>Feature sequence01 1385 483 gene locus_tag LOCUS_00010 1385 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_00010 2149 1385 gene locus_tag LOCUS_00020 2149 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015886998.1 protein_id gnl|my_center|LOCUS_00020 3587 2673 gene locus_tag LOCUS_00030 3587 2673 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107322.1 protein_id gnl|my_center|LOCUS_00030 4349 3609 gene locus_tag LOCUS_00040 4349 3609 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225465.1 protein_id gnl|my_center|LOCUS_00040 5368 4577 gene locus_tag LOCUS_00050 5368 4577 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_00050 6063 5410 gene locus_tag LOCUS_00060 6063 5410 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_00060 6558 7115 gene locus_tag LOCUS_00070 6558 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7127 8002 gene locus_tag LOCUS_00080 7127 8002 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229321.1 protein_id gnl|my_center|LOCUS_00080 9286 8063 gene locus_tag LOCUS_00090 gene eptA 9286 8063 CDS product phosphoethanolamine transferase EptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24867 protein_id gnl|my_center|LOCUS_00090 9420 9695 gene locus_tag LOCUS_00100 9420 9695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9692 10558 gene locus_tag LOCUS_00110 9692 10558 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940726.1 protein_id gnl|my_center|LOCUS_00110 11265 10906 gene locus_tag LOCUS_00120 11265 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11802 11308 gene locus_tag LOCUS_00130 11802 11308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12598 11807 gene locus_tag LOCUS_00140 12598 11807 CDS product phospholipid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964451.1 protein_id gnl|my_center|LOCUS_00140 13679 12744 gene locus_tag LOCUS_00150 13679 12744 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_00150 16098 13666 gene locus_tag LOCUS_00160 16098 13666 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_00160 16819 16256 gene locus_tag LOCUS_00170 16819 16256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17898 16855 gene locus_tag LOCUS_00180 17898 16855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18917 18084 gene locus_tag LOCUS_00190 18917 18084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_00190 21330 18922 gene locus_tag LOCUS_00200 21330 18922 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_00200 22855 21833 gene locus_tag LOCUS_00210 22855 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23621 24310 gene locus_tag LOCUS_00220 23621 24310 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 protein_id gnl|my_center|LOCUS_00220 24300 25964 gene locus_tag LOCUS_00230 24300 25964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 protein_id gnl|my_center|LOCUS_00230 25970 27316 gene locus_tag LOCUS_00240 25970 27316 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 protein_id gnl|my_center|LOCUS_00240 27313 28710 gene locus_tag LOCUS_00250 27313 28710 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_00250 31514 29277 gene locus_tag LOCUS_00260 31514 29277 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036291.1 protein_id gnl|my_center|LOCUS_00260 32545 31526 gene locus_tag LOCUS_00270 32545 31526 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_00270 33071 32538 gene locus_tag LOCUS_00280 33071 32538 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036293.1 protein_id gnl|my_center|LOCUS_00280 33401 34342 gene locus_tag LOCUS_00290 33401 34342 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_00290 34509 34345 gene locus_tag LOCUS_00300 34509 34345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 34545 34712 gene locus_tag LOCUS_00310 34545 34712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 35887 34814 gene locus_tag LOCUS_00320 35887 34814 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942641.1 protein_id gnl|my_center|LOCUS_00320 37047 36067 gene locus_tag LOCUS_00330 37047 36067 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063683.1 protein_id gnl|my_center|LOCUS_00330 37283 37804 gene locus_tag LOCUS_00340 37283 37804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069765.1 protein_id gnl|my_center|LOCUS_00340 37816 38328 gene locus_tag LOCUS_00350 37816 38328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 38354 38770 gene locus_tag LOCUS_00360 38354 38770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 38831 39250 gene locus_tag LOCUS_00370 gene phnB 38831 39250 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_00370 39252 39644 gene locus_tag LOCUS_00380 39252 39644 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528007.1 protein_id gnl|my_center|LOCUS_00380 39721 39984 gene locus_tag LOCUS_00390 39721 39984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40416 39994 gene locus_tag LOCUS_00400 40416 39994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090582.1 protein_id gnl|my_center|LOCUS_00400 41389 40436 gene locus_tag LOCUS_00410 41389 40436 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001082266.1 protein_id gnl|my_center|LOCUS_00410 41821 42321 gene locus_tag LOCUS_00420 41821 42321 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886701.1 protein_id gnl|my_center|LOCUS_00420 42333 42545 gene locus_tag LOCUS_00430 42333 42545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 42785 43027 gene locus_tag LOCUS_00440 42785 43027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 43237 43725 gene locus_tag LOCUS_00450 43237 43725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 43722 45164 gene locus_tag LOCUS_00460 gene accC 43722 45164 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_00460 45169 46710 gene locus_tag LOCUS_00470 gene pccB 45169 46710 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_00470 48943 47036 gene locus_tag LOCUS_00480 gene acsA 48943 47036 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_00480 50813 49101 gene locus_tag LOCUS_00490 50813 49101 CDS product sodium/solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_232332.2 protein_id gnl|my_center|LOCUS_00490 51103 50843 gene locus_tag LOCUS_00500 51103 50843 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_00500 51556 52929 gene locus_tag LOCUS_00510 51556 52929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_00510 52999 54486 gene locus_tag LOCUS_00520 52999 54486 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_00520 54521 55543 gene locus_tag LOCUS_00530 54521 55543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 55552 56163 gene locus_tag LOCUS_00540 55552 56163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 56226 57323 gene locus_tag LOCUS_00550 56226 57323 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107293.1 protein_id gnl|my_center|LOCUS_00550 57415 58683 gene locus_tag LOCUS_00560 57415 58683 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_00560 58854 59489 gene locus_tag LOCUS_00570 58854 59489 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_00570 60902 60027 gene locus_tag LOCUS_00580 60902 60027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 63008 61086 gene locus_tag LOCUS_00590 63008 61086 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_00590 62994 63464 gene locus_tag LOCUS_00600 62994 63464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362013.1 protein_id gnl|my_center|LOCUS_00600 64509 63427 gene locus_tag LOCUS_00610 gene fjo30 64509 63427 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_00610 65546 64644 gene locus_tag LOCUS_00620 gene gldN 65546 64644 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_00620 67176 65641 gene locus_tag LOCUS_00630 gene gldM 67176 65641 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_00630 67923 67270 gene locus_tag LOCUS_00640 gene gldL 67923 67270 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_00640 69224 67992 gene locus_tag LOCUS_00650 gene gldK 69224 67992 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_00650 70621 69464 gene locus_tag LOCUS_00660 gene fjo29 70621 69464 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_00660 73236 70747 gene locus_tag LOCUS_00670 gene topA 73236 70747 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_00670 73532 74977 gene locus_tag LOCUS_00680 gene miaB 73532 74977 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_00680 74983 76263 gene locus_tag LOCUS_00690 74983 76263 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 protein_id gnl|my_center|LOCUS_00690 76263 76781 gene locus_tag LOCUS_00700 76263 76781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_00700 76785 77696 gene locus_tag LOCUS_00710 76785 77696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_00710 77704 78066 gene locus_tag LOCUS_00720 77704 78066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 78206 78484 gene locus_tag LOCUS_00730 gene groS 78206 78484 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_00730 78508 80136 gene locus_tag LOCUS_00740 gene groL 78508 80136 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_00740 80573 80211 gene locus_tag LOCUS_00750 80573 80211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 82869 80638 gene locus_tag LOCUS_00760 82869 80638 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_00760 83244 82972 gene locus_tag LOCUS_00770 83244 82972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 83524 83976 gene locus_tag LOCUS_00780 83524 83976 CDS product GAF domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964137.1 protein_id gnl|my_center|LOCUS_00780 84073 85605 gene locus_tag LOCUS_00790 gene purH 84073 85605 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_00790 85661 86689 gene locus_tag LOCUS_00800 gene mreB 85661 86689 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_00800 86811 87635 gene locus_tag LOCUS_00810 gene mreC 86811 87635 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 protein_id gnl|my_center|LOCUS_00810 87625 88134 gene locus_tag LOCUS_00820 87625 88134 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792054.1 protein_id gnl|my_center|LOCUS_00820 88131 89999 gene locus_tag LOCUS_00830 gene pbpA 88131 89999 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 protein_id gnl|my_center|LOCUS_00830 89989 91272 gene locus_tag LOCUS_00840 gene rodA 89989 91272 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_00840 92152 91379 gene locus_tag LOCUS_00850 gene nucA 92152 91379 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_00850 92310 93272 gene locus_tag LOCUS_00860 92310 93272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_00860 95516 93345 gene locus_tag LOCUS_00870 95516 93345 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00870 95668 96483 gene locus_tag LOCUS_00880 gene surE 95668 96483 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_00880 96476 96757 gene locus_tag LOCUS_00890 96476 96757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964420.1 protein_id gnl|my_center|LOCUS_00890 96814 97923 gene locus_tag LOCUS_00900 gene lpxB 96814 97923 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_00900 98029 98535 gene locus_tag LOCUS_00910 98029 98535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 98621 100555 gene locus_tag LOCUS_00920 98621 100555 CDS product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 protein_id gnl|my_center|LOCUS_00920 102093 100549 gene locus_tag LOCUS_00930 102093 100549 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964426.1 protein_id gnl|my_center|LOCUS_00930 104272 102104 gene locus_tag LOCUS_00940 gene pepX1 104272 102104 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_00940 104438 105742 gene locus_tag LOCUS_00950 gene mvaA 104438 105742 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_00950 105742 106674 gene locus_tag LOCUS_00960 105742 106674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_00960 108902 106782 gene locus_tag LOCUS_00970 108902 106782 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_00970 110399 109110 gene locus_tag LOCUS_00980 110399 109110 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_00980 110605 110402 gene locus_tag LOCUS_00990 110605 110402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964519.1 protein_id gnl|my_center|LOCUS_00990 111206 110607 gene locus_tag LOCUS_01000 111206 110607 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_01000 112572 111208 gene locus_tag LOCUS_01010 112572 111208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 protein_id gnl|my_center|LOCUS_01010 113769 112615 gene locus_tag LOCUS_01020 113769 112615 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 protein_id gnl|my_center|LOCUS_01020 114606 113878 gene locus_tag LOCUS_01030 gene coaX 114606 113878 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 protein_id gnl|my_center|LOCUS_01030 114708 114781 gene locus_tag LOCUS_t00010 114708 114781 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 115006 114926 gene locus_tag LOCUS_t00020 115006 114926 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 115151 116092 gene locus_tag LOCUS_01040 gene prsA 115151 116092 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_01040 116139 116747 gene locus_tag LOCUS_01050 gene rplY 116139 116747 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_01050 116888 117454 gene locus_tag LOCUS_01060 gene pth 116888 117454 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 protein_id gnl|my_center|LOCUS_01060 118137 117457 gene locus_tag LOCUS_01070 118137 117457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 121913 118134 gene locus_tag LOCUS_01080 gene fpp1 121913 118134 CDS product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 protein_id gnl|my_center|LOCUS_01080 121961 122887 gene locus_tag LOCUS_01090 gene ribF 121961 122887 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 protein_id gnl|my_center|LOCUS_01090 122887 124197 gene locus_tag LOCUS_01100 122887 124197 CDS product type I deoxyribonuclease HsdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_01100 125349 124333 gene locus_tag LOCUS_01110 gene adhA 125349 124333 CDS product zinc-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096816.1 protein_id gnl|my_center|LOCUS_01110 125637 126164 gene locus_tag LOCUS_01120 125637 126164 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140452.1 protein_id gnl|my_center|LOCUS_01120 126271 127542 gene locus_tag LOCUS_01130 gene serS 126271 127542 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_01130 128945 127830 gene locus_tag LOCUS_01140 128945 127830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 132621 129277 gene locus_tag LOCUS_01150 132621 129277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 134641 132785 gene locus_tag LOCUS_01160 134641 132785 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_01160 137844 134653 gene locus_tag LOCUS_01170 137844 134653 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_01170 140688 138274 gene locus_tag LOCUS_01180 140688 138274 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201943.1 protein_id gnl|my_center|LOCUS_01180 141913 140738 gene locus_tag LOCUS_01190 141913 140738 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_01190 143091 142048 gene locus_tag LOCUS_01200 143091 142048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 protein_id gnl|my_center|LOCUS_01200 144301 143591 gene locus_tag LOCUS_01210 144301 143591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764129.1 protein_id gnl|my_center|LOCUS_01210 146190 144301 gene locus_tag LOCUS_01220 146190 144301 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801846.1 protein_id gnl|my_center|LOCUS_01220 149355 146209 gene locus_tag LOCUS_01230 149355 146209 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291394.1 protein_id gnl|my_center|LOCUS_01230 152147 150069 gene locus_tag LOCUS_01240 152147 150069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784055.1 protein_id gnl|my_center|LOCUS_01240 154166 152361 gene locus_tag LOCUS_01250 154166 152361 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762477.1 protein_id gnl|my_center|LOCUS_01250 154520 158428 gene locus_tag LOCUS_01260 154520 158428 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_01260 158585 160336 gene locus_tag LOCUS_01270 158585 160336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962252.1 protein_id gnl|my_center|LOCUS_01270 160351 160677 gene locus_tag LOCUS_01280 160351 160677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_01280 160674 160988 gene locus_tag LOCUS_01290 160674 160988 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021110.1 protein_id gnl|my_center|LOCUS_01290 161188 161685 gene locus_tag LOCUS_01300 161188 161685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 161746 162054 gene locus_tag LOCUS_01310 161746 162054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 162293 164659 gene locus_tag LOCUS_01320 162293 164659 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107767.1 protein_id gnl|my_center|LOCUS_01320 164695 165468 gene locus_tag LOCUS_01330 164695 165468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 165530 166009 gene locus_tag LOCUS_01340 165530 166009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107766.1 protein_id gnl|my_center|LOCUS_01340 166019 166960 gene locus_tag LOCUS_01350 166019 166960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 167166 167870 gene locus_tag LOCUS_01360 167166 167870 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397598.1 protein_id gnl|my_center|LOCUS_01360 168217 169083 gene locus_tag LOCUS_01370 gene rsmA 168217 169083 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_01370 169070 170425 gene locus_tag LOCUS_01380 gene mgtE 169070 170425 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 protein_id gnl|my_center|LOCUS_01380 170612 170977 gene locus_tag LOCUS_01390 170612 170977 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_01390 170986 171927 gene locus_tag LOCUS_01400 170986 171927 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_01400 172081 172458 gene locus_tag LOCUS_01410 172081 172458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 172537 173025 gene locus_tag LOCUS_01420 172537 173025 CDS product phosphinothricin N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990112.1 protein_id gnl|my_center|LOCUS_01420 174879 173065 gene locus_tag LOCUS_01430 174879 173065 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_01430 176212 174962 gene locus_tag LOCUS_01440 gene lysC 176212 174962 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_01440 176729 176250 gene locus_tag LOCUS_01450 176729 176250 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_01450 176848 177852 gene locus_tag LOCUS_01460 gene fbp 176848 177852 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 protein_id gnl|my_center|LOCUS_01460 178299 177871 gene locus_tag LOCUS_01470 178299 177871 CDS product fructose 1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962635.1 protein_id gnl|my_center|LOCUS_01470 178383 179468 gene locus_tag LOCUS_01480 178383 179468 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_01480 179484 181112 gene locus_tag LOCUS_01490 gene lig2 179484 181112 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_01490 181109 183574 gene locus_tag LOCUS_01500 181109 183574 CDS product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268715.1 protein_id gnl|my_center|LOCUS_01500 183715 184353 gene locus_tag LOCUS_01510 183715 184353 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 protein_id gnl|my_center|LOCUS_01510 184450 185247 gene locus_tag LOCUS_01520 184450 185247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_01520 186621 185272 gene locus_tag LOCUS_01530 186621 185272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082551.1 protein_id gnl|my_center|LOCUS_01530 187530 186745 gene locus_tag LOCUS_01540 