene dsbD 14997 13030 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_01140 16396 15020 gene locus_tag LOCUS_01150 16396 15020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 17728 16415 gene locus_tag LOCUS_01160 gene tilS 17728 16415 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 protein_id gnl|my_center|LOCUS_01160 18572 17751 gene locus_tag LOCUS_01170 18572 17751 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_01170 18965 18723 gene locus_tag LOCUS_01180 18965 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 20363 19053 gene locus_tag LOCUS_01190 gene pabB 20363 19053 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_01190 21843 20443 gene locus_tag LOCUS_01200 gene lpdA1 21843 20443 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_01200 21977 22450 gene locus_tag LOCUS_01210 21977 22450 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_01210 22451 23689 gene locus_tag LOCUS_01220 22451 23689 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_01220 25784 23769 gene locus_tag LOCUS_01230 gene dcp1 25784 23769 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_01230 26321 25842 gene locus_tag LOCUS_01240 gene purE 26321 25842 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_01240 27482 26325 gene locus_tag LOCUS_01250 gene purK 27482 26325 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_01250 27823 27533 gene locus_tag LOCUS_01260 27823 27533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 28059 28532 gene locus_tag LOCUS_01270 gene greA 28059 28532 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_01270 28690 29079 gene locus_tag LOCUS_01280 28690 29079 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_01280 30485 29301 gene locus_tag LOCUS_01290 gene porY 30485 29301 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_01290 30528 31388 gene locus_tag LOCUS_01300 30528 31388 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_01300 31394 31762 gene locus_tag LOCUS_01310 31394 31762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_01310 32134 31889 gene locus_tag LOCUS_01320 32134 31889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 32782 32153 gene locus_tag LOCUS_01330 32782 32153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 32910 33548 gene locus_tag LOCUS_01340 gene aat 32910 33548 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_01340 33998 33525 gene locus_tag LOCUS_01350 33998 33525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 34641 34075 gene locus_tag LOCUS_01360 34641 34075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 38145 34768 gene locus_tag LOCUS_01370 38145 34768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 protein_id gnl|my_center|LOCUS_01370 38684 38202 gene locus_tag LOCUS_01380 gene ogt1 38684 38202 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_01380 39448 38684 gene locus_tag LOCUS_01390 39448 38684 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_01390 39550 40902 gene locus_tag LOCUS_01400 gene rhlE 39550 40902 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_01400 40902 41267 gene locus_tag LOCUS_01410 40902 41267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 42277 41429 gene locus_tag LOCUS_01420 42277 41429 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_01420 42393 43385 gene locus_tag LOCUS_01430 42393 43385 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_01430 44228 43443 gene locus_tag LOCUS_01440 44228 43443 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_01440 45142 44339 gene locus_tag LOCUS_01450 gene map 45142 44339 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_01450 45821 45216 gene locus_tag LOCUS_01460 45821 45216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 47317 45821 gene locus_tag LOCUS_01470 gene gpmI 47317 45821 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_01470 47642 47382 gene locus_tag LOCUS_01480 47642 47382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 48077 49834 gene locus_tag LOCUS_01490 gene phhA 48077 49834 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_01490 49877 50152 gene locus_tag LOCUS_01500 49877 50152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 51111 50164 gene locus_tag LOCUS_01510 51111 50164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_01510 52725 51148 gene locus_tag LOCUS_01520 52725 51148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_01520 54349 52727 gene locus_tag LOCUS_01530 54349 52727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_01530 57013 54473 gene locus_tag LOCUS_01540 gene alaS 57013 54473 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_01540 57252 58214 gene locus_tag LOCUS_01550 57252 58214 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_01550 58217 58546 gene locus_tag LOCUS_01560 58217 58546 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_01560 58742 60556 gene locus_tag LOCUS_01570 58742 60556 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_01570 60556 61332 gene locus_tag LOCUS_01580 60556 61332 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087987.1 protein_id gnl|my_center|LOCUS_01580 61416 62636 gene locus_tag LOCUS_01590 61416 62636 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085773.1 protein_id gnl|my_center|LOCUS_01590 62633 63691 gene locus_tag LOCUS_01600 62633 63691 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098170.1 protein_id gnl|my_center|LOCUS_01600 63694 64074 gene locus_tag LOCUS_01610 63694 64074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 64076 64828 gene locus_tag LOCUS_01620 64076 64828 CDS product putative oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG0 protein_id gnl|my_center|LOCUS_01620 64891 65721 gene locus_tag LOCUS_01630 64891 65721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 66219 65809 gene locus_tag LOCUS_01640 66219 65809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 66806 66429 gene locus_tag LOCUS_01650 66806 66429 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_01650 70432 66815 gene locus_tag LOCUS_01660 70432 66815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 71108 70506 gene locus_tag LOCUS_01670 71108 70506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 72131 71112 gene locus_tag LOCUS_01680 72131 71112 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110224.1 protein_id gnl|my_center|LOCUS_01680 72447 72175 gene locus_tag LOCUS_01690 72447 72175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 73667 72450 gene locus_tag LOCUS_01700 73667 72450 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_01700 74198 73680 gene locus_tag LOCUS_01710 gene msrA 74198 73680 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM41 protein_id gnl|my_center|LOCUS_01710 75133 74189 gene locus_tag LOCUS_01720 75133 74189 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886895.1 protein_id gnl|my_center|LOCUS_01720 76705 75149 gene locus_tag LOCUS_01730 76705 75149 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 protein_id gnl|my_center|LOCUS_01730 77034 76798 gene locus_tag LOCUS_01740 77034 76798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 77615 77079 gene locus_tag LOCUS_01750 gene msrA 77615 77079 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M7 protein_id gnl|my_center|LOCUS_01750 78069 77608 gene locus_tag LOCUS_01760 78069 77608 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_01760 79663 78479 gene locus_tag LOCUS_01770 79663 78479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 80571 79666 gene locus_tag LOCUS_01780 gene rfbB 80571 79666 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649925.1 protein_id gnl|my_center|LOCUS_01780 81665 80559 gene locus_tag LOCUS_01790 gene ddhB 81665 80559 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_01790 82429 81659 gene locus_tag LOCUS_01800 82429 81659 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088721.1 protein_id gnl|my_center|LOCUS_01800 84050 82440 gene locus_tag LOCUS_01810 84050 82440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 85507 84050 gene locus_tag LOCUS_01820 85507 84050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 87716 85917 gene locus_tag LOCUS_01830 87716 85917 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962350.1 protein_id gnl|my_center|LOCUS_01830 89527 87977 gene locus_tag LOCUS_01840 89527 87977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 89990 91195 gene locus_tag LOCUS_01850 89990 91195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 93589 91202 gene locus_tag LOCUS_01860 93589 91202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 95047 93737 gene locus_tag LOCUS_01870 gene der 95047 93737 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_01870 95937 96401 gene locus_tag LOCUS_01880 95937 96401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 96404 97321 gene locus_tag LOCUS_01890 96404 97321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 97452 98012 gene locus_tag LOCUS_01900 97452 98012 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963563.1 protein_id gnl|my_center|LOCUS_01900 98393 98788 gene locus_tag LOCUS_01910 98393 98788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence003 510 178 gene locus_tag LOCUS_01920 510 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 1174 701 gene locus_tag LOCUS_01930 gene guaD 1174 701 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_01930 2650 1253 gene locus_tag LOCUS_01940 gene fumC 2650 1253 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_01940 2810 2983 gene locus_tag LOCUS_01950 2810 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_01950 3457 3116 gene locus_tag LOCUS_01960 3457 3116 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_01960 4588 3494 gene locus_tag LOCUS_01970 gene prfB 4588 3494 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_01970 4675 7101 gene locus_tag LOCUS_01980 4675 7101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_01980 7216 8235 gene locus_tag LOCUS_01990 gene ltaE 7216 8235 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_01990 8717 8232 gene locus_tag LOCUS_02000 8717 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 9341 8727 gene locus_tag LOCUS_02010 9341 8727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 9840 9346 gene locus_tag LOCUS_02020 9840 9346 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_02020 9926 10852 gene locus_tag LOCUS_02030 9926 10852 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_02030 10915 12381 gene locus_tag LOCUS_02040 gene crtI 10915 12381 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_02040 12383 13228 gene locus_tag LOCUS_02050 gene crtB 12383 13228 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_02050 13228 13671 gene locus_tag LOCUS_02060 gene crtZ 13228 13671 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_02060 13800 14939 gene locus_tag LOCUS_02070 gene crtY 13800 14939 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_02070 16321 15044 gene locus_tag LOCUS_02080 gene argH 16321 15044 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_02080 17490 16423 gene locus_tag LOCUS_02090 17490 16423 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_02090 18275 17493 gene locus_tag LOCUS_02100 gene argB 18275 17493 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_02100 19206 18268 gene locus_tag LOCUS_02110 19206 18268 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202024.1 protein_id gnl|my_center|LOCUS_02110 20395 19259 gene locus_tag LOCUS_02120 gene argD 20395 19259 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ6 protein_id gnl|my_center|LOCUS_02120 21192 20392 gene locus_tag LOCUS_02130 gene proC 21192 20392 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_02130 22296 21319 gene locus_tag LOCUS_02140 gene argC 22296 21319 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_02140 23489 22299 gene locus_tag LOCUS_02150 23489 22299 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_02150 24093 23476 gene locus_tag LOCUS_02160 24093 23476 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_02160 24705 25121 gene locus_tag LOCUS_02170 24705 25121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 25139 26500 gene locus_tag LOCUS_02180 25139 26500 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_02180 26500 26826 gene locus_tag LOCUS_02190 26500 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963760.1 protein_id gnl|my_center|LOCUS_02190 26826 27113 gene locus_tag LOCUS_02200 26826 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 27119 27454 gene locus_tag LOCUS_02210 27119 27454 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_02210 27459 27770 gene locus_tag LOCUS_02220 27459 27770 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_02220 27840 28595 gene locus_tag LOCUS_02230 27840 28595 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_02230 28859 29854 gene locus_tag LOCUS_02240 gene fjo19 28859 29854 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_02240 29875 30453 gene locus_tag LOCUS_02250 29875 30453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 30701 30537 gene locus_tag LOCUS_02260 30701 30537 CDS product Arc family DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764408.1 protein_id gnl|my_center|LOCUS_02260 31269 30784 gene locus_tag LOCUS_02270 31269 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 31772 31269 gene locus_tag LOCUS_02280 31772 31269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 31933 31772 gene locus_tag LOCUS_02290 31933 31772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 32269 32123 gene locus_tag LOCUS_02300 32269 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 33184 32324 gene locus_tag LOCUS_02310 33184 32324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_02310 33309 34091 gene locus_tag LOCUS_02320 33309 34091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 34199 34720 gene locus_tag LOCUS_02330 34199 34720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 35034 34771 gene locus_tag LOCUS_02340 35034 34771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 35104 36963 gene locus_tag LOCUS_02350 35104 36963 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_02350 38700 36976 gene locus_tag LOCUS_02360 38700 36976 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108021.1 protein_id gnl|my_center|LOCUS_02360 39861 38836 gene locus_tag LOCUS_02370 gene tsaD 39861 38836 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_02370 40084 44484 gene locus_tag LOCUS_02380 40084 44484 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_02380 44645 45628 gene locus_tag LOCUS_02390 gene pfkA 44645 45628 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_02390 45647 46648 gene locus_tag LOCUS_02400 gene gapA 45647 46648 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JQH1 protein_id gnl|my_center|LOCUS_02400 47120 46740 gene locus_tag LOCUS_02410 gene yjgF 47120 46740 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_02410 49716 47170 gene locus_tag LOCUS_02420 49716 47170 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_02420 49953 51050 gene locus_tag LOCUS_02430 49953 51050 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_02430 51105 52070 gene locus_tag LOCUS_02440 51105 52070 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_02440 52102 53418 gene locus_tag LOCUS_02450 52102 53418 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_02450 53494 54273 gene locus_tag LOCUS_02460 53494 54273 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_02460 54279 54788 gene locus_tag LOCUS_02470 54279 54788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 54781 56283 gene locus_tag LOCUS_02480 54781 56283 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457110.1 protein_id gnl|my_center|LOCUS_02480 56274 57206 gene locus_tag LOCUS_02490 gene menA 56274 57206 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_02490 57216 57731 gene locus_tag LOCUS_02500 57216 57731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 57740 58780 gene locus_tag LOCUS_02510 gene menC 57740 58780 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_02510 58816 59778 gene locus_tag LOCUS_02520 gene yyaK 58816 59778 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_02520 59780 60892 gene locus_tag LOCUS_02530 gene menE 59780 60892 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_02530 61653 61805 gene locus_tag LOCUS_02540 61653 61805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 62195 62602 gene locus_tag LOCUS_02550 62195 62602 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_02550 62609 64321 gene locus_tag LOCUS_02560 62609 64321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 64466 65167 gene locus_tag LOCUS_02570 64466 65167 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_02570 65313 67949 gene locus_tag LOCUS_02580 65313 67949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 70530 68458 gene locus_tag LOCUS_02590 70530 68458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963167.1 protein_id gnl|my_center|LOCUS_02590 70548 71939 gene locus_tag LOCUS_02600 70548 71939 CDS product sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963088.1 protein_id gnl|my_center|LOCUS_02600 72040 73215 gene locus_tag LOCUS_02610 72040 73215 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963087.1 protein_id gnl|my_center|LOCUS_02610 74742 73228 gene locus_tag LOCUS_02620 74742 73228 CDS product glycosyl hydrolase family 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963086.1 protein_id gnl|my_center|LOCUS_02620 75950 74736 gene locus_tag LOCUS_02630 75950 74736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963085.1 protein_id gnl|my_center|LOCUS_02630 79039 75950 gene locus_tag LOCUS_02640 79039 75950 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963084.1 protein_id gnl|my_center|LOCUS_02640 79219 80364 gene locus_tag LOCUS_02650 79219 80364 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963083.1 protein_id gnl|my_center|LOCUS_02650 80398 80835 gene locus_tag LOCUS_02660 80398 80835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence004 3088 2243 gene locus_tag LOCUS_02670 3088 2243 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_02670 4007 3108 gene locus_tag LOCUS_02680 4007 3108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_02680 4662 4162 gene locus_tag LOCUS_02690 4662 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_02690 4729 5151 gene locus_tag LOCUS_02700 4729 5151 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_02700 5153 6211 gene locus_tag LOCUS_02710 gene menF 5153 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_02710 6708 6328 gene locus_tag LOCUS_02720 6708 6328 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_02720 8455 6791 gene locus_tag LOCUS_02730 8455 6791 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_02730 8695 9633 gene locus_tag LOCUS_02740 gene nusB 8695 9633 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_02740 9684 10154 gene locus_tag LOCUS_02750 9684 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_02750 10157 10477 gene locus_tag LOCUS_02760 gene yajC 10157 10477 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_02760 10580 11512 gene locus_tag LOCUS_02770 10580 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 11516 12112 gene locus_tag LOCUS_02780 gene coaE 11516 12112 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_02780 12216 13784 gene locus_tag LOCUS_02790 gene rprX 12216 13784 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_02790 13800 14501 gene locus_tag LOCUS_02800 gene rprY 13800 14501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_02800 14578 15198 gene locus_tag LOCUS_02810 14578 15198 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_02810 16286 15288 gene locus_tag LOCUS_02820 16286 15288 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_02820 16705 16352 gene locus_tag LOCUS_02830 16705 16352 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_02830 16813 17814 gene locus_tag LOCUS_02840 gene holA 16813 17814 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_02840 17826 18410 gene locus_tag LOCUS_02850 17826 18410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123243.1 protein_id gnl|my_center|LOCUS_02850 20284 18506 gene locus_tag LOCUS_02860 gene fadD 20284 18506 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_02860 22124 20361 gene locus_tag LOCUS_02870 gene fadD 22124 20361 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_02870 22921 22220 gene locus_tag LOCUS_02880 22921 22220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 23350 24105 gene locus_tag LOCUS_02890 23350 24105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 25450 24242 gene locus_tag LOCUS_02900 25450 24242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070677.1 protein_id gnl|my_center|LOCUS_02900 29220 25540 gene locus_tag LOCUS_02910 gene purL 29220 25540 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_02910 31477 29387 gene locus_tag LOCUS_02920 31477 29387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 33746 31533 gene locus_tag LOCUS_02930 33746 31533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 35098 33821 gene locus_tag LOCUS_02940 gene rsmB 35098 33821 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_02940 35110 37206 gene locus_tag LOCUS_02950 gene recG 35110 37206 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_02950 38631 37303 gene locus_tag LOCUS_02960 38631 37303 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_02960 39963 38641 gene locus_tag LOCUS_02970 39963 38641 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969941.1 protein_id gnl|my_center|LOCUS_02970 40905 40039 gene locus_tag LOCUS_02980 40905 40039 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228419.1 protein_id gnl|my_center|LOCUS_02980 42381 40996 gene locus_tag LOCUS_02990 42381 40996 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891590.1 protein_id gnl|my_center|LOCUS_02990 44076 42388 gene locus_tag LOCUS_03000 44076 42388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 45424 44090 gene locus_tag LOCUS_03010 45424 44090 CDS product putative aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702442.1 protein_id gnl|my_center|LOCUS_03010 46990 45524 gene locus_tag LOCUS_03020 gene iolA2 46990 45524 CDS product methylmalonate semialdehyde dehydrogenase [acylating] 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HIK3 protein_id gnl|my_center|LOCUS_03020 48251 47793 gene locus_tag LOCUS_03030 48251 47793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 49233 48283 gene locus_tag LOCUS_03040 49233 48283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362591.1 protein_id gnl|my_center|LOCUS_03040 49752 49243 gene locus_tag LOCUS_03050 49752 49243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 51994 49742 gene locus_tag LOCUS_03060 gene xdhB 51994 49742 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114679.1 protein_id gnl|my_center|LOCUS_03060 53394 51991 gene locus_tag LOCUS_03070 gene xdhA 53394 51991 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972218.1 protein_id gnl|my_center|LOCUS_03070 53517 54065 gene locus_tag LOCUS_03080 53517 54065 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHZ8 protein_id gnl|my_center|LOCUS_03080 55298 54201 gene locus_tag LOCUS_03090 55298 54201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 56652 55753 gene locus_tag LOCUS_03100 56652 55753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937941.1 protein_id gnl|my_center|LOCUS_03100 57276 56938 gene locus_tag LOCUS_03110 57276 56938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 57621 57283 gene locus_tag LOCUS_03120 57621 57283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 58854 58138 gene locus_tag LOCUS_03130 58854 58138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 59318 58911 gene locus_tag LOCUS_03140 59318 58911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 60181 59918 gene locus_tag LOCUS_03150 60181 59918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 61165 60410 gene locus_tag LOCUS_03160 61165 60410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 63021 61402 gene locus_tag LOCUS_03170 63021 61402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 64546 63371 gene locus_tag LOCUS_03180 64546 63371 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530336.1 protein_id gnl|my_center|LOCUS_03180 66075 65083 gene locus_tag LOCUS_03190 66075 65083 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080864.1 protein_id gnl|my_center|LOCUS_03190 67875 66229 gene locus_tag LOCUS_03200 67875 66229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 68699 68292 gene locus_tag LOCUS_03210 68699 68292 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229959.1 protein_id gnl|my_center|LOCUS_03210 69618 69433 gene locus_tag LOCUS_03220 69618 69433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 70654 69776 gene locus_tag LOCUS_03230 70654 69776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 protein_id gnl|my_center|LOCUS_03230 71615 70827 gene locus_tag LOCUS_03240 71615 70827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254537.1 protein_id gnl|my_center|LOCUS_03240 72077 71757 gene locus_tag LOCUS_03250 72077 71757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 73115 72315 gene locus_tag LOCUS_03260 73115 72315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 73534 73112 gene locus_tag LOCUS_03270 73534 73112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_03270 74925 73780 gene locus_tag LOCUS_03280 74925 73780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 76406 75267 gene locus_tag LOCUS_03290 76406 75267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 76878 76714 gene locus_tag LOCUS_03300 76878 76714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence005 2559 1213 gene locus_tag LOCUS_03310 2559 1213 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A685 protein_id gnl|my_center|LOCUS_03310 2729 3409 gene locus_tag LOCUS_03320 2729 3409 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_03320 3440 3688 gene locus_tag LOCUS_03330 gene feoA 3440 3688 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_03330 3694 5805 gene locus_tag LOCUS_03340 gene feoB 3694 5805 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_03340 6010 6552 gene locus_tag LOCUS_03350 6010 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 7651 6638 gene locus_tag LOCUS_03360 gene galE 7651 6638 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_03360 8838 7690 gene locus_tag LOCUS_03370 gene porR 8838 7690 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_03370 8912 11293 gene locus_tag LOCUS_03380 gene pac 8912 11293 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964303.1 protein_id gnl|my_center|LOCUS_03380 12081 11344 gene locus_tag LOCUS_03390 12081 11344 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107566.1 protein_id gnl|my_center|LOCUS_03390 12527 12090 gene locus_tag LOCUS_03400 12527 12090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 13248 12562 gene locus_tag LOCUS_03410 13248 12562 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_03410 13866 13255 gene locus_tag LOCUS_03420 gene engB 13866 13255 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_03420 14672 13908 gene locus_tag LOCUS_03430 gene pcbD 14672 13908 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_03430 14880 15347 gene locus_tag LOCUS_03440 gene mraZ 14880 15347 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_03440 15334 16254 gene locus_tag LOCUS_03450 gene rsmH 15334 16254 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_03450 16257 16583 gene locus_tag LOCUS_03460 16257 16583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_03460 16642 18609 gene locus_tag LOCUS_03470 gene ftsI 16642 18609 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_03470 18632 20074 gene locus_tag LOCUS_03480 gene murE 18632 20074 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_03480 20079 21305 gene locus_tag LOCUS_03490 gene mraY 20079 21305 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_03490 21306 22640 gene locus_tag LOCUS_03500 gene murD 21306 22640 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_03500 22724 23911 gene locus_tag LOCUS_03510 gene ftsW 22724 23911 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_03510 23898 24989 gene locus_tag LOCUS_03520 gene murG 23898 24989 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_03520 24986 26338 gene locus_tag LOCUS_03530 gene murC 24986 26338 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_03530 26367 27053 gene locus_tag LOCUS_03540 gene ftsQ 26367 27053 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_03540 27060 28391 gene locus_tag LOCUS_03550 gene ftsA 27060 28391 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_03550 28460 30358 gene locus_tag LOCUS_03560 gene ftsZ 28460 30358 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_03560 30527 30742 gene locus_tag LOCUS_03570 30527 30742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 32229 31042 gene locus_tag LOCUS_03580 gene aspC1 32229 31042 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_03580 33351 32260 gene locus_tag LOCUS_03590 33351 32260 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_03590 33470 34099 gene locus_tag LOCUS_03600 gene rsmG 33470 34099 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_03600 35165 34107 gene locus_tag LOCUS_03610 35165 34107 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_03610 36142 35366 gene locus_tag LOCUS_03620 36142 35366 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249195.1 protein_id gnl|my_center|LOCUS_03620 37243 36326 gene locus_tag LOCUS_03630 gene glsA 37243 36326 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPV1 protein_id gnl|my_center|LOCUS_03630 39101 37407 gene locus_tag LOCUS_03640 gene lysS 39101 37407 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_03640 40444 40136 gene locus_tag LOCUS_03650 40444 40136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 40598 40416 gene locus_tag LOCUS_03660 40598 40416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03660 40719 41309 gene locus_tag LOCUS_03670 40719 41309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 42592 41402 gene locus_tag LOCUS_03680 42592 41402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 44544 43156 gene locus_tag LOCUS_03690 44544 43156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_03690 44649 44731 gene locus_tag LOCUS_t00020 44649 44731 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44995 45975 gene locus_tag LOCUS_03700 44995 45975 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_03700 46554 46117 gene locus_tag LOCUS_03710 46554 46117 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_03710 47079 46579 gene locus_tag LOCUS_03720 gene maoC 47079 46579 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001151673.1 protein_id gnl|my_center|LOCUS_03720 47852 47112 gene locus_tag LOCUS_03730 gene fabG 47852 47112 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8P2 protein_id gnl|my_center|LOCUS_03730 48539 48093 gene locus_tag LOCUS_03740 48539 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 50743 48611 gene locus_tag LOCUS_03750 50743 48611 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_03750 51015 51785 gene locus_tag LOCUS_03760 gene surE 51015 51785 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_03760 51773 52060 gene locus_tag LOCUS_03770 51773 