187530 186745 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088129.1 protein_id gnl|my_center|LOCUS_01540 187767 191138 gene locus_tag LOCUS_01550 gene mfd 187767 191138 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_01550 191218 192573 gene locus_tag LOCUS_01560 191218 192573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 193253 192579 gene locus_tag LOCUS_01570 193253 192579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 193665 193306 gene locus_tag LOCUS_01580 193665 193306 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 protein_id gnl|my_center|LOCUS_01580 193858 195351 gene locus_tag LOCUS_01590 193858 195351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 protein_id gnl|my_center|LOCUS_01590 195361 197055 gene locus_tag LOCUS_01600 195361 197055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 197199 199268 gene locus_tag LOCUS_01610 gene metG 197199 199268 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_01610 199380 201506 gene locus_tag LOCUS_01620 199380 201506 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 protein_id gnl|my_center|LOCUS_01620 201609 202460 gene locus_tag LOCUS_01630 201609 202460 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257729.1 protein_id gnl|my_center|LOCUS_01630 202468 203307 gene locus_tag LOCUS_01640 202468 203307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 203853 206402 gene locus_tag LOCUS_01650 gene ppc 203853 206402 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8N7 protein_id gnl|my_center|LOCUS_01650 207643 206465 gene locus_tag LOCUS_01660 gene gcdH 207643 206465 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_01660 208485 207769 gene locus_tag LOCUS_01670 208485 207769 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 protein_id gnl|my_center|LOCUS_01670 209050 208517 gene locus_tag LOCUS_01680 gene rimM 209050 208517 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_01680 209621 209064 gene locus_tag LOCUS_01690 209621 209064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 209989 214374 gene locus_tag LOCUS_01700 gene dnaE 209989 214374 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_01700 214533 214850 gene locus_tag LOCUS_01710 214533 214850 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_01710 215065 215994 gene locus_tag LOCUS_01720 215065 215994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_01720 216137 216400 gene locus_tag LOCUS_01730 216137 216400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 216378 216452 gene locus_tag LOCUS_t00030 216378 216452 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 216472 216660 gene locus_tag LOCUS_01740 216472 216660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 216813 217052 gene locus_tag LOCUS_01750 216813 217052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 217045 217320 gene locus_tag LOCUS_01760 217045 217320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 218255 222571 gene locus_tag LOCUS_01770 218255 222571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 222598 226777 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgattgaagattagaaaacacgatatc 227330 227025 gene locus_tag LOCUS_01780 gene cas2 227330 227025 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS1 protein_id gnl|my_center|LOCUS_01780 228229 227345 gene locus_tag LOCUS_01790 gene cas1 228229 227345 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZS0 protein_id gnl|my_center|LOCUS_01790 229410 228415 gene locus_tag LOCUS_01800 229410 228415 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974604.1 protein_id gnl|my_center|LOCUS_01800 229657 230658 gene locus_tag LOCUS_01810 gene gpsA 229657 230658 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_01810 233093 230655 gene locus_tag LOCUS_01820 gene pbpC 233093 230655 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_01820 233432 233124 gene locus_tag LOCUS_01830 233432 233124 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707594.1 protein_id gnl|my_center|LOCUS_01830 233796 233440 gene locus_tag LOCUS_01840 233796 233440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_01840 233858 234445 gene locus_tag LOCUS_01850 233858 234445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 235076 234549 gene locus_tag LOCUS_01860 235076 234549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 235689 235240 gene locus_tag LOCUS_01870 235689 235240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 241296 235780 gene locus_tag LOCUS_01880 241296 235780 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 protein_id gnl|my_center|LOCUS_01880 241652 242131 gene locus_tag LOCUS_01890 241652 242131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 242221 242760 gene locus_tag LOCUS_01900 gene haaO 242221 242760 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_01900 242960 244513 gene locus_tag LOCUS_01910 gene pcd 242960 244513 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_01910 245941 244889 gene locus_tag LOCUS_01920 245941 244889 CDS product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962232.1 protein_id gnl|my_center|LOCUS_01920 246671 245946 gene locus_tag LOCUS_01930 gene pphA 246671 245946 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_01930 247029 249581 gene locus_tag LOCUS_01940 247029 249581 CDS product ribonucleoside-diphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203460.1 protein_id gnl|my_center|LOCUS_01940 249722 250669 gene locus_tag LOCUS_01950 249722 250669 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246640.1 protein_id gnl|my_center|LOCUS_01950 251813 250677 gene locus_tag LOCUS_01960 251813 250677 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 protein_id gnl|my_center|LOCUS_01960 252568 251810 gene locus_tag LOCUS_01970 252568 251810 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946047.1 protein_id gnl|my_center|LOCUS_01970 253478 252603 gene locus_tag LOCUS_01980 253478 252603 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 protein_id gnl|my_center|LOCUS_01980 253638 254639 gene locus_tag LOCUS_01990 253638 254639 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_01990 254727 255593 gene locus_tag LOCUS_02000 254727 255593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_02000 255602 257263 gene locus_tag LOCUS_02010 255602 257263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_02010 257264 258262 gene locus_tag LOCUS_02020 gene batA 257264 258262 CDS product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 protein_id gnl|my_center|LOCUS_02020 258265 259311 gene locus_tag LOCUS_02030 gene batB 258265 259311 CDS product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_02030 259292 260167 gene locus_tag LOCUS_02040 gene batC 259292 260167 CDS product BatC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962308.1 protein_id gnl|my_center|LOCUS_02040 260167 261954 gene locus_tag LOCUS_02050 gene batD 260167 261954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_02050 261995 262753 gene locus_tag LOCUS_02060 gene batE 261995 262753 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_02060 262922 263548 gene locus_tag LOCUS_02070 gene cynT 262922 263548 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_02070 263687 263965 gene locus_tag LOCUS_02080 263687 263965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 264042 265628 gene locus_tag LOCUS_02090 264042 265628 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 protein_id gnl|my_center|LOCUS_02090 265640 266278 gene locus_tag LOCUS_02100 gene cynT 265640 266278 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H168 protein_id gnl|my_center|LOCUS_02100 266661 267680 gene locus_tag LOCUS_02110 gene pheS 266661 267680 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_02110 267946 268422 gene locus_tag LOCUS_02120 267946 268422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 268497 269552 gene locus_tag LOCUS_02130 268497 269552 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_02130 269591 272737 gene locus_tag LOCUS_02140 269591 272737 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783792.1 protein_id gnl|my_center|LOCUS_02140 272768 274171 gene locus_tag LOCUS_02150 272768 274171 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108068.1 protein_id gnl|my_center|LOCUS_02150 274248 274841 gene locus_tag LOCUS_02160 274248 274841 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791598.1 protein_id gnl|my_center|LOCUS_02160 275328 274861 gene locus_tag LOCUS_02170 275328 274861 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_02170 276009 275344 gene locus_tag LOCUS_02180 276009 275344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 276038 277135 gene locus_tag LOCUS_02190 gene dinB2 276038 277135 CDS product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 protein_id gnl|my_center|LOCUS_02190 277456 277968 gene locus_tag LOCUS_02200 277456 277968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963609.1 protein_id gnl|my_center|LOCUS_02200 279523 278087 gene locus_tag LOCUS_02210 gene pykA 279523 278087 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_02210 279990 279526 gene locus_tag LOCUS_02220 279990 279526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962379.1 protein_id gnl|my_center|LOCUS_02220 280839 280102 gene locus_tag LOCUS_02230 gene rnc 280839 280102 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_02230 282098 280848 gene locus_tag LOCUS_02240 gene fabF 282098 280848 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_02240 282441 282208 gene locus_tag LOCUS_02250 gene acpP 282441 282208 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_02250 282599 283171 gene locus_tag LOCUS_02260 gene purN 282599 283171 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 protein_id gnl|my_center|LOCUS_02260 283158 283625 gene locus_tag LOCUS_02270 gene rnhA 283158 283625 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_02270 283736 284662 gene locus_tag LOCUS_02280 283736 284662 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_02280 284706 286604 gene locus_tag LOCUS_02290 gene purF 284706 286604 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_02290 288170 287562 gene locus_tag LOCUS_02300 gene sodA 288170 287562 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_02300 288293 291409 gene locus_tag LOCUS_02310 288293 291409 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 protein_id gnl|my_center|LOCUS_02310 291420 292613 gene locus_tag LOCUS_02320 gene kbl 291420 292613 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_02320 292727 294067 gene locus_tag LOCUS_02330 292727 294067 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_02330 294203 296947 gene locus_tag LOCUS_02340 294203 296947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_02340 297664 296951 gene locus_tag LOCUS_02350 297664 296951 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888106.1 protein_id gnl|my_center|LOCUS_02350 298170 299213 gene locus_tag LOCUS_02360 298170 299213 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_02360 299535 302726 gene locus_tag LOCUS_02370 299535 302726 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_02370 302806 304272 gene locus_tag LOCUS_02380 302806 304272 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766157.1 protein_id gnl|my_center|LOCUS_02380 304392 305594 gene locus_tag LOCUS_02390 304392 305594 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964539.1 protein_id gnl|my_center|LOCUS_02390 306625 305564 gene locus_tag LOCUS_02400 306625 305564 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482643.1 protein_id gnl|my_center|LOCUS_02400 307242 306622 gene locus_tag LOCUS_02410 gene arsC 307242 306622 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_02410 307848 307375 gene locus_tag LOCUS_02420 307848 307375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 protein_id gnl|my_center|LOCUS_02420 308235 307903 gene locus_tag LOCUS_02430 308235 307903 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_02430 308532 310061 gene locus_tag LOCUS_02440 308532 310061 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_02440 311373 311768 gene locus_tag LOCUS_02450 311373 311768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 311844 312974 gene locus_tag LOCUS_02460 311844 312974 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 protein_id gnl|my_center|LOCUS_02460 313353 313279 gene locus_tag LOCUS_t00040 313353 313279 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 314225 313425 gene locus_tag LOCUS_02470 314225 313425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 314371 314871 gene locus_tag LOCUS_02480 314371 314871 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966038.1 protein_id gnl|my_center|LOCUS_02480 314874 316214 gene locus_tag LOCUS_02490 314874 316214 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029304.1 protein_id gnl|my_center|LOCUS_02490 316217 317002 gene locus_tag LOCUS_02500 316217 317002 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_02500 317020 317496 gene locus_tag LOCUS_02510 317020 317496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 318314 317676 gene locus_tag LOCUS_02520 318314 317676 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022240.1 protein_id gnl|my_center|LOCUS_02520 318651 319442 gene locus_tag LOCUS_02530 318651 319442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_02530 319615 320757 gene locus_tag LOCUS_02540 319615 320757 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037018.1 protein_id gnl|my_center|LOCUS_02540 320839 321291 gene locus_tag LOCUS_02550 320839 321291 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_02550 321295 322095 gene locus_tag LOCUS_02560 gene lpxH 321295 322095 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_02560 322424 322071 gene locus_tag LOCUS_02570 322424 322071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 324432 322744 gene locus_tag LOCUS_02580 gene recJ 324432 322744 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_02580 324960 324538 gene locus_tag LOCUS_02590 324960 324538 CDS product OsmC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811690.1 protein_id gnl|my_center|LOCUS_02590 325053 326807 gene locus_tag LOCUS_02600 gene ade 325053 326807 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI0 protein_id gnl|my_center|LOCUS_02600 327502 326828 gene locus_tag LOCUS_02610 gene rsmI 327502 326828 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 protein_id gnl|my_center|LOCUS_02610 328272 327577 gene locus_tag LOCUS_02620 328272 327577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_02620 328549 329190 gene locus_tag LOCUS_02630 gene tdk 328549 329190 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_02630 329294 330403 gene locus_tag LOCUS_02640 329294 330403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 330478 330897 gene locus_tag LOCUS_02650 gene mscL 330478 330897 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI6 protein_id gnl|my_center|LOCUS_02650 331034 331573 gene locus_tag LOCUS_02660 331034 331573 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963592.1 protein_id gnl|my_center|LOCUS_02660 331655 332653 gene locus_tag LOCUS_02670 gene asd 331655 332653 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_02670 332751 334907 gene locus_tag LOCUS_02680 332751 334907 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 protein_id gnl|my_center|LOCUS_02680 334992 335969 gene locus_tag LOCUS_02690 334992 335969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 protein_id gnl|my_center|LOCUS_02690 335974 336381 gene locus_tag LOCUS_02700 335974 336381 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_02700 336837 336385 gene locus_tag LOCUS_02710 336837 336385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_02710 337968 336853 gene locus_tag LOCUS_02720 337968 336853 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_02720 339486 338131 gene locus_tag LOCUS_02730 gene accC 339486 338131 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_02730 340051 339569 gene locus_tag LOCUS_02740 gene accB 340051 339569 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_02740 341090 340095 gene locus_tag LOCUS_02750 gene fabH3 341090 340095 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_02750 342003 341467 gene locus_tag LOCUS_02760 342003 341467 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_02760 343233 342187 gene locus_tag LOCUS_02770 gene pdxA 343233 342187 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_02770 343292 343885 gene locus_tag LOCUS_02780 gene ribE 343292 343885 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_02780 344977 343889 gene locus_tag LOCUS_02790 344977 343889 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_02790 346801 344990 gene locus_tag LOCUS_02800 gene sglT 346801 344990 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_02800 346877 347632 gene locus_tag LOCUS_02810 346877 347632 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_02810 347857 349263 gene locus_tag LOCUS_02820 347857 349263 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_02820 349839 349276 gene locus_tag LOCUS_02830 349839 349276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 351001 349913 gene locus_tag LOCUS_02840 351001 349913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 352512 351004 gene locus_tag LOCUS_02850 352512 351004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 353986 352634 gene locus_tag LOCUS_02860 353986 352634 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481438.1 protein_id gnl|my_center|LOCUS_02860 355238 353991 gene locus_tag LOCUS_02870 355238 353991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 356841 355258 gene locus_tag LOCUS_02880 356841 355258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 358493 356913 gene locus_tag LOCUS_02890 358493 356913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_02890 361668 358504 gene locus_tag LOCUS_02900 361668 358504 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405560.1 protein_id gnl|my_center|LOCUS_02900 361952 362518 gene locus_tag LOCUS_02910 361952 362518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 363217 362531 gene locus_tag LOCUS_02920 363217 362531 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120647.1 protein_id gnl|my_center|LOCUS_02920 364365 363214 gene locus_tag LOCUS_02930 364365 363214 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120646.1 protein_id gnl|my_center|LOCUS_02930 365684 364383 gene locus_tag LOCUS_02940 365684 364383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120645.1 protein_id gnl|my_center|LOCUS_02940 366372 365944 gene locus_tag LOCUS_02950 366372 365944 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_02950 368181 366382 gene locus_tag LOCUS_02960 368181 366382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 370284 368431 gene locus_tag LOCUS_02970 gene kefB 370284 368431 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943387.1 protein_id gnl|my_center|LOCUS_02970 371339 370464 gene locus_tag LOCUS_02980 371339 370464 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_02980 372509 371553 gene locus_tag LOCUS_02990 372509 371553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 372844 372575 gene locus_tag LOCUS_03000 372844 372575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 373049 372867 gene locus_tag LOCUS_03010 373049 372867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 375464 374388 gene locus_tag LOCUS_03020 375464 374388 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459859.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence02 1412 291 gene locus_tag LOCUS_03030 1412 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860887.1 protein_id gnl|my_center|LOCUS_03030 1942 1514 gene locus_tag LOCUS_03040 1942 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 2933 2025 gene locus_tag LOCUS_03050 2933 2025 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528028.1 protein_id gnl|my_center|LOCUS_03050 3011 3385 gene locus_tag LOCUS_03060 3011 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4807 3413 gene locus_tag LOCUS_03070 4807 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 5496 4825 gene locus_tag LOCUS_03080 5496 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5662 7569 gene locus_tag LOCUS_03090 5662 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 7572 8315 gene locus_tag LOCUS_03100 7572 8315 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_03100 10836 8431 gene locus_tag LOCUS_03110 10836 8431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_03110 11476 10946 gene locus_tag LOCUS_03120 11476 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 12214 11861 gene locus_tag LOCUS_03130 12214 11861 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000860820.1 protein_id gnl|my_center|LOCUS_03130 12325 12690 gene locus_tag LOCUS_03140 12325 12690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12698 13297 gene locus_tag LOCUS_03150 gene azoR 12698 13297 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TL54 protein_id gnl|my_center|LOCUS_03150 13811 13365 gene locus_tag LOCUS_03160 13811 13365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 14525 14082 gene locus_tag LOCUS_03170 14525 14082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 15533 14661 gene locus_tag LOCUS_03180 15533 14661 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_03180 15723 15983 gene locus_tag LOCUS_03190 15723 15983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 17054 15999 gene locus_tag LOCUS_03200 17054 15999 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962858.1 protein_id gnl|my_center|LOCUS_03200 17761 17051 gene locus_tag LOCUS_03210 17761 17051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962859.1 protein_id gnl|my_center|LOCUS_03210 18222 17749 gene locus_tag LOCUS_03220 18222 17749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_03220 18655 18275 gene locus_tag LOCUS_03230 18655 18275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472569.1 protein_id gnl|my_center|LOCUS_03230 19146 18667 gene locus_tag LOCUS_03240 19146 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 19896 19216 gene locus_tag LOCUS_03250 19896 19216 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962862.1 protein_id gnl|my_center|LOCUS_03250 20797 20033 gene locus_tag LOCUS_03260 20797 20033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 22349 21012 gene locus_tag LOCUS_03270 22349 21012 CDS product K+ transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393256.1 protein_id gnl|my_center|LOCUS_03270 22711 22355 gene locus_tag LOCUS_03280 22711 22355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 23651 22974 gene locus_tag LOCUS_03290 gene kdpE 23651 22974 CDS product two-component regulatory protein response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001007153.2 protein_id gnl|my_center|LOCUS_03290 24726 23623 gene locus_tag LOCUS_03300 24726 23623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 24999 28283 gene locus_tag LOCUS_03310 24999 28283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_03310 28666 29457 gene locus_tag LOCUS_03320 28666 29457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 29454 30245 gene locus_tag LOCUS_03330 29454 30245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 30257 30469 gene locus_tag LOCUS_03340 30257 30469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 30536 30868 gene locus_tag LOCUS_03350 30536 30868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 31147 30929 gene locus_tag LOCUS_03360 31147 30929 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109410.1 protein_id gnl|my_center|LOCUS_03360 31721 32896 gene locus_tag LOCUS_03370 31721 32896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 32908 33276 gene locus_tag LOCUS_03380 32908 33276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 33281 33490 gene locus_tag LOCUS_03390 33281 33490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 33950 34777 gene locus_tag LOCUS_03400 33950 34777 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920429.1 protein_id gnl|my_center|LOCUS_03400 34962 35816 gene locus_tag LOCUS_03410 34962 35816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 36496 36032 gene locus_tag LOCUS_03420 36496 36032 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYB0 protein_id gnl|my_center|LOCUS_03420 37100 36618 gene locus_tag LOCUS_03430 37100 36618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 38111 37146 gene locus_tag LOCUS_03440 38111 37146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 protein_id gnl|my_center|LOCUS_03440 39089 38118 gene locus_tag LOCUS_03450 39089 38118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_03450 39145 39690 gene locus_tag LOCUS_03460 39145 39690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 40583 39693 gene locus_tag LOCUS_03470 40583 39693 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_03470 40933 40580 gene locus_tag LOCUS_03480 40933 40580 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 protein_id gnl|my_center|LOCUS_03480 41121 41675 gene locus_tag LOCUS_03490 41121 41675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 protein_id gnl|my_center|LOCUS_03490 42505 41759 gene locus_tag LOCUS_03500 42505 41759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 42594 43748 gene locus_tag LOCUS_03510 42594 43748 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_03510 44006 45349 gene locus_tag LOCUS_03520 gene gdhA 44006 45349 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_03520 45501 46220 gene locus_tag LOCUS_03530 gene recO 45501 46220 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_03530 46519 49920 gene locus_tag LOCUS_03540 gene ileS 46519 49920 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_03540 49926 50309 gene locus_tag LOCUS_03550 gene dksA 49926 50309 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_03550 50491 51120 gene locus_tag LOCUS_03560 50491 51120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 51155 51865 gene locus_tag LOCUS_03570 gene lspA 51155 51865 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_03570 52413 51853 gene locus_tag LOCUS_03580 gene ygfA 52413 51853 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_03580 53028 54815 gene locus_tag LOCUS_03590 gene uvrC 53028 54815 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_03590 54815 57067 gene locus_tag LOCUS_03600 54815 57067 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 protein_id gnl|my_center|LOCUS_03600 57493 58635 gene locus_tag LOCUS_03610 gene hppD 57493 58635 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_03610 58978 59757 gene locus_tag LOCUS_03620 58978 59757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_03620 59764 60729 gene locus_tag LOCUS_03630 59764 60729 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_03630 60736 62010 gene locus_tag LOCUS_03640 60736 62010 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_03640 62015 63652 gene locus_tag LOCUS_03650 gene pgi 62015 63652 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 protein_id gnl|my_center|LOCUS_03650 63827 66625 gene locus_tag LOCUS_03660 63827 66625 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 protein_id gnl|my_center|LOCUS_03660 66718 67176 gene locus_tag LOCUS_03670 66718 67176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_03670 68292 67252 gene locus_tag LOCUS_03680 68292 67252 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 protein_id gnl|my_center|LOCUS_03680 68506 71151 gene locus_tag LOCUS_03690 68506 71151 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 protein_id gnl|my_center|LOCUS_03690 71295 72533 gene locus_tag LOCUS_03700 71295 72533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 72902 73660 gene locus_tag LOCUS_03710 72902 73660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 73948 74415 gene locus_tag LOCUS_03720 73948 74415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858381.1 protein_id gnl|my_center|LOCUS_03720 74499 75272 gene locus_tag LOCUS_03730 74499 75272 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 protein_id gnl|my_center|LOCUS_03730 76731 75256 gene locus_tag LOCUS_03740 76731 75256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_03740 77542 76922 gene locus_tag LOCUS_03750 77542 76922 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964515.1 protein_id gnl|my_center|LOCUS_03750 77665 78564 gene locus_tag LOCUS_03760 77665 78564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 78602 80143 gene locus_tag LOCUS_03770 gene glyS 78602 80143 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 protein_id gnl|my_center|LOCUS_03770 80216 80980 gene locus_tag LOCUS_03780 gene xth 80216 80980 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 protein_id gnl|my_center|LOCUS_03780 81131 82639 gene locus_tag LOCUS_03790 81131 82639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 82752 83792 gene locus_tag LOCUS_03800 82752 83792 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104034.1 protein_id gnl|my_center|LOCUS_03800 85267 83906 gene locus_tag LOCUS_03810 gene radA 85267 83906 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_03810 86496 85354 gene locus_tag LOCUS_03820 86496 85354 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962284.1 protein_id gnl|my_center|LOCUS_03820 87427 86522 gene locus_tag LOCUS_03830 87427 86522 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_03830 87839 87489 gene locus_tag LOCUS_03840 gene panD 87839 87489 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_03840 88752 87853 gene locus_tag LOCUS_03850 gene panC 88752 87853 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_03850 88898 89614 gene locus_tag LOCUS_03860 88898 89614 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_03860 89620 91503 gene locus_tag LOCUS_03870 89620 91503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 91702 93549 gene locus_tag LOCUS_03880 gene glmS 91702 93549 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_03880 93798 96497 gene locus_tag LOCUS_03890 93798 96497 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_03890 96525 98024 gene locus_tag LOCUS_03900 96525 98024 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962292.1 protein_id gnl|my_center|LOCUS_03900 98215 99723 gene locus_tag LOCUS_03910 gene atpD 98215 99723 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_03910 99787 100065 gene locus_tag LOCUS_03920 99787 100065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_03920 100585 100211 gene locus_tag LOCUS_03930 100585 100211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 101341 100784 gene locus_tag LOCUS_03940 101341 100784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 103125 101320 gene locus_tag LOCUS_03950 103125 101320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920396.1 protein_id gnl|my_center|LOCUS_03950 103192 104322 gene locus_tag LOCUS_03960 gene bioF 103192 104322 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 protein_id gnl|my_center|LOCUS_03960 104329 104724 gene locus_tag LOCUS_03970 104329 104724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 104861 105478 gene locus_tag LOCUS_03980 gene bioD 104861 105478 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 protein_id gnl|my_center|LOCUS_03980 106948 105470 gene locus_tag LOCUS_03990 106948 105470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 107020 108294 gene locus_tag LOCUS_04000 gene bioA 107020 108294 CDS product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 protein_id gnl|my_center|LOCUS_04000 108305 109459 gene locus_tag LOCUS_04010 108305 109459 CDS product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 protein_id gnl|my_center|LOCUS_04010 109746 110840 gene locus_tag LOCUS_04020 gene bioB 109746 110840 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 protein_id gnl|my_center|LOCUS_04020 110905 111807 gene locus_tag LOCUS_04030 110905 111807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525382.1 protein_id gnl|my_center|LOCUS_04030 112276 111800 gene locus_tag LOCUS_04040 gene recX 112276 111800 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_04040 113977 112421 gene locus_tag LOCUS_04050 gene cafA 113977 112421 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_04050 114512 114222 gene locus_tag LOCUS_04060 gene hupA 114512 114222 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_04060 114640 115677 gene locus_tag LOCUS_04070 gene mutY 114640 115677 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 protein_id gnl|my_center|LOCUS_04070 115703 116158 gene locus_tag LOCUS_04080 gene ssb 115703 116158 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_04080 116226 117518 gene locus_tag LOCUS_04090 116226 117518 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 protein_id gnl|my_center|LOCUS_04090 117505 118065 gene locus_tag LOCUS_04100 gene gldD 117505 118065 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_04100 118571 118113 gene locus_tag LOCUS_04110 118571 118113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 120848 118779 gene locus_tag LOCUS_04120 120848 118779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 122172 120850 gene locus_tag LOCUS_04130 122172 120850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04130 122345 122809 gene locus_tag LOCUS_04140 122345 122809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 122992 123708 gene locus_tag LOCUS_04150 gene rplU 122992 123708 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P9 protein_id gnl|my_center|LOCUS_04150 123739 123999 gene locus_tag LOCUS_04160 gene rpmA 123739 123999 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_04160 124354 125889 gene locus_tag LOCUS_04170 124354 125889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 126058 128928 gene locus_tag LOCUS_04180 126058 128928 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783463.1 protein_id gnl|my_center|LOCUS_04180 128974 129993 gene locus_tag LOCUS_04190 128974 129993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 130228 132873 gene locus_tag LOCUS_04200 130228 132873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 132877 133779 gene locus_tag LOCUS_04210 132877 133779 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_04210 133782 135845 gene locus_tag LOCUS_04220 133782 135845 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_04220 135927 136511 gene locus_tag LOCUS_04230 135927 136511 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765673.1 protein_id gnl|my_center|LOCUS_04230 137727 136627 gene locus_tag LOCUS_04240 137727 136627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963180.1 protein_id gnl|my_center|LOCUS_04240 139156 137840 gene locus_tag LOCUS_04250 gene ahcY 139156 137840 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_04250 139324 139959 gene locus_tag LOCUS_04260 gene sfp 139324 139959 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 protein_id gnl|my_center|LOCUS_04260 140013 140273 gene locus_tag LOCUS_04270 140013 140273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 140257 140895 gene locus_tag LOCUS_04280 gene pnuC 140257 140895 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_04280 140850 141413 gene locus_tag LOCUS_04290 140850 141413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04290 141410 142957 gene locus_tag LOCUS_04300 141410 142957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04300 143152 143484 gene locus_tag LOCUS_04310 143152 143484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 143782 144084 gene locus_tag LOCUS_04320 143782 144084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 144422 144727 gene locus_tag LOCUS_04330 144422 144727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 145239 145547 gene locus_tag LOCUS_04340 145239 145547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 145773 147152 gene locus_tag LOCUS_04350 145773 147152 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762735.1 protein_id gnl|my_center|LOCUS_04350 149607 147127 gene locus_tag LOCUS_04360 149607 147127 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792029.1 protein_id gnl|my_center|LOCUS_04360 149925 152084 gene locus_tag LOCUS_04370 149925 152084 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964459.1 protein_id gnl|my_center|LOCUS_04370 152239 153249 gene locus_tag LOCUS_04380 152239 153249 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 protein_id gnl|my_center|LOCUS_04380 153364 154491 gene locus_tag LOCUS_04390 153364 154491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 154923 154504 gene locus_tag LOCUS_04400 154923 154504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964454.1 protein_id gnl|my_center|LOCUS_04400 155141 155617 gene locus_tag LOCUS_04410 gene greA 155141 155617 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_04410 155666 156058 gene locus_tag LOCUS_04420 155666 156058 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 protein_id gnl|my_center|LOCUS_04420 156401 156045 gene locus_tag LOCUS_04430 156401 156045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 157550 156405 gene locus_tag LOCUS_04440 gene porY 157550 156405 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_04440 157662 158543 gene locus_tag LOCUS_04450 157662 158543 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_04450 158550 158924 gene locus_tag LOCUS_04460 158550 158924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_04460 159007 159675 gene locus_tag LOCUS_04470 gene aat 159007 159675 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 protein_id gnl|my_center|LOCUS_04470 160350 159658 gene locus_tag LOCUS_04480 160350 159658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 160846 160331 gene locus_tag LOCUS_04490 160846 160331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 161468 160905 gene locus_tag LOCUS_04500 gene tag 161468 160905 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957540.1 protein_id gnl|my_center|LOCUS_04500 161680 162279 gene locus_tag LOCUS_04510 161680 162279 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_04510 162984 162262 gene locus_tag LOCUS_04520 162984 162262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 163760 163062 gene locus_tag LOCUS_04530 gene truB 163760 163062 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_04530 164545 163760 gene locus_tag LOCUS_04540 gene uppP 164545 163760 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H239 protein_id gnl|my_center|LOCUS_04540 164815 164549 gene locus_tag LOCUS_04550 gene fjo13 164815 164549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_04550 165703 164825 gene locus_tag LOCUS_04560 gene ftsX 165703 164825 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 protein_id gnl|my_center|LOCUS_04560 167736 165886 gene locus_tag LOCUS_04570 167736 165886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 167925 170945 gene locus_tag LOCUS_04580 167925 170945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 171267 172367 gene locus_tag LOCUS_04590 171267 172367 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA0 protein_id gnl|my_center|LOCUS_04590 172494 173189 gene locus_tag LOCUS_04600 172494 173189 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964453.1 protein_id gnl|my_center|LOCUS_04600 173884 173366 gene locus_tag LOCUS_04610 gene ftnA 173884 173366 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H6 protein_id gnl|my_center|LOCUS_04610 174297 173977 gene locus_tag LOCUS_04620 174297 173977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 174850 174338 gene locus_tag LOCUS_04630 174850 174338 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_04630 176228 174855 gene locus_tag LOCUS_04640 176228 174855 