52060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 52061 53173 gene locus_tag LOCUS_03780 gene lpxB 52061 53173 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_03780 53275 55290 gene locus_tag LOCUS_03790 53275 55290 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_03790 55444 56853 gene locus_tag LOCUS_03800 55444 56853 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887900.1 protein_id gnl|my_center|LOCUS_03800 59149 56864 gene locus_tag LOCUS_03810 59149 56864 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 protein_id gnl|my_center|LOCUS_03810 59788 59240 gene locus_tag LOCUS_03820 59788 59240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 61370 59826 gene locus_tag LOCUS_03830 61370 59826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 62846 61440 gene locus_tag LOCUS_03840 62846 61440 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707249.1 protein_id gnl|my_center|LOCUS_03840 65066 62871 gene locus_tag LOCUS_03850 gene pepX1 65066 62871 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_03850 65211 66944 gene locus_tag LOCUS_03860 65211 66944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 66941 67870 gene locus_tag LOCUS_03870 66941 67870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_03870 67996 69207 gene locus_tag LOCUS_03880 67996 69207 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_03880 69311 69868 gene locus_tag LOCUS_03890 69311 69868 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_03890 70485 69880 gene locus_tag LOCUS_03900 70485 69880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence006 1532 2686 gene locus_tag LOCUS_03910 1532 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2765 5017 gene locus_tag LOCUS_03920 2765 5017 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX3 protein_id gnl|my_center|LOCUS_03920 7274 5076 gene locus_tag LOCUS_03930 7274 5076 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_03930 9067 7271 gene locus_tag LOCUS_03940 gene uvrC 9067 7271 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_03940 9987 9328 gene locus_tag LOCUS_03950 gene lspA 9987 9328 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_03950 10708 10010 gene locus_tag LOCUS_03960 10708 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 11091 10714 gene locus_tag LOCUS_03970 gene dksA 11091 10714 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_03970 14504 11097 gene locus_tag LOCUS_03980 gene ileS 14504 11097 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_03980 15422 14664 gene locus_tag LOCUS_03990 15422 14664 CDS product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 protein_id gnl|my_center|LOCUS_03990 15586 15996 gene locus_tag LOCUS_04000 gene yqiW 15586 15996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_04000 16056 16295 gene locus_tag LOCUS_04010 16056 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 16297 16956 gene locus_tag LOCUS_04020 16297 16956 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_04020 17132 16959 gene locus_tag LOCUS_04030 17132 16959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 18015 17143 gene locus_tag LOCUS_04040 18015 17143 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_04040 18324 18899 gene locus_tag LOCUS_04050 18324 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 19777 18995 gene locus_tag LOCUS_04060 gene crt 19777 18995 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_04060 21204 19813 gene locus_tag LOCUS_04070 21204 19813 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_04070 22761 21403 gene locus_tag LOCUS_04080 22761 21403 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_04080 22829 23623 gene locus_tag LOCUS_04090 22829 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 26358 23620 gene locus_tag LOCUS_04100 26358 23620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_04100 26429 27211 gene locus_tag LOCUS_04110 26429 27211 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_04110 27223 27741 gene locus_tag LOCUS_04120 27223 27741 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963696.1 protein_id gnl|my_center|LOCUS_04120 28850 27870 gene locus_tag LOCUS_04130 28850 27870 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_04130 29530 28856 gene locus_tag LOCUS_04140 gene plsC 29530 28856 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_04140 30009 29587 gene locus_tag LOCUS_04150 30009 29587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_04150 31649 30111 gene locus_tag LOCUS_04160 31649 30111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 34261 31721 gene locus_tag LOCUS_04170 34261 31721 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_04170 36048 34480 gene locus_tag LOCUS_04180 gene pgi 36048 34480 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_04180 37317 36052 gene locus_tag LOCUS_04190 37317 36052 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_04190 38082 37417 gene locus_tag LOCUS_04200 38082 37417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_04200 39293 38376 gene locus_tag LOCUS_04210 39293 38376 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_04210 40709 39546 gene locus_tag LOCUS_04220 gene hppD 40709 39546 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_04220 42050 40893 gene locus_tag LOCUS_04230 gene hmgA 42050 40893 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_04230 42651 42304 gene locus_tag LOCUS_04240 42651 42304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 43785 42730 gene locus_tag LOCUS_04250 43785 42730 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_04250 44098 43862 gene locus_tag LOCUS_04260 44098 43862 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_04260 45241 44102 gene locus_tag LOCUS_04270 gene mrp 45241 44102 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_04270 45687 45355 gene locus_tag LOCUS_04280 gene ogt2 45687 45355 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_04280 46450 45779 gene locus_tag LOCUS_04290 gene trmB 46450 45779 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_04290 46681 46460 gene locus_tag LOCUS_04300 46681 46460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 46723 47652 gene locus_tag LOCUS_04310 46723 47652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 48300 47647 gene locus_tag LOCUS_04320 gene upp 48300 47647 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_04320 48678 49544 gene locus_tag LOCUS_04330 48678 49544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_04330 49545 50126 gene locus_tag LOCUS_04340 gene gmk 49545 50126 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_04340 50182 50763 gene locus_tag LOCUS_04350 gene nadD 50182 50763 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_04350 50811 51674 gene locus_tag LOCUS_04360 50811 51674 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_04360 51674 53170 gene locus_tag LOCUS_04370 51674 53170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_04370 53272 53721 gene locus_tag LOCUS_04380 53272 53721 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_04380 54396 53767 gene locus_tag LOCUS_04390 gene pth 54396 53767 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_04390 55066 54467 gene locus_tag LOCUS_04400 gene rplY 55066 54467 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_04400 56027 55086 gene locus_tag LOCUS_04410 gene prsA 56027 55086 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_04410 56154 56236 gene locus_tag LOCUS_t00030 56154 56236 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 56782 56552 gene locus_tag LOCUS_04420 gene yozV 56782 56552 CDS product putative membrane protein YozV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H423 protein_id gnl|my_center|LOCUS_04420 57448 58152 gene locus_tag LOCUS_04430 57448 58152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 58758 58534 gene locus_tag LOCUS_04440 58758 58534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 58976 59923 gene locus_tag LOCUS_04450 gene yfhH 58976 59923 CDS product steroid 5-alpha reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905448.1 protein_id gnl|my_center|LOCUS_04450 60635 60963 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttaaccaagacataggttcttgggatgt 61572 61486 gene locus_tag LOCUS_t00040 61572 61486 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 107 367 gene locus_tag LOCUS_04460 107 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 410 835 gene locus_tag LOCUS_04470 410 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04470 902 1633 gene locus_tag LOCUS_04480 902 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 1676 2341 gene locus_tag LOCUS_04490 1676 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04490 2410 2637 gene locus_tag LOCUS_04500 2410 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3183 3629 gene locus_tag LOCUS_04510 3183 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3661 4746 gene locus_tag LOCUS_04520 3661 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 5103 6275 gene locus_tag LOCUS_04530 gene moeA 5103 6275 CDS product molybdopterin molybdenumtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45210 protein_id gnl|my_center|LOCUS_04530 6278 6826 gene locus_tag LOCUS_04540 gene mobA 6278 6826 CDS product putative molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGH6 protein_id gnl|my_center|LOCUS_04540 6810 7046 gene locus_tag LOCUS_04550 6810 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 7182 8294 gene locus_tag LOCUS_04560 7182 8294 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_04560 8300 8743 gene locus_tag LOCUS_04570 8300 8743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8761 9117 gene locus_tag LOCUS_04580 8761 9117 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_04580 9149 10063 gene locus_tag LOCUS_04590 gene moaCB 9149 10063 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_04590 10528 10058 gene locus_tag LOCUS_04600 10528 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 12859 10676 gene locus_tag LOCUS_04610 12859 10676 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_04610 12999 13595 gene locus_tag LOCUS_04620 12999 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 13668 13743 gene locus_tag LOCUS_t00050 13668 13743 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13881 14513 gene locus_tag LOCUS_04630 13881 14513 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_04630 14510 15931 gene locus_tag LOCUS_04640 14510 15931 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_04640 16044 17354 gene locus_tag LOCUS_04650 gene phrB3 16044 17354 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964143.1 protein_id gnl|my_center|LOCUS_04650 17356 18888 gene locus_tag LOCUS_04660 17356 18888 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_04660 18878 20368 gene locus_tag LOCUS_04670 gene phrB2 18878 20368 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_04670 20460 20894 gene locus_tag LOCUS_04680 20460 20894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 20906 21178 gene locus_tag LOCUS_04690 20906 21178 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_04690 21476 21700 gene locus_tag LOCUS_04700 21476 21700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 21778 21993 gene locus_tag LOCUS_04710 21778 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 22000 22683 gene locus_tag LOCUS_04720 22000 22683 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_04720 22699 23172 gene locus_tag LOCUS_04730 22699 23172 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E75 protein_id gnl|my_center|LOCUS_04730 23178 23351 gene locus_tag LOCUS_04740 23178 23351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 23348 23809 gene locus_tag LOCUS_04750 23348 23809 CDS product sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383769.1 protein_id gnl|my_center|LOCUS_04750 23811 24275 gene locus_tag LOCUS_04760 23811 24275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_04760 24384 25685 gene locus_tag LOCUS_04770 gene phrB1 24384 25685 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_04770 25893 25967 gene locus_tag LOCUS_t00060 25893 25967 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 26154 27986 gene locus_tag LOCUS_04780 26154 27986 CDS product diacylglycerol O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MNU9 protein_id gnl|my_center|LOCUS_04780 27990 28925 gene locus_tag LOCUS_04790 27990 28925 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_04790 28935 30095 gene locus_tag LOCUS_04800 28935 30095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 30098 33346 gene locus_tag LOCUS_04810 30098 33346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 33358 34359 gene locus_tag LOCUS_04820 gene gpsA 33358 34359 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MHA8 protein_id gnl|my_center|LOCUS_04820 34372 34884 gene locus_tag LOCUS_04830 34372 34884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 34892 35695 gene locus_tag LOCUS_04840 34892 35695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 35745 36038 gene locus_tag LOCUS_04850 35745 36038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 36114 36959 gene locus_tag LOCUS_04860 36114 36959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 36988 37278 gene locus_tag LOCUS_04870 36988 37278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 37398 38060 gene locus_tag LOCUS_04880 37398 38060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_04880 38063 39373 gene locus_tag LOCUS_04890 38063 39373 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_04890 39423 40028 gene locus_tag LOCUS_04900 gene udk 39423 40028 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_04900 40029 40349 gene locus_tag LOCUS_04910 40029 40349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_04910 40349 41704 gene locus_tag LOCUS_04920 gene mutA 40349 41704 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_04920 41697 43763 gene locus_tag LOCUS_04930 gene mutB 41697 43763 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_04930 43945 47034 gene locus_tag LOCUS_04940 gene ccsBA 43945 47034 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_04940 47110 47649 gene locus_tag LOCUS_04950 47110 47649 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_04950 49357 47738 gene locus_tag LOCUS_04960 49357 47738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_04960 50883 49348 gene locus_tag LOCUS_04970 gene guaA 50883 49348 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_04970 52145 51081 gene locus_tag LOCUS_04980 gene fabH1 52145 51081 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_04980 53170 52688 gene locus_tag LOCUS_04990 gene cdd 53170 52688 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_04990 54372 53245 gene locus_tag LOCUS_05000 gene porV 54372 53245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_05000 57806 54411 gene locus_tag LOCUS_05010 gene porU 57806 54411 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_05010 58005 59687 gene locus_tag LOCUS_05020 gene gldJ 58005 59687 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence008 2458 1118 gene locus_tag LOCUS_05030 gene dgt 2458 1118 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_05030 4362 2584 gene locus_tag LOCUS_05040 4362 2584 CDS product ribonucleoside-diphosphate reductase, alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229097.1 protein_id gnl|my_center|LOCUS_05040 5640 4366 gene locus_tag LOCUS_05050 5640 4366 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402917.1 protein_id gnl|my_center|LOCUS_05050 6028 6219 gene locus_tag LOCUS_05060 6028 6219 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_05060 6599 7621 gene locus_tag LOCUS_05070 gene ctaA 6599 7621 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 protein_id gnl|my_center|LOCUS_05070 8084 7662 gene locus_tag LOCUS_05080 gene moaE 8084 7662 CDS product molybdopterin converting factor, subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531878.1 protein_id gnl|my_center|LOCUS_05080 8227 8505 gene locus_tag LOCUS_05090 gene ydzA 8227 8505 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_05090 8812 8570 gene locus_tag LOCUS_05100 gene moaD 8812 8570 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866971.1 protein_id gnl|my_center|LOCUS_05100 11304 8833 gene locus_tag LOCUS_05110 11304 8833 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_05110 11637 13913 gene locus_tag LOCUS_05120 gene maeB 11637 13913 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_05120 13944 14525 gene locus_tag LOCUS_05130 gene ruvA 13944 14525 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_05130 14530 21618 gene locus_tag LOCUS_05140 gene sprA 14530 21618 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_05140 21642 22022 gene locus_tag LOCUS_05150 gene gcvH 21642 22022 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_05150 22039 22356 gene locus_tag LOCUS_05160 22039 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 22430 23149 gene locus_tag LOCUS_05170 22430 23149 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_05170 23390 23590 gene locus_tag LOCUS_05180 23390 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_05180 24474 23788 gene locus_tag LOCUS_05190 24474 23788 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_05190 25897 24566 gene locus_tag LOCUS_05200 25897 24566 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_05200 26246 26022 gene locus_tag LOCUS_05210 26246 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_05210 26778 26239 gene locus_tag LOCUS_05220 gene yozB 26778 26239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_05220 27415 26771 gene locus_tag LOCUS_05230 gene ypmQ 27415 26771 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_05230 28089 27412 gene locus_tag LOCUS_05240 28089 27412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_05240 28541 28200 gene locus_tag LOCUS_05250 28541 28200 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_05250 29546 28566 gene locus_tag LOCUS_05260 29546 28566 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_05260 30189 29602 gene locus_tag LOCUS_05270 gene ctaE 30189 29602 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_05270 31014 30193 gene locus_tag LOCUS_05280 gene ctaB 31014 30193 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_05280 30896 31129 gene locus_tag LOCUS_05290 30896 31129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 31937 31383 gene locus_tag LOCUS_05300 31937 31383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 32494 31937 gene locus_tag LOCUS_05310 32494 31937 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_05310 33269 32499 gene locus_tag LOCUS_05320 33269 32499 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_05320 33660 33403 gene locus_tag LOCUS_05330 33660 33403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_05330 37238 33885 gene locus_tag LOCUS_05340 37238 33885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 37427 38344 gene locus_tag LOCUS_05350 37427 38344 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764292.1 protein_id gnl|my_center|LOCUS_05350 39653 38763 gene locus_tag LOCUS_05360 gene fabD 39653 38763 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_05360 39853 40539 gene locus_tag LOCUS_05370 39853 40539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_05370 40595 41305 gene locus_tag LOCUS_05380 40595 41305 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_05380 41341 41676 gene locus_tag LOCUS_05390 41341 41676 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_05390 41816 42868 gene locus_tag LOCUS_05400 41816 42868 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_05400 42899 43894 gene locus_tag LOCUS_05410 42899 43894 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_05410 44045 44467 gene locus_tag LOCUS_05420 44045 44467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 44460 45065 gene locus_tag LOCUS_05430 44460 45065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_05430 45066 45881 gene locus_tag LOCUS_05440 gene deoD 45066 45881 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_05440 46181 46855 gene locus_tag LOCUS_05450 46181 46855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038642.1 protein_id gnl|my_center|LOCUS_05450 47014 47565 gene locus_tag LOCUS_05460 47014 47565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 47829 51161 gene locus_tag LOCUS_05470 47829 51161 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962267.1 protein_id gnl|my_center|LOCUS_05470 51350 54487 gene locus_tag LOCUS_05480 51350 54487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 54561 54710 gene locus_tag LOCUS_05490 54561 54710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 55159 54989 gene locus_tag LOCUS_05500 55159 54989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 55577 55203 gene locus_tag LOCUS_05510 55577 55203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_05510 55846 55580 gene locus_tag LOCUS_05520 55846 55580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 56256 59399 gene locus_tag LOCUS_05530 56256 59399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence009 412 804 gene locus_tag LOCUS_05540 412 804 CDS product (deoxy)nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021612.1 protein_id gnl|my_center|LOCUS_05540 2490 862 gene locus_tag LOCUS_05550 2490 862 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_05550 3137 2541 gene locus_tag LOCUS_05560 3137 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3058 3786 gene locus_tag LOCUS_05570 gene pyrE 3058 3786 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_05570 3797 4189 gene locus_tag LOCUS_05580 3797 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_05580 4912 4181 gene locus_tag LOCUS_05590 gene birA 4912 4181 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_05590 5000 5368 gene locus_tag LOCUS_05600 gene rsfS 5000 5368 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_05600 5389 7362 gene locus_tag LOCUS_05610 gene ftsH 5389 7362 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_05610 7370 7954 gene locus_tag LOCUS_05620 7370 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_05620 7956 8750 gene locus_tag LOCUS_05630 gene cdsA 7956 8750 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_05630 8753 9409 gene locus_tag LOCUS_05640 gene psd 8753 9409 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_05640 9393 9656 gene locus_tag LOCUS_05650 9393 9656 CDS product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962768.1 protein_id gnl|my_center|LOCUS_05650 9706 10317 gene locus_tag LOCUS_05660 9706 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821257.1 protein_id gnl|my_center|LOCUS_05660 11197 10322 gene locus_tag LOCUS_05670 11197 10322 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_05670 12194 11190 gene locus_tag LOCUS_05680 12194 11190 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698132.1 protein_id gnl|my_center|LOCUS_05680 14876 12261 gene locus_tag LOCUS_05690 14876 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403224.1 protein_id gnl|my_center|LOCUS_05690 15081 16205 gene locus_tag LOCUS_05700 15081 16205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_05700 16257 17723 gene locus_tag LOCUS_05710 16257 17723 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_05710 18168 17815 gene locus_tag LOCUS_05720 18168 17815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 20377 18179 gene locus_tag LOCUS_05730 20377 18179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 20946 20452 gene locus_tag LOCUS_05740 20946 20452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 22511 21033 gene locus_tag LOCUS_05750 22511 21033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 23414 22515 gene locus_tag LOCUS_05760 23414 22515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_05760 23586 23750 gene locus_tag LOCUS_05770 23586 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 25676 24378 gene locus_tag LOCUS_05780 25676 24378 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_05780 26151 25801 gene locus_tag LOCUS_05790 26151 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 26434 27018 gene locus_tag LOCUS_05800 26434 27018 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_05800 27005 27403 gene locus_tag LOCUS_05810 27005 27403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 28401 27538 gene locus_tag LOCUS_05820 28401 27538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402886.1 protein_id gnl|my_center|LOCUS_05820 29222 28398 gene locus_tag LOCUS_05830 29222 28398 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947815.1 protein_id gnl|my_center|LOCUS_05830 29803 29288 gene locus_tag LOCUS_05840 29803 29288 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989581.1 protein_id gnl|my_center|LOCUS_05840 31078 29840 gene locus_tag LOCUS_05850 31078 29840 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_05850 31676 31218 gene locus_tag LOCUS_05860 31676 31218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 32417 31776 gene locus_tag LOCUS_05870 32417 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 32895 32401 gene locus_tag LOCUS_05880 32895 32401 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_05880 33635 33051 gene locus_tag LOCUS_05890 33635 33051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 34378 34196 gene locus_tag LOCUS_05900 34378 34196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 34786 34457 gene locus_tag LOCUS_05910 34786 34457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 36821 34917 gene locus_tag LOCUS_05920 gene htpG 36821 34917 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_05920 36940 37542 gene locus_tag LOCUS_05930 36940 37542 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_05930 37558 38361 gene locus_tag LOCUS_05940 37558 38361 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_05940 38368 39627 gene locus_tag LOCUS_05950 gene erg3 38368 39627 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_05950 39751 41487 gene locus_tag LOCUS_05960 39751 41487 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123282.1 protein_id gnl|my_center|LOCUS_05960 41537 44188 gene locus_tag LOCUS_05970 41537 44188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 44268 45839 gene locus_tag LOCUS_05980 44268 45839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523287.1 protein_id gnl|my_center|LOCUS_05980 45864 47387 gene locus_tag LOCUS_05990 45864 47387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733179.1 protein_id gnl|my_center|LOCUS_05990 47391 48941 gene locus_tag LOCUS_06000 gene fadD 47391 48941 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_06000 48945 50369 gene locus_tag LOCUS_06010 gene putA 48945 50369 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 protein_id gnl|my_center|LOCUS_06010 50373 51257 gene locus_tag LOCUS_06020 50373 51257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 51261 52328 gene locus_tag LOCUS_06030 gene fabH1 51261 52328 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_06030 52328 54109 gene locus_tag LOCUS_06040 gene atsA 52328 54109 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206777.1 protein_id gnl|my_center|LOCUS_06040 55665 54274 gene locus_tag LOCUS_06050 gene nagA 55665 54274 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_06050 55776 56783 gene locus_tag LOCUS_06060 gene fabH2 55776 56783 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_06060 57139 57915 gene locus_tag LOCUS_06070 57139 57915 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_06070 58458 58183 gene locus_tag LOCUS_06080 58458 58183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 <59439 58379 gene locus_tag LOCUS_06090 <59439 58379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963618.1:TonB-dependent receptor note possible pseudo, internal stop codon >Feature sequence010 <1 2280 gene locus_tag LOCUS_06100 <1 2280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763369.1:aminopeptidase 2809 2510 gene locus_tag LOCUS_06110 2809 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3315 2965 gene locus_tag LOCUS_06120 3315 2965 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_06120 3661 4719 gene locus_tag LOCUS_06130 3661 4719 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_06130 4797 5276 gene locus_tag LOCUS_06140 4797 5276 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_06140 5389 7380 gene locus_tag LOCUS_06150 gene bfmBA 5389 7380 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_06150 7414 8421 gene locus_tag LOCUS_06160 7414 8421 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097826.1 protein_id gnl|my_center|LOCUS_06160 8426 8605 gene locus_tag LOCUS_06170 8426 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 9551 8847 gene locus_tag LOCUS_06180 gene truC 9551 8847 CDS product tRNA pseudouridine synthase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KTL4 protein_id gnl|my_center|LOCUS_06180 10791 9586 gene locus_tag LOCUS_06190 10791 9586 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257181.1 protein_id gnl|my_center|LOCUS_06190 11282 10890 gene locus_tag LOCUS_06200 11282 10890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 12806 11535 gene locus_tag LOCUS_06210 gene purA 12806 11535 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_06210 13297 12848 gene locus_tag LOCUS_06220 gene fur 13297 12848 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_06220 15592 13370 gene locus_tag LOCUS_06230 gene relA 15592 13370 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_06230 16975 15743 gene locus_tag LOCUS_06240 16975 15743 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_06240 17822 17076 gene locus_tag LOCUS_06250 17822 17076 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_06250 18623 17829 gene locus_tag LOCUS_06260 18623 17829 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_06260 20407 19112 gene locus_tag LOCUS_06270 20407 19112 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_06270 23374 20414 gene locus_tag LOCUS_06280 23374 20414 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_06280 24542 23466 gene locus_tag LOCUS_06290 24542 23466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_06290 24681 26198 gene locus_tag LOCUS_06300 gene dnaB 24681 26198 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_06300 26341 28368 gene locus_tag LOCUS_06310 26341 28368 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405118.1 protein_id gnl|my_center|LOCUS_06310 28467 29651 gene locus_tag LOCUS_06320 28467 29651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_06320 29852 30697 gene locus_tag LOCUS_06330 gene tktA 29852 30697 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_06330 30863 31996 gene locus_tag LOCUS_06340 30863 31996 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_06340 32430 33755 gene locus_tag LOCUS_06350 gene gltP 32430 33755 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_06350 33778 34626 gene locus_tag LOCUS_06360 33778 34626 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_06360 35427 34771 gene locus_tag LOCUS_06370 35427 34771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 protein_id gnl|my_center|LOCUS_06370 35743 35429 gene locus_tag LOCUS_06380 35743 35429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 36173 35757 gene locus_tag LOCUS_06390 gene yuxK 36173 35757 CDS product thiol-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_06390 