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_04640 176337 176726 gene locus_tag LOCUS_04650 176337 176726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_04650 176766 178382 gene locus_tag LOCUS_04660 gene pckA 176766 178382 CDS product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q816Q7 protein_id gnl|my_center|LOCUS_04660 179179 178427 gene locus_tag LOCUS_04670 179179 178427 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_04670 179835 179179 gene locus_tag LOCUS_04680 179835 179179 CDS product DUF4271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962358.1 protein_id gnl|my_center|LOCUS_04680 181502 179835 gene locus_tag LOCUS_04690 181502 179835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 181631 182359 gene locus_tag LOCUS_04700 181631 182359 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_04700 182361 183695 gene locus_tag LOCUS_04710 gene pyrC1 182361 183695 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_04710 183699 184106 gene locus_tag LOCUS_04720 183699 184106 CDS product lipoprotein precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962340.1 protein_id gnl|my_center|LOCUS_04720 185180 184173 gene locus_tag LOCUS_04730 185180 184173 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_04730 185353 186648 gene locus_tag LOCUS_04740 gene tyrS 185353 186648 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 protein_id gnl|my_center|LOCUS_04740 186722 187159 gene locus_tag LOCUS_04750 186722 187159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 188140 187163 gene locus_tag LOCUS_04760 188140 187163 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_04760 188611 188288 gene locus_tag LOCUS_04770 188611 188288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 189099 188791 gene locus_tag LOCUS_04780 189099 188791 CDS product T9SS C-terminal target domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962299.1 protein_id gnl|my_center|LOCUS_04780 191315 189255 gene locus_tag LOCUS_04790 191315 189255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 194117 191328 gene locus_tag LOCUS_04800 194117 191328 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_04800 194337 195032 gene locus_tag LOCUS_04810 gene phoP 194337 195032 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_04810 195032 196096 gene locus_tag LOCUS_04820 gene phoR 195032 196096 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_04820 196243 196914 gene locus_tag LOCUS_04830 gene trmB 196243 196914 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_04830 196918 197547 gene locus_tag LOCUS_04840 196918 197547 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962540.1 protein_id gnl|my_center|LOCUS_04840 197547 197897 gene locus_tag LOCUS_04850 gene ogt2 197547 197897 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_04850 198137 199276 gene locus_tag LOCUS_04860 gene mrp 198137 199276 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_04860 199279 199521 gene locus_tag LOCUS_04870 199279 199521 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_04870 199569 200624 gene locus_tag LOCUS_04880 199569 200624 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_04880 200664 201059 gene locus_tag LOCUS_04890 200664 201059 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_04890 201981 201079 gene locus_tag LOCUS_04900 201981 201079 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_04900 202194 201991 gene locus_tag LOCUS_04910 202194 201991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 202451 202579 gene locus_tag LOCUS_04920 202451 202579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 204557 202821 gene locus_tag LOCUS_04930 gene ygaD 204557 202821 CDS product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 protein_id gnl|my_center|LOCUS_04930 204817 207021 gene locus_tag LOCUS_04940 204817 207021 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_04940 207198 207872 gene locus_tag LOCUS_04950 207198 207872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 208954 207917 gene locus_tag LOCUS_04960 208954 207917 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_04960 209847 208960 gene locus_tag LOCUS_04970 209847 208960 CDS product apolipoprotein acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_04970 210207 210452 gene locus_tag LOCUS_04980 210207 210452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 210443 210766 gene locus_tag LOCUS_04990 210443 210766 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_04990 211691 211044 gene locus_tag LOCUS_05000 211691 211044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 212233 211853 gene locus_tag LOCUS_05010 212233 211853 CDS product acetaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035360.1 protein_id gnl|my_center|LOCUS_05010 213767 212244 gene locus_tag LOCUS_05020 gene aldA 213767 212244 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYG9 protein_id gnl|my_center|LOCUS_05020 214002 214910 gene locus_tag LOCUS_05030 214002 214910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 215985 214921 gene locus_tag LOCUS_05040 215985 214921 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_05040 217107 216001 gene locus_tag LOCUS_05050 217107 216001 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120946.1 protein_id gnl|my_center|LOCUS_05050 217568 217104 gene locus_tag LOCUS_05060 217568 217104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332434.1 protein_id gnl|my_center|LOCUS_05060 218899 217583 gene locus_tag LOCUS_05070 218899 217583 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369355.1 protein_id gnl|my_center|LOCUS_05070 219929 219036 gene locus_tag LOCUS_05080 219929 219036 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_05080 220894 219941 gene locus_tag LOCUS_05090 220894 219941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 221098 223482 gene locus_tag LOCUS_05100 221098 223482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 224710 223508 gene locus_tag LOCUS_05110 224710 223508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 224770 228471 gene locus_tag LOCUS_05120 224770 228471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 229339 228479 gene locus_tag LOCUS_05130 229339 228479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 229611 231266 gene locus_tag LOCUS_05140 229611 231266 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 protein_id gnl|my_center|LOCUS_05140 232538 231438 gene locus_tag LOCUS_05150 232538 231438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_05150 234053 232701 gene locus_tag LOCUS_05160 234053 232701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 234423 234058 gene locus_tag LOCUS_05170 234423 234058 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761500.1 protein_id gnl|my_center|LOCUS_05170 236031 234604 gene locus_tag LOCUS_05180 236031 234604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_05180 236189 236271 gene locus_tag LOCUS_t00050 236189 236271 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 237736 236654 gene locus_tag LOCUS_05190 237736 236654 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315813.1 protein_id gnl|my_center|LOCUS_05190 238712 237822 gene locus_tag LOCUS_05200 238712 237822 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651837.1 protein_id gnl|my_center|LOCUS_05200 239584 238814 gene locus_tag LOCUS_05210 239584 238814 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_05210 240429 239680 gene locus_tag LOCUS_05220 240429 239680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967667.1 protein_id gnl|my_center|LOCUS_05220 241453 240509 gene locus_tag LOCUS_05230 241453 240509 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643797.1 protein_id gnl|my_center|LOCUS_05230 242356 241634 gene locus_tag LOCUS_05240 242356 241634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 243380 242466 gene locus_tag LOCUS_05250 243380 242466 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_05250 244165 243401 gene locus_tag LOCUS_05260 244165 243401 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705962.1 protein_id gnl|my_center|LOCUS_05260 245529 244687 gene locus_tag LOCUS_05270 245529 244687 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727784.1 protein_id gnl|my_center|LOCUS_05270 246557 245604 gene locus_tag LOCUS_05280 246557 245604 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786279.1 protein_id gnl|my_center|LOCUS_05280 247943 247020 gene locus_tag LOCUS_05290 247943 247020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 248964 248116 gene locus_tag LOCUS_05300 gene yisY 248964 248116 CDS product AB hydrolase superfamily protein YisY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06734 protein_id gnl|my_center|LOCUS_05300 249946 249125 gene locus_tag LOCUS_05310 249946 249125 CDS product chloroperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529999.1 protein_id gnl|my_center|LOCUS_05310 250990 250166 gene locus_tag LOCUS_05320 250990 250166 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765858.1 protein_id gnl|my_center|LOCUS_05320 251383 251069 gene locus_tag LOCUS_05330 251383 251069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967855.1 protein_id gnl|my_center|LOCUS_05330 252198 251404 gene locus_tag LOCUS_05340 252198 251404 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207439.1 protein_id gnl|my_center|LOCUS_05340 252323 252703 gene locus_tag LOCUS_05350 252323 252703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 253242 254462 gene locus_tag LOCUS_05360 253242 254462 CDS product Bcr/CflA family drug resistance efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957917.1 protein_id gnl|my_center|LOCUS_05360 255368 254484 gene locus_tag LOCUS_05370 255368 254484 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 protein_id gnl|my_center|LOCUS_05370 255744 258143 gene locus_tag LOCUS_05380 255744 258143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_05380 258266 259060 gene locus_tag LOCUS_05390 258266 259060 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200881.1 protein_id gnl|my_center|LOCUS_05390 259506 259069 gene locus_tag LOCUS_05400 259506 259069 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460339.1 protein_id gnl|my_center|LOCUS_05400 259885 260856 gene locus_tag LOCUS_05410 259885 260856 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_05410 262387 261029 gene locus_tag LOCUS_05420 262387 261029 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107401.1 protein_id gnl|my_center|LOCUS_05420 263748 262384 gene locus_tag LOCUS_05430 263748 262384 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762306.1 protein_id gnl|my_center|LOCUS_05430 264030 265376 gene locus_tag LOCUS_05440 264030 265376 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107803.1 protein_id gnl|my_center|LOCUS_05440 265391 266641 gene locus_tag LOCUS_05450 265391 266641 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202492.1 protein_id gnl|my_center|LOCUS_05450 266652 267005 gene locus_tag LOCUS_05460 266652 267005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 267151 267849 gene locus_tag LOCUS_05470 267151 267849 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_05470 267878 270283 gene locus_tag LOCUS_05480 267878 270283 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05480 270304 272700 gene locus_tag LOCUS_05490 270304 272700 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05490 272733 273491 gene locus_tag LOCUS_05500 272733 273491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 273502 275946 gene locus_tag LOCUS_05510 273502 275946 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05510 275979 278366 gene locus_tag LOCUS_05520 275979 278366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05520 278392 280788 gene locus_tag LOCUS_05530 278392 280788 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_05530 280807 283248 gene locus_tag LOCUS_05540 280807 283248 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05540 283287 285668 gene locus_tag LOCUS_05550 283287 285668 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05550 285728 288088 gene locus_tag LOCUS_05560 285728 288088 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_05560 288127 290535 gene locus_tag LOCUS_05570 288127 290535 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202706.1 protein_id gnl|my_center|LOCUS_05570 290679 292874 gene locus_tag LOCUS_05580 290679 292874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_05580 293011 295419 gene locus_tag LOCUS_05590 293011 295419 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_05590 295435 296163 gene locus_tag LOCUS_05600 295435 296163 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761370.1 protein_id gnl|my_center|LOCUS_05600 296496 297668 gene locus_tag LOCUS_05610 296496 297668 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_05610 297668 298177 gene locus_tag LOCUS_05620 297668 298177 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388296.1 protein_id gnl|my_center|LOCUS_05620 300916 299573 gene locus_tag LOCUS_05630 gene xylE 300916 299573 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_05630 302344 301103 gene locus_tag LOCUS_05640 gene kdtA 302344 301103 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_05640 302432 303583 gene locus_tag LOCUS_05650 gene porR 302432 303583 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_05650 303589 304608 gene locus_tag LOCUS_05660 gene galE 303589 304608 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 protein_id gnl|my_center|LOCUS_05660 304671 305024 gene locus_tag LOCUS_05670 304671 305024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964494.1 protein_id gnl|my_center|LOCUS_05670 305484 305086 gene locus_tag LOCUS_05680 305484 305086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 305708 308524 gene locus_tag LOCUS_05690 gene sucA 305708 308524 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_05690 308564 309784 gene locus_tag LOCUS_05700 gene sucB 308564 309784 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_05700 310283 309843 gene locus_tag LOCUS_05710 310283 309843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 310320 311087 gene locus_tag LOCUS_05720 310320 311087 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 protein_id gnl|my_center|LOCUS_05720 311100 312128 gene locus_tag LOCUS_05730 gene ansA 311100 312128 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 protein_id gnl|my_center|LOCUS_05730 312194 312282 gene locus_tag LOCUS_t00060 312194 312282 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 312386 313153 gene locus_tag LOCUS_05740 312386 313153 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_05740 313181 313624 gene locus_tag LOCUS_05750 313181 313624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 313679 314263 gene locus_tag LOCUS_05760 313679 314263 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_05760 314285 314767 gene locus_tag LOCUS_05770 314285 314767 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_05770 314906 315550 gene locus_tag LOCUS_05780 314906 315550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_05780 316202 315594 gene locus_tag LOCUS_05790 316202 315594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 protein_id gnl|my_center|LOCUS_05790 317656 316199 gene locus_tag LOCUS_05800 gene rpoN 317656 316199 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_05800 319132 317699 gene locus_tag LOCUS_05810 gene asnS 319132 317699 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_05810 321622 319223 gene locus_tag LOCUS_05820 321622 319223 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_05820 324096 321670 gene locus_tag LOCUS_05830 324096 321670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962609.1 protein_id gnl|my_center|LOCUS_05830 324979 324425 gene locus_tag LOCUS_05840 gene frr 324979 324425 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_05840 325725 325018 gene locus_tag LOCUS_05850 gene pyrH 325725 325018 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_05850 325974 327767 gene locus_tag LOCUS_05860 325974 327767 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963061.1 protein_id gnl|my_center|LOCUS_05860 328225 328037 gene locus_tag LOCUS_05870 328225 328037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 329689 328865 gene locus_tag LOCUS_05880 gene tsf 329689 328865 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_05880 330912 329863 gene locus_tag LOCUS_05890 330912 329863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 331501 331115 gene locus_tag LOCUS_05900 gene rpsI 331501 331115 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_05900 331956 331501 gene locus_tag LOCUS_05910 gene rplM 331956 331501 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_05910 332432 332109 gene locus_tag LOCUS_05920 332432 332109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 332432 332659 gene locus_tag LOCUS_05930 332432 332659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 332716 333201 gene locus_tag LOCUS_05940 332716 333201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 336133 333296 gene locus_tag LOCUS_05950 gene polA 336133 333296 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 protein_id gnl|my_center|LOCUS_05950 337272 336277 gene locus_tag LOCUS_05960 gene aspG 337272 336277 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_05960 337315 338037 gene locus_tag LOCUS_05970 gene cutC 337315 338037 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CI67 protein_id gnl|my_center|LOCUS_05970 338094 339323 gene locus_tag LOCUS_05980 338094 339323 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_05980 339409 339705 gene locus_tag LOCUS_05990 339409 339705 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_05990 340867 340586 gene locus_tag LOCUS_06000 340867 340586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06000 341730 340864 gene locus_tag LOCUS_06010 341730 340864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_06010 342151 343245 gene locus_tag LOCUS_06020 342151 343245 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_06020 343800 343615 gene locus_tag LOCUS_06030 343800 343615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 344657 344043 gene locus_tag LOCUS_06040 344657 344043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence03 505 1389 gene locus_tag LOCUS_06050 505 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 1470 2267 gene locus_tag LOCUS_06060 1470 2267 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039239.1 protein_id gnl|my_center|LOCUS_06060 3145 3603 gene locus_tag LOCUS_06070 3145 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4676 3651 gene locus_tag LOCUS_06080 4676 3651 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_06080 4921 8004 gene locus_tag LOCUS_06090 4921 8004 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108758.1 protein_id gnl|my_center|LOCUS_06090 8008 9381 gene locus_tag LOCUS_06100 8008 9381 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766186.1 protein_id gnl|my_center|LOCUS_06100 9418 10863 gene locus_tag LOCUS_06110 9418 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 10951 11664 gene locus_tag LOCUS_06120 10951 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 11774 12541 gene locus_tag LOCUS_06130 gene nagB 11774 12541 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_06130 12534 14108 gene locus_tag LOCUS_06140 12534 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 14121 15593 gene locus_tag LOCUS_06150 14121 15593 CDS product sodium-coupled permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227769.1 protein_id gnl|my_center|LOCUS_06150 15597 16748 gene locus_tag LOCUS_06160 gene nagA 15597 16748 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XWH7 protein_id gnl|my_center|LOCUS_06160 16811 18436 gene locus_tag LOCUS_06170 16811 18436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 19290 18499 gene locus_tag LOCUS_06180 gene yeeZ 19290 18499 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_06180 21590 19308 gene locus_tag LOCUS_06190 21590 19308 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228011.1 protein_id gnl|my_center|LOCUS_06190 21834 22298 gene locus_tag LOCUS_06200 21834 22298 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_06200 22679 22329 gene locus_tag LOCUS_06210 22679 22329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 protein_id gnl|my_center|LOCUS_06210 23456 22881 gene locus_tag LOCUS_06220 23456 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 23730 23428 gene locus_tag LOCUS_06230 23730 23428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 24274 23861 gene locus_tag LOCUS_06240 24274 23861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 25238 24357 gene locus_tag LOCUS_06250 25238 24357 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169648.1 protein_id gnl|my_center|LOCUS_06250 25672 25250 gene locus_tag LOCUS_06260 25672 25250 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966951.1 protein_id gnl|my_center|LOCUS_06260 26660 25926 gene locus_tag LOCUS_06270 26660 25926 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525829.1 protein_id gnl|my_center|LOCUS_06270 27524 26661 gene locus_tag LOCUS_06280 27524 26661 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946370.1 protein_id gnl|my_center|LOCUS_06280 28500 27802 gene locus_tag LOCUS_06290 28500 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 28778 29626 gene locus_tag LOCUS_06300 28778 29626 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639946.1 protein_id gnl|my_center|LOCUS_06300 29623 30117 gene locus_tag LOCUS_06310 29623 30117 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763624.1 protein_id gnl|my_center|LOCUS_06310 30095 30646 gene locus_tag LOCUS_06320 30095 30646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 32151 30664 gene locus_tag LOCUS_06330 32151 30664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 33633 32293 gene locus_tag LOCUS_06340 33633 32293 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107678.1 protein_id gnl|my_center|LOCUS_06340 34082 33789 gene locus_tag LOCUS_06350 34082 33789 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_06350 34693 34079 gene locus_tag LOCUS_06360 34693 34079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 35308 34898 gene locus_tag LOCUS_06370 35308 34898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 35858 35400 gene locus_tag LOCUS_06380 35858 35400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 36749 35928 gene locus_tag LOCUS_06390 36749 35928 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_06390 37435 36776 gene locus_tag LOCUS_06400 gene sirR 37435 36776 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_06400 37514 39817 gene locus_tag LOCUS_06410 37514 39817 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 protein_id gnl|my_center|LOCUS_06410 39819 40304 gene locus_tag LOCUS_06420 39819 40304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 40535 41683 gene locus_tag LOCUS_06430 gene crtY 40535 41683 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_06430 42031 45360 gene locus_tag LOCUS_06440 gene gdhP 42031 45360 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118605.1 protein_id gnl|my_center|LOCUS_06440 46314 45340 gene locus_tag LOCUS_06450 46314 45340 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_06450 46590 47195 gene locus_tag LOCUS_06460 46590 47195 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_06460 47200 48534 gene locus_tag LOCUS_06470 47200 48534 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 protein_id gnl|my_center|LOCUS_06470 48575 49747 gene locus_tag LOCUS_06480 48575 49747 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_06480 49752 53234 gene locus_tag LOCUS_06490 49752 53234 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_06490 54043 53312 gene locus_tag LOCUS_06500 54043 53312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 54234 54064 gene locus_tag LOCUS_06510 54234 54064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 55276 54572 gene locus_tag LOCUS_06520 55276 54572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 56640 55390 gene locus_tag LOCUS_06530 56640 55390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 57771 56755 gene locus_tag LOCUS_06540 57771 56755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 58517 57861 gene locus_tag LOCUS_06550 58517 57861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 59563 59060 gene locus_tag LOCUS_06560 59563 59060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 60695 61396 gene locus_tag LOCUS_06570 60695 61396 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_06570 61393 63270 gene locus_tag LOCUS_06580 61393 63270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 63479 63994 gene locus_tag LOCUS_06590 63479 63994 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_06590 64208 64813 gene locus_tag LOCUS_06600 64208 64813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 64954 65337 gene locus_tag LOCUS_06610 64954 65337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_06610 65544 66827 gene locus_tag LOCUS_06620 65544 66827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 67339 66986 gene locus_tag LOCUS_06630 67339 66986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_06630 67564 69375 gene locus_tag LOCUS_06640 gene aspS 67564 69375 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_06640 69493 71202 gene locus_tag LOCUS_06650 69493 71202 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760864.1 protein_id gnl|my_center|LOCUS_06650 71207 71464 gene locus_tag LOCUS_06660 71207 71464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 71970 71521 gene locus_tag LOCUS_06670 gene tadA 71970 71521 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_06670 72144 73907 gene locus_tag LOCUS_06680 gene dxs 72144 73907 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 protein_id gnl|my_center|LOCUS_06680 73894 75063 gene locus_tag LOCUS_06690 73894 75063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 76475 75060 gene locus_tag LOCUS_06700 gene dgt 76475 75060 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_06700 76783 77919 gene locus_tag LOCUS_06710 76783 77919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 77991 80261 gene locus_tag LOCUS_06720 77991 80261 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A666 protein_id gnl|my_center|LOCUS_06720 80582 81043 gene locus_tag LOCUS_06730 80582 81043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 81649 81059 gene locus_tag LOCUS_06740 gene nadD 81649 81059 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_06740 82252 81674 gene locus_tag LOCUS_06750 gene gmk 82252 81674 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 protein_id gnl|my_center|LOCUS_06750 83097 82252 gene locus_tag LOCUS_06760 83097 82252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_06760 84248 83433 gene locus_tag LOCUS_06770 84248 83433 CDS product endo-1,3-1,4-beta glucanase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265727.1 protein_id gnl|my_center|LOCUS_06770 85079 84324 gene locus_tag LOCUS_06780 85079 84324 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_06780 86155 85103 gene locus_tag LOCUS_06790 86155 85103 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_06790 86470 86922 gene locus_tag LOCUS_06800 86470 86922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 88153 87017 gene locus_tag LOCUS_06810 88153 87017 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919503.1 protein_id gnl|my_center|LOCUS_06810 89423 88185 gene locus_tag LOCUS_06820 89423 88185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 90682 89453 gene locus_tag LOCUS_06830 90682 89453 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 protein_id gnl|my_center|LOCUS_06830 91139 90696 gene locus_tag LOCUS_06840 91139 90696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 92138 91152 gene locus_tag LOCUS_06850 92138 91152 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_06850 92273 93985 gene locus_tag LOCUS_06860 92273 93985 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_06860 93985 94632 gene locus_tag LOCUS_06870 93985 94632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 94697 95566 gene locus_tag LOCUS_06880 94697 95566 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDL2 protein_id gnl|my_center|LOCUS_06880 98294 95859 gene locus_tag LOCUS_06890 gene nrdA 98294 95859 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_06890 99466 98480 gene locus_tag LOCUS_06900 gene nrdB 99466 98480 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_06900 100578 99985 gene locus_tag LOCUS_06910 100578 99985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 100741 100589 gene locus_tag LOCUS_06920 100741 100589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 102169 100811 gene locus_tag LOCUS_06930 102169 100811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 102542 103276 gene locus_tag LOCUS_06940 102542 103276 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_06940 103418 105262 gene locus_tag LOCUS_06950 103418 105262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 105824 105255 gene locus_tag LOCUS_06960 105824 105255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_06960 106082 105873 gene locus_tag LOCUS_06970 106082 105873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 105972 106544 gene locus_tag LOCUS_06980 105972 106544 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_06980 106665 106868 gene locus_tag LOCUS_06990 106665 106868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962630.1 protein_id gnl|my_center|LOCUS_06990 108469 106865 gene locus_tag LOCUS_07000 108469 106865 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_07000 108986 108492 gene locus_tag LOCUS_07010 108986 108492 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_07010 109655 109071 gene locus_tag LOCUS_07020 109655 109071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_07020 110481 109720 gene locus_tag LOCUS_07030 110481 109720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 110611 110994 gene locus_tag LOCUS_07040 gene yqiW 110611 110994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 protein_id gnl|my_center|LOCUS_07040 111167 111904 gene locus_tag LOCUS_07050 gene plsC 111167 111904 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 protein_id gnl|my_center|LOCUS_07050 111901 112560 gene locus_tag LOCUS_07060 111901 112560 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 protein_id gnl|my_center|LOCUS_07060 112664 114085 gene locus_tag LOCUS_07070 112664 114085 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_07070 114524 114147 gene locus_tag LOCUS_07080 114524 114147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_07080 115761 114667 gene locus_tag LOCUS_07090 115761 114667 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958153.1 protein_id gnl|my_center|LOCUS_07090 117460 115904 gene locus_tag LOCUS_07100 117460 115904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 118263 117481 gene locus_tag LOCUS_07110 gene crt 118263 117481 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_07110 119726 118317 gene locus_tag LOCUS_07120 119726 118317 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_07120 120419 119826 gene locus_tag LOCUS_07130 120419 119826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_07130 123547 120461 gene locus_tag LOCUS_07140 123547 120461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_07140 126784 123650 gene locus_tag LOCUS_07150 126784 123650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 128470 127067 gene locus_tag LOCUS_07160 128470 127067 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948764.1 protein_id gnl|my_center|LOCUS_07160 129501 128470 gene locus_tag LOCUS_07170 gene hemH 129501 128470 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_07170 129739 130812 gene locus_tag LOCUS_07180 129739 130812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 130934 134452 gene locus_tag LOCUS_07190 130934 134452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 134487 135305 gene locus_tag LOCUS_07200 134487 135305 CDS product xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794479.1 protein_id gnl|my_center|LOCUS_07200 136680 135790 gene locus_tag LOCUS_07210 136680 135790 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_07210 136884 138140 gene locus_tag LOCUS_07220 gene hemA 136884 138140 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_07220 138137 139039 gene locus_tag LOCUS_07230 gene hemC 138137 139039 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 protein_id gnl|my_center|LOCUS_07230 139042 140787 gene locus_tag LOCUS_07240 139042 140787 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109365.1 protein_id gnl|my_center|LOCUS_07240 140800 141504 gene locus_tag LOCUS_07250 140800 141504 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785882.1 protein_id gnl|my_center|LOCUS_07250 141485 142162 gene locus_tag LOCUS_07260 gene hemD 141485 142162 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_07260 142190 143242 gene locus_tag LOCUS_07270 gene hemE 142190 143242 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_07270 143288 144190 gene locus_tag LOCUS_07280 gene hemF 143288 144190 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_07280 144276 145253 gene locus_tag LOCUS_07290 gene hemB 144276 145253 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_07290 145635 146150 gene locus_tag LOCUS_07300 145635 146150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 146161 147468 gene locus_tag LOCUS_07310 146161 147468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 147532 148650 gene locus_tag LOCUS_07320 147532 148650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_07320 148651 149127 gene locus_tag LOCUS_07330 gene ogt1 148651 149127 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 protein_id gnl|my_center|LOCUS_07330 149394 151175 gene locus_tag LOCUS_07340 149394 151175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 151176 151889 gene locus_tag LOCUS_07350 151176 151889 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_07350 153994 151886 gene locus_tag LOCUS_07360 153994 151886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 154665 155876 gene locus_tag LOCUS_07370 gene hflX 154665 155876 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_07370 157420 156488 gene locus_tag LOCUS_07380 157420 156488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 157994 157485 gene locus_tag LOCUS_07390 157994 157485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_07390 158327 157998 gene locus_tag LOCUS_07400 158327 157998 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_07400 158786 158364 gene locus_tag LOCUS_07410 gene sufE 158786 158364 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_07410 159346 158915 gene locus_tag LOCUS_07420 159346 158915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 160605 159379 gene locus_tag LOCUS_07430 gene sufS 160605 159379 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 protein_id gnl|my_center|LOCUS_07430 161979 160645 gene locus_tag LOCUS_07440 gene sufD 161979 160645 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_07440 162776 162024 gene locus_tag LOCUS_07450 gene sufC 162776 162024 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_07450 164274 162829 gene locus_tag LOCUS_07460 gene sufB 164274 162829 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_07460 164670 164341 gene locus_tag LOCUS_07470 gene sufA 164670 164341 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_07470 164938 165984 gene locus_tag LOCUS_07480 gene thiL 164938 165984 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_07480 166257 165988 gene locus_tag LOCUS_07490 166257 165988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 166491 167777 gene locus_tag LOCUS_07500 166491 167777 CDS product branched-chain amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459557.1 protein_id gnl|my_center|LOCUS_07500 169116 167818 gene locus_tag LOCUS_07510 gene pepP 169116 167818 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_07510 169701 172400 gene locus_tag LOCUS_07520 169701 172400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 172554 173063 gene locus_tag LOCUS_07530 172554 173063 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617516.1 protein_id gnl|my_center|LOCUS_07530 174073 173069 gene locus_tag LOCUS_07540 174073 173069 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962397.1 protein_id gnl|my_center|LOCUS_07540 174367 175035 gene locus_tag LOCUS_07550 gene sdhC 174367 175035 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_07550 175038 177041 gene locus_tag LOCUS_07560 gene sdhA 175038 177041 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_07560 177049 177795 gene locus_tag LOCUS_07570 gene sdhB 177049 177795 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_07570 177957 178442 gene locus_tag LOCUS_07580 177957 178442 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837388.1 protein_id gnl|my_center|LOCUS_07580 178589 179161 gene locus_tag LOCUS_07590 gene pfpI 178589 179161 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090767.1 protein_id gnl|my_center|LOCUS_07590 179294 180442 gene locus_tag LOCUS_07600 179294 180442 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204047.1 protein_id gnl|my_center|LOCUS_07600 180931 180449 gene locus_tag LOCUS_07610 180931 180449 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814588.1 protein_id gnl|my_center|LOCUS_07610 182834 182181 gene locus_tag LOCUS_07620 gene atoA 182834 182181 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_07620 183538 182837 gene locus_tag LOCUS_07630 gene atoD 183538 182837 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_07630 186053 183711 gene locus_tag LOCUS_07640 gene mrcA 186053 183711 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_07640 186535 186053 gene locus_tag LOCUS_07650 gene gldH 186535 186053 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_07650 187661 186528 gene locus_tag LOCUS_07660 187661 186528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 189019 187988 gene locus_tag LOCUS_07670 gene yceA 189019 187988 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_07670 189285 190292 gene locus_tag LOCUS_07680 gene recA 189285 190292 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_07680 190378 190806 gene locus_tag LOCUS_07690 190378 190806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 190923 191372 gene locus_tag LOCUS_07700 190923 191372 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_07700 191524 192972 gene locus_tag LOCUS_07710 191524 192972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 193624 193016 gene locus_tag LOCUS_07720 193624 193016 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_07720 193814 194806 gene locus_tag LOCUS_07730 gene trpS 193814 194806 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_07730 196147 195038 gene locus_tag LOCUS_07740 gene smf 196147 195038 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 protein_id gnl|my_center|LOCUS_07740 196251 197192 gene locus_tag LOCUS_07750 196251 197192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_07750 197247 197765 gene locus_tag LOCUS_07760 197247 197765 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_07760 199025 197796 gene locus_tag LOCUS_07770 199025 197796 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_07770 199812 199027 gene locus_tag LOCUS_07780 199812 199027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 protein_id gnl|my_center|LOCUS_07780 200791 199817 gene locus_tag LOCUS_07790 200791 199817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 201804 