36348 37049 gene locus_tag LOCUS_06400 36348 37049 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_06400 37052 38284 gene locus_tag LOCUS_06410 37052 38284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_06410 38287 39531 gene locus_tag LOCUS_06420 38287 39531 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_06420 39548 40663 gene locus_tag LOCUS_06430 39548 40663 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_06430 41531 40716 gene locus_tag LOCUS_06440 41531 40716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 41589 42263 gene locus_tag LOCUS_06450 41589 42263 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_06450 43635 42298 gene locus_tag LOCUS_06460 43635 42298 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_06460 43740 44135 gene locus_tag LOCUS_06470 43740 44135 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_06470 44166 45287 gene locus_tag LOCUS_06480 44166 45287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 45368 45994 gene locus_tag LOCUS_06490 45368 45994 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_06490 49292 46044 gene locus_tag LOCUS_06500 49292 46044 CDS product tricorn protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7W6 protein_id gnl|my_center|LOCUS_06500 50787 49387 gene locus_tag LOCUS_06510 50787 49387 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_06510 52172 50817 gene locus_tag LOCUS_06520 52172 50817 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_06520 53841 52177 gene locus_tag LOCUS_06530 53841 52177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_06530 54515 53844 gene locus_tag LOCUS_06540 54515 53844 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence011 2357 168 gene locus_tag LOCUS_06550 gene katG 2357 168 CDS product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C4 protein_id gnl|my_center|LOCUS_06550 2642 3289 gene locus_tag LOCUS_06560 2642 3289 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963839.1 protein_id gnl|my_center|LOCUS_06560 3299 3607 gene locus_tag LOCUS_06570 3299 3607 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963838.1 protein_id gnl|my_center|LOCUS_06570 3609 3866 gene locus_tag LOCUS_06580 3609 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963837.1 protein_id gnl|my_center|LOCUS_06580 4386 4234 gene locus_tag LOCUS_06590 4386 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 4725 5552 gene locus_tag LOCUS_06600 4725 5552 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_06600 5642 6127 gene locus_tag LOCUS_06610 5642 6127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_06610 6261 9179 gene locus_tag LOCUS_06620 6261 9179 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_06620 10371 9310 gene locus_tag LOCUS_06630 10371 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11327 10398 gene locus_tag LOCUS_06640 11327 10398 CDS product symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_06640 11952 11311 gene locus_tag LOCUS_06650 11952 11311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_06650 12725 11997 gene locus_tag LOCUS_06660 12725 11997 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_06660 13903 12782 gene locus_tag LOCUS_06670 gene yghO 13903 12782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_06670 14937 13918 gene locus_tag LOCUS_06680 14937 13918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_06680 15105 15356 gene locus_tag LOCUS_06690 15105 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 15435 17855 gene locus_tag LOCUS_06700 15435 17855 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_06700 19540 17852 gene locus_tag LOCUS_06710 19540 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 19946 21136 gene locus_tag LOCUS_06720 19946 21136 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_06720 21133 22392 gene locus_tag LOCUS_06730 21133 22392 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_06730 22398 23891 gene locus_tag LOCUS_06740 22398 23891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 24080 23886 gene locus_tag LOCUS_06750 24080 23886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 24885 24310 gene locus_tag LOCUS_06760 24885 24310 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790890.1 protein_id gnl|my_center|LOCUS_06760 25581 24952 gene locus_tag LOCUS_06770 25581 24952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_06770 27352 25655 gene locus_tag LOCUS_06780 gene lepB 27352 25655 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_06780 28134 27433 gene locus_tag LOCUS_06790 gene dapB 28134 27433 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_06790 28732 28136 gene locus_tag LOCUS_06800 28732 28136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_06800 29617 28733 gene locus_tag LOCUS_06810 gene parB 29617 28733 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_06810 30382 29618 gene locus_tag LOCUS_06820 gene parA 30382 29618 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_06820 32036 30570 gene locus_tag LOCUS_06830 gene pepD 32036 30570 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_06830 32766 32134 gene locus_tag LOCUS_06840 32766 32134 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_06840 32877 34148 gene locus_tag LOCUS_06850 32877 34148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_06850 36575 34149 gene locus_tag LOCUS_06860 36575 34149 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_06860 39154 36701 gene locus_tag LOCUS_06870 39154 36701 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_06870 42110 39300 gene locus_tag LOCUS_06880 42110 39300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 protein_id gnl|my_center|LOCUS_06880 43010 42303 gene locus_tag LOCUS_06890 43010 42303 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_06890 45877 43055 gene locus_tag LOCUS_06900 gene uvrA2 45877 43055 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_06900 45989 46216 gene locus_tag LOCUS_06910 45989 46216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 protein_id gnl|my_center|LOCUS_06910 46220 47218 gene locus_tag LOCUS_06920 46220 47218 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_06920 47220 48119 gene locus_tag LOCUS_06930 47220 48119 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_06930 48206 49822 gene locus_tag LOCUS_06940 gene dagA 48206 49822 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_06940 49838 50734 gene locus_tag LOCUS_06950 49838 50734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_06950 50762 51928 gene locus_tag LOCUS_06960 50762 51928 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963323.1 protein_id gnl|my_center|LOCUS_06960 52186 52383 gene locus_tag LOCUS_06970 gene rpsU 52186 52383 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_06970 52482 53369 gene locus_tag LOCUS_06980 gene xerC 52482 53369 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_06980 53373 53681 gene locus_tag LOCUS_06990 53373 53681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_06990 53790 53864 gene locus_tag LOCUS_t00070 53790 53864 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 53906 53988 gene locus_tag LOCUS_t00080 53906 53988 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence012 599 57 gene locus_tag LOCUS_07000 599 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_07000 774 4208 gene locus_tag LOCUS_07010 gene icmF 774 4208 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_07010 5073 4729 gene locus_tag LOCUS_07020 5073 4729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 5618 6493 gene locus_tag LOCUS_07030 5618 6493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 9121 6572 gene locus_tag LOCUS_07040 9121 6572 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_07040 9261 10082 gene locus_tag LOCUS_07050 9261 10082 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964046.1 protein_id gnl|my_center|LOCUS_07050 10261 11610 gene locus_tag LOCUS_07060 10261 11610 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 protein_id gnl|my_center|LOCUS_07060 11965 13071 gene locus_tag LOCUS_07070 11965 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 14917 13331 gene locus_tag LOCUS_07080 14917 13331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 14905 16245 gene locus_tag LOCUS_07090 14905 16245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 16277 17464 gene locus_tag LOCUS_07100 16277 17464 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268944.1 protein_id gnl|my_center|LOCUS_07100 19480 17516 gene locus_tag LOCUS_07110 19480 17516 CDS product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RL0 protein_id gnl|my_center|LOCUS_07110 19934 21514 gene locus_tag LOCUS_07120 19934 21514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 22285 21530 gene locus_tag LOCUS_07130 22285 21530 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981419.1 protein_id gnl|my_center|LOCUS_07130 22399 24318 gene locus_tag LOCUS_07140 gene gaa 22399 24318 CDS product glutaryl-7-ACA acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037381.1 protein_id gnl|my_center|LOCUS_07140 24366 25814 gene locus_tag LOCUS_07150 24366 25814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115383.1 protein_id gnl|my_center|LOCUS_07150 25843 26007 gene locus_tag LOCUS_07160 25843 26007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 26097 26774 gene locus_tag LOCUS_07170 26097 26774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_07170 26913 28529 gene locus_tag LOCUS_07180 26913 28529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 28598 28786 gene locus_tag LOCUS_07190 28598 28786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 29622 28801 gene locus_tag LOCUS_07200 gene pyrF 29622 28801 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_07200 29707 30201 gene locus_tag LOCUS_07210 gene tlpA 29707 30201 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_07210 30284 31042 gene locus_tag LOCUS_07220 gene tpiA 30284 31042 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_07220 31121 31957 gene locus_tag LOCUS_07230 gene prmA 31121 31957 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_07230 31962 32243 gene locus_tag LOCUS_07240 gene clpS 31962 32243 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_07240 32247 32519 gene locus_tag LOCUS_07250 32247 32519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 33300 32716 gene locus_tag LOCUS_07260 33300 32716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 33569 33297 gene locus_tag LOCUS_07270 33569 33297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 34597 34004 gene locus_tag LOCUS_07280 34597 34004 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_07280 35283 34603 gene locus_tag LOCUS_07290 35283 34603 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_07290 35567 37027 gene locus_tag LOCUS_07300 35567 37027 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_07300 37296 37222 gene locus_tag LOCUS_t00090 37296 37222 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 37584 37354 gene locus_tag LOCUS_07310 37584 37354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962825.1 protein_id gnl|my_center|LOCUS_07310 38248 39180 gene locus_tag LOCUS_07320 gene yrbG 38248 39180 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07320 39484 40551 gene locus_tag LOCUS_07330 39484 40551 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_07330 40570 41184 gene locus_tag LOCUS_07340 40570 41184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_07340 42154 41453 gene locus_tag LOCUS_07350 42154 41453 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267293.1 protein_id gnl|my_center|LOCUS_07350 42536 42165 gene locus_tag LOCUS_07360 gene crcB 42536 42165 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZS4 protein_id gnl|my_center|LOCUS_07360 43504 42536 gene locus_tag LOCUS_07370 43504 42536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_07370 44220 43684 gene locus_tag LOCUS_07380 44220 43684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_07380 44405 44986 gene locus_tag LOCUS_07390 44405 44986 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q815T3 protein_id gnl|my_center|LOCUS_07390 44986 45810 gene locus_tag LOCUS_07400 gene folP 44986 45810 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_07400 46099 46704 gene locus_tag LOCUS_07410 46099 46704 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_07410 46758 47534 gene locus_tag LOCUS_07420 46758 47534 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202009.1 protein_id gnl|my_center|LOCUS_07420 49358 47592 gene locus_tag LOCUS_07430 49358 47592 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_07430 50087 49362 gene locus_tag LOCUS_07440 gene truA 50087 49362 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_07440 >Feature sequence013 <1 2406 gene locus_tag LOCUS_07450 <1 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964399.1:T9SS C-terminal target domain-containing protein 2524 6573 gene locus_tag LOCUS_07460 2524 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 8260 6629 gene locus_tag LOCUS_07470 gene aceA 8260 6629 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117581.1 protein_id gnl|my_center|LOCUS_07470 9938 8343 gene locus_tag LOCUS_07480 gene aceB 9938 8343 CDS product malate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM57 protein_id gnl|my_center|LOCUS_07480 10067 11551 gene locus_tag LOCUS_07490 10067 11551 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704845.1 protein_id gnl|my_center|LOCUS_07490 11589 13217 gene locus_tag LOCUS_07500 11589 13217 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_07500 13348 13794 gene locus_tag LOCUS_07510 13348 13794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 13902 15995 gene locus_tag LOCUS_07520 gene pta 13902 15995 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S7 protein_id gnl|my_center|LOCUS_07520 15997 17181 gene locus_tag LOCUS_07530 gene ackA 15997 17181 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYB1 protein_id gnl|my_center|LOCUS_07530 17394 18110 gene locus_tag LOCUS_07540 17394 18110 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_07540 18331 19590 gene locus_tag LOCUS_07550 18331 19590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 20013 19591 gene locus_tag LOCUS_07560 20013 19591 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_07560 20201 20635 gene locus_tag LOCUS_07570 20201 20635 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_07570 20654 20998 gene locus_tag LOCUS_07580 20654 20998 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_07580 20991 22652 gene locus_tag LOCUS_07590 20991 22652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_07590 22748 23473 gene locus_tag LOCUS_07600 22748 23473 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_07600 23497 24000 gene locus_tag LOCUS_07610 23497 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 24642 27071 gene locus_tag LOCUS_07620 24642 27071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 27515 27108 gene locus_tag LOCUS_07630 27515 27108 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788775.1 protein_id gnl|my_center|LOCUS_07630 27583 28254 gene locus_tag LOCUS_07640 gene pcgL 27583 28254 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZSD4 protein_id gnl|my_center|LOCUS_07640 28332 28991 gene locus_tag LOCUS_07650 28332 28991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 29123 30112 gene locus_tag LOCUS_07660 gene pdhA 29123 30112 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_07660 30116 31735 gene locus_tag LOCUS_07670 gene pdhC 30116 31735 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_07670 31922 32680 gene locus_tag LOCUS_07680 31922 32680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_07680 32867 33553 gene locus_tag LOCUS_07690 32867 33553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 34962 33643 gene locus_tag LOCUS_07700 gene bfmBB 34962 33643 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_07700 37386 35206 gene locus_tag LOCUS_07710 37386 35206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 38323 37418 gene locus_tag LOCUS_07720 gene hemF 38323 37418 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_07720 39059 38304 gene locus_tag LOCUS_07730 39059 38304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 40198 39170 gene locus_tag LOCUS_07740 gene hemE 40198 39170 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_07740 40650 40204 gene locus_tag LOCUS_07750 40650 40204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 41943 40654 gene locus_tag LOCUS_07760 gene hemL 41943 40654 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 protein_id gnl|my_center|LOCUS_07760 42970 42008 gene locus_tag LOCUS_07770 gene hemB 42970 42008 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67876 protein_id gnl|my_center|LOCUS_07770 44675 43074 gene locus_tag LOCUS_07780 44675 43074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 45921 44686 gene locus_tag LOCUS_07790 gene hemA 45921 44686 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence014 <1 1326 gene locus_tag LOCUS_07800 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0J8:adenylosuccinate lyase 1326 1697 gene locus_tag LOCUS_07810 1326 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 2012 2251 gene locus_tag LOCUS_07820 2012 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2290 4692 gene locus_tag LOCUS_07830 2290 4692 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_07830 4716 5279 gene locus_tag LOCUS_07840 4716 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6843 5467 gene locus_tag LOCUS_07850 6843 5467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_07850 7735 6914 gene locus_tag LOCUS_07860 7735 6914 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_07860 7995 8435 gene locus_tag LOCUS_07870 7995 8435 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088596.1 protein_id gnl|my_center|LOCUS_07870 8572 9096 gene locus_tag LOCUS_07880 8572 9096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 9778 11106 gene locus_tag LOCUS_07890 gene ffh 9778 11106 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_07890 11175 12050 gene locus_tag LOCUS_07900 gene folD 11175 12050 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_07900 13091 12084 gene locus_tag LOCUS_07910 13091 12084 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107805.1 protein_id gnl|my_center|LOCUS_07910 13524 13162 gene locus_tag LOCUS_07920 13524 13162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 14189 13626 gene locus_tag LOCUS_07930 14189 13626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 15774 14236 gene locus_tag LOCUS_07940 15774 14236 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_07940 16126 15863 gene locus_tag LOCUS_07950 16126 15863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 16026 19163 gene locus_tag LOCUS_07960 16026 19163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07960 19166 19849 gene locus_tag LOCUS_07970 19166 19849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 19849 21156 gene locus_tag LOCUS_07980 19849 21156 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_07980 21267 21896 gene locus_tag LOCUS_07990 21267 21896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_07990 23865 21898 gene locus_tag LOCUS_08000 gene yyaL 23865 21898 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_08000 25524 24145 gene locus_tag LOCUS_08010 25524 24145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 29181 25891 gene locus_tag LOCUS_08020 29181 25891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 30272 29340 gene locus_tag LOCUS_08030 30272 29340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 32666 30303 gene locus_tag LOCUS_08040 32666 30303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 34152 32695 gene locus_tag LOCUS_08050 gene srfJ 34152 32695 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 protein_id gnl|my_center|LOCUS_08050 35491 34205 gene locus_tag LOCUS_08060 35491 34205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 37267 35534 gene locus_tag LOCUS_08070 37267 35534 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223197.1 protein_id gnl|my_center|LOCUS_08070 40800 37342 gene locus_tag LOCUS_08080 40800 37342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 42211 40913 gene locus_tag LOCUS_08090 42211 40913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 44148 42478 gene locus_tag LOCUS_08100 44148 42478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence015 10 95 gene locus_tag LOCUS_t00100 10 95 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 567 1169 gene locus_tag LOCUS_08110 567 1169 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_08110 1204 2088 gene locus_tag LOCUS_08120 gene rluF 1204 2088 CDS product 23S rRNA pseudouridine(2604) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1V3 protein_id gnl|my_center|LOCUS_08120 3888 3016 gene locus_tag LOCUS_08130 3888 3016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 4986 3892 gene locus_tag LOCUS_08140 gene galK 4986 3892 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39574 protein_id gnl|my_center|LOCUS_08140 6620 4986 gene locus_tag LOCUS_08150 6620 4986 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203204.1 protein_id gnl|my_center|LOCUS_08150 8186 6657 gene locus_tag LOCUS_08160 8186 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 10487 8196 gene locus_tag LOCUS_08170 10487 8196 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 protein_id gnl|my_center|LOCUS_08170 11283 10480 gene locus_tag LOCUS_08180 gene fdhD 11283 10480 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0R194 protein_id gnl|my_center|LOCUS_08180 12647 11472 gene locus_tag LOCUS_08190 12647 11472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_08190 13737 12655 gene locus_tag LOCUS_08200 13737 12655 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_08200 15014 13737 gene locus_tag LOCUS_08210 15014 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 16041 15178 gene locus_tag LOCUS_08220 16041 15178 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941331.1 protein_id gnl|my_center|LOCUS_08220 16457 16041 gene locus_tag LOCUS_08230 16457 16041 CDS product ring-cleaving dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_08230 18244 16553 gene locus_tag LOCUS_08240 gene ggt 18244 16553 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_08240 18789 18241 gene locus_tag LOCUS_08250 18789 18241 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_08250 20045 18927 gene locus_tag LOCUS_08260 gene dnaN 20045 18927 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_08260 20222 22738 gene locus_tag LOCUS_08270 20222 22738 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383264.1 protein_id gnl|my_center|LOCUS_08270 23061 24947 gene locus_tag LOCUS_08280 23061 24947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 24934 25914 gene locus_tag LOCUS_08290 24934 25914 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_08290 26936 26088 gene locus_tag LOCUS_08300 26936 26088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_08300 27045 27713 gene locus_tag LOCUS_08310 27045 27713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 27700 28461 gene locus_tag LOCUS_08320 gene yeeZ 27700 28461 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261981.1 protein_id gnl|my_center|LOCUS_08320 30107 28464 gene locus_tag LOCUS_08330 gene gldG 30107 28464 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_08330 30762 30100 gene locus_tag LOCUS_08340 gene gldF 30762 30100 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_08340 31482 30955 gene locus_tag LOCUS_08350 gene yoaA 31482 30955 CDS product putative N-acetyltransferase YoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34569 protein_id gnl|my_center|LOCUS_08350 31782 31486 gene locus_tag LOCUS_08360 gene fjo15 31782 31486 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_08360 32647 31787 gene locus_tag LOCUS_08370 gene fjo14 32647 31787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_08370 32776 33729 gene locus_tag LOCUS_08380 gene phoH 32776 33729 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_08380 33818 34762 gene locus_tag LOCUS_08390 gene purC 33818 34762 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_08390 34762 35244 gene locus_tag LOCUS_08400 34762 35244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 protein_id gnl|my_center|LOCUS_08400 35237 35608 gene locus_tag LOCUS_08410 35237 35608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 36381 35815 gene locus_tag LOCUS_08420 36381 35815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_08420 37326 36535 gene locus_tag LOCUS_08430 37326 36535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 protein_id gnl|my_center|LOCUS_08430 37479 39131 gene locus_tag LOCUS_08440 37479 39131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 39899 39132 gene locus_tag LOCUS_08450 39899 39132 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX9 protein_id gnl|my_center|LOCUS_08450 39984 40241 gene locus_tag LOCUS_08460 39984 40241 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_08460 40252 41937 gene locus_tag LOCUS_08470 40252 41937 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence016 186 1079 gene locus_tag LOCUS_08480 186 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_08480 1291 2241 gene locus_tag LOCUS_08490 1291 2241 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207526.1 protein_id gnl|my_center|LOCUS_08490 3192 2257 gene locus_tag LOCUS_08500 3192 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762383.1 protein_id gnl|my_center|LOCUS_08500 3193 4128 gene locus_tag LOCUS_08510 3193 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104214.1 protein_id gnl|my_center|LOCUS_08510 5247 4129 gene locus_tag LOCUS_08520 5247 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6850 5252 gene locus_tag LOCUS_08530 6850 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104215.1 protein_id gnl|my_center|LOCUS_08530 7595 6843 gene locus_tag LOCUS_08540 7595 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104212.1 protein_id gnl|my_center|LOCUS_08540 8659 7616 gene locus_tag LOCUS_08550 8659 7616 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_08550 10108 9029 gene locus_tag LOCUS_08560 10108 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_08560 11053 10247 gene locus_tag LOCUS_08570 11053 10247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 11600 11040 gene locus_tag LOCUS_08580 11600 11040 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_08580 11921 13663 gene locus_tag LOCUS_08590 11921 13663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 16170 13750 gene locus_tag LOCUS_08600 gene priA 16170 13750 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_08600 16282 17160 gene locus_tag LOCUS_08610 gene lipZ 16282 17160 CDS product putative hydrolase LipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLR1 protein_id gnl|my_center|LOCUS_08610 17163 18050 gene locus_tag LOCUS_08620 17163 18050 CDS product putative hydrolase, alpha/beta fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705027.1 protein_id gnl|my_center|LOCUS_08620 18109 18969 gene locus_tag LOCUS_08630 gene lipZ 18109 18969 CDS product putative hydrolase LipZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLR1 protein_id gnl|my_center|LOCUS_08630 20441 19230 gene locus_tag LOCUS_08640 20441 19230 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_08640 20552 21277 gene locus_tag LOCUS_08650 20552 21277 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_08650 21274 21951 gene locus_tag LOCUS_08660 21274 21951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_08660 24546 22363 gene locus_tag LOCUS_08670 gene recQ1 24546 22363 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_08670 24684 25652 gene locus_tag LOCUS_08680 gene kdsD 24684 25652 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_08680 25652 26473 gene locus_tag LOCUS_08690 gene tatC 25652 26473 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_08690 26457 26804 gene locus_tag LOCUS_08700 26457 26804 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_08700 26939 27682 gene locus_tag LOCUS_08710 gene lptB 26939 27682 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_08710 28890 27679 gene locus_tag LOCUS_08720 28890 27679 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268185.1 protein_id gnl|my_center|LOCUS_08720 29626 28910 gene locus_tag LOCUS_08730 gene pssA 29626 28910 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_08730 29802 30704 gene locus_tag LOCUS_08740 29802 30704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_08740 30777 31847 gene locus_tag LOCUS_08750 30777 31847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 protein_id gnl|my_center|LOCUS_08750 31853 33022 gene locus_tag LOCUS_08760 31853 33022 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 protein_id gnl|my_center|LOCUS_08760 33182 34864 gene locus_tag LOCUS_08770 33182 34864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 35242 35466 gene locus_tag LOCUS_08780 35242 35466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 35874 35461 gene locus_tag LOCUS_08790 gene aroQ 35874 35461 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_08790 35961 36431 gene locus_tag LOCUS_08800 35961 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 36501 37397 gene locus_tag LOCUS_08810 gene xerD 36501 37397 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_08810 39187 37619 gene locus_tag LOCUS_08820 gene rny 39187 37619 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_08820 39705 39415 gene locus_tag LOCUS_08830 39705 39415 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_08830 40009 39719 gene locus_tag LOCUS_08840 40009 39719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_08840 40161 41864 gene locus_tag LOCUS_08850 40161 41864 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence017 3529 203 gene locus_tag LOCUS_08860 gene fpp1 3529 203 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_08860 3597 4301 gene locus_tag LOCUS_08870 gene lipB 3597 4301 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_08870 5415 4363 gene locus_tag LOCUS_08880 5415 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_08880 6224 5625 gene locus_tag LOCUS_08890 gene rnhB 6224 5625 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_08890 6326 8296 gene locus_tag LOCUS_08900 6326 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_08900 9045 8605 gene locus_tag LOCUS_08910 9045 8605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 10531 9047 gene locus_tag LOCUS_08920 10531 9047 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_08920 10612 11634 gene locus_tag LOCUS_08930 10612 11634 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_08930 12937 11738 gene locus_tag LOCUS_08940 12937 11738 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_08940 13093 13551 gene locus_tag LOCUS_08950 13093 13551 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_08950 15716 13716 gene locus_tag LOCUS_08960 15716 13716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 17545 15722 gene locus_tag LOCUS_08970 17545 15722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 18517 17882 gene locus_tag LOCUS_08980 18517 17882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 19098 18646 gene locus_tag LOCUS_08990 gene dtd 19098 18646 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650H8 protein_id gnl|my_center|LOCUS_08990 20067 19102 gene locus_tag LOCUS_09000 gene rsgA 20067 19102 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_09000 21346 20264 gene locus_tag LOCUS_09010 21346 20264 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_09010 22218 21367 gene locus_tag LOCUS_09020 gene tyrA 22218 21367 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_09020 23378 22236 gene locus_tag LOCUS_09030 gene aspC3 23378 22236 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_09030 24202 23375 gene locus_tag LOCUS_09040 gene pheA 24202 23375 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_09040 24664 25746 gene locus_tag LOCUS_09050 24664 25746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_09050 26467 26393 gene locus_tag LOCUS_t00110 26467 26393 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 27441 26521 gene locus_tag LOCUS_09060 27441 26521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_09060 30007 27443 gene locus_tag LOCUS_09070 30007 27443 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_09070 30409 30092 gene locus_tag LOCUS_09080 30409 30092 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_09080 30964 30635 gene locus_tag LOCUS_09090 30964 30635 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_09090 32441 31221 gene locus_tag LOCUS_09100 32441 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 36338 32937 gene locus_tag LOCUS_09110 36338 32937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 36881 36432 gene locus_tag LOCUS_09120 36881 36432 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_09120 38201 36894 gene locus_tag LOCUS_09130 gene metY 38201 36894 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_09130 38902 40158 gene locus_tag LOCUS_09140 gene metK 38902 40158 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_09140 >Feature sequence018 1304 789 gene locus_tag LOCUS_09150 1304 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1564 2028 gene locus_tag LOCUS_09160 1564 2028 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704876.1 protein_id gnl|my_center|LOCUS_09160 2685 2308 gene locus_tag LOCUS_09170 2685 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3009 3902 gene locus_tag LOCUS_09180 3009 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 5844 4450 gene locus_tag LOCUS_09190 gene mnmE 5844 4450 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_09190 5945 6283 gene locus_tag LOCUS_09200 5945 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_09200 6948 6514 gene locus_tag LOCUS_09210 6948 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_09210 7582 7001 gene locus_tag LOCUS_09220 gene miaE 7582 7001 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_09220 9777 7588 gene locus_tag LOCUS_09230 9777 7588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 10611 9778 gene locus_tag LOCUS_09240 10611 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 10740 12569 gene locus_tag LOCUS_09250 10740 12569 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481446.1 protein_id gnl|my_center|LOCUS_09250 14325 12637 gene locus_tag LOCUS_09260 14325 12637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 14601 15194 gene locus_tag LOCUS_09270 gene msrA1 14601 15194 CDS product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK0 protein_id gnl|my_center|LOCUS_09270 16168 15386 gene locus_tag LOCUS_09280 16168 15386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 17047 16529 gene locus_tag LOCUS_09290 17047 16529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 18027 17107 gene locus_tag LOCUS_09300 gene miaA 18027 17107 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 protein_id gnl|my_center|LOCUS_09300 18854 18027 gene locus_tag LOCUS_09310 18854 18027 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_09310 21003 19126 gene locus_tag LOCUS_09320 21003 19126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 22282 21200 gene locus_tag LOCUS_09330 22282 21200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 22977 22306 gene locus_tag LOCUS_09340 22977 22306 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_09340 24205 22967 gene locus_tag LOCUS_09350 24205 22967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_09350 25159 24209 gene locus_tag LOCUS_09360 gene serA 25159 24209 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_09360 26285 25221 gene locus_tag LOCUS_09370 gene serC 26285 25221 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_09370 27395 26334 gene locus_tag LOCUS_09380 27395 26334 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_09380 27466 27813 gene locus_tag LOCUS_09390 gene fdx1 27466 27813 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_09390 30635 28011 gene locus_tag LOCUS_09400 30635 28011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_09400 31714 30971 gene locus_tag LOCUS_09410 31714 30971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 34526 31824 gene locus_tag LOCUS_09420 34526 31824 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_09420 37619 34683 gene locus_tag LOCUS_09430 37619 34683 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962806.1 protein_id gnl|my_center|LOCUS_09430 38629 37640 gene locus_tag LOCUS_09440 38629 37640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 39264 38701 gene locus_tag LOCUS_09450 39264 38701 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_09450 39386 40483 gene locus_tag LOCUS_09460 gene engD 39386 40483 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_09460 >Feature sequence019 <1 895 gene locus_tag LOCUS_09470 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX82:prolipoprotein diacylglyceryl transferase 885 1211 gene locus_tag LOCUS_09480 885 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_09480 1489 1238 gene locus_tag LOCUS_09490 1489 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_09490 1583 2209 gene locus_tag LOCUS_09500 1583 2209 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_09500 2263 3081 gene locus_tag LOCUS_09510 2263 3081 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_09510 3410 4216 gene locus_tag LOCUS_09520 gene proC 3410 4216 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_09520 6698 4485 gene locus_tag LOCUS_09530 6698 4485 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_09530 8962 6854 gene locus_tag LOCUS_09540 8962 6854 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_09540 9487 8990 gene locus_tag LOCUS_09550 9487 8990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 10324 9518 gene locus_tag LOCUS_09560 10324 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 11173 10400 gene locus_tag LOCUS_09570 11173 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 11819 11292 gene locus_tag LOCUS_09580 11819 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 11883 12584 gene locus_tag LOCUS_09590 gene pepE 11883 12584 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_09590 13767 12622 gene locus_tag LOCUS_09600 gene ribBA 13767 12622 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_09600 15131 13764 gene locus_tag LOCUS_09610 15131 13764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 protein_id gnl|my_center|LOCUS_09610 15933 15277 gene locus_tag LOCUS_09620 gene lolA 15933 15277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_09620 18383 15936 gene locus_tag LOCUS_09630 gene ftsK 18383 15936 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_09630 18799 18419 gene locus_tag LOCUS_09640 gene dgkA 18799 18419 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 protein_id gnl|my_center|LOCUS_09640 19298 18801 gene locus_tag LOCUS_09650 gene tpx 19298 18801 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 protein_id gnl|my_center|LOCUS_09650 19426 20817 gene locus_tag LOCUS_09660 gene norM 19426 20817 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_09660 20923 21147 gene locus_tag LOCUS_09670 20923 21147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_09670 21860 21363 gene locus_tag LOCUS_09680 21860 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 23172 22117 gene locus_tag LOCUS_09690 23172 22117 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_09690 23958 23242 gene locus_tag LOCUS_09700 23958 23242 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_09700 24747 24094 gene locus_tag LOCUS_09710 24747 24094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 24662 25108 gene locus_tag LOCUS_09720 24662 25108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 25746 25168 gene locus_tag LOCUS_09730 25746 25168 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_09730 25951 26736 gene locus_tag LOCUS_09740 25951 26736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 27214 26741 gene locus_tag LOCUS_09750 gene rlmH 27214 26741 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_09750 27367 28224 gene locus_tag LOCUS_09760 gene nadC 27367 28224 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_09760 28302 28874 gene locus_tag LOCUS_09770 28302 28874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_09770 28871 29344 gene locus_tag LOCUS_09780 28871 29344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 29386 30333 gene locus_tag LOCUS_09790 gene yfkH 29386 30333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_09790 30465 31829 gene locus_tag LOCUS_09800 gene hisS 30465 31829 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_09800 32022 32690 gene locus_tag LOCUS_09810 gene folE2 32022 32690 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_09810 36257 32916 gene locus_tag LOCUS_09820 gene secA 36257 32916 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_09820 36628 36407 gene locus_tag LOCUS_09830 36628 36407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_09830 37371 36796 gene locus_tag LOCUS_09840 37371 36796 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_09840 37924 37430 gene locus_tag LOCUS_09850 37924 37430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 39159 37924 gene locus_tag LOCUS_09860 gene hutI 39159 37924 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_09860 39165 39719 gene locus_tag LOCUS_09870 39165 39719 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_09870 39867 40259 gene locus_tag LOCUS_09880 39867 40259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962736.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence020 1524 394 gene locus_tag LOCUS_09890 gene dnaJ 1524 394 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_09890 2218 1670 gene locus_tag LOCUS_09900 gene grpE 2218 1670 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_09900 3635 2325 gene locus_tag LOCUS_09910 gene murA 3635 2325 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_09910 4301 3639 gene locus_tag LOCUS_09920 4301 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_09920 6764 4443 gene locus_tag LOCUS_09930 gene uvrD 6764 4443 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_09930 7002 7616 gene locus_tag LOCUS_09940 7002 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 7619 8338 gene locus_tag LOCUS_09950 7619 8338 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836846.1 protein_id gnl|my_center|LOCUS_09950 8342 8854 gene locus_tag LOCUS_09960 8342 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_09960 10853 8910 gene locus_tag LOCUS_09970 gene btuB 10853 8910 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FP11 protein_id gnl|my_center|LOCUS_09970 11229 12365 gene locus_tag LOCUS_09980 11229 12365 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_09980 13108 12419 gene locus_tag LOCUS_09990 gene racD 13108 12419 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207167.1 protein_id gnl|my_center|LOCUS_09990 13440 13105 gene locus_tag LOCUS_10000 13440 13105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 16199 13443 gene locus_tag LOCUS_10010 gene parC 16199 13443 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_10010 18137 16278 gene locus_tag LOCUS_10020 gene parE 18137 16278 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_10020 18314 19597 gene locus_tag LOCUS_10030 18314 19597 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_10030 19678 20190 gene locus_tag LOCUS_10040 19678 20190 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_10040 20283 22406 gene locus_tag LOCUS_10050 20283 22406 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_10050 22556 24889 gene locus_tag LOCUS_10060 gene topB 22556 24889 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DB3 protein_id gnl|my_center|LOCUS_10060 25093 26019 gene locus_tag LOCUS_10070 25093 26019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 26134 26706 gene locus_tag LOCUS_10080 26134 26706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 26951 26730 gene locus_tag LOCUS_10090 26951 26730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_10090 27617 26952 gene locus_tag LOCUS_10100 27617 26952 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042743.1 protein_id gnl|my_center|LOCUS_10100 29257 27617 gene locus_tag LOCUS_10110 gene pepP 29257 27617 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001290092.1 protein_id gnl|my_center|LOCUS_10110 29427 30512 gene locus_tag LOCUS_10120 gene gcvT 29427 30512 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_10120 30643 31356 gene locus_tag LOCUS_10130 30643 31356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_10130 31528 32643 gene locus_tag LOCUS_10140 31528 32643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963180.1 protein_id gnl|my_center|LOCUS_10140 33016 32831 gene locus_tag LOCUS_10150 33016 32831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 32973 33278 gene locus_tag LOCUS_10160 32973 33278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 33543 33719 gene locus_tag LOCUS_10170 33543 33719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 33750 33986 gene locus_tag LOCUS_10180 33750 33986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 34196 34810 gene locus_tag LOCUS_10190 34196 34810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246043.1 protein_id gnl|my_center|LOCUS_10190 36097 34946 gene locus_tag LOCUS_10200 36097 34946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 37307 36048 gene locus_tag LOCUS_10210 37307 36048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 38580 37393 gene locus_tag LOCUS_10220 38580 37393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_10220 <39585 38641 gene locus_tag LOCUS_10230 <39585 38641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC6:ribosome-binding ATPase YchF >Feature sequence021 484 2472 gene locus_tag LOCUS_10240 gene uvrB 484 2472 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_10240 2523 3698 gene locus_tag LOCUS_10250 2523 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 3731 4336 gene locus_tag LOCUS_10260 3731 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4987 4424 gene locus_tag LOCUS_10270 4987 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070688.1 protein_id gnl|my_center|LOCUS_10270 6332 5133 gene locus_tag LOCUS_10280 gene sucC 6332 5133 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_10280 6653 9082 gene locus_tag LOCUS_10290 6653 9082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 9168 9827 gene locus_tag LOCUS_10300 gene lolD 9168 9827 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_10300 9837 10601 gene locus_tag LOCUS_10310 9837 10601 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_10310 10671 12155 gene locus_tag LOCUS_10320 10671 12155 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_10320 12167 14116 gene locus_tag LOCUS_10330 12167 14116 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_10330 14113 15369 gene locus_tag LOCUS_10340 gene pyrC2 14113 15369 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_10340 15376 15702 gene locus_tag LOCUS_10350 15376 15702 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_10350 15731 16369 gene locus_tag LOCUS_10360 15731 16369 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_10360 17536 16754 gene locus_tag LOCUS_10370 gene phnP 17536 16754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_10370 17612 19060 gene locus_tag LOCUS_10380 17612 19060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_10380 19111 19659 gene locus_tag LOCUS_10390 19111 19659 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_10390 19691 20227 gene locus_tag LOCUS_10400 19691 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 20255 20716 gene locus_tag LOCUS_10410 20255 20716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_10410 21036 20752 gene locus_tag LOCUS_10420 21036 20752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 21340 21080 gene locus_tag LOCUS_10430 21340 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_10430 22010 21381 gene locus_tag LOCUS_10440 22010 21381 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787873.1 protein_id gnl|my_center|LOCUS_10440 22711 22007 gene locus_tag LOCUS_10450 22711 22007 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_10450 23446 22715 gene locus_tag LOCUS_10460 gene kdsB 23446 22715 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_10460 24428 23451 gene locus_tag LOCUS_10470 gene manA 24428 23451 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_10470 25074 24661 gene locus_tag LOCUS_10480 gene ygcM 25074 24661 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_10480 25629 25105 gene locus_tag LOCUS_10490 gene idi 25629 25105 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_10490 25752 26450 gene locus_tag LOCUS_10500 25752 26450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 27745 26543 gene locus_tag LOCUS_10510 27745 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_10510 28248 27766 gene locus_tag LOCUS_10520 28248 27766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 28362 29954 gene locus_tag LOCUS_10530 gene prfC 28362 29954 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_10530 29960 31546 gene locus_tag LOCUS_10540 29960 31546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 31603 32532 gene locus_tag LOCUS_10550 gene ppiC 31603 32532 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_10550 32749 34434 gene locus_tag LOCUS_10560 32749 34434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 34445 36133 gene locus_tag LOCUS_10570 34445 36133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 36617 36462 gene locus_tag LOCUS_10580 36617 36462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence022 138 956 gene locus_tag LOCUS_10590 gene panB 138 956 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_10590 1049 1987 gene locus_tag LOCUS_10600 1049 1987 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_10600 2385 2783 gene locus_tag LOCUS_10610 2385 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_10610 3784 2927 gene locus_tag LOCUS_10620 3784 2927 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_10620 5708 3831 gene locus_tag LOCUS_10630 gene mnmG 5708 3831 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_10630 6167 5754 gene locus_tag LOCUS_10640 gene ybeY 6167 5754 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_10640 9549 6169 gene locus_tag LOCUS_10650 9549 6169 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_10650 9663 10502 gene locus_tag LOCUS_10660 9663 10502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 10600 12120 gene locus_tag LOCUS_10670 gene gltX 10600 12120 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_10670 12125 12688 gene locus_tag LOCUS_10680 12125 12688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 12846 13772 gene locus_tag LOCUS_10690 12846 13772 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_10690 14098 14973 gene locus_tag LOCUS_10700 14098 14973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 15358 15170 gene locus_tag LOCUS_10710 15358 15170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 16113 15424 gene locus_tag LOCUS_10720 16113 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 18429 16198 gene locus_tag LOCUS_10730 gene rnr 18429 16198 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_10730 18542 19453 gene locus_tag LOCUS_10740 18542 19453 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_10740 20357 20791 gene locus_tag LOCUS_10750 gene rpiB 20357 20791 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_10750 20878 21318 gene locus_tag LOCUS_10760 gene elaA 20878 21318 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_10760 23852 21321 gene locus_tag LOCUS_10770 23852 21321 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_10770 24756 23842 gene locus_tag LOCUS_10780 24756 23842 CDS product sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107954.1 protein_id gnl|my_center|LOCUS_10780 25313 24804 gene locus_tag LOCUS_10790 25313 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 25496 26542 gene locus_tag LOCUS_10800 25496 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 26644 27453 gene locus_tag LOCUS_10810 26644 27453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 27472 28059 gene locus_tag LOCUS_10820 27472 28059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790695.1 protein_id gnl|my_center|LOCUS_10820 28694 28122 gene locus_tag LOCUS_10830 28694 28122 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_10830 29496 28696 gene locus_tag LOCUS_10840 29496 28696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 29600 30607 gene locus_tag LOCUS_10850 gene recA 29600 30607 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_10850 30683 31219 gene locus_tag LOCUS_10860 30683 31219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 31654 31223 gene locus_tag LOCUS_10870 gene dut 31654 31223 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_10870 31747 32745 gene locus_tag LOCUS_10880 gene gpsA 31747 32745 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_10880 32789 33448 gene locus_tag LOCUS_10890 32789 33448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 33452 34720 gene locus_tag LOCUS_10900 gene entS 33452 34720 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence023 <1 689 gene locus_tag LOCUS_10910 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1S7:protein RecA 764 1300 gene locus_tag LOCUS_10920 764 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1728 1297 gene locus_tag LOCUS_10930 gene dut 1728 1297 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_10930 1825 2820 gene locus_tag LOCUS_10940 gene gpsA 1825 2820 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_10940 2864 3523 gene locus_tag LOCUS_10950 2864 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3528 4796 gene locus_tag LOCUS_10960 gene entS 3528 4796 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_10960 4851 6188 gene locus_tag LOCUS_10970 4851 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201886.1 protein_id gnl|my_center|LOCUS_10970 8068 6422 gene locus_tag LOCUS_10980 gene glpD 8068 6422 CDS product aerobic glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P18158 protein_id gnl|my_center|LOCUS_10980 8371 8778 gene locus_tag LOCUS_10990 8371 8778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 9215 12463 gene locus_tag LOCUS_11000 9215 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 12677 12513 gene locus_tag LOCUS_11010 12677 12513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 13414 12743 gene locus_tag LOCUS_11020 13414 12743 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_11020 14088 13411 gene locus_tag LOCUS_11030 14088 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 15109 14453 gene locus_tag LOCUS_11040 15109 14453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 16703 15219 gene locus_tag LOCUS_11050 gene glpK2 16703 15219 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BQ0 protein_id gnl|my_center|LOCUS_11050 16784 18259 gene locus_tag LOCUS_11060 16784 18259 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_11060 18716 18321 gene locus_tag LOCUS_11070 18716 18321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962302.1 protein_id gnl|my_center|LOCUS_11070 18984 18727 gene locus_tag LOCUS_11080 18984 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 20003 18984 gene locus_tag LOCUS_11090 gene pheS 20003 18984 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_11090 20201 21556 gene locus_tag LOCUS_11100 gene gdhA 20201 21556 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_11100 21664 22278 gene locus_tag LOCUS_11110 21664 22278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 22286 23125 gene locus_tag LOCUS_11120 22286 23125 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583927.1 protein_id gnl|my_center|LOCUS_11120 23252 24334 gene locus_tag LOCUS_11130 gene dinB2 23252 24334 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_11130 24346 24798 gene locus_tag LOCUS_11140 24346 24798 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965852.1 protein_id gnl|my_center|LOCUS_11140 24799 25908 gene locus_tag LOCUS_11150 24799 25908 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_11150 25913 27049 gene locus_tag LOCUS_11160 25913 27049 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_11160 27049 27768 gene locus_tag LOCUS_11170 27049 27768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889586.1 protein_id gnl|my_center|LOCUS_11170 27717 28856 gene locus_tag LOCUS_11180 27717 28856 CDS product chalcone synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404147.1 protein_id gnl|my_center|LOCUS_11180 28850 29647 gene locus_tag LOCUS_11190 28850 29647 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_11190 29650 30102 gene locus_tag LOCUS_11200 29650 30102 CDS product beta-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770367.1 protein_id gnl|my_center|LOCUS_11200 30123 31409 gene locus_tag LOCUS_11210 30123 31409 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770365.1 protein_id gnl|my_center|LOCUS_11210 31378 31665 gene locus_tag LOCUS_11220 31378 31665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 31665 32231 gene locus_tag LOCUS_11230 31665 32231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 32244 32789 gene locus_tag LOCUS_11240 32244 32789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 32770 33228 gene locus_tag LOCUS_11250 32770 33228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence024 <1 619 gene locus_tag LOCUS_11260 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0P5:primosomal protein N' 847 1302 gene locus_tag LOCUS_11270 847 1302 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_11270 1289 2128 gene locus_tag LOCUS_11280 1289 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2206 3243 gene locus_tag LOCUS_11290 2206 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_11290 3566 3907 gene locus_tag LOCUS_11300 gene rpsF 3566 3907 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_11300 3911 4207 gene locus_tag LOCUS_11310 gene rpsR 3911 4207 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_11310 4222 4668 gene locus_tag LOCUS_11320 gene rplI 4222 4668 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_11320 4779 7943 gene locus_tag LOCUS_11330 4779 7943 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765900.1 protein_id gnl|my_center|LOCUS_11330 8005 8472 gene locus_tag LOCUS_11340 8005 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_11340 8649 9062 gene locus_tag LOCUS_11350 8649 9062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_11350 9064 9606 gene locus_tag LOCUS_11360 gene hnoX 9064 9606 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 protein_id gnl|my_center|LOCUS_11360 9701 10840 gene locus_tag LOCUS_11370 9701 10840 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_11370 10840 11886 gene locus_tag LOCUS_11380 10840 11886 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963164.1 protein_id gnl|my_center|LOCUS_11380 11889 12212 gene locus_tag LOCUS_11390 11889 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 12217 12921 gene locus_tag LOCUS_11400 12217 12921 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_11400 13279 13557 gene locus_tag LOCUS_11410 13279 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 14269 13583 gene locus_tag LOCUS_11420 gene npdA 14269 13583 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_11420 14398 15075 gene locus_tag LOCUS_11430 gene trmH 14398 15075 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_11430 15572 15204 gene locus_tag LOCUS_11440 15572 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 16817 15621 gene locus_tag LOCUS_11450 gene ald 16817 15621 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_11450 17232 16825 gene locus_tag LOCUS_11460 17232 16825 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_11460 17855 17475 gene locus_tag LOCUS_11470 17855 17475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 19443 17896 gene locus_tag LOCUS_11480 gene porX 19443 17896 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_11480 19575 20798 gene locus_tag LOCUS_11490 19575 20798 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_11490 20844 21875 gene locus_tag LOCUS_11500 gene lpxD 20844 21875 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_11500 21878 23269 gene locus_tag LOCUS_11510 gene fabZ 21878 23269 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_11510 23273 24058 gene locus_tag LOCUS_11520 gene lpxA 23273 24058 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_11520 24118 24684 gene locus_tag LOCUS_11530 gene efp 24118 24684 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_11530 24703 25284 gene locus_tag LOCUS_11540 24703 25284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 25289 26215 gene locus_tag LOCUS_11550 25289 26215 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_11550 26276 27148 gene locus_tag LOCUS_11560 gene sucD 26276 27148 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_11560 27259 28005 gene locus_tag LOCUS_11570 27259 28005 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_11570 29569 28061 gene locus_tag LOCUS_11580 29569 28061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 29757 31748 gene locus_tag LOCUS_11590 29757 31748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence025 2051 393 gene locus_tag LOCUS_11600 2051 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3469 2054 gene locus_tag LOCUS_11610 3469 2054 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_11610 6952 3476 gene locus_tag LOCUS_11620 6952 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 8915 6960 gene locus_tag LOCUS_11630 gene susA 8915 6960 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_11630 11233 8927 gene locus_tag LOCUS_11640 11233 8927 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_11640 11967 11314 gene locus_tag LOCUS_11650 gene pgmB2 11967 11314 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_11650 13303 11972 gene locus_tag LOCUS_11660 13303 11972 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_11660 14508 13486 gene locus_tag LOCUS_11670 14508 13486 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_11670 14707 17619 gene locus_tag LOCUS_11680 14707 17619 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_11680 17634 19523 gene locus_tag LOCUS_11690 17634 19523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 19535 20857 gene locus_tag LOCUS_11700 19535 20857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 20919 23705 gene locus_tag LOCUS_11710 20919 23705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 25453 23771 gene locus_tag LOCUS_11720 25453 23771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 26753 26277 gene locus_tag LOCUS_11730 26753 26277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 26873 27304 gene locus_tag LOCUS_11740 26873 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 27574 27501 gene locus_tag LOCUS_t00120 27574 27501 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27755 28639 gene locus_tag LOCUS_11750 gene era 27755 28639 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_11750 28798 30108 gene locus_tag LOCUS_11760 gene der 28798 30108 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_11760 30298 30744 gene locus_tag LOCUS_11770 30298 30744 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000935885.