200788 gene locus_tag LOCUS_07800 201804 200788 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_07800 202276 201842 gene locus_tag LOCUS_07810 gene dut 202276 201842 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 protein_id gnl|my_center|LOCUS_07810 203736 202273 gene locus_tag LOCUS_07820 203736 202273 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_07820 204907 204047 gene locus_tag LOCUS_07830 gene atpG 204907 204047 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_07830 206704 205127 gene locus_tag LOCUS_07840 gene atpA 206704 205127 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_07840 207290 206751 gene locus_tag LOCUS_07850 gene atpH 207290 206751 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_07850 207796 207296 gene locus_tag LOCUS_07860 gene atpF 207796 207296 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_07860 208165 207974 gene locus_tag LOCUS_07870 208165 207974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 209227 208199 gene locus_tag LOCUS_07880 gene atpB 209227 208199 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_07880 210028 209636 gene locus_tag LOCUS_07890 210028 209636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 210264 210031 gene locus_tag LOCUS_07900 210264 210031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 210658 210236 gene locus_tag LOCUS_07910 210658 210236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_07910 213186 210664 gene locus_tag LOCUS_07920 gene sprE 213186 210664 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_07920 214124 213429 gene locus_tag LOCUS_07930 214124 213429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785344.1 protein_id gnl|my_center|LOCUS_07930 215620 214148 gene locus_tag LOCUS_07940 215620 214148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 215769 216818 gene locus_tag LOCUS_07950 gene paaE 215769 216818 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_07950 218032 217250 gene locus_tag LOCUS_07960 218032 217250 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258987.1 protein_id gnl|my_center|LOCUS_07960 218420 219112 gene locus_tag LOCUS_07970 218420 219112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 219248 219583 gene locus_tag LOCUS_07980 219248 219583 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I3A6 protein_id gnl|my_center|LOCUS_07980 219695 220750 gene locus_tag LOCUS_07990 219695 220750 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272562.1 protein_id gnl|my_center|LOCUS_07990 221129 221743 gene locus_tag LOCUS_08000 221129 221743 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941434.1 protein_id gnl|my_center|LOCUS_08000 222744 221740 gene locus_tag LOCUS_08010 222744 221740 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_08010 223408 222803 gene locus_tag LOCUS_08020 223408 222803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_08020 224375 223437 gene locus_tag LOCUS_08030 224375 223437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 224559 224780 gene locus_tag LOCUS_08040 224559 224780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 226158 224887 gene locus_tag LOCUS_08050 gene purD 226158 224887 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 protein_id gnl|my_center|LOCUS_08050 227183 226206 gene locus_tag LOCUS_08060 227183 226206 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_08060 228545 227193 gene locus_tag LOCUS_08070 gene wcaJ 228545 227193 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964563.1 protein_id gnl|my_center|LOCUS_08070 229500 228721 gene locus_tag LOCUS_08080 229500 228721 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946515.1 protein_id gnl|my_center|LOCUS_08080 230099 229503 gene locus_tag LOCUS_08090 230099 229503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 234328 233243 gene locus_tag LOCUS_08100 gene wbmB 234328 233243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064737.1 protein_id gnl|my_center|LOCUS_08100 235486 234332 gene locus_tag LOCUS_08110 235486 234332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 236406 235495 gene locus_tag LOCUS_08120 236406 235495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 237743 236535 gene locus_tag LOCUS_08130 237743 236535 CDS product O-unit flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_08130 238872 237994 gene locus_tag LOCUS_08140 gene rmlD 238872 237994 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_08140 239417 238872 gene locus_tag LOCUS_08150 gene rmlC 239417 238872 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964566.1 protein_id gnl|my_center|LOCUS_08150 240283 239417 gene locus_tag LOCUS_08160 gene rfbA 240283 239417 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C714 protein_id gnl|my_center|LOCUS_08160 240698 240465 gene locus_tag LOCUS_08170 240698 240465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 242061 241003 gene locus_tag LOCUS_08180 gene rmlB 242061 241003 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_08180 243118 242063 gene locus_tag LOCUS_08190 243118 242063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 244807 243122 gene locus_tag LOCUS_08200 244807 243122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_08200 246498 244993 gene locus_tag LOCUS_08210 246498 244993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_08210 247373 246504 gene locus_tag LOCUS_08220 247373 246504 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_08220 247589 247774 gene locus_tag LOCUS_08230 247589 247774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 248047 250167 gene locus_tag LOCUS_08240 248047 250167 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_08240 250620 250790 gene locus_tag LOCUS_08250 250620 250790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 251876 250890 gene locus_tag LOCUS_08260 251876 250890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 253546 251897 gene locus_tag LOCUS_08270 253546 251897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 254845 253652 gene locus_tag LOCUS_08280 gene pgk 254845 253652 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_08280 255029 256180 gene locus_tag LOCUS_08290 gene holB 255029 256180 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_08290 256202 256603 gene locus_tag LOCUS_08300 256202 256603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_08300 256719 256646 gene locus_tag LOCUS_t00070 256719 256646 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 257205 256840 gene locus_tag LOCUS_08310 gene folB 257205 256840 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_08310 258283 257336 gene locus_tag LOCUS_08320 gene sprF 258283 257336 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962198.1 protein_id gnl|my_center|LOCUS_08320 273281 258306 gene locus_tag LOCUS_08330 273281 258306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 275305 273281 gene locus_tag LOCUS_08340 275305 273281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 277580 275310 gene locus_tag LOCUS_08350 277580 275310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 277831 279519 gene locus_tag LOCUS_08360 gene glnS 277831 279519 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_08360 279968 280297 gene locus_tag LOCUS_08370 279968 280297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 280304 280654 gene locus_tag LOCUS_08380 280304 280654 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964582.1 protein_id gnl|my_center|LOCUS_08380 280651 280869 gene locus_tag LOCUS_08390 280651 280869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 281815 281006 gene locus_tag LOCUS_08400 281815 281006 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_08400 283770 282250 gene locus_tag LOCUS_08410 gene gltX 283770 282250 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_08410 284040 287354 gene locus_tag LOCUS_08420 284040 287354 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_08420 287335 287754 gene locus_tag LOCUS_08430 gene ybeY 287335 287754 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_08430 287763 289631 gene locus_tag LOCUS_08440 gene mnmG 287763 289631 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_08440 289923 290750 gene locus_tag LOCUS_08450 289923 290750 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_08450 291002 291508 gene locus_tag LOCUS_08460 291002 291508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 292229 291564 gene locus_tag LOCUS_08470 292229 291564 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 protein_id gnl|my_center|LOCUS_08470 292863 292234 gene locus_tag LOCUS_08480 292863 292234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 295163 292974 gene locus_tag LOCUS_08490 gene rnr 295163 292974 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_08490 295862 296314 gene locus_tag LOCUS_08500 gene rpiB 295862 296314 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_08500 296360 296815 gene locus_tag LOCUS_08510 gene elaA 296360 296815 CDS product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 protein_id gnl|my_center|LOCUS_08510 297283 296909 gene locus_tag LOCUS_08520 297283 296909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 298700 297453 gene locus_tag LOCUS_08530 298700 297453 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXL6 protein_id gnl|my_center|LOCUS_08530 298799 299998 gene locus_tag LOCUS_08540 298799 299998 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_08540 300027 300374 gene locus_tag LOCUS_08550 300027 300374 CDS product type III effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_08550 300943 300371 gene locus_tag LOCUS_08560 300943 300371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 protein_id gnl|my_center|LOCUS_08560 302529 300979 gene locus_tag LOCUS_08570 302529 300979 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919511.1 protein_id gnl|my_center|LOCUS_08570 302971 302519 gene locus_tag LOCUS_08580 302971 302519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 303446 303667 gene locus_tag LOCUS_08590 303446 303667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 303866 304150 gene locus_tag LOCUS_08600 303866 304150 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_08600 304876 304274 gene locus_tag LOCUS_08610 304876 304274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 305265 305050 gene locus_tag LOCUS_08620 305265 305050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 307559 305370 gene locus_tag LOCUS_08630 307559 305370 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787240.1 protein_id gnl|my_center|LOCUS_08630 308260 307742 gene locus_tag LOCUS_08640 308260 307742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 308660 308469 gene locus_tag LOCUS_08650 308660 308469 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_08650 309347 308871 gene locus_tag LOCUS_08660 gene guaD 309347 308871 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34598 protein_id gnl|my_center|LOCUS_08660 309448 310335 gene locus_tag LOCUS_08670 309448 310335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_08670 312466 310451 gene locus_tag LOCUS_08680 312466 310451 CDS product acylaminoacyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947368.1 protein_id gnl|my_center|LOCUS_08680 314251 312659 gene locus_tag LOCUS_08690 gene prc 314251 312659 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_08690 314789 314406 gene locus_tag LOCUS_08700 gene rnpA 314789 314406 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H257 protein_id gnl|my_center|LOCUS_08700 316794 314926 gene locus_tag LOCUS_08710 316794 314926 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_08710 318435 316798 gene locus_tag LOCUS_08720 318435 316798 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_08720 318908 318483 gene locus_tag LOCUS_08730 318908 318483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 319777 318917 gene locus_tag LOCUS_08740 319777 318917 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_08740 319931 321784 gene locus_tag LOCUS_08750 319931 321784 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972017.1 protein_id gnl|my_center|LOCUS_08750 322177 324207 gene locus_tag LOCUS_08760 322177 324207 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932816.1 protein_id gnl|my_center|LOCUS_08760 324212 325981 gene locus_tag LOCUS_08770 324212 325981 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_08770 326126 326449 gene locus_tag LOCUS_08780 326126 326449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 326461 326943 gene locus_tag LOCUS_08790 326461 326943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001700947.1 protein_id gnl|my_center|LOCUS_08790 328771 326975 gene locus_tag LOCUS_08800 gene lepA 328771 326975 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 protein_id gnl|my_center|LOCUS_08800 328979 331369 gene locus_tag LOCUS_08810 328979 331369 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405046.1 protein_id gnl|my_center|LOCUS_08810 331521 332516 gene locus_tag LOCUS_08820 331521 332516 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_08820 333775 332576 gene locus_tag LOCUS_08830 333775 332576 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_08830 334171 333779 gene locus_tag LOCUS_08840 gene rbfA 334171 333779 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_08840 334243 334647 gene locus_tag LOCUS_08850 334243 334647 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_08850 334794 334868 gene locus_tag LOCUS_t00080 334794 334868 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 336477 335866 gene locus_tag LOCUS_08860 336477 335866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 337116 336523 gene locus_tag LOCUS_08870 337116 336523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 338754 337879 gene locus_tag LOCUS_08880 338754 337879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 342660 338845 gene locus_tag LOCUS_08890 342660 338845 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108527.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence04 881 525 gene locus_tag LOCUS_08900 881 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1695 901 gene locus_tag LOCUS_08910 1695 901 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090363.1 protein_id gnl|my_center|LOCUS_08910 2865 2014 gene locus_tag LOCUS_08920 2865 2014 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_08920 4151 3048 gene locus_tag LOCUS_08930 4151 3048 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021039.1 protein_id gnl|my_center|LOCUS_08930 4487 4771 gene locus_tag LOCUS_08940 4487 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 4810 5640 gene locus_tag LOCUS_08950 4810 5640 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074319.1 protein_id gnl|my_center|LOCUS_08950 6979 5669 gene locus_tag LOCUS_08960 gene dbpA 6979 5669 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962821.1 protein_id gnl|my_center|LOCUS_08960 8365 7046 gene locus_tag LOCUS_08970 8365 7046 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 protein_id gnl|my_center|LOCUS_08970 8977 8549 gene locus_tag LOCUS_08980 8977 8549 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G65 protein_id gnl|my_center|LOCUS_08980 9212 10672 gene locus_tag LOCUS_08990 9212 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 12062 10713 gene locus_tag LOCUS_09000 gene rhlE 12062 10713 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_09000 12262 14397 gene locus_tag LOCUS_09010 12262 14397 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203284.1 protein_id gnl|my_center|LOCUS_09010 15286 14414 gene locus_tag LOCUS_09020 15286 14414 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528888.1 protein_id gnl|my_center|LOCUS_09020 17613 15676 gene locus_tag LOCUS_09030 17613 15676 CDS product cadmium/zinc/cobalt-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962595.1 protein_id gnl|my_center|LOCUS_09030 18080 17667 gene locus_tag LOCUS_09040 18080 17667 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_09040 18180 19040 gene locus_tag LOCUS_09050 gene rlmF 18180 19040 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CKP5 protein_id gnl|my_center|LOCUS_09050 20667 19111 gene locus_tag LOCUS_09060 20667 19111 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_09060 21512 20835 gene locus_tag LOCUS_09070 gene chd1 21512 20835 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119974.1 protein_id gnl|my_center|LOCUS_09070 22905 22462 gene locus_tag LOCUS_09080 22905 22462 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MEN3 protein_id gnl|my_center|LOCUS_09080 23560 22973 gene locus_tag LOCUS_09090 23560 22973 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_09090 24793 25170 gene locus_tag LOCUS_09100 24793 25170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962310.1 protein_id gnl|my_center|LOCUS_09100 26210 25755 gene locus_tag LOCUS_09110 26210 25755 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_09110 27481 26522 gene locus_tag LOCUS_09120 gene yeiH 27481 26522 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263101.1 protein_id gnl|my_center|LOCUS_09120 28457 27549 gene locus_tag LOCUS_09130 28457 27549 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785776.1 protein_id gnl|my_center|LOCUS_09130 29894 28626 gene locus_tag LOCUS_09140 gene entS 29894 28626 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117292.1 protein_id gnl|my_center|LOCUS_09140 30064 30900 gene locus_tag LOCUS_09150 30064 30900 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_09150 31766 31002 gene locus_tag LOCUS_09160 31766 31002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_09160 34555 31814 gene locus_tag LOCUS_09170 34555 31814 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_09170 35576 34608 gene locus_tag LOCUS_09180 35576 34608 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_09180 36250 35675 gene locus_tag LOCUS_09190 36250 35675 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784499.1 protein_id gnl|my_center|LOCUS_09190 39184 36503 gene locus_tag LOCUS_09200 39184 36503 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141168.1 protein_id gnl|my_center|LOCUS_09200 40067 39798 gene locus_tag LOCUS_09210 40067 39798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 41080 40064 gene locus_tag LOCUS_09220 41080 40064 CDS product peptidase M4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022497.1 protein_id gnl|my_center|LOCUS_09220 42275 41187 gene locus_tag LOCUS_09230 42275 41187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 42909 42280 gene locus_tag LOCUS_09240 42909 42280 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256910.1 protein_id gnl|my_center|LOCUS_09240 43934 42909 gene locus_tag LOCUS_09250 43934 42909 CDS product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_09250 45135 43936 gene locus_tag LOCUS_09260 gene moeA 45135 43936 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_09260 45917 45138 gene locus_tag LOCUS_09270 45917 45138 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ULX9 protein_id gnl|my_center|LOCUS_09270 46978 45908 gene locus_tag LOCUS_09280 46978 45908 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143401.1 protein_id gnl|my_center|LOCUS_09280 47568 46975 gene locus_tag LOCUS_09290 47568 46975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 48606 47623 gene locus_tag LOCUS_09300 gene moaA 48606 47623 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y870 protein_id gnl|my_center|LOCUS_09300 48920 48666 gene locus_tag LOCUS_09310 gene moaD 48920 48666 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDC0 protein_id gnl|my_center|LOCUS_09310 50045 49116 gene locus_tag LOCUS_09320 50045 49116 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53WD3 protein_id gnl|my_center|LOCUS_09320 50210 51301 gene locus_tag LOCUS_09330 50210 51301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 52839 51370 gene locus_tag LOCUS_09340 52839 51370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 53500 52898 gene locus_tag LOCUS_09350 53500 52898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946025.1 protein_id gnl|my_center|LOCUS_09350 54046 53582 gene locus_tag LOCUS_09360 54046 53582 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263864.1 protein_id gnl|my_center|LOCUS_09360 54933 54052 gene locus_tag LOCUS_09370 54933 54052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970113.1 protein_id gnl|my_center|LOCUS_09370 55015 56349 gene locus_tag LOCUS_09380 55015 56349 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 protein_id gnl|my_center|LOCUS_09380 56742 56368 gene locus_tag LOCUS_09390 56742 56368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 57312 57079 gene locus_tag LOCUS_09400 57312 57079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 57932 57318 gene locus_tag LOCUS_09410 57932 57318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 58341 58682 gene locus_tag LOCUS_09420 58341 58682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 60642 59800 gene locus_tag LOCUS_09430 gene menB 60642 59800 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 protein_id gnl|my_center|LOCUS_09430 61873 60707 gene locus_tag LOCUS_09440 61873 60707 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 protein_id gnl|my_center|LOCUS_09440 63734 62223 gene locus_tag LOCUS_09450 63734 62223 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 protein_id gnl|my_center|LOCUS_09450 64435 63878 gene locus_tag LOCUS_09460 64435 63878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963095.1 protein_id gnl|my_center|LOCUS_09460 64590 65453 gene locus_tag LOCUS_09470 gene rpoD 64590 65453 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_09470 66815 66078 gene locus_tag LOCUS_09480 66815 66078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 68602 66908 gene locus_tag LOCUS_09490 68602 66908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 68782 70071 gene locus_tag LOCUS_09500 68782 70071 CDS product peptidase M19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267353.1 protein_id gnl|my_center|LOCUS_09500 70589 70188 gene locus_tag LOCUS_09510 70589 70188 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_09510 71634 70735 gene locus_tag LOCUS_09520 71634 70735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 73021 71663 gene locus_tag LOCUS_09530 73021 71663 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709100.1 protein_id gnl|my_center|LOCUS_09530 73343 73684 gene locus_tag LOCUS_09540 73343 73684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 protein_id gnl|my_center|LOCUS_09540 74353 73655 gene locus_tag LOCUS_09550 74353 73655 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932742.1 protein_id gnl|my_center|LOCUS_09550 74450 75244 gene locus_tag LOCUS_09560 gene cysE 74450 75244 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 protein_id gnl|my_center|LOCUS_09560 75234 76118 gene locus_tag LOCUS_09570 gene cysM 75234 76118 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 protein_id gnl|my_center|LOCUS_09570 76753 76247 gene locus_tag LOCUS_09580 76753 76247 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_09580 77972 76938 gene locus_tag LOCUS_09590 gene corA 77972 76938 CDS product magnesium and cobalt transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021725.1 protein_id gnl|my_center|LOCUS_09590 78981 78193 gene locus_tag LOCUS_09600 gene truA 78981 78193 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E1G5 protein_id gnl|my_center|LOCUS_09600 80668 79223 gene locus_tag LOCUS_09610 80668 79223 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074151.1 protein_id gnl|my_center|LOCUS_09610 82018 80681 gene locus_tag LOCUS_09620 82018 80681 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074152.1 protein_id gnl|my_center|LOCUS_09620 82323 82736 gene locus_tag LOCUS_09630 82323 82736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 84291 82822 gene locus_tag LOCUS_09640 84291 82822 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_09640 85504 84362 gene locus_tag LOCUS_09650 85504 84362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_09650 85743 86399 gene locus_tag LOCUS_09660 85743 86399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 87034 86414 gene locus_tag LOCUS_09670 gene hisIE 87034 86414 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 protein_id gnl|my_center|LOCUS_09670 87832 87077 gene locus_tag LOCUS_09680 gene hisF 87832 87077 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_09680 88357 87839 gene locus_tag LOCUS_09690 88357 87839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 89078 88347 gene locus_tag LOCUS_09700 gene hisA 89078 88347 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_09700 89793 89209 gene locus_tag LOCUS_09710 gene hisH 89793 89209 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_09710 90975 89842 gene locus_tag LOCUS_09720 gene hisB 90975 89842 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_09720 92059 90998 gene locus_tag LOCUS_09730 gene hisC 92059 90998 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_09730 93382 92096 gene locus_tag LOCUS_09740 gene hisD 93382 92096 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_09740 93814 93383 gene locus_tag LOCUS_09750 93814 93383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 94682 93825 gene locus_tag LOCUS_09760 gene hisG 94682 93825 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_09760 95746 94925 gene locus_tag LOCUS_09770 95746 94925 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_09770 97768 95753 gene locus_tag LOCUS_09780 97768 95753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_09780 98591 97845 gene locus_tag LOCUS_09790 98591 97845 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_09790 99659 98787 gene locus_tag LOCUS_09800 gene sucD 99659 98787 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_09800 100677 99736 gene locus_tag LOCUS_09810 100677 99736 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_09810 101355 100789 gene locus_tag LOCUS_09820 gene efp 101355 100789 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_09820 102147 101362 gene locus_tag LOCUS_09830 gene lpxA 102147 101362 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_09830 103550 102150 gene locus_tag LOCUS_09840 gene fabZ 103550 102150 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_09840 104568 103543 gene locus_tag LOCUS_09850 gene lpxD 104568 103543 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_09850 105695 104592 gene locus_tag LOCUS_09860 105695 104592 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_09860 105860 107404 gene locus_tag LOCUS_09870 gene porX 105860 107404 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_09870 107440 107853 gene locus_tag LOCUS_09880 107440 107853 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_09880 108159 108542 gene locus_tag LOCUS_09890 108159 108542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 109662 108712 gene locus_tag LOCUS_09900 109662 108712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 111044 111283 gene locus_tag LOCUS_09910 111044 111283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 111325 112524 gene locus_tag LOCUS_09920 gene ald 111325 112524 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_09920 112528 112908 gene locus_tag LOCUS_09930 112528 112908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 114095 112929 gene locus_tag LOCUS_09940 gene putA 114095 112929 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_09940 114189 115250 gene locus_tag LOCUS_09950 gene aroB 114189 115250 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 protein_id gnl|my_center|LOCUS_09950 116189 115299 gene locus_tag LOCUS_09960 116189 115299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 116701 116186 gene locus_tag LOCUS_09970 116701 116186 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_09970 117248 116769 gene locus_tag LOCUS_09980 117248 116769 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_09980 118457 117351 gene locus_tag LOCUS_09990 118457 117351 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_09990 118827 119240 gene locus_tag LOCUS_10000 118827 119240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_10000 119299 119682 gene locus_tag LOCUS_10010 119299 119682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_10010 120734 119775 gene locus_tag LOCUS_10020 120734 119775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919320.1 protein_id gnl|my_center|LOCUS_10020 123800 121146 gene locus_tag LOCUS_10030 gene parC 123800 121146 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_10030 125685 123829 gene locus_tag LOCUS_10040 gene parE 125685 123829 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_10040 126974 125880 gene locus_tag LOCUS_10050 gene engD 126974 125880 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_10050 127991 127641 gene locus_tag LOCUS_10060 gene fdx1 127991 127641 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_10060 128061 129131 gene locus_tag LOCUS_10070 128061 129131 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_10070 129193 130257 gene locus_tag LOCUS_10080 gene serC 129193 130257 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 protein_id gnl|my_center|LOCUS_10080 130313 131263 gene locus_tag LOCUS_10090 gene serA 130313 131263 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_10090 131355 131987 gene locus_tag LOCUS_10100 131355 131987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962799.1 protein_id gnl|my_center|LOCUS_10100 132146 132631 gene locus_tag LOCUS_10110 132146 132631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962798.1 protein_id gnl|my_center|LOCUS_10110 132665 132988 gene locus_tag LOCUS_10120 132665 132988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_10120 133903 133025 gene locus_tag LOCUS_10130 133903 133025 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_10130 134432 133971 gene locus_tag LOCUS_10140 134432 133971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 135653 134433 gene locus_tag LOCUS_10150 135653 134433 CDS product molybdopterin containing oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853131.1 protein_id gnl|my_center|LOCUS_10150 136071 135772 gene locus_tag LOCUS_10160 136071 135772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962796.1 protein_id gnl|my_center|LOCUS_10160 136856 136257 gene locus_tag LOCUS_10170 gene folE 136856 136257 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P85 protein_id gnl|my_center|LOCUS_10170 137539 137000 gene locus_tag LOCUS_10180 gene msrA 137539 137000 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_10180 138044 138706 gene locus_tag LOCUS_10190 gene lolD 138044 138706 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_10190 138709 139266 gene locus_tag LOCUS_10200 138709 139266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 139263 140027 gene locus_tag LOCUS_10210 139263 140027 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_10210 140089 141591 gene locus_tag LOCUS_10220 140089 141591 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_10220 142081 141860 gene locus_tag LOCUS_10230 142081 141860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 142959 144527 gene locus_tag LOCUS_10240 gene glpA 142959 144527 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_10240 144600 146090 gene locus_tag LOCUS_10250 gene glpK 144600 146090 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WHM7 protein_id gnl|my_center|LOCUS_10250 146216 146953 gene locus_tag LOCUS_10260 gene glpF 146216 146953 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_10260 147018 148388 gene locus_tag LOCUS_10270 gene mscS2 147018 148388 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_10270 148472 149260 gene locus_tag LOCUS_10280 148472 149260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_10280 149303 150373 gene locus_tag LOCUS_10290 gene tqsA 149303 150373 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118294.1 protein_id gnl|my_center|LOCUS_10290 150583 151269 gene locus_tag LOCUS_10300 150583 151269 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107331.1 protein_id gnl|my_center|LOCUS_10300 151365 152894 gene locus_tag LOCUS_10310 151365 152894 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787651.1 protein_id gnl|my_center|LOCUS_10310 152992 154218 gene locus_tag LOCUS_10320 152992 154218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 154251 155342 gene locus_tag LOCUS_10330 154251 155342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_10330 155484 156047 gene locus_tag LOCUS_10340 155484 156047 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815873.1 protein_id gnl|my_center|LOCUS_10340 156052 157056 gene locus_tag LOCUS_10350 156052 157056 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944069.1 protein_id gnl|my_center|LOCUS_10350 157222 159147 gene locus_tag LOCUS_10360 157222 159147 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_10360 159144 160397 gene locus_tag LOCUS_10370 gene pyrC2 159144 160397 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_10370 160407 160733 gene locus_tag LOCUS_10380 160407 160733 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_10380 160735 161394 gene locus_tag LOCUS_10390 160735 161394 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_10390 161885 161391 gene locus_tag LOCUS_10400 161885 161391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_10400 162549 161899 gene locus_tag LOCUS_10410 gene phnP 162549 161899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_10410 162746 164206 gene locus_tag LOCUS_10420 162746 164206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 protein_id gnl|my_center|LOCUS_10420 164849 164397 gene locus_tag LOCUS_10430 164849 164397 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_10430 164908 165570 gene locus_tag LOCUS_10440 gene nth 164908 165570 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_10440 165725 165582 gene locus_tag LOCUS_10450 165725 165582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 166380 165799 gene locus_tag LOCUS_10460 166380 165799 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_10460 166630 169407 gene locus_tag LOCUS_10470 gene uvrA1 166630 169407 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_10470 169531 170745 gene locus_tag LOCUS_10480 169531 170745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 172298 170829 gene locus_tag LOCUS_10490 172298 170829 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868291.1 protein_id gnl|my_center|LOCUS_10490 173569 172289 gene locus_tag LOCUS_10500 173569 172289 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_10500 176016 173569 gene locus_tag LOCUS_10510 176016 173569 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_10510 176283 176020 gene locus_tag LOCUS_10520 176283 176020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 176387 177430 gene locus_tag LOCUS_10530 176387 177430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963908.1 protein_id gnl|my_center|LOCUS_10530 177525 178646 gene locus_tag LOCUS_10540 gene yghO 177525 178646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_10540 179949 178804 gene locus_tag LOCUS_10550 179949 178804 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_10550 181239 180199 gene locus_tag LOCUS_10560 181239 180199 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963027.1 protein_id gnl|my_center|LOCUS_10560 183383 181326 gene locus_tag LOCUS_10570 gene ptrB 183383 181326 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_10570 183694 184020 gene locus_tag LOCUS_10580 183694 184020 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 protein_id gnl|my_center|LOCUS_10580 184239 184685 gene locus_tag LOCUS_10590 184239 184685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 184763 185086 gene locus_tag LOCUS_10600 184763 185086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 186103 185081 gene locus_tag LOCUS_10610 gene ltaE 186103 185081 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_10610 188530 186119 gene locus_tag LOCUS_10620 188530 186119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405145.1 protein_id gnl|my_center|LOCUS_10620 188720 190186 gene locus_tag LOCUS_10630 188720 190186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257880.1 protein_id gnl|my_center|LOCUS_10630 190168 190431 gene locus_tag LOCUS_10640 190168 190431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 190465 191412 gene locus_tag LOCUS_10650 190465 191412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057009.1 protein_id gnl|my_center|LOCUS_10650 191438 192289 gene locus_tag LOCUS_10660 191438 192289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 192426 193457 gene locus_tag LOCUS_10670 gene prfB 192426 193457 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_10670 193551 193892 gene locus_tag LOCUS_10680 gene arsC 193551 193892 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_10680 194204 194689 gene locus_tag LOCUS_10690 194204 194689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 194730 197180 gene locus_tag LOCUS_10700 194730 197180 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_10700 197494 197321 gene locus_tag LOCUS_10710 197494 197321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 protein_id gnl|my_center|LOCUS_10710 197779 199176 gene locus_tag LOCUS_10720 gene fumC 197779 199176 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_10720 200230 199343 gene locus_tag LOCUS_10730 200230 199343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 201715 200531 gene locus_tag LOCUS_10740 201715 200531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 202035 201811 gene locus_tag LOCUS_10750 202035 201811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 202578 203369 gene locus_tag LOCUS_10760 202578 203369 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766271.1 protein_id gnl|my_center|LOCUS_10760 205261 204173 gene locus_tag LOCUS_10770 205261 204173 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085719.1 protein_id gnl|my_center|LOCUS_10770 208494 205267 gene locus_tag LOCUS_10780 208494 205267 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140878.1 protein_id gnl|my_center|LOCUS_10780 209889 208507 gene locus_tag LOCUS_10790 209889 208507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 210042 211073 gene locus_tag LOCUS_10800 210042 211073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 211070 211774 gene locus_tag LOCUS_10810 211070 211774 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_10810 213504 211813 gene locus_tag LOCUS_10820 213504 211813 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_10820 213726 213544 gene locus_tag LOCUS_10830 213726 213544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963197.1 protein_id gnl|my_center|LOCUS_10830 214781 213798 gene locus_tag LOCUS_10840 214781 213798 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_10840 214858 216486 gene locus_tag LOCUS_10850 214858 216486 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_10850 217924 216614 gene locus_tag LOCUS_10860 217924 216614 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256013.1 protein_id gnl|my_center|LOCUS_10860 219192 218119 gene locus_tag LOCUS_10870 gene menE 219192 218119 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_10870 220138 219155 gene locus_tag LOCUS_10880 gene yyaK 220138 219155 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_10880 221280 220129 gene locus_tag LOCUS_10890 gene menC 221280 220129 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 protein_id gnl|my_center|LOCUS_10890 223270 221372 gene locus_tag LOCUS_10900 223270 221372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 224678 223932 gene locus_tag