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence026 <1 2193 gene locus_tag LOCUS_11780 <1 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405453.1:glutaminyl-tRNA synthetase 2354 4057 gene locus_tag LOCUS_11790 2354 4057 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482972.1 protein_id gnl|my_center|LOCUS_11790 4609 5562 gene locus_tag LOCUS_11800 4609 5562 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97DM0 protein_id gnl|my_center|LOCUS_11800 6427 5564 gene locus_tag LOCUS_11810 6427 5564 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405402.1 protein_id gnl|my_center|LOCUS_11810 6375 6566 gene locus_tag LOCUS_11820 6375 6566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 8169 6538 gene locus_tag LOCUS_11830 8169 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 8276 8728 gene locus_tag LOCUS_11840 8276 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 9340 8825 gene locus_tag LOCUS_11850 9340 8825 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_11850 10417 9587 gene locus_tag LOCUS_11860 10417 9587 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_11860 11355 10414 gene locus_tag LOCUS_11870 gene acdS 11355 10414 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_11870 13361 11445 gene locus_tag LOCUS_11880 13361 11445 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_11880 13416 13790 gene locus_tag LOCUS_11890 13416 13790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_11890 14881 13835 gene locus_tag LOCUS_11900 gene fjo30 14881 13835 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_11900 15814 14960 gene locus_tag LOCUS_11910 gene gldN 15814 14960 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_11910 17369 15831 gene locus_tag LOCUS_11920 gene gldM 17369 15831 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_11920 18048 17413 gene locus_tag LOCUS_11930 gene gldL 18048 17413 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_11930 19444 18083 gene locus_tag LOCUS_11940 gene gldK 19444 18083 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_11940 20710 19550 gene locus_tag LOCUS_11950 gene fjo29 20710 19550 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_11950 23245 20747 gene locus_tag LOCUS_11960 gene topA 23245 20747 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_11960 23447 24901 gene locus_tag LOCUS_11970 gene miaB 23447 24901 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_11970 24990 26213 gene locus_tag LOCUS_11980 24990 26213 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_11980 26252 26758 gene locus_tag LOCUS_11990 26252 26758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_11990 26752 27498 gene locus_tag LOCUS_12000 26752 27498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_12000 27495 27827 gene locus_tag LOCUS_12010 27495 27827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 28006 28281 gene locus_tag LOCUS_12020 gene groS 28006 28281 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_12020 28377 30011 gene locus_tag LOCUS_12030 gene groL 28377 30011 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_12030 >Feature sequence027 544 1128 gene locus_tag LOCUS_12040 544 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_12040 1291 1707 gene locus_tag LOCUS_12050 1291 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2467 1850 gene locus_tag LOCUS_12060 gene recR 2467 1850 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_12060 2564 4000 gene locus_tag LOCUS_12070 2564 4000 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_12070 4584 9665 gene locus_tag LOCUS_12080 4584 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 9774 10244 gene locus_tag LOCUS_12090 9774 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 10225 10872 gene locus_tag LOCUS_12100 gene pdxH 10225 10872 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_12100 10904 11392 gene locus_tag LOCUS_12110 gene sixA 10904 11392 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_12110 11398 12294 gene locus_tag LOCUS_12120 gene ppx 11398 12294 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_12120 12445 13509 gene locus_tag LOCUS_12130 12445 13509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 14358 13870 gene locus_tag LOCUS_12140 14358 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 15546 14521 gene locus_tag LOCUS_12150 gene lpxK 15546 14521 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_12150 15600 16694 gene locus_tag LOCUS_12160 gene yqfO 15600 16694 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_12160 16697 17470 gene locus_tag LOCUS_12170 16697 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_12170 19445 17547 gene locus_tag LOCUS_12180 19445 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_12180 20312 19554 gene locus_tag LOCUS_12190 gene aroE 20312 19554 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_12190 21300 20293 gene locus_tag LOCUS_12200 21300 20293 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_12200 22224 21304 gene locus_tag LOCUS_12210 22224 21304 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 protein_id gnl|my_center|LOCUS_12210 22468 22920 gene locus_tag LOCUS_12220 22468 22920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 24758 23388 gene locus_tag LOCUS_12230 24758 23388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_12230 24981 25520 gene locus_tag LOCUS_12240 gene pyrR1 24981 25520 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_12240 25522 26451 gene locus_tag LOCUS_12250 gene pyrB 25522 26451 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_12250 26456 26788 gene locus_tag LOCUS_12260 26456 26788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 26799 27119 gene locus_tag LOCUS_12270 26799 27119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 27116 28030 gene locus_tag LOCUS_12280 gene rnz 27116 28030 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_12280 28405 28043 gene locus_tag LOCUS_12290 28405 28043 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence028 <1 1754 gene locus_tag LOCUS_12300 <1 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257457.1:histidine kinase 3940 1874 gene locus_tag LOCUS_12310 3940 1874 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 protein_id gnl|my_center|LOCUS_12310 4332 4736 gene locus_tag LOCUS_12320 4332 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4754 6310 gene locus_tag LOCUS_12330 4754 6310 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_12330 6499 7704 gene locus_tag LOCUS_12340 6499 7704 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_12340 7851 8531 gene locus_tag LOCUS_12350 gene trmD 7851 8531 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_12350 8521 10002 gene locus_tag LOCUS_12360 8521 10002 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 protein_id gnl|my_center|LOCUS_12360 10112 10465 gene locus_tag LOCUS_12370 gene rplS 10112 10465 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_12370 10779 10934 gene locus_tag LOCUS_12380 10779 10934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 11217 13436 gene locus_tag LOCUS_12390 11217 13436 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262307.1 protein_id gnl|my_center|LOCUS_12390 13574 15952 gene locus_tag LOCUS_12400 13574 15952 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_12400 15957 16787 gene locus_tag LOCUS_12410 15957 16787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_12410 16840 17652 gene locus_tag LOCUS_12420 gene murQ 16840 17652 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_12420 17649 17894 gene locus_tag LOCUS_12430 17649 17894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 17946 18953 gene locus_tag LOCUS_12440 17946 18953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 19348 20145 gene locus_tag LOCUS_12450 19348 20145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 22046 20355 gene locus_tag LOCUS_12460 22046 20355 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_12460 22279 22097 gene locus_tag LOCUS_12470 22279 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_12470 23390 22398 gene locus_tag LOCUS_12480 gene lpxD 23390 22398 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZZ4 protein_id gnl|my_center|LOCUS_12480 25454 23430 gene locus_tag LOCUS_12490 gene fadH1 25454 23430 CDS product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 protein_id gnl|my_center|LOCUS_12490 26508 25639 gene locus_tag LOCUS_12500 26508 25639 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097180.1 protein_id gnl|my_center|LOCUS_12500 27144 26632 gene locus_tag LOCUS_12510 27144 26632 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_12510 27414 27166 gene locus_tag LOCUS_12520 27414 27166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 27951 27418 gene locus_tag LOCUS_12530 27951 27418 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479525.1 protein_id gnl|my_center|LOCUS_12530 28346 27996 gene locus_tag LOCUS_12540 28346 27996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence029 <1 1438 gene locus_tag LOCUS_12550 <1 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107277.1:beta-N-acetylhexosaminidase 1521 2225 gene locus_tag LOCUS_12560 gene cutC 1521 2225 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Q87 protein_id gnl|my_center|LOCUS_12560 2218 4725 gene locus_tag LOCUS_12570 2218 4725 CDS product beta-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_12570 5715 4759 gene locus_tag LOCUS_12580 5715 4759 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_12580 7813 5813 gene locus_tag LOCUS_12590 7813 5813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 8791 7982 gene locus_tag LOCUS_12600 8791 7982 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_12600 10503 8851 gene locus_tag LOCUS_12610 gene recN 10503 8851 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_12610 11417 10563 gene locus_tag LOCUS_12620 11417 10563 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_12620 12738 11527 gene locus_tag LOCUS_12630 gene coaBC 12738 11527 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_12630 13058 12738 gene locus_tag LOCUS_12640 13058 12738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_12640 13949 13065 gene locus_tag LOCUS_12650 gene bamD 13949 13065 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_12650 14580 14068 gene locus_tag LOCUS_12660 14580 14068 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEB9 protein_id gnl|my_center|LOCUS_12660 15562 14687 gene locus_tag LOCUS_12670 gene dapA 15562 14687 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_12670 16186 15662 gene locus_tag LOCUS_12680 16186 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 17012 16323 gene locus_tag LOCUS_12690 17012 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963792.1 protein_id gnl|my_center|LOCUS_12690 20640 16990 gene locus_tag LOCUS_12700 20640 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402959.1 protein_id gnl|my_center|LOCUS_12700 21601 20714 gene locus_tag LOCUS_12710 21601 20714 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_12710 21754 22842 gene locus_tag LOCUS_12720 21754 22842 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_12720 22895 23437 gene locus_tag LOCUS_12730 22895 23437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 24243 23476 gene locus_tag LOCUS_12740 24243 23476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 26082 24316 gene locus_tag LOCUS_12750 26082 24316 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_12750 <27217 26237 gene locus_tag LOCUS_12760 <27217 26237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963090.1:acetyl-coenzyme A synthetase >Feature sequence030 101 1549 gene locus_tag LOCUS_12770 gene sufB 101 1549 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_12770 1624 2376 gene locus_tag LOCUS_12780 gene sufC 1624 2376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_12780 2480 3793 gene locus_tag LOCUS_12790 gene sufD 2480 3793 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_12790 3835 4077 gene locus_tag LOCUS_12800 3835 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5446 4124 gene locus_tag LOCUS_12810 5446 4124 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_12810 5511 6761 gene locus_tag LOCUS_12820 gene sufS 5511 6761 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_12820 8345 6837 gene locus_tag LOCUS_12830 8345 6837 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_12830 11200 8366 gene locus_tag LOCUS_12840 11200 8366 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_12840 11396 12328 gene locus_tag LOCUS_12850 gene ribF 11396 12328 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_12850 12388 13662 gene locus_tag LOCUS_12860 gene serS 12388 13662 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_12860 13864 13721 gene locus_tag LOCUS_12870 13864 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 14022 15797 gene locus_tag LOCUS_12880 14022 15797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_12880 15845 16174 gene locus_tag LOCUS_12890 15845 16174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_12890 16404 17336 gene locus_tag LOCUS_12900 gene rsmA 16404 17336 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_12900 17326 18675 gene locus_tag LOCUS_12910 gene mgtE 17326 18675 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_12910 19336 18728 gene locus_tag LOCUS_12920 19336 18728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 19488 20525 gene locus_tag LOCUS_12930 19488 20525 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_12930 21192 20641 gene locus_tag LOCUS_12940 21192 20641 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_12940 21293 23866 gene locus_tag LOCUS_12950 gene mutS 21293 23866 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_12950 24216 23995 gene locus_tag LOCUS_12960 24216 23995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 24628 24245 gene locus_tag LOCUS_12970 24628 24245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 25660 25130 gene locus_tag LOCUS_12980 25660 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 25959 26240 gene locus_tag LOCUS_12990 25959 26240 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence031 2929 452 gene locus_tag LOCUS_13000 2929 452 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_13000 3423 5057 gene locus_tag LOCUS_13010 gene bshC 3423 5057 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_13010 5057 5911 gene locus_tag LOCUS_13020 gene rlmF 5057 5911 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G2 protein_id gnl|my_center|LOCUS_13020 6510 5908 gene locus_tag LOCUS_13030 6510 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 7328 6558 gene locus_tag LOCUS_13040 7328 6558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 8052 7525 gene locus_tag LOCUS_13050 8052 7525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 10253 8073 gene locus_tag LOCUS_13060 10253 8073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 13256 10278 gene locus_tag LOCUS_13070 13256 10278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 14824 13277 gene locus_tag LOCUS_13080 14824 13277 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525350.1 protein_id gnl|my_center|LOCUS_13080 15952 14825 gene locus_tag LOCUS_13090 15952 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 17452 16064 gene locus_tag LOCUS_13100 gene lpdA2 17452 16064 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_13100 19416 17641 gene locus_tag LOCUS_13110 gene argS 19416 17641 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_13110 19505 20029 gene locus_tag LOCUS_13120 19505 20029 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_13120 21935 20172 gene locus_tag LOCUS_13130 21935 20172 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861711.1 protein_id gnl|my_center|LOCUS_13130 23173 21941 gene locus_tag LOCUS_13140 23173 21941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_13140 23295 24413 gene locus_tag LOCUS_13150 23295 24413 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence032 174 983 gene locus_tag LOCUS_13160 174 983 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_13160 2030 1077 gene locus_tag LOCUS_13170 2030 1077 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727427.1 protein_id gnl|my_center|LOCUS_13170 2926 2135 gene locus_tag LOCUS_13180 2926 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_13180 2986 4494 gene locus_tag LOCUS_13190 2986 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_13190 5433 4498 gene locus_tag LOCUS_13200 5433 4498 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_13200 6701 5658 gene locus_tag LOCUS_13210 gene rlmN 6701 5658 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_13210 7818 6769 gene locus_tag LOCUS_13220 gene queA 7818 6769 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_13220 9122 7893 gene locus_tag LOCUS_13230 gene aroA 9122 7893 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_13230 9190 12297 gene locus_tag LOCUS_13240 9190 12297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 12596 12348 gene locus_tag LOCUS_13250 12596 12348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 12922 12596 gene locus_tag LOCUS_13260 12922 12596 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_13260 13098 13655 gene locus_tag LOCUS_13270 13098 13655 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460612.1 protein_id gnl|my_center|LOCUS_13270 14474 13704 gene locus_tag LOCUS_13280 14474 13704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_13280 15299 14586 gene locus_tag LOCUS_13290 gene pdxJ 15299 14586 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_13290 15360 16019 gene locus_tag LOCUS_13300 15360 16019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_13300 16085 16984 gene locus_tag LOCUS_13310 gene nadK 16085 16984 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_13310 17092 17769 gene locus_tag LOCUS_13320 17092 17769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 17773 18516 gene locus_tag LOCUS_13330 gene uppS 17773 18516 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_13330 18524 21028 gene locus_tag LOCUS_13340 gene bamA 18524 21028 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_13340 21066 21923 gene locus_tag LOCUS_13350 gene skp 21066 21923 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964196.1 protein_id gnl|my_center|LOCUS_13350 21962 22492 gene locus_tag LOCUS_13360 21962 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 22558 23352 gene locus_tag LOCUS_13370 gene murI 22558 23352 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_13370 24332 23349 gene locus_tag LOCUS_13380 24332 23349 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_13380 <25220 24592 gene locus_tag LOCUS_13390 <25220 24592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202206.1:MFS transporter >Feature sequence033 353 2593 gene locus_tag LOCUS_13400 gene pnp 353 2593 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_13400 2697 3821 gene locus_tag LOCUS_13410 2697 3821 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_13410 4160 3825 gene locus_tag LOCUS_13420 gene gldC 4160 3825 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_13420 5119 4160 gene locus_tag LOCUS_13430 gene gldB 5119 4160 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_13430 5179 5967 gene locus_tag LOCUS_13440 gene nadE 5179 5967 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_13440 8281 6281 gene locus_tag LOCUS_13450 gene dnaG 8281 6281 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_13450 9641 8406 gene locus_tag LOCUS_13460 gene clpX 9641 8406 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_13460 10405 9743 gene locus_tag LOCUS_13470 gene clpP 10405 9743 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_13470 11901 10579 gene locus_tag LOCUS_13480 gene tig 11901 10579 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_13480 12117 12824 gene locus_tag LOCUS_13490 gene pyrH 12117 12824 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_13490 12852 13406 gene locus_tag LOCUS_13500 gene frr 12852 13406 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_13500 13498 15870 gene locus_tag LOCUS_13510 13498 15870 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_13510 16528 17256 gene locus_tag LOCUS_13520 16528 17256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 18314 17265 gene locus_tag LOCUS_13530 18314 17265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 18439 19872 gene locus_tag LOCUS_13540 gene asnS 18439 19872 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_13540 19873 21330 gene locus_tag LOCUS_13550 gene rpoN 19873 21330 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_13550 21330 21929 gene locus_tag LOCUS_13560 21330 21929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 22523 21924 gene locus_tag LOCUS_13570 22523 21924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_13570 23182 22715 gene locus_tag LOCUS_13580 23182 22715 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_13580 23825 23202 gene locus_tag LOCUS_13590 23825 23202 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_13590 24293 23829 gene locus_tag LOCUS_13600 24293 23829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 <25047 24302 gene locus_tag LOCUS_13610 <25047 24302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766463.1:flagellar motor protein MotA >Feature sequence034 495 2444 gene locus_tag LOCUS_13620 495 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2447 3709 gene locus_tag LOCUS_13630 2447 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861451.1 protein_id gnl|my_center|LOCUS_13630 4124 5317 gene locus_tag LOCUS_13640 4124 5317 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_13640 5409 6530 gene locus_tag LOCUS_13650 gene irpA 5409 6530 CDS product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 protein_id gnl|my_center|LOCUS_13650 7037 7975 gene locus_tag LOCUS_13660 7037 7975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 7953 10382 gene locus_tag LOCUS_13670 gene fecA 7953 10382 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_13670 10813 10619 gene locus_tag LOCUS_13680 10813 10619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 11322 12797 gene locus_tag LOCUS_13690 gene guaB 11322 12797 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_13690 12833 13708 gene locus_tag LOCUS_13700 12833 13708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 15186 14008 gene locus_tag LOCUS_13710 gene argD 15186 14008 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_13710 16822 15176 gene locus_tag LOCUS_13720 16822 15176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_13720 17381 17004 gene locus_tag LOCUS_13730 17381 17004 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098871.1 protein_id gnl|my_center|LOCUS_13730 18612 17407 gene locus_tag LOCUS_13740 18612 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_13740 19885 18881 gene locus_tag LOCUS_13750 19885 18881 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_13750 21062 19869 gene locus_tag LOCUS_13760 21062 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 21814 21104 gene locus_tag LOCUS_13770 21814 21104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 22780 21815 gene locus_tag LOCUS_13780 22780 21815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_13780 22803 23615 gene locus_tag LOCUS_13790 22803 23615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence035 627 1982 gene locus_tag LOCUS_13800 gene fjo17 627 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_13800 1996 2457 gene locus_tag LOCUS_13810 gene gldH 1996 2457 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_13810 2459 4729 gene locus_tag LOCUS_13820 gene mrcA 2459 4729 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_13820 4771 5472 gene locus_tag LOCUS_13830 gene atoD 4771 5472 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_13830 5475 6128 gene locus_tag LOCUS_13840 gene atoA 5475 6128 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_13840 6130 6351 gene locus_tag LOCUS_13850 6130 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 6353 6580 gene locus_tag LOCUS_13860 6353 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 6631 7392 gene locus_tag LOCUS_13870 gene xth 6631 7392 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_13870 7396 8919 gene locus_tag LOCUS_13880 gene mltD 7396 8919 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962200.1 protein_id gnl|my_center|LOCUS_13880 8924 9907 gene locus_tag LOCUS_13890 8924 9907 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_13890 10990 10022 gene locus_tag LOCUS_13900 gene trpS 10990 10022 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_13900 11182 11973 gene locus_tag LOCUS_13910 11182 11973 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_13910 11990 12583 gene locus_tag LOCUS_13920 11990 12583 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 protein_id gnl|my_center|LOCUS_13920 13182 12709 gene locus_tag LOCUS_13930 13182 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108881.1 protein_id gnl|my_center|LOCUS_13930 13269 15599 gene locus_tag LOCUS_13940 13269 15599 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_13940 15599 16321 gene locus_tag LOCUS_13950 gene recO 15599 16321 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_13950 16321 18804 gene locus_tag LOCUS_13960 16321 18804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_13960 19606 18794 gene locus_tag LOCUS_13970 19606 18794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 19953 19609 gene locus_tag LOCUS_13980 gene yfhL 19953 19609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31580 protein_id gnl|my_center|LOCUS_13980 20849 19977 gene locus_tag LOCUS_13990 gene tesB 20849 19977 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972544.1 protein_id gnl|my_center|LOCUS_13990 22026 20842 gene locus_tag LOCUS_14000 22026 20842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_14000 22423 23538 gene locus_tag LOCUS_14010 22423 23538 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455175.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence036 116 43 gene locus_tag LOCUS_t00130 116 43 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 235 726 gene locus_tag LOCUS_14020 gene aroK 235 726 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_14020 1221 718 gene locus_tag LOCUS_14030 gene pyrR2 1221 718 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_14030 1607 1218 gene locus_tag LOCUS_14040 1607 1218 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_14040 1687 2562 gene locus_tag LOCUS_14050 1687 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_14050 3243 2641 gene locus_tag LOCUS_14060 3243 2641 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108458.1 protein_id gnl|my_center|LOCUS_14060 4245 3292 gene locus_tag LOCUS_14070 gene tktC 4245 3292 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_14070 4972 4394 gene locus_tag LOCUS_14080 4972 4394 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_14080 5439 4972 gene locus_tag LOCUS_14090 gene smpB 5439 4972 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_14090 5545 6273 gene locus_tag LOCUS_14100 5545 6273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_14100 6856 6359 gene locus_tag LOCUS_14110 6856 6359 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_14110 7175 7567 gene locus_tag LOCUS_14120 gene ytxJ 7175 7567 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_14120 7627 9177 gene locus_tag LOCUS_14130 7627 9177 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_14130 10605 9247 gene locus_tag LOCUS_14140 10605 9247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 12177 10900 gene locus_tag LOCUS_14150 gene fahA 12177 10900 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_14150 12376 13650 gene locus_tag LOCUS_14160 gene glyA 12376 13650 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_14160 15077 13734 gene locus_tag LOCUS_14170 gene rmuC 15077 13734 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_14170 15119 15658 gene locus_tag LOCUS_14180 15119 15658 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947974.1 protein_id gnl|my_center|LOCUS_14180 16904 15663 gene locus_tag LOCUS_14190 gene pepT 16904 15663 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_14190 17461 16901 gene locus_tag LOCUS_14200 17461 16901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 18543 17500 gene locus_tag LOCUS_14210 18543 17500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_14210 18590 19510 gene locus_tag LOCUS_14220 18590 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 21056 19560 gene locus_tag LOCUS_14230 21056 19560 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_14230 22541 21060 gene locus_tag LOCUS_14240 22541 21060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 22696 23205 gene locus_tag LOCUS_14250 22696 23205 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_14250 23192 23626 gene locus_tag LOCUS_14260 23192 23626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 23668 24186 gene locus_tag LOCUS_14270 23668 24186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence037 814 287 gene locus_tag LOCUS_14280 gene ppa 814 287 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_14280 1969 992 gene locus_tag LOCUS_14290 gene pdhB 1969 992 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_14290 2186 2932 gene locus_tag LOCUS_14300 gene etfB 2186 2932 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_14300 3003 3986 gene locus_tag LOCUS_14310 gene etfA 3003 3986 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_14310 4163 4774 gene locus_tag LOCUS_14320 4163 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_14320 4778 6196 gene locus_tag LOCUS_14330 gene yeiM 4778 6196 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_14330 6345 7169 gene locus_tag LOCUS_14340 gene thyA 6345 7169 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_14340 7424 7918 gene locus_tag LOCUS_14350 gene dfrA 7424 7918 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_14350 8345 7911 gene locus_tag LOCUS_14360 8345 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 8446 9792 gene locus_tag LOCUS_14370 8446 9792 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_14370 9793 10350 gene locus_tag LOCUS_14380 gene tag 9793 10350 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964443.1 protein_id gnl|my_center|LOCUS_14380 10932 12923 gene locus_tag LOCUS_14390 10932 12923 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_14390 13289 13083 gene locus_tag LOCUS_14400 13289 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 13388 14116 gene locus_tag LOCUS_14410 13388 14116 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815942.1 protein_id gnl|my_center|LOCUS_14410 14157 14582 gene locus_tag LOCUS_14420 14157 14582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_14420 15237 14791 gene locus_tag LOCUS_14430 15237 14791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 15534 15301 gene locus_tag LOCUS_14440 15534 15301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_14440 16150 15527 gene locus_tag LOCUS_14450 16150 15527 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965038.1 protein_id gnl|my_center|LOCUS_14450 16261 16602 gene locus_tag LOCUS_14460 16261 16602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 16779 17834 gene locus_tag LOCUS_14470 16779 17834 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764715.1 protein_id gnl|my_center|LOCUS_14470 17824 18510 gene locus_tag LOCUS_14480 17824 18510 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817185.1 protein_id gnl|my_center|LOCUS_14480 18546 19625 gene locus_tag LOCUS_14490 gene mvaD 18546 19625 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_14490 19653 20147 gene locus_tag LOCUS_14500 19653 20147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 20204 21130 gene locus_tag LOCUS_14510 gene mvaK 20204 21130 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_14510 21141 22058 gene locus_tag LOCUS_14520 21141 22058 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_14520 22095 22982 gene locus_tag LOCUS_14530 22095 22982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 23061 23510 gene locus_tag LOCUS_14540 23061 23510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 23984 23523 gene locus_tag LOCUS_14550 23984 23523 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence038 1005 3476 gene locus_tag LOCUS_14560 gene lon 1005 3476 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_14560 3720 4532 gene locus_tag LOCUS_14570 3720 4532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5932 4622 gene locus_tag LOCUS_14580 5932 4622 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_14580 6982 6203 gene locus_tag LOCUS_14590 6982 6203 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_14590 7484 7062 gene locus_tag LOCUS_14600 7484 7062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 protein_id gnl|my_center|LOCUS_14600 8219 7629 gene locus_tag LOCUS_14610 gene def 8219 7629 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_14610 8681 8271 gene locus_tag LOCUS_14620 8681 8271 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_14620 8868 9683 gene locus_tag LOCUS_14630 gene dapD 8868 9683 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_14630 9697 10452 gene locus_tag LOCUS_14640 9697 10452 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_14640 11195 10449 gene locus_tag LOCUS_14650 11195 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 11995 11192 gene locus_tag LOCUS_14660 11995 11192 CDS product alpha-1,2-fucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056838.1 protein_id gnl|my_center|LOCUS_14660 12108 13520 gene locus_tag LOCUS_14670 gene cca 12108 13520 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_14670 13521 13916 gene locus_tag LOCUS_14680 13521 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701975.1 protein_id gnl|my_center|LOCUS_14680 15858 14032 gene locus_tag LOCUS_14690 gene msbA 15858 14032 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_14690 17573 15858 gene locus_tag LOCUS_14700 17573 15858 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_14700 18574 17618 gene locus_tag LOCUS_14710 18574 17618 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_14710 19185 18658 gene locus_tag LOCUS_14720 19185 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 19584 20390 gene locus_tag LOCUS_14730 19584 20390 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_14730 21409 20387 gene locus_tag LOCUS_14740 21409 20387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 21593 22246 gene locus_tag LOCUS_14750 gene tal 21593 22246 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_14750 22373 24031 gene locus_tag LOCUS_14760 gene menD 22373 24031 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_14760 >Feature sequence039 2165 309 gene locus_tag LOCUS_14770 gene glmS 2165 309 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_14770 3792 2197 gene locus_tag LOCUS_14780 3792 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 protein_id gnl|my_center|LOCUS_14780 4602 3793 gene locus_tag LOCUS_14790 4602 3793 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_14790 4700 5542 gene locus_tag LOCUS_14800 gene panC 4700 5542 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_14800 5576 5794 gene locus_tag LOCUS_14810 5576 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 5861 6805 gene locus_tag LOCUS_14820 5861 6805 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_14820 7002 8363 gene locus_tag LOCUS_14830 gene radA 7002 8363 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_14830 9303 8557 gene locus_tag LOCUS_14840 9303 8557 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_14840 10045 10767 gene locus_tag LOCUS_14850 10045 10767 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_14850 10929 12269 gene locus_tag LOCUS_14860 gene pyrC1 10929 12269 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_14860 12229 12726 gene locus_tag LOCUS_14870 12229 12726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 13717 12716 gene locus_tag LOCUS_14880 13717 12716 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_14880 13903 15195 gene locus_tag LOCUS_14890 gene tyrS 13903 15195 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_14890 15518 15324 gene locus_tag LOCUS_14900 15518 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 15717 15508 gene locus_tag LOCUS_14910 15717 15508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 16790 15816 gene locus_tag LOCUS_14920 16790 15816 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_14920 16948 17640 gene locus_tag LOCUS_14930 16948 17640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 17650 18051 gene locus_tag LOCUS_14940 17650 18051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 18098 18598 gene locus_tag LOCUS_14950 18098 18598 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_14950 18599 19912 gene locus_tag LOCUS_14960 18599 19912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 20034 20378 gene locus_tag LOCUS_14970 20034 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 20538 20882 gene locus_tag LOCUS_14980 20538 20882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 21928 20870 gene locus_tag LOCUS_14990 gene iaaA 21928 20870 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence040 <1 1715 gene locus_tag LOCUS_15000 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108753.1:DEAD/DEAH box helicase 3442 1976 gene locus_tag LOCUS_15010 3442 1976 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_15010 4406 3549 gene locus_tag LOCUS_15020 gene mvaB 4406 3549 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_15020 4491 5660 gene locus_tag LOCUS_15030 4491 5660 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 protein_id gnl|my_center|LOCUS_15030 6002 5652 gene locus_tag LOCUS_15040 6002 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 6049 6270 gene locus_tag LOCUS_15050 6049 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 7448 6414 gene locus_tag LOCUS_15060 gene pyrD 7448 6414 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_15060 10000 7574 gene locus_tag LOCUS_15070 gene pheT 10000 7574 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_15070 10204 11352 gene locus_tag LOCUS_15080 10204 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11462 13381 gene locus_tag LOCUS_15090 11462 13381 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268477.1 protein_id gnl|my_center|LOCUS_15090 13939 13370 gene locus_tag LOCUS_15100 13939 13370 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_15100 15092 13932 gene locus_tag LOCUS_15110 gene ppiB 15092 13932 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963994.1 protein_id gnl|my_center|LOCUS_15110 15821 15096 gene locus_tag LOCUS_15120 15821 15096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 16332 15826 gene locus_tag LOCUS_15130 16332 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 17377 16349 gene locus_tag LOCUS_15140 gene fjo19 17377 16349 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_15140 17500 17919 gene locus_tag LOCUS_15150 gene ndk 17500 17919 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_15150 18418 18122 gene locus_tag LOCUS_15160 18418 18122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_15160 19560 18481 gene locus_tag LOCUS_15170 gene recF 19560 18481 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_15170 19676 20440 gene locus_tag LOCUS_15180 19676 20440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_15180 20503 21009 gene locus_tag LOCUS_15190 gene ribH 20503 21009 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_15190 21155 21430 gene locus_tag LOCUS_15200 21155 21430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence041 455 1036 gene locus_tag LOCUS_15210 455 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 2684 1608 gene locus_tag LOCUS_15220 gene prfA 2684 1608 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_15220 4116 2944 gene locus_tag LOCUS_15230 4116 2944 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846900.1 protein_id gnl|my_center|LOCUS_15230 5506 4127 gene locus_tag LOCUS_15240 gene pntB 5506 4127 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNS8 protein_id gnl|my_center|LOCUS_15240 5811 5506 gene locus_tag LOCUS_15250 5811 5506 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325302.1 protein_id gnl|my_center|LOCUS_15250 6919 5822 gene locus_tag LOCUS_15260 gene pntA 6919 5822 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_15260 7447 6962 gene locus_tag LOCUS_15270 7447 6962 CDS product putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZUN7 protein_id gnl|my_center|LOCUS_15270 7490 7669 gene locus_tag LOCUS_15280 7490 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 10311 7765 gene locus_tag LOCUS_15290 10311 7765 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_15290 11676 10498 gene locus_tag LOCUS_15300 gene purM 11676 10498 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_15300 13070 11814 gene locus_tag LOCUS_15310 gene amaA 13070 11814 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038867.1 protein_id gnl|my_center|LOCUS_15310 15345 13162 gene locus_tag LOCUS_15320 gene glnA 15345 13162 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_15320 15511 16536 gene locus_tag LOCUS_15330 gene glnII 15511 16536 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_15330 17098 16613 gene locus_tag LOCUS_15340 17098 16613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_15340 19155 17167 gene locus_tag LOCUS_15350 gene hutU 19155 17167 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_15350 >Feature sequence042 867 436 gene locus_tag LOCUS_15360 867 436 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_15360 2330 891 gene locus_tag LOCUS_15370 gene gabD 2330 891 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367662.1 protein_id gnl|my_center|LOCUS_15370 3477 2350 gene locus_tag LOCUS_15380 3477 2350 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066962.1 protein_id gnl|my_center|LOCUS_15380 4610 3477 gene locus_tag LOCUS_15390 4610 3477 CDS product isovaleryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083842.1 protein_id gnl|my_center|LOCUS_15390 5810 4617 gene locus_tag LOCUS_15400 5810 4617 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_15400 6676 5846 gene locus_tag LOCUS_15410 6676 5846 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000969790.1 protein_id gnl|my_center|LOCUS_15410 7188 6688 gene locus_tag LOCUS_15420 gene nodN 7188 6688 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 protein_id gnl|my_center|LOCUS_15420 7959 7219 gene locus_tag LOCUS_15430 gene fabG 7959 7219 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z8P2 protein_id gnl|my_center|LOCUS_15430 8747 7992 gene locus_tag LOCUS_15440 8747 7992 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_15440 11554 8756 gene locus_tag LOCUS_15450 11554 8756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 12590 11565 gene locus_tag LOCUS_15460 12590 11565 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085668.1 protein_id gnl|my_center|LOCUS_15460 14255 12594 gene locus_tag LOCUS_15470 14255 12594 CDS product long-chain acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_15470 15755 14256 gene locus_tag LOCUS_15480 gene hapE 15755 14256 CDS product 4-hydroxyacetophenone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206172.1 protein_id gnl|my_center|LOCUS_15480 15913 16533 gene locus_tag LOCUS_15490 15913 16533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 18032 16617 gene locus_tag LOCUS_15500 18032 16617 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_15500 18152 18799 gene locus_tag LOCUS_15510 18152 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 18865 20046 gene locus_tag LOCUS_15520 18865 20046 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888067.1 protein_id gnl|my_center|LOCUS_15520 20185 21162 gene locus_tag LOCUS_15530 20185 21162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence043 172 870 gene locus_tag LOCUS_15540 gene phoP 172 870 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_15540 889 1929 gene locus_tag LOCUS_15550 gene phoR 889 1929 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_15550 3213 1939 gene locus_tag LOCUS_15560 gene purD 3213 1939 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_15560 4064 3327 gene locus_tag LOCUS_15570 4064 3327 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_15570 5422 4067 gene locus_tag LOCUS_15580 gene wcaJ 5422 4067 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_15580 6622 5456 gene locus_tag LOCUS_15590 6622 5456 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_15590 7494 6730 gene locus_tag LOCUS_15600 7494 6730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 8644 7475 gene locus_tag LOCUS_15610 8644 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 9366 8641 gene locus_tag LOCUS_15620 9366 8641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9506 9688 gene locus_tag LOCUS_15630 9506 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 10897 9893 gene locus_tag LOCUS_15640 10897 9893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 10854 11051 gene locus_tag LOCUS_15650 10854 11051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 12623 11682 gene locus_tag LOCUS_15660 12623 11682 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584122.1 protein_id gnl|my_center|LOCUS_15660 13289 12639 gene locus_tag LOCUS_15670 13289 12639 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162995.1 protein_id gnl|my_center|LOCUS_15670 13986 13291 gene locus_tag LOCUS_15680 13986 13291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 14851 13970 gene locus_tag LOCUS_15690 14851 13970 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_15690 15638 14853 gene locus_tag LOCUS_15700 gene hpcH 15638 14853 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_15700 16364 15693 gene locus_tag LOCUS_15710 16364 15693 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_15710 16981 16439 gene locus_tag LOCUS_15720 gene rmlC 16981 16439 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_15720 17835 16981 gene locus_tag LOCUS_15730 gene rfbA 17835 16981 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z5I1 protein_id gnl|my_center|LOCUS_15730 18842 17832 gene locus_tag LOCUS_15740 gene rfbB 18842 17832 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F5L7 protein_id gnl|my_center|LOCUS_15740 19883 18846 gene locus_tag LOCUS_15750 19883 18846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 21471 19924 gene locus_tag LOCUS_15760 21471 19924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence044 762 73 gene locus_tag LOCUS_15770 762 73 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_15770 2314 911 gene locus_tag LOCUS_15780 2314 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_15780 3562 2330 gene locus_tag LOCUS_15790 3562 2330 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_15790 4803 3733 gene locus_tag LOCUS_15800 4803 3733 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_15800 4888 6030 gene locus_tag LOCUS_15810 4888 6030 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_15810 7061 6279 gene locus_tag LOCUS_15820 gene truA2 7061 6279 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7H2 protein_id gnl|my_center|LOCUS_15820 7334 8326 gene locus_tag LOCUS_15830 7334 8326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 8354 8692 gene locus_tag LOCUS_15840 8354 8692 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_15840 8712 9953 gene locus_tag LOCUS_15850 gene amtB 8712 9953 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDS3 protein_id gnl|my_center|LOCUS_15850 10169 14680 gene locus_tag LOCUS_15860 gene gltA 10169 14680 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_15860 14685 16148 gene locus_tag LOCUS_15870 gene gltD 14685 16148 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_109751.2 protein_id gnl|my_center|LOCUS_15870 16411 16232 gene locus_tag LOCUS_15880 16411 16232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 17064 18080 gene locus_tag LOCUS_15890 gene thrA 17064 18080 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C3KQ03 protein_id gnl|my_center|LOCUS_15890 18097 19494 gene locus_tag LOCUS_15900 18097 19494 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_15900 20082 19585 gene locus_tag LOCUS_15910 20082 19585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 20934 21089 gene locus_tag LOCUS_15920 20934 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence045 <1 1332 gene locus_tag LOCUS_15930 <1 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:Xaa-Pro aminopeptidase 1537 1319 gene locus_tag LOCUS_15940 1537 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4851 1561 gene locus_tag LOCUS_15950 4851 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5731 4874 gene locus_tag LOCUS_15960 5731 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_15960 8101 6053 gene locus_tag LOCUS_15970 8101 6053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 8526 8101 gene locus_tag LOCUS_15980 8526 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 10451 8529 gene locus_tag LOCUS_15990 10451 8529 CDS product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 protein_id gnl|my_center|LOCUS_15990 12201 10615 gene locus_tag LOCUS_16000 12201 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 protein_id gnl|my_center|LOCUS_16000 15224 12213 gene locus_tag LOCUS_16010 15224 12213 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_16010 15633 16475 gene locus_tag LOCUS_16020 15633 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 16493 17203 gene locus_tag LOCUS_16030 16493 17203 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_16030 17353 18681 gene locus_tag LOCUS_16040 gene gluP 17353 18681 CDS product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 protein_id gnl|my_center|LOCUS_16040 18686 19774 gene locus_tag LOCUS_16050 18686 19774 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201990.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence046 132 992 gene locus_tag LOCUS_16060 132 992 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_16060 999 1784 gene locus_tag LOCUS_16070 999 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1925 6004 gene locus_tag LOCUS_16080 1925 6004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 6001 6960 gene locus_tag LOCUS_16090 6001 6960 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_16090 7599 6970 gene locus_tag LOCUS_16100 7599 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000998659.1 protein_id gnl|my_center|LOCUS_16100 7664 8209 gene locus_tag LOCUS_16110 7664 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_16110 8225 9358 gene locus_tag LOCUS_16120 8225 9358 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_16120 9870 9682 gene locus_tag LOCUS_16130 9870 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 10121 12853 gene locus_tag LOCUS_16140 10121 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_16140 13066 16068 gene locus_tag LOCUS_16150 13066 16068 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_16150 16080 17564 gene locus_tag LOCUS_16160 16080 17564 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence047 946 1503 gene locus_tag LOCUS_16170 946 1503 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962813.1 protein_id gnl|my_center|LOCUS_16170 1575 2612 gene locus_tag LOCUS_16180 1575 2612 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_16180 3277 2747 gene locus_tag LOCUS_16190 3277 2747 CDS product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 protein_id gnl|my_center|LOCUS_16190 3820 3353 gene locus_tag LOCUS_16200 3820 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_16200 4157 3831 gene locus_tag LOCUS_16210 4157 3831 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_16210 5121 4216 gene locus_tag LOCUS_16220 5121 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 5611 5135 gene locus_tag LOCUS_16230 5611 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 6521 5652 gene locus_tag LOCUS_16240 6521 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 7143 6604 gene locus_tag LOCUS_16250 7143 6604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 7724 7185 gene locus_tag LOCUS_16260 7724 7185 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_16260 7931 8689 gene locus_tag LOCUS_16270 7931 8689 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_16270 9570 8686 gene locus_tag LOCUS_16280 9570 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 9696 10403 gene locus_tag LOCUS_16290 9696 10403 CDS product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 protein_id gnl|my_center|LOCUS_16290 11294 10518 gene locus_tag LOCUS_16300 11294 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 13091 11667 gene locus_tag LOCUS_16310 gene sdaA 13091 11667 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_16310 13523 13182 gene locus_tag LOCUS_16320 13523 13182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_16320 13768 15672 gene locus_tag LOCUS_16330 gene dnaK 13768 15672 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_16330 15851 16699 gene locus_tag LOCUS_16340 15851 16699 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385340.1 protein_id gnl|my_center|LOCUS_16340 16705 17247 gene locus_tag LOCUS_16350 16705 17247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963203.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence048 1325 966 gene locus_tag LOCUS_16360 1325 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 1544 3616 gene locus_tag LOCUS_16370 1544 3616 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_16370 4160 3636 gene locus_tag LOCUS_16380 4160 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4920 4174 gene locus_tag LOCUS_16390 4920 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 6289 5561 gene locus_tag LOCUS_16400 6289 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 7592 7152 gene locus_tag LOCUS_16410 7592 7152 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706749.1 protein_id gnl|my_center|LOCUS_16410 7892 8989 gene locus_tag LOCUS_16420 7892 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 9095 9220 gene locus_tag LOCUS_16430 9095 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 9344 10093 gene locus_tag LOCUS_16440 9344 10093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 10795 11313 gene locus_tag LOCUS_16450 10795 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 12449 12964 gene locus_tag LOCUS_16460 12449 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 12977 13846 gene locus_tag LOCUS_16470 12977 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 13883 14386 gene locus_tag LOCUS_16480 13883 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 14479 17412 gene locus_tag LOCUS_16490 14479 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 17591 18832 gene locus_tag LOCUS_16500 17591 18832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence049 1657 527 gene locus_tag LOCUS_16510 1657 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2445 1975 gene locus_tag LOCUS_16520 2445 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 5450 2607 gene locus_tag LOCUS_16530 gene gcvP 5450 2607 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_16530 5638 6459 gene locus_tag LOCUS_16540 5638 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_16540 6601 8493 gene locus_tag LOCUS_16550 6601 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 9803 8661 gene locus_tag LOCUS_16560 9803 8661 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_16560 10004 11269 gene locus_tag LOCUS_16570 gene kynU 10004 11269 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_16570 11416 12825 gene locus_tag LOCUS_16580 gene kmo 11416 12825 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_16580 12998 13402 gene locus_tag LOCUS_16590 gene tdcF 12998 13402 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124713.1 protein_id gnl|my_center|LOCUS_16590 13402 14910 gene locus_tag LOCUS_16600 13402 14910 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203446.1 protein_id gnl|my_center|LOCUS_16600 14923 16365 gene locus_tag LOCUS_16610 gene hpaE 14923 16365 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000723530.1 protein_id gnl|my_center|LOCUS_16610 16432 17208 gene locus_tag LOCUS_16620 16432 17208 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_16620 17299 17829 gene locus_tag LOCUS_16630 gene nbaC 17299 17829 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_16630 17906 19009 gene locus_tag LOCUS_16640 17906 19009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence050 879 115 gene locus_tag LOCUS_16650 879 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_16650 2901 904 gene locus_tag LOCUS_16660 gene ligA 2901 904 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_16660 2979 3641 gene locus_tag LOCUS_16670 2979 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 4205 3645 gene locus_tag LOCUS_16680 4205 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 5911 4469 gene locus_tag LOCUS_16690 gene gapA2 5911 4469 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_16690 7444 6047 gene locus_tag LOCUS_16700 gene degP/Q 7444 6047 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_16700 7573 8343 gene locus_tag LOCUS_16710 gene dapF 7573 8343 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_16710 8343 8867 gene locus_tag LOCUS_16720 8343 8867 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_16720 8899 9927 gene locus_tag LOCUS_16730 gene pabC 8899 9927 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_16730 10189 10698 gene locus_tag LOCUS_16740 10189 10698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 11403 10699 gene locus_tag LOCUS_16750 11403 10699 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_16750 11868 11416 gene locus_tag LOCUS_16760 11868 11416 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_16760 13311 11884 gene locus_tag LOCUS_16770 gene dnaA 13311 11884 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_16770 13535 13882 gene locus_tag LOCUS_16780 13535 13882 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_16780 14534 13926 gene locus_tag LOCUS_16790 14534 13926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_16790 15397 14534 gene locus_tag LOCUS_16800 15397 14534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 16002 15394 gene locus_tag LOCUS_16810 16002 15394 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_16810 16777 15995 gene locus_tag LOCUS_16820 16777 15995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 17490 17080 gene locus_tag LOCUS_16830 17490 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 17597 18088 gene locus_tag LOCUS_16840 gene yjgM 17597 18088 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence051 421 1794 gene locus_tag LOCUS_16850 421 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 3022 2081 gene locus_tag LOCUS_16860 3022 2081 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_16860 3775 3026 gene locus_tag LOCUS_16870 3775 3026 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_16870 4840 3800 gene locus_tag LOCUS_16880 4840 3800 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_16880 5555 5001 gene locus_tag LOCUS_16890 gene ruvC 5555 5001 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_16890 6462 5791 gene locus_tag LOCUS_16900 6462 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_16900 7128 6559 gene locus_tag LOCUS_16910 7128 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 7143 8234 gene locus_tag LOCUS_16920 7143 8234 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_16920 8320 9261 gene locus_tag LOCUS_16930 8320 9261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 9837 9397 gene locus_tag LOCUS_16940 9837 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 11616 9859 gene locus_tag LOCUS_16950 11616 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 12331 11744 gene locus_tag LOCUS_16960 12331 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_16960 13080 12343 gene locus_tag LOCUS_16970 13080 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 14253 13084 gene locus_tag LOCUS_16980 14253 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 18068 14316 gene locus_tag LOCUS_16990 18068 14316 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence052 599 525 gene locus_tag LOCUS_t00140 599 525 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 711 1094 gene locus_tag LOCUS_17000 711 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_17000 1194 2027 gene locus_tag LOCUS_17010 1194 2027 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_17010 2581 2024 gene locus_tag LOCUS_17020 2581 2024 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_17020 2933 2661 gene locus_tag LOCUS_17030 gene hupB 2933 2661 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_17030 4072 3128 gene locus_tag LOCUS_17040 gene fmt 4072 3128 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_17040 5967 4078 gene locus_tag LOCUS_17050 gene recQ2 5967 4078 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_17050 6515 5964 gene locus_tag LOCUS_17060 6515 5964 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_17060 6657 6938 gene locus_tag LOCUS_17070 6657 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 6943 8577 gene locus_tag LOCUS_17080 6943 8577 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_17080 8578 9426 gene locus_tag LOCUS_17090 8578 9426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 9392 10774 gene locus_tag LOCUS_17100 gene surA 9392 10774 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_17100 10774 11727 gene locus_tag LOCUS_17110 10774 11727 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_17110 12281 11724 gene locus_tag LOCUS_17120 12281 11724 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_17120 13114 12281 gene locus_tag LOCUS_17130 13114 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 protein_id gnl|my_center|LOCUS_17130 13817 13083 gene locus_tag LOCUS_17140 13817 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 13922 15346 gene locus_tag LOCUS_17150 13922 15346 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_17150 16152 15343 gene locus_tag LOCUS_17160 16152 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 16386 17246 gene locus_tag LOCUS_17170 16386 17246 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_17170 17253 18038 gene locus_tag LOCUS_17180 17253 18038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence053 240 644 gene locus_tag LOCUS_17190 240 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 1972 641 gene locus_tag LOCUS_17200 1972 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2127 3317 gene locus_tag LOCUS_17210 gene aspC2 2127 3317 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_17210 3318 4325 gene locus_tag LOCUS_17220 gene murB 3318 4325 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_17220 5045 4383 gene locus_tag LOCUS_17230 5045 4383 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_17230 5640 5029 gene locus_tag LOCUS_17240 5640 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 6406 5627 gene locus_tag LOCUS_17250 6406 5627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 6761 6471 gene locus_tag LOCUS_17260 6761 6471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 7540 6890 gene locus_tag LOCUS_17270 7540 6890 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_17270 8191 7589 gene locus_tag LOCUS_17280 8191 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 9226 8195 gene locus_tag LOCUS_17290 9226 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 9822 9352 gene locus_tag LOCUS_17300 9822 9352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 10166 9828 gene locus_tag LOCUS_17310 10166 9828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 10848 10246 gene locus_tag LOCUS_17320 10848 10246 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFP4 protein_id gnl|my_center|LOCUS_17320 11148 11351 gene locus_tag LOCUS_17330 11148 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 11367 12470 gene locus_tag LOCUS_17340 11367 12470 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_17340 12461 13024 gene locus_tag LOCUS_17350 12461 13024 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_17350 13359 14579 gene locus_tag LOCUS_17360 13359 14579 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_17360 14620 15489 gene locus_tag LOCUS_17370 gene lipA 14620 15489 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_17370 16839 15664 gene locus_tag LOCUS_17380 16839 15664 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039289.1 protein_id gnl|my_center|LOCUS_17380 <17949 17426 gene locus_tag LOCUS_17390 <17949 17426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963328.1:cystathionine beta-synthase >Feature sequence054 <1 1344 gene locus_tag LOCUS_17400 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963860.1:antirepressor 1822 1616 gene locus_tag LOCUS_17410 1822 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 1728 2099 gene locus_tag LOCUS_17420 1728 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2195 3481 gene locus_tag LOCUS_17430 2195 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 4467 3478 gene locus_tag LOCUS_17440 gene obg 4467 3478 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_17440 5676 4558 gene locus_tag LOCUS_17450 5676 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 8747 5775 gene locus_tag LOCUS_17460 gene secDF 8747 5775 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_17460 8948 10624 gene locus_tag LOCUS_17470 gene fhs 8948 10624 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EB3 protein_id gnl|my_center|LOCUS_17470 11641 10715 gene locus_tag LOCUS_17480 gene mdh 11641 10715 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_17480 12772 11774 gene locus_tag LOCUS_17490 12772 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 14825 12888 gene locus_tag LOCUS_17500 gene gyrB 14825 12888 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_17500 <17337 15111 gene locus_tag LOCUS_17510 <17337 15111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WGJ7:aspartate--tRNA(Asp/Asn) ligase >Feature sequence055 863 582 gene locus_tag LOCUS_17520 863 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 1736 1365 gene locus_tag LOCUS_17530 1736 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 2712 3062 gene locus_tag LOCUS_17540 2712 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4291 3401 gene locus_tag LOCUS_17550 4291 3401 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846458.1 protein_id gnl|my_center|LOCUS_17550 5043 4393 gene locus_tag LOCUS_17560 5043 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 6201 5104 gene locus_tag LOCUS_17570 gene capI 6201 5104 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_17570 6906 6220 gene locus_tag LOCUS_17580 gene ftsE 6906 6220 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_17580 7068 10097 gene locus_tag LOCUS_17590 7068 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_17590 10102 11883 gene locus_tag LOCUS_17600 10102 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_17600 11920 12639 gene locus_tag LOCUS_17610 11920 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 12700 14133 gene locus_tag LOCUS_17620 12700 14133 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_17620 14138 14500 gene locus_tag LOCUS_17630 14138 14500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963140.1 protein_id gnl|my_center|LOCUS_17630 14510 16129 gene locus_tag LOCUS_17640 14510 16129 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_17640 16338 17168 gene locus_tag LOCUS_17650 16338 17168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence056 211 17 gene locus_tag LOCUS_17660 gene rpmF 211 17 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_17660 749 213 gene locus_tag LOCUS_17670 749 213 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_17670 1867 839 gene locus_tag LOCUS_17680 gene pdxA 1867 839 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_17680 1926 2516 gene locus_tag LOCUS_17690 gene ribE 1926 2516 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_17690 3655 2513 gene locus_tag LOCUS_17700 gene holB 3655 2513 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_17700 3764 4951 gene locus_tag LOCUS_17710 gene pgk 3764 4951 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_17710 5067 6107 gene locus_tag LOCUS_17720 5067 6107 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105677.1 protein_id gnl|my_center|LOCUS_17720 6427 6245 gene locus_tag LOCUS_17730 6427 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 7020 6451 gene locus_tag LOCUS_17740 7020 6451 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_17740 7773 7027 gene locus_tag LOCUS_17750 gene deoC 7773 7027 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F6 protein_id gnl|my_center|LOCUS_17750 8566 7826 gene locus_tag LOCUS_17760 8566 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 9568 8999 gene locus_tag LOCUS_17770 9568 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_17770 9658 10242 gene locus_tag LOCUS_17780 9658 10242 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_17780 10244 10852 gene locus_tag LOCUS_17790 10244 10852 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962631.1 protein_id gnl|my_center|LOCUS_17790 11734 11540 gene locus_tag LOCUS_17800 11734 11540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 12404 12036 gene locus_tag LOCUS_17810 12404 12036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 13162 12518 gene locus_tag LOCUS_17820 13162 12518 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_17820 15000 13168 gene locus_tag LOCUS_17830 15000 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 16090 14993 gene locus_tag LOCUS_17840 16090 14993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 <16844 16093 gene locus_tag LOCUS_17850 <16844 16093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143551.1:sensor histidine kinase >Feature sequence057 687 163 gene locus_tag LOCUS_17860 gene kdsC 687 163 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_17860 1372 677 gene locus_tag LOCUS_17870 1372 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_17870 1447 2604 gene locus_tag LOCUS_17880 1447 2604 CDS product L-methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDT4 protein_id gnl|my_center|LOCUS_17880 2642 3358 gene locus_tag LOCUS_17890 2642 3358 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_17890 3414 3488 gene locus_tag LOCUS_t00150 3414 3488 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3770 3621 gene locus_tag LOCUS_17900 3770 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 4827 4072 gene locus_tag LOCUS_17910 gene lytT 4827 4072 CDS product sensory transduction protein LytT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94514 protein_id gnl|my_center|LOCUS_17910 5674 4829 gene locus_tag LOCUS_17920 5674 4829 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898793.1 protein_id gnl|my_center|LOCUS_17920 7611 5674 gene locus_tag LOCUS_17930 7611 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 8817 7732 gene locus_tag LOCUS_17940 8817 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 11930 9138 gene locus_tag LOCUS_17950 gene uvrA1 11930 9138 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_17950 12146 12733 gene locus_tag LOCUS_17960 12146 12733 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_17960 13631 12972 gene locus_tag LOCUS_17970 gene nth 13631 12972 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_17970 13748 14200 gene locus_tag LOCUS_17980 13748 14200 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_17980 16703 14256 gene locus_tag LOCUS_17990 16703 14256 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence058 102 1382 gene locus_tag LOCUS_18000 102 1382 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 protein_id gnl|my_center|LOCUS_18000 2685 1486 gene locus_tag LOCUS_18010 2685 1486 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962646.1 protein_id gnl|my_center|LOCUS_18010 3000 2926 gene locus_tag LOCUS_t00160 3000 2926 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3471 3019 gene locus_tag LOCUS_18020 3471 3019 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_18020 3956 3507 gene locus_tag LOCUS_18030 3956 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5370 4060 gene locus_tag LOCUS_18040 gene nqrF 5370 4060 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_18040 6106 5375 gene locus_tag LOCUS_18050 gene nqrE 6106 5375 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L1 protein_id gnl|my_center|LOCUS_18050 6822 6175 gene locus_tag LOCUS_18060 gene nqrD 6822 6175 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_18060 7572 6826 gene locus_tag LOCUS_18070 gene nqrC 7572 6826 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_18070 8837 7575 gene locus_tag LOCUS_18080 gene nqrB 8837 7575 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_18080 10191 8842 gene locus_tag LOCUS_18090 gene nqrA 10191 8842 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_18090 10582 11796 gene locus_tag LOCUS_18100 10582 11796 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_18100 11846 12232 gene locus_tag LOCUS_18110 gene apaG 11846 12232 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_18110 12550 13311 gene locus_tag LOCUS_18120 12550 13311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 13993 13274 gene locus_tag LOCUS_18130 13993 13274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_18130 14141 15766 gene locus_tag LOCUS_18140 gene pruA 14141 15766 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence059 148 561 gene locus_tag LOCUS_18150 148 561 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_18150 1049 4351 gene locus_tag LOCUS_18160 1049 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 5365 4436 gene locus_tag LOCUS_18170 gene thrB 5365 4436 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UHA8 protein_id gnl|my_center|LOCUS_18170 6821 5367 gene locus_tag LOCUS_18180 gene thrC2 6821 5367 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967249.1 protein_id gnl|my_center|LOCUS_18180 7774 6824 gene locus_tag LOCUS_18190 7774 6824 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_18190 8743 7793 gene locus_tag LOCUS_18200 8743 7793 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089449.1 protein_id gnl|my_center|LOCUS_18200 9822 9235 gene locus_tag LOCUS_18210 9822 9235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 10196 9819 gene locus_tag LOCUS_18220 10196 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 10395 12542 gene locus_tag LOCUS_18230 10395 12542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 12928 13539 gene locus_tag LOCUS_18240 12928 13539 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962826.1 protein_id gnl|my_center|LOCUS_18240 13589 14230 gene locus_tag LOCUS_18250 gene thiE 13589 14230 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 protein_id gnl|my_center|LOCUS_18250 14339 15589 gene locus_tag LOCUS_18260 gene mscS2 14339 15589 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence060 <1 812 gene locus_tag LOCUS_18270 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H125:60 kDa chaperonin 1643 903 gene locus_tag LOCUS_18280 1643 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 2024 1644 gene locus_tag LOCUS_18290 2024 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 4256 2094 gene locus_tag LOCUS_18300 4256 2094 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_18300 4817 4413 gene locus_tag LOCUS_18310 4817 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 4952 5407 gene locus_tag LOCUS_18320 4952 5407 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_18320 5500 7026 gene locus_tag LOCUS_18330 gene purH 5500 7026 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_18330 7101 8129 gene locus_tag LOCUS_18340 gene mreB 7101 8129 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_18340 8205 8975 gene locus_tag LOCUS_18350 gene mreC 8205 8975 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_18350 9471 11363 gene locus_tag LOCUS_18360 gene pbpA 9471 11363 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_18360 11344 12624 gene locus_tag LOCUS_18370 gene rodA 11344 12624 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_18370 13061 12810 gene locus_tag LOCUS_18380 gene rpsT 13061 12810 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_18380 13170 13098 gene locus_tag LOCUS_t00170 13170 13098 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 14746 13268 gene locus_tag LOCUS_18390 gene proS 14746 13268 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_18390 >Feature sequence061 <1 2968 gene locus_tag LOCUS_18400 <1 2968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein 2958 4286 gene locus_tag LOCUS_18410 2958 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 4640 5224 gene locus_tag LOCUS_18420 gene tpm 4640 5224 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_18420 7985 5274 gene locus_tag LOCUS_18430 7985 5274 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_18430 9596 8418 gene locus_tag LOCUS_18440 gene gcdH 9596 8418 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_18440 10779 9697 gene locus_tag LOCUS_18450 10779 9697 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_18450 10836 12143 gene locus_tag LOCUS_18460 10836 12143 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_18460 12145 13023 gene locus_tag LOCUS_18470 12145 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 13067 13459 gene locus_tag LOCUS_18480 gene rnpA 13067 13459 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_18480 13446 15080 gene locus_tag LOCUS_18490 gene prc 13446 15080 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence062 <1 1841 gene locus_tag LOCUS_18500 <1 1841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974111.1:aconitate hydratase 2039 4306 gene locus_tag LOCUS_18510 gene acnA 2039 4306 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_18510 6708 4501 gene locus_tag LOCUS_18520 6708 4501 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 protein_id gnl|my_center|LOCUS_18520 6746 7408 gene locus_tag LOCUS_18530 gene ung2 6746 7408 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_18530 8583 7723 gene locus_tag LOCUS_18540 8583 7723 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963181.1 protein_id gnl|my_center|LOCUS_18540 9454 8585 gene locus_tag LOCUS_18550 gene udp 9454 8585 CDS product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 protein_id gnl|my_center|LOCUS_18550 10399 9455 gene locus_tag LOCUS_18560 10399 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 10775 10452 gene locus_tag LOCUS_18570 10775 10452 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963176.1 protein_id gnl|my_center|LOCUS_18570 11789 10842 gene locus_tag LOCUS_18580 11789 10842 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_18580 12555 11851 gene locus_tag LOCUS_18590 12555 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_18590 12991 12536 gene locus_tag LOCUS_18600 12991 12536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_18600 13286 12996 gene locus_tag LOCUS_18610 13286 12996 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THX7 protein_id gnl|my_center|LOCUS_18610 14871 13417 gene locus_tag LOCUS_18620 14871 13417 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J51 protein_id gnl|my_center|LOCUS_18620 >Feature sequence063 83 8 gene locus_tag LOCUS_t00180 83 8 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 206 1252 gene locus_tag LOCUS_18630 206 1252 CDS product pyrroloquinoline-quinone glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403228.1 protein_id gnl|my_center|LOCUS_18630 1387 2334 gene locus_tag LOCUS_18640 gene trxB1 1387 2334 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_18640 2977 2531 gene locus_tag LOCUS_18650 2977 2531 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_18650 4162 3155 gene locus_tag LOCUS_18660 4162 3155 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920359.1 protein_id gnl|my_center|LOCUS_18660 6062 4254 gene locus_tag LOCUS_18670 6062 4254 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_18670 7271 6081 gene locus_tag LOCUS_18680 7271 6081 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_18680 9681 7276 gene locus_tag LOCUS_18690 9681 7276 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_18690 10160 9705 gene locus_tag LOCUS_18700 10160 9705 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_18700 10337 11266 gene locus_tag LOCUS_18710 gene natA 10337 11266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_18710 11270 12595 gene locus_tag LOCUS_18720 gene natB 11270 12595 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_18720 12599 13429 gene locus_tag LOCUS_18730 12599 13429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 13451 14614 gene locus_tag LOCUS_18740 13451 14614 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence064 986 33 gene locus_tag LOCUS_18750 986 33 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_18750 1475 993 gene locus_tag LOCUS_18760 1475 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_18760 2174 1578 gene locus_tag LOCUS_18770 2174 1578 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_18770 2305 3141 gene locus_tag LOCUS_18780 2305 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 3138 3653 gene locus_tag LOCUS_18790 3138 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_18790 4227 3748 gene locus_tag LOCUS_18800 gene recX 4227 3748 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_18800 7806 4297 gene locus_tag LOCUS_18810 7806 4297 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_18810 8986 7814 gene locus_tag LOCUS_18820 8986 7814 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_18820 10403 8997 gene locus_tag LOCUS_18830 10403 8997 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_18830 10998 10405 gene locus_tag LOCUS_18840 10998 10405 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_18840 11125 12096 gene locus_tag LOCUS_18850 11125 12096 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_18850 12160 12234 gene locus_tag LOCUS_t00190 12160 12234 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14356 12425 gene locus_tag LOCUS_18860 14356 12425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence065 <1 1449 gene locus_tag LOCUS_18870 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963779.1:ribonuclease G 2831 1992 gene locus_tag LOCUS_18880 2831 1992 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963150.1 protein_id gnl|my_center|LOCUS_18880 4388 3333 gene locus_tag LOCUS_18890 4388 3333 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_18890 4562 7270 gene locus_tag LOCUS_18900 4562 7270 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_18900 7289 8710 gene locus_tag LOCUS_18910 7289 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964329.1 protein_id gnl|my_center|LOCUS_18910 8723 9124 gene locus_tag LOCUS_18920 8723 9124 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_18920 9200 10078 gene locus_tag LOCUS_18930 gene ftsX 9200 10078 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_18930 10082 10324 gene locus_tag LOCUS_18940 gene fjo13 10082 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_18940 10328 11122 gene locus_tag LOCUS_18950 gene uppP 10328 11122 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_18950 11145 11837 gene locus_tag LOCUS_18960 gene truB 11145 11837 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_18960 11913 12401 gene locus_tag LOCUS_18970 11913 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 12899 12489 gene locus_tag LOCUS_18980 gene mscL 12899 12489 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P626 protein_id gnl|my_center|LOCUS_18980 14045 12945 gene locus_tag LOCUS_18990 14045 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 <14631 14038 gene locus_tag LOCUS_19000 <14631 14038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYI4:thymidine kinase >Feature sequence066 <1 1094 gene locus_tag LOCUS_19010 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206839.1:2,5-dioxovalerate dehydrogenase 1097 2833 gene locus_tag LOCUS_19020 1097 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074318.1 protein_id gnl|my_center|LOCUS_19020 2826 3836 gene locus_tag LOCUS_19030 2826 3836 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_19030 3844 5094 gene locus_tag LOCUS_19040 gene dadA 3844 5094 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_19040 5097 6389 gene locus_tag LOCUS_19050 gene pepP 5097 6389 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_19050 6398 7606 gene locus_tag LOCUS_19060 6398 7606 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107426.1 protein_id gnl|my_center|LOCUS_19060 8076 7603 gene locus_tag LOCUS_19070 8076 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 11421 8395 gene locus_tag LOCUS_19080 11421 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887605.1 protein_id gnl|my_center|LOCUS_19080 12603 11536 gene locus_tag LOCUS_19090 12603 11536 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258816.1 protein_id gnl|my_center|LOCUS_19090 13555 12596 gene locus_tag LOCUS_19100 13555 12596 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence067 1233 1634 gene locus_tag LOCUS_19110 1233 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1641 2642 gene locus_tag LOCUS_19120 1641 2642 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_19120 3237 2644 gene locus_tag LOCUS_19130 3237 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 4445 3243 gene locus_tag LOCUS_19140 4445 3243 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_19140 4856 4461 gene locus_tag LOCUS_19150 gene rbfA 4856 4461 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_19150 5384 5091 gene locus_tag LOCUS_19160 5384 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 6976 5465 gene locus_tag LOCUS_19170 gene atpD 6976 5465 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_19170 8487 7135 gene locus_tag LOCUS_19180 8487 7135 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_19180 9799 8606 gene locus_tag LOCUS_19190 gene kbl 9799 8606 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_19190 12976 9848 gene locus_tag LOCUS_19200 12976 9848 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_19200 <14025 13016 gene locus_tag LOCUS_19210 <14025 13016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458884.1:zinc ABC transporter permease >Feature sequence068 1457 792 gene locus_tag LOCUS_19220 1457 792 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 protein_id gnl|my_center|LOCUS_19220 2164 1733 gene locus_tag LOCUS_19230 2164 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_19230 2360 4057 gene locus_tag LOCUS_19240 gene rho 2360 4057 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_19240 6505 4415 gene locus_tag LOCUS_19250 6505 4415 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_19250 7893 6628 gene locus_tag LOCUS_19260 7893 6628 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_19260 8622 8113 gene locus_tag LOCUS_19270 8622 8113 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_19270 10017 8686 gene locus_tag LOCUS_19280 10017 8686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109224.1 protein_id gnl|my_center|LOCUS_19280 11316 10033 gene locus_tag LOCUS_19290 11316 10033 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_19290 12041 11313 gene locus_tag LOCUS_19300 gene coaX 12041 11313 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_19300 12140 12213 gene locus_tag LOCUS_t00200 12140 12213 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 13199 12267 gene locus_tag LOCUS_19310 gene ltd 13199 12267 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_19310 13366 13827 gene locus_tag LOCUS_19320 13366 13827 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_19320 >Feature sequence069 233 1228 gene locus_tag LOCUS_19330 gene fabH3 233 1228 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_19330 1264 1740 gene locus_tag LOCUS_19340 gene accB 1264 1740 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_19340 1830 3170 gene locus_tag LOCUS_19350 gene accC 1830 3170 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_19350 3260 3709 gene locus_tag LOCUS_19360 3260 3709 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_19360 4265 5995 gene locus_tag LOCUS_19370 4265 5995 CDS product aminopeptidase family M28 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250863.1 protein_id gnl|my_center|LOCUS_19370 6663 6061 gene locus_tag LOCUS_19380 6663 6061 CDS product fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121856.1 protein_id gnl|my_center|LOCUS_19380 6724 7734 gene locus_tag LOCUS_19390 gene ykfB 6724 7734 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_19390 10224 8050 gene locus_tag LOCUS_19400 10224 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 10298 10726 gene locus_tag LOCUS_19410 10298 10726 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_19410 10755 12440 gene locus_tag LOCUS_19420 gene recJ 10755 12440 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_19420 <13598 12463 gene locus_tag LOCUS_19430 <13598 12463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494262.1:ATP-dependent DNA helicase RecQ >Feature sequence070 305 2953 gene locus_tag LOCUS_19440 305 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3272 2973 gene locus_tag LOCUS_19450 3272 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962578.1 protein_id gnl|my_center|LOCUS_19450 3606 3352 gene locus_tag LOCUS_19460 3606 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 5313 3628 gene locus_tag LOCUS_19470 gene glnS 5313 3628 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_19470 5861 6292 gene locus_tag LOCUS_19480 5861 6292 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_19480 6293 6649 gene locus_tag LOCUS_19490 gene folB 6293 6649 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_19490 6747 6820 gene locus_tag LOCUS_t00210 6747 6820 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 7081 7923 gene locus_tag LOCUS_19500 7081 7923 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_19500 7928 9568 gene locus_tag LOCUS_19510 7928 9568 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_19510 9614 11464 gene locus_tag LOCUS_19520 9614 11464 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_19520 12186 11521 gene locus_tag LOCUS_19530 12186 11521 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_19530 <13185 12207 gene locus_tag LOCUS_19540 <13185 12207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964555.1:flavodoxin reductase >Feature sequence071 2051 1713 gene locus_tag LOCUS_19550 2051 1713 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_19550 2245 2793 gene locus_tag LOCUS_19560 2245 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 2806 3159 gene locus_tag LOCUS_19570 2806 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_19570 3722 3252 gene locus_tag LOCUS_19580 3722 3252 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262101.1 protein_id gnl|my_center|LOCUS_19580 3828 6125 gene locus_tag LOCUS_19590 3828 6125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 7627 6200 gene locus_tag LOCUS_19600 gene pykA 7627 6200 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_19600 8103 7633 gene locus_tag LOCUS_19610 8103 7633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_19610 8932 8195 gene locus_tag LOCUS_19620 gene rnc 8932 8195 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_19620 10189 8936 gene locus_tag LOCUS_19630 gene fabF 10189 8936 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_19630 10432 10196 gene locus_tag LOCUS_19640 gene acpP 10432 10196 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_19640 10604 11176 gene locus_tag LOCUS_19650 gene purN 10604 11176 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_19650 11169 11804 gene locus_tag LOCUS_19660 11169 11804 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_19660 <12556 11890 gene locus_tag LOCUS_19670 <12556 11890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962275.1:succinate dehydrogenase >Feature sequence072 1348 755 gene locus_tag LOCUS_19680 1348 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4211 1380 gene locus_tag LOCUS_19690 4211 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 4343 4618 gene locus_tag LOCUS_19700 4343 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4778 6085 gene locus_tag LOCUS_19710 gene rhlE 4778 6085 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_19710 6233 7525 gene locus_tag LOCUS_19720 gene pepP 6233 7525 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_19720 8350 7568 gene locus_tag LOCUS_19730 8350 7568 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_19730 9755 8484 gene locus_tag LOCUS_19740 gene brnQ-1 9755 8484 CDS product branched-chain amino acid transport system carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BB9 protein_id gnl|my_center|LOCUS_19740 11308 9758 gene locus_tag LOCUS_19750 11308 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 11400 12179 gene locus_tag LOCUS_19760 11400 12179 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence073 489 956 gene locus_tag LOCUS_19770 489 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 946 1470 gene locus_tag LOCUS_19780 946 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1454 2533 gene locus_tag LOCUS_19790 1454 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 2559 3293 gene locus_tag LOCUS_19800 2559 3293 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767601.1 protein_id gnl|my_center|LOCUS_19800 4579 3404 gene locus_tag LOCUS_19810 4579 3404 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_19810 5354 4734 gene locus_tag LOCUS_19820 5354 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6791 5922 gene locus_tag LOCUS_19830 6791 5922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_19830 7236 6796 gene locus_tag LOCUS_19840 7236 6796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 7773 7354 gene locus_tag LOCUS_19850 7773 7354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 8138 7785 gene locus_tag LOCUS_19860 8138 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 9384 8299 gene locus_tag LOCUS_19870 9384 8299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 9523 9960 gene locus_tag LOCUS_19880 9523 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 9953 10501 gene locus_tag LOCUS_19890 9953 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 10491 11396 gene locus_tag LOCUS_19900 10491 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 11668 12042 gene locus_tag LOCUS_19910 11668 12042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 >Feature sequence074 22 360 gene locus_tag LOCUS_19920 gene csaA 22 360 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_19920 409 1581 gene locus_tag LOCUS_19930 409 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 4360 1871 gene locus_tag LOCUS_19940 4360 1871 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_19940 5508 4702 gene locus_tag LOCUS_19950 5508 4702 CDS product DUF1338 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070950.1 protein_id gnl|my_center|LOCUS_19950 5660 6118 gene locus_tag LOCUS_19960 5660 6118 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993802.1 protein_id gnl|my_center|LOCUS_19960 6378 9308 gene locus_tag LOCUS_19970 6378 9308 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_19970 9391 10647 gene locus_tag LOCUS_19980 9391 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 10644 11639 gene locus_tag LOCUS_19990 10644 11639 CDS product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172178.1 protein_id gnl|my_center|LOCUS_19990 >Feature sequence075 197 985 gene locus_tag LOCUS_20000 197 985 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_20000 1021 2163 gene locus_tag LOCUS_20010 1021 2163 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_20010 2482 2165 gene locus_tag LOCUS_20020 2482 2165 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168851.1 protein_id gnl|my_center|LOCUS_20020 2976 2479 gene locus_tag LOCUS_20030 2976 2479 CDS product alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_20030 3016 4350 gene locus_tag LOCUS_20040 3016 4350 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_20040 4403 5062 gene locus_tag LOCUS_20050 4403 5062 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_20050 5170 6012 gene locus_tag LOCUS_20060 5170 6012 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_20060 6211 6014 gene locus_tag LOCUS_20070 6211 6014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_20070 6490 6299 gene locus_tag LOCUS_20080 gene cspC 6490 6299 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_20080 7548 6607 gene locus_tag LOCUS_20090 7548 6607 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_20090 9173 7548 gene locus_tag LOCUS_20100 9173 7548 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_20100 10413 9226 gene locus_tag LOCUS_20110 gene mnmA 10413 9226 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_20110 11262 10546 gene locus_tag LOCUS_20120 11262 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964005.1 protein_id gnl|my_center|LOCUS_20120 >Feature sequence076 2820 1051 gene locus_tag LOCUS_20130 gene dxs 2820 1051 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_20130 2931 3380 gene locus_tag LOCUS_20140 gene tadA 2931 3380 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_20140 3811 3377 gene locus_tag LOCUS_20150 3811 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 4040 3834 gene locus_tag LOCUS_20160 4040 3834 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902968.1 protein_id gnl|my_center|LOCUS_20160 4570 4043 gene locus_tag LOCUS_20170 4570 4043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 5079 4573 gene locus_tag LOCUS_20180 5079 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 5590 5156 gene locus_tag LOCUS_20190 5590 5156 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_20190 6018 5641 gene locus_tag LOCUS_20200 6018 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 7295 6030 gene locus_tag LOCUS_20210 gene umuC 7295 6030 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_20210 8921 7422 gene locus_tag LOCUS_20220 gene mocR 8921 7422 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208163.1 protein_id gnl|my_center|LOCUS_20220 8996 10816 gene locus_tag LOCUS_20230 gene btuB 8996 10816 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207616.1 protein_id gnl|my_center|LOCUS_20230 >Feature sequence077 441 1046 gene locus_tag LOCUS_20240 gene rpsD 441 1046 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_20240 1142 2134 gene locus_tag LOCUS_20250 gene rpoA 1142 2134 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_20250 2195 2668 gene locus_tag LOCUS_20260 gene rplQ 2195 2668 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_20260 4673 2745 gene locus_tag LOCUS_20270 4673 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5194 5943 gene locus_tag LOCUS_20280 5194 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6025 6732 gene locus_tag LOCUS_20290 6025 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 6811 7929 gene locus_tag LOCUS_20300 gene carA 6811 7929 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_20300 8202 9488 gene locus_tag LOCUS_20310 gene eno 8202 9488 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_20310 9665 10951 gene locus_tag LOCUS_20320 gene gltA 9665 10951 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_20320 >Feature sequence078 962 246 gene locus_tag LOCUS_20330 962 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 914 1123 gene locus_tag LOCUS_20340 914 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2020 1637 gene locus_tag LOCUS_20350 2020 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 3899 2652 gene locus_tag LOCUS_20360 3899 2652 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_20360 4975 3980 gene locus_tag LOCUS_20370 4975 3980 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_20370 7251 5143 gene locus_tag LOCUS_20380 gene ptrB 7251 5143 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_20380 7393 7716 gene locus_tag LOCUS_20390 7393 7716 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_20390 7802 8026 gene locus_tag LOCUS_20400 7802 8026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 8038 8370 gene locus_tag LOCUS_20410 8038 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 8398 8601 gene locus_tag LOCUS_20420 8398 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 9019 8579 gene locus_tag LOCUS_20430 9019 8579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_20430 <10426 9120 gene locus_tag LOCUS_20440 <10426 9120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962898.1:ornithine--oxo-acid transaminase >Feature sequence079 4974 6326 gene locus_tag LOCUS_20450 4974 6326 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_20450 7413 6310 gene locus_tag LOCUS_20460 7413 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 8542 7403 gene locus_tag LOCUS_20470 8542 7403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 8799 8632 gene locus_tag LOCUS_20480 8799 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence080 373 1692 gene locus_tag LOCUS_20490 373 1692 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_20490 1712 3763 gene locus_tag LOCUS_20500 1712 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 4775 3900 gene locus_tag LOCUS_20510 gene fjo11 4775 3900 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_20510 4870 5304 gene locus_tag LOCUS_20520 4870 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 5497 5850 gene locus_tag LOCUS_20530 5497 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_20530 7889 5925 gene locus_tag LOCUS_20540 7889 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 <10387 8020 gene locus_tag LOCUS_20550 <10387 8020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109087.1:collagen-binding protein >Feature sequence081 409 861 gene locus_tag LOCUS_20560 409 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_20560 1165 962 gene locus_tag LOCUS_20570 1165 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1949 1308 gene locus_tag LOCUS_20580 gene pcm 1949 1308 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_20580 2142 3125 gene locus_tag LOCUS_20590 2142 3125 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_20590 3255 4142 gene locus_tag LOCUS_20600 3255 4142 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_20600 4152 4793 gene locus_tag LOCUS_20610 4152 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 5329 4859 gene locus_tag LOCUS_20620 5329 4859 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_20620 5435 6376 gene locus_tag LOCUS_20630 gene oxyR 5435 6376 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_20630 8140 6521 gene locus_tag LOCUS_20640 8140 6521 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_20640 8326 9720 gene locus_tag LOCUS_20650 8326 9720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence082 <1 3733 gene locus_tag LOCUS_20660 <1 3733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402900.1:T9SS C-terminal target domain-containing protein 3791 4570 gene locus_tag LOCUS_20670 3791 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247460.1 protein_id gnl|my_center|LOCUS_20670 4810 4977 gene locus_tag LOCUS_20680 4810 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 5300 5503 gene locus_tag LOCUS_20690 5300 5503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 5542 5907 gene locus_tag LOCUS_20700 5542 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 8025 6172 gene locus_tag LOCUS_20710 8025 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 >Feature sequence083 133 1497 gene locus_tag LOCUS_20720 133 1497 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_20720 1602 2507 gene locus_tag LOCUS_20730 1602 2507 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_20730 2548 3276 gene locus_tag LOCUS_20740 gene menG 2548 3276 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_20740 3278 3976 gene locus_tag LOCUS_20750 gene porT 3278 3976 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_20750 4766 4035 gene locus_tag LOCUS_20760 4766 4035 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_20760 4875 7316 gene locus_tag LOCUS_20770 4875 7316 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_20770 7428 8495 gene locus_tag LOCUS_20780 gene fbaA 7428 8495 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_20780 8667 9524 gene locus_tag LOCUS_20790 gene accD 8667 9524 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_20790 9632 9901 gene locus_tag LOCUS_20800 gene rpsO 9632 9901 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_20800 >Feature sequence084 369 442 gene locus_tag LOCUS_t00220 369 442 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1260 607 gene locus_tag LOCUS_20810 1260 607 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 protein_id gnl|my_center|LOCUS_20810 1403 2263 gene locus_tag LOCUS_20820 1403 2263 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_20820 3710 2241 gene locus_tag LOCUS_20830 3710 2241 CDS product selenocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_20830 4543 3710 gene locus_tag LOCUS_20840 4543 3710 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962664.1 protein_id gnl|my_center|LOCUS_20840 5935 4544 gene locus_tag LOCUS_20850 5935 4544 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_20850 7747 6434 gene locus_tag LOCUS_20860 gene rimO 7747 6434 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_20860 9007 8054 gene locus_tag LOCUS_20870 gene ftsY 9007 8054 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_20870 9474 9322 gene locus_tag LOCUS_20880 9474 9322 CDS product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 protein_id gnl|my_center|LOCUS_20880 9710 9528 gene locus_tag LOCUS_20890 gene rpmG 9710 9528 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_20890 >Feature sequence085 428 1321 gene locus_tag LOCUS_20900 428 1321 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168169.1 protein_id gnl|my_center|LOCUS_20900 1704 1429 gene locus_tag LOCUS_20910 1704 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 1775 2179 gene locus_tag LOCUS_20920 1775 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 3203 2304 gene locus_tag LOCUS_20930 3203 2304 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109171.1 protein_id gnl|my_center|LOCUS_20930 4093 3347 gene locus_tag LOCUS_20940 4093 3347 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511395.1 protein_id gnl|my_center|LOCUS_20940 4773 4141 gene locus_tag LOCUS_20950 4773 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108147.1 protein_id gnl|my_center|LOCUS_20950 4894 6234 gene locus_tag LOCUS_20960 4894 6234 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_20960 6237 7550 gene locus_tag LOCUS_20970 6237 7550 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817866.1 protein_id gnl|my_center|LOCUS_20970 7556 9091 gene locus_tag LOCUS_20980 7556 9091 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_20980 >Feature sequence086 1037 36 gene locus_tag LOCUS_20990 1037 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_20990 1410 2756 gene locus_tag LOCUS_21000 1410 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 2816 4438 gene locus_tag LOCUS_21010 2816 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 4784 5476 gene locus_tag LOCUS_21020 4784 5476 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_21020 5476 6966 gene locus_tag LOCUS_21030 5476 6966 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_21030 7236 8351 gene locus_tag LOCUS_21040 7236 8351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence087 352 807 gene locus_tag LOCUS_21050 gene coaD 352 807 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_21050 855 2567 gene locus_tag LOCUS_21060 855 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_21060 2581 3087 gene locus_tag LOCUS_21070 2581 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3246 4058 gene locus_tag LOCUS_21080 3246 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989516.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21080 4459 6759 gene locus_tag LOCUS_21090 4459 6759 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_21090 6799 7263 gene locus_tag LOCUS_21100 6799 7263 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382916.1 protein_id gnl|my_center|LOCUS_21100 >Feature sequence088 3132 1732 gene locus_tag LOCUS_21110 gene gatA 3132 1732 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_21110 3404 3135 gene locus_tag LOCUS_21120 3404 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 4168 5559 gene locus_tag LOCUS_21130 gene trpE 4168 5559 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_21130 5616 6194 gene locus_tag LOCUS_21140 gene pabA 5616 6194 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_21140 6275 7264 gene locus_tag LOCUS_21150 gene trpD 6275 7264 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_21150 7310 7480 gene locus_tag LOCUS_21160 7310 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 7491 8279 gene locus_tag LOCUS_21170 gene trpC 7491 8279 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_21170 8394 9092 gene locus_tag LOCUS_21180 gene trpF 8394 9092 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_21180 >Feature sequence089 1259 33 gene locus_tag LOCUS_21190 gene mntH 1259 33 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121855.1 protein_id gnl|my_center|LOCUS_21190 2397 1252 gene locus_tag LOCUS_21200 2397 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121577.1 protein_id gnl|my_center|LOCUS_21200 4104 2494 gene locus_tag LOCUS_21210 gene pckA 4104 2494 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_21210 4572 4192 gene locus_tag LOCUS_21220 4572 4192 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_21220 4647 6017 gene locus_tag LOCUS_21230 4647 6017 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_21230 6838 6119 gene locus_tag LOCUS_21240 6838 6119 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_21240 7001 7420 gene locus_tag LOCUS_21250 7001 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 8067 7982 gene locus_tag LOCUS_t00230 8067 7982 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence090 452 379 gene locus_tag LOCUS_t00240 452 379 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1283 516 gene locus_tag LOCUS_21260 1283 516 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_21260 2024 1284 gene locus_tag LOCUS_21270 2024 1284 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_21270 2136 3773 gene locus_tag LOCUS_21280 gene pafA 2136 3773 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_21280 3780 4919 gene locus_tag LOCUS_21290 3780 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 6078 5143 gene locus_tag LOCUS_21300 6078 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_21300 6801 6358 gene locus_tag LOCUS_21310 6801 6358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 7259 8194 gene locus_tag LOCUS_21320 7259 8194 CDS product beta-Ig-H3/fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405131.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence091 523 1848 gene locus_tag LOCUS_21330 523 1848 CDS product L-gulono-1,4-lactone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WIT3 protein_id gnl|my_center|LOCUS_21330 1835 2485 gene locus_tag LOCUS_21340 gene yhcW 1835 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54607 protein_id gnl|my_center|LOCUS_21340 3415 2522 gene locus_tag LOCUS_21350 gene gldA 3415 2522 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_21350 4233 3463 gene locus_tag LOCUS_21360 4233 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7075 4304 gene locus_tag LOCUS_21370 7075 4304 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_21370 7946 7113 gene locus_tag LOCUS_21380 7946 7113 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_21380 >Feature sequence092 784 394 gene locus_tag LOCUS_tm00010 784 394 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 938 2143 gene locus_tag LOCUS_21390 938 2143 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_21390 2143 2364 gene locus_tag LOCUS_21400 2143 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_21400 2961 2398 gene locus_tag LOCUS_21410 2961 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 4312 3494 gene locus_tag LOCUS_21420 gene kdsA 4312 3494 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_21420 4508 5464 gene locus_tag LOCUS_21430 4508 5464 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796268.1 protein_id gnl|my_center|LOCUS_21430 6003 5545 gene locus_tag LOCUS_21440 6003 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 <8071 6057 gene locus_tag LOCUS_21450 <8071 6057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin >Feature sequence093 <1 738 gene locus_tag LOCUS_21460 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ66:molybdenum cofactor guanylyltransferase 802 1893 gene locus_tag LOCUS_21470 802 1893 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_21470 1899 3680 gene locus_tag LOCUS_21480 1899 3680 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009293016.1 protein_id gnl|my_center|LOCUS_21480 4371 3820 gene locus_tag LOCUS_21490 gene gldD 4371 3820 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_21490 5692 4364 gene locus_tag LOCUS_21500 5692 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 6143 5712 gene locus_tag LOCUS_21510 gene ssb 6143 5712 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_21510 7125 6184 gene locus_tag LOCUS_21520 gene mutY 7125 6184 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_21520 7369 7659 gene locus_tag LOCUS_21530 gene hupA 7369 7659 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_21530 >Feature sequence094 1332 274 gene locus_tag LOCUS_21540 1332 274 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_21540 2168 1419 gene locus_tag LOCUS_21550 2168 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 3483 2173 gene locus_tag LOCUS_21560 3483 2173 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583646.1 protein_id gnl|my_center|LOCUS_21560 4735 3491 gene locus_tag LOCUS_21570 4735 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 6189 4732 gene locus_tag LOCUS_21580 6189 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 6296 7345 gene locus_tag LOCUS_21590 gene thiL 6296 7345 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_21590 >Feature sequence095 2395 875 gene locus_tag LOCUS_21600 2395 875 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_21600 3016 2417 gene locus_tag LOCUS_21610 3016 2417 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_21610 4507 3107 gene locus_tag LOCUS_21620 gene leuC 4507 3107 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP1 protein_id gnl|my_center|LOCUS_21620 6085 5036 gene locus_tag LOCUS_21630 gene czcO 6085 5036 CDS product putative oxidoreductase CzcO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07085 protein_id gnl|my_center|LOCUS_21630 6411 7091 gene locus_tag LOCUS_21640 6411 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 7338 7802 gene locus_tag LOCUS_21650 7338 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_21650 >Feature sequence096 1658 660 gene locus_tag LOCUS_21660 1658 660 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920217.1 protein_id gnl|my_center|LOCUS_21660 3949 1664 gene locus_tag LOCUS_21670 3949 1664 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_21670 6982 4040 gene locus_tag LOCUS_21680 6982 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 >Feature sequence097 708 169 gene locus_tag LOCUS_21690 gene rpsP 708 169 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 protein_id gnl|my_center|LOCUS_21690 1034 5371 gene locus_tag LOCUS_21700 gene dnaE 1034 5371 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_21700 6312 5437 gene locus_tag LOCUS_21710 6312 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 6874 6398 gene locus_tag LOCUS_21720 6874 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 7372 6926 gene locus_tag LOCUS_21730 7372 6926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence098 4156 1253 gene locus_tag LOCUS_21740 4156 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 >Feature sequence099 45 911 gene locus_tag LOCUS_21750 gene atpG 45 911 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_21750 1154 1630 gene locus_tag LOCUS_21760 1154 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 1737 2669 gene locus_tag LOCUS_21770 1737 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2931 3683 gene locus_tag LOCUS_21780 2931 3683 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946047.1 protein_id gnl|my_center|LOCUS_21780 3685 4824 gene locus_tag LOCUS_21790 3685 4824 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_21790 5866 5093 gene locus_tag LOCUS_21800 5866 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942960.1 protein_id gnl|my_center|LOCUS_21800 6336 6112 gene locus_tag LOCUS_21810 6336 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 <7264 6531 gene locus_tag LOCUS_21820 <7264 6531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964414.1:aldehyde dehydrogenase >Feature sequence100 1527 286 gene locus_tag LOCUS_21830 1527 286 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_21830 2257 1928 gene locus_tag LOCUS_21840 2257 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2885 2277 gene locus_tag LOCUS_21850 2885 2277 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_21850 3782 2913 gene locus_tag LOCUS_21860 gene purU 3782 2913 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWT1 protein_id gnl|my_center|LOCUS_21860 4703 3864 gene locus_tag LOCUS_21870 gene menB 4703 3864 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_21870 4834 5931 gene locus_tag LOCUS_21880 4834 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 6694 6200 gene locus_tag LOCUS_21890 6694 6200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence101 1904 912 gene locus_tag LOCUS_21900 gene moaA 1904 912 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747W9 protein_id gnl|my_center|LOCUS_21900 2318 1905 gene locus_tag LOCUS_21910 2318 1905 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_21910 2878 2321 gene locus_tag LOCUS_21920 2878 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_21920 4113 2881 gene locus_tag LOCUS_21930 gene kdtA 4113 2881 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_21930 5080 4340 gene locus_tag LOCUS_21940 5080 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 6055 5093 gene locus_tag LOCUS_21950 6055 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence102 1335 304 gene locus_tag LOCUS_21960 gene ansA 1335 304 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_21960 1430 2128 gene locus_tag LOCUS_21970 1430 2128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_21970 4332 2536 gene locus_tag LOCUS_21980 gene lepA 4332 2536 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_21980 4649 5167 gene locus_tag LOCUS_21990 4649 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 protein_id gnl|my_center|LOCUS_21990 5508 5227 gene locus_tag LOCUS_22000 5508 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 5945 5619 gene locus_tag LOCUS_22010 5945 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 >Feature sequence103 1693 1328 gene locus_tag LOCUS_22020 1693 1328 CDS product preprotein translocase SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963077.1 protein_id gnl|my_center|LOCUS_22020 2024 1695 gene locus_tag LOCUS_22030 2024 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2336 4318 gene locus_tag LOCUS_22040 gene tetP/tetQ 2336 4318 CDS product tetracycline resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964757.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence104 2095 323 gene locus_tag LOCUS_22050 gene typA 2095 323 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_22050 3348 2293 gene locus_tag LOCUS_22060 3348 2293 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_22060 <4465 3348 gene locus_tag LOCUS_22070 <4465 3348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962602.1:thiamine biosynthesis protein ThiH >Feature sequence105 1611 868 gene locus_tag LOCUS_22080 1611 868 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_22080 1748 2599 gene locus_tag LOCUS_22090 1748 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_22090 <4443 3284 gene locus_tag LOCUS_22100 <4443 3284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF0:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence106 497 1210 gene locus_tag LOCUS_22110 497 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1374 1249 gene locus_tag LOCUS_22120 1374 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 2043 1501 gene locus_tag LOCUS_22130 2043 1501 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404172.1 protein_id gnl|my_center|LOCUS_22130 2935 3732 gene locus_tag LOCUS_22140 2935 3732 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229183.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence107 617 102 gene locus_tag LOCUS_22150 gene aroK 617 102 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_22150 714 787 gene locus_tag LOCUS_t00250 714 787 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 838 922 gene locus_tag LOCUS_t00260 838 922 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 996 1799 gene locus_tag LOCUS_22160 996 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2183 3397 gene locus_tag LOCUS_22170 2183 3397 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262931.1 protein_id gnl|my_center|LOCUS_22170 <4117 3482 gene locus_tag LOCUS_22180 <4117 3482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001121076.1:membrane protein >Feature sequence108 3378 1906 gene locus_tag LOCUS_22190 3378 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence109 3 2090 gene locus_tag LOCUS_22200 3 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2217 2528 gene locus_tag LOCUS_22210 2217 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_22210 3492 2605 gene locus_tag LOCUS_22220 3492 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence110 1356 475 gene locus_tag LOCUS_22230 1356 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 2200 1643 gene locus_tag LOCUS_22240 gene ybcL 2200 1643 CDS product kinase inhibitor Raf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_22240 3605 2400 gene locus_tag LOCUS_22250 gene sucB 3605 2400 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_22250 >Feature sequence111 1152 58 gene locus_tag LOCUS_22260 1152 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2431 1367 gene locus_tag LOCUS_22270 gene aroC 2431 1367 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 protein_id gnl|my_center|LOCUS_22270 2676 2761 gene locus_tag LOCUS_t00270 2676 2761 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence112 232 1212 gene locus_tag LOCUS_22280 gene porQ 232 1212 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_22280 1213 1902 gene locus_tag LOCUS_22290 gene cmk 1213 1902 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_22290 2626 1997 gene locus_tag LOCUS_22300 gene queE 2626 1997 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_22300 >Feature sequence113 633 358 gene locus_tag LOCUS_22310 633 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 1796 633 gene locus_tag LOCUS_22320 gene putA 1796 633 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_22320 1887 2945 gene locus_tag LOCUS_22330 gene aroB 1887 2945 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence114 <1 1194 gene locus_tag LOCUS_22340 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYR1:DNA mismatch repair protein MutL 1197 1973 gene locus_tag LOCUS_22350 1197 1973 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_22350 1973 2827 gene locus_tag LOCUS_22360 1973 2827 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence115 <1 570 gene locus_tag LOCUS_22370 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921552.1:alpha/beta hydrolase 1187 762 gene locus_tag LOCUS_22380 1187 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2005 1550 gene locus_tag LOCUS_22390 2005 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2601 2176 gene locus_tag LOCUS_22400 2601 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence116 <1 1359 gene locus_tag LOCUS_22410 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZA1:elongation factor G 1378 1683 gene locus_tag LOCUS_22420 gene rpsJ 1378 1683 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_22420