LOCUS_10910 224678 223932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 225617 224709 gene locus_tag LOCUS_10920 gene menA 225617 224709 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 protein_id gnl|my_center|LOCUS_10920 226218 225619 gene locus_tag LOCUS_10930 226218 225619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 227222 226359 gene locus_tag LOCUS_10940 227222 226359 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_10940 227684 227343 gene locus_tag LOCUS_10950 227684 227343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963785.1 protein_id gnl|my_center|LOCUS_10950 229430 227724 gene locus_tag LOCUS_10960 gene menD 229430 227724 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 protein_id gnl|my_center|LOCUS_10960 230594 229491 gene locus_tag LOCUS_10970 gene menF 230594 229491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 protein_id gnl|my_center|LOCUS_10970 231066 230608 gene locus_tag LOCUS_10980 231066 230608 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_10980 231137 231784 gene locus_tag LOCUS_10990 231137 231784 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_10990 231781 232341 gene locus_tag LOCUS_11000 231781 232341 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854745.1 protein_id gnl|my_center|LOCUS_11000 232533 233339 gene locus_tag LOCUS_11010 232533 233339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 234348 233419 gene locus_tag LOCUS_11020 234348 233419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 236337 234493 gene locus_tag LOCUS_11030 gene dnaK 236337 234493 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 protein_id gnl|my_center|LOCUS_11030 236670 238094 gene locus_tag LOCUS_11040 gene sdaA 236670 238094 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963040.1 protein_id gnl|my_center|LOCUS_11040 238433 238110 gene locus_tag LOCUS_11050 238433 238110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 238682 239500 gene locus_tag LOCUS_11060 gene panB 238682 239500 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_11060 239515 240009 gene locus_tag LOCUS_11070 gene lspA 239515 240009 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK54 protein_id gnl|my_center|LOCUS_11070 240009 240707 gene locus_tag LOCUS_11080 240009 240707 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_11080 241006 240782 gene locus_tag LOCUS_11090 241006 240782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 241986 241444 gene locus_tag LOCUS_11100 241986 241444 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119848.1 protein_id gnl|my_center|LOCUS_11100 243813 242269 gene locus_tag LOCUS_11110 243813 242269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_11110 243960 245132 gene locus_tag LOCUS_11120 243960 245132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 245132 246250 gene locus_tag LOCUS_11130 gene leuB 245132 246250 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 protein_id gnl|my_center|LOCUS_11130 247541 246318 gene locus_tag LOCUS_11140 247541 246318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 247802 250225 gene locus_tag LOCUS_11150 gene pheT 247802 250225 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_11150 250871 250368 gene locus_tag LOCUS_11160 250871 250368 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528503.1 protein_id gnl|my_center|LOCUS_11160 251729 251220 gene locus_tag LOCUS_11170 251729 251220 CDS product fasciclin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038746.1 protein_id gnl|my_center|LOCUS_11170 252110 252829 gene locus_tag LOCUS_11180 252110 252829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 254638 253010 gene locus_tag LOCUS_11190 254638 253010 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 protein_id gnl|my_center|LOCUS_11190 254817 256223 gene locus_tag LOCUS_11200 254817 256223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_11200 257065 256412 gene locus_tag LOCUS_11210 gene tal 257065 256412 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_11210 257957 257142 gene locus_tag LOCUS_11220 257957 257142 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_11220 258818 259858 gene locus_tag LOCUS_11230 258818 259858 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_11230 259861 260253 gene locus_tag LOCUS_11240 259861 260253 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207371.1 protein_id gnl|my_center|LOCUS_11240 260399 261808 gene locus_tag LOCUS_11250 260399 261808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_11250 261969 262703 gene locus_tag LOCUS_11260 261969 262703 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645452.1 protein_id gnl|my_center|LOCUS_11260 262843 263007 gene locus_tag LOCUS_11270 262843 263007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 263144 265186 gene locus_tag LOCUS_11280 263144 265186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 265197 265865 gene locus_tag LOCUS_11290 265197 265865 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002893493.1 protein_id gnl|my_center|LOCUS_11290 266012 266686 gene locus_tag LOCUS_11300 266012 266686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 268016 266742 gene locus_tag LOCUS_11310 gene glyA 268016 266742 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_11310 268129 269418 gene locus_tag LOCUS_11320 gene fahA 268129 269418 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_11320 269611 270798 gene locus_tag LOCUS_11330 269611 270798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_11330 271201 270806 gene locus_tag LOCUS_11340 gene ytxJ 271201 270806 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_11340 271361 273961 gene locus_tag LOCUS_11350 gene clpB 271361 273961 CDS product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 protein_id gnl|my_center|LOCUS_11350 274223 274858 gene locus_tag LOCUS_11360 274223 274858 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963700.1 protein_id gnl|my_center|LOCUS_11360 276184 274859 gene locus_tag LOCUS_11370 276184 274859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 276329 276859 gene locus_tag LOCUS_11380 276329 276859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 277670 276846 gene locus_tag LOCUS_11390 277670 276846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 277727 278188 gene locus_tag LOCUS_11400 gene smpB 277727 278188 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_11400 278312 278773 gene locus_tag LOCUS_11410 278312 278773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 278808 279272 gene locus_tag LOCUS_11420 278808 279272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 279749 280834 gene locus_tag LOCUS_11430 279749 280834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 281264 281067 gene locus_tag LOCUS_11440 281264 281067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 281263 281601 gene locus_tag LOCUS_11450 281263 281601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 282120 281689 gene locus_tag LOCUS_11460 282120 281689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 283550 282255 gene locus_tag LOCUS_11470 283550 282255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 284856 283612 gene locus_tag LOCUS_11480 284856 283612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 285200 285601 gene locus_tag LOCUS_11490 285200 285601 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948145.1 protein_id gnl|my_center|LOCUS_11490 285978 285652 gene locus_tag LOCUS_11500 285978 285652 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786368.1 protein_id gnl|my_center|LOCUS_11500 287654 285990 gene locus_tag LOCUS_11510 287654 285990 CDS product fused response regulator/thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140483.1 protein_id gnl|my_center|LOCUS_11510 289064 287673 gene locus_tag LOCUS_11520 289064 287673 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141661.1 protein_id gnl|my_center|LOCUS_11520 289296 290027 gene locus_tag LOCUS_11530 289296 290027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 290052 290888 gene locus_tag LOCUS_11540 290052 290888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 293104 290987 gene locus_tag LOCUS_11550 293104 290987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 293278 293991 gene locus_tag LOCUS_11560 293278 293991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_11560 294047 294571 gene locus_tag LOCUS_11570 294047 294571 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_11570 294794 295756 gene locus_tag LOCUS_11580 294794 295756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 298041 295792 gene locus_tag LOCUS_11590 298041 295792 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203587.1 protein_id gnl|my_center|LOCUS_11590 302942 298074 gene locus_tag LOCUS_11600 302942 298074 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202866.1 protein_id gnl|my_center|LOCUS_11600 303930 303343 gene locus_tag LOCUS_11610 303930 303343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_11610 304395 304210 gene locus_tag LOCUS_11620 304395 304210 CDS product CsbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004391853.1 protein_id gnl|my_center|LOCUS_11620 304730 305806 gene locus_tag LOCUS_11630 304730 305806 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202490.1 protein_id gnl|my_center|LOCUS_11630 309531 305803 gene locus_tag LOCUS_11640 309531 305803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 310063 310671 gene locus_tag LOCUS_11650 310063 310671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 310738 312552 gene locus_tag LOCUS_11660 310738 312552 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_11660 313137 313544 gene locus_tag LOCUS_11670 313137 313544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 313601 313924 gene locus_tag LOCUS_11680 313601 313924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 313979 314422 gene locus_tag LOCUS_11690 313979 314422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 314513 315214 gene locus_tag LOCUS_11700 314513 315214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 316270 315227 gene locus_tag LOCUS_11710 316270 315227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 316802 316960 gene locus_tag LOCUS_11720 316802 316960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 317076 317411 gene locus_tag LOCUS_11730 317076 317411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 317703 318287 gene locus_tag LOCUS_11740 317703 318287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 318295 318741 gene locus_tag LOCUS_11750 gene rcp1 318295 318741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_11750 318758 320923 gene locus_tag LOCUS_11760 318758 320923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 321179 321322 gene locus_tag LOCUS_11770 321179 321322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 321556 322578 gene locus_tag LOCUS_11780 321556 322578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 323246 322698 gene locus_tag LOCUS_11790 323246 322698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 323509 324327 gene locus_tag LOCUS_11800 323509 324327 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267572.1 protein_id gnl|my_center|LOCUS_11800 324790 324341 gene locus_tag LOCUS_11810 324790 324341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 325038 325604 gene locus_tag LOCUS_11820 325038 325604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 327130 325601 gene locus_tag LOCUS_11830 327130 325601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_11830 327417 327169 gene locus_tag LOCUS_11840 327417 327169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 329378 327822 gene locus_tag LOCUS_11850 329378 327822 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_11850 329602 329988 gene locus_tag LOCUS_11860 329602 329988 CDS product glyoxalase/bleomycin resistance protein/dioxygenase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530129.1 protein_id gnl|my_center|LOCUS_11860 330914 330153 gene locus_tag LOCUS_11870 330914 330153 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_11870 331380 330898 gene locus_tag LOCUS_11880 331380 330898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 331866 331384 gene locus_tag LOCUS_11890 331866 331384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 333327 331954 gene locus_tag LOCUS_11900 333327 331954 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202771.1 protein_id gnl|my_center|LOCUS_11900 334030 333311 gene locus_tag LOCUS_11910 334030 333311 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_11910 334255 334560 gene locus_tag LOCUS_11920 334255 334560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 334646 335008 gene locus_tag LOCUS_11930 334646 335008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence05 1134 406 gene locus_tag LOCUS_11940 1134 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1863 3641 gene locus_tag LOCUS_11950 1863 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3901 5016 gene locus_tag LOCUS_11960 gene gmd 3901 5016 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q56872 protein_id gnl|my_center|LOCUS_11960 5093 6175 gene locus_tag LOCUS_11970 gene fcl 5093 6175 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VA9 protein_id gnl|my_center|LOCUS_11970 7687 8634 gene locus_tag LOCUS_11980 7687 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_11980 8688 9404 gene locus_tag LOCUS_11990 8688 9404 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203390.1 protein_id gnl|my_center|LOCUS_11990 9397 10566 gene locus_tag LOCUS_12000 9397 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288206.1 protein_id gnl|my_center|LOCUS_12000 10563 11753 gene locus_tag LOCUS_12010 10563 11753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 11904 12773 gene locus_tag LOCUS_12020 11904 12773 CDS product acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203012.1 protein_id gnl|my_center|LOCUS_12020 12856 13890 gene locus_tag LOCUS_12030 12856 13890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767223.1 protein_id gnl|my_center|LOCUS_12030 13887 15047 gene locus_tag LOCUS_12040 13887 15047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 15057 16268 gene locus_tag LOCUS_12050 15057 16268 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_12050 16424 17530 gene locus_tag LOCUS_12060 gene wbyK 16424 17530 CDS product mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_12060 17781 18527 gene locus_tag LOCUS_12070 17781 18527 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203385.1 protein_id gnl|my_center|LOCUS_12070 18546 19457 gene locus_tag LOCUS_12080 18546 19457 CDS product UDP-galactose-4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202474.1 protein_id gnl|my_center|LOCUS_12080 19492 20544 gene locus_tag LOCUS_12090 19492 20544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 20778 22496 gene locus_tag LOCUS_12100 20778 22496 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_12100 22518 22949 gene locus_tag LOCUS_12110 22518 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 22993 24006 gene locus_tag LOCUS_12120 22993 24006 CDS product UDP-GlcNAc--UDP-phosphate GlcNAc-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786860.1 protein_id gnl|my_center|LOCUS_12120 24144 27860 gene locus_tag LOCUS_12130 24144 27860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 27857 28555 gene locus_tag LOCUS_12140 27857 28555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 29696 28743 gene locus_tag LOCUS_12150 gene purC 29696 28743 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 protein_id gnl|my_center|LOCUS_12150 30659 29706 gene locus_tag LOCUS_12160 gene phoH 30659 29706 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_12160 30788 31618 gene locus_tag LOCUS_12170 gene fjo14 30788 31618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_12170 31619 31936 gene locus_tag LOCUS_12180 gene fjo15 31619 31936 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963226.1 protein_id gnl|my_center|LOCUS_12180 31936 32667 gene locus_tag LOCUS_12190 gene gldF 31936 32667 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_12190 32667 34331 gene locus_tag LOCUS_12200 gene gldG 32667 34331 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_12200 34611 35729 gene locus_tag LOCUS_12210 gene dnaN 34611 35729 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_12210 36221 35856 gene locus_tag LOCUS_12220 36221 35856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074087.1 protein_id gnl|my_center|LOCUS_12220 37494 36352 gene locus_tag LOCUS_12230 37494 36352 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_12230 40572 37630 gene locus_tag LOCUS_12240 40572 37630 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_12240 41147 40665 gene locus_tag LOCUS_12250 41147 40665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 protein_id gnl|my_center|LOCUS_12250 42020 41229 gene locus_tag LOCUS_12260 42020 41229 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_12260 43359 42034 gene locus_tag LOCUS_12270 43359 42034 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_12270 44328 43363 gene locus_tag LOCUS_12280 44328 43363 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_12280 45689 44385 gene locus_tag LOCUS_12290 45689 44385 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_12290 45969 48602 gene locus_tag LOCUS_12300 45969 48602 CDS product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_12300 48661 49041 gene locus_tag LOCUS_12310 gene yjgF 48661 49041 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 protein_id gnl|my_center|LOCUS_12310 49885 49034 gene locus_tag LOCUS_12320 49885 49034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_12320 51055 50054 gene locus_tag LOCUS_12330 gene gapA3 51055 50054 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_12330 52003 51074 gene locus_tag LOCUS_12340 gene pfkA 52003 51074 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_12340 56763 52345 gene locus_tag LOCUS_12350 56763 52345 CDS product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_12350 56729 57871 gene locus_tag LOCUS_12360 gene tsaD 56729 57871 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_12360 57917 58621 gene locus_tag LOCUS_12370 57917 58621 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_12370 58884 59534 gene locus_tag LOCUS_12380 58884 59534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_12380 59537 60637 gene locus_tag LOCUS_12390 59537 60637 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_12390 60645 61823 gene locus_tag LOCUS_12400 60645 61823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 protein_id gnl|my_center|LOCUS_12400 62596 61841 gene locus_tag LOCUS_12410 62596 61841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 62990 64009 gene locus_tag LOCUS_12420 62990 64009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109096.1 protein_id gnl|my_center|LOCUS_12420 65154 64324 gene locus_tag LOCUS_12430 65154 64324 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_12430 65880 65164 gene locus_tag LOCUS_12440 65880 65164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 67603 65885 gene locus_tag LOCUS_12450 67603 65885 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_12450 69837 67723 gene locus_tag LOCUS_12460 gene yyaL 69837 67723 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_12460 71301 70060 gene locus_tag LOCUS_12470 71301 70060 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118593.1 protein_id gnl|my_center|LOCUS_12470 71273 71428 gene locus_tag LOCUS_12480 71273 71428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 72411 71452 gene locus_tag LOCUS_12490 72411 71452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_12490 73549 72860 gene locus_tag LOCUS_12500 73549 72860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 74076 75584 gene locus_tag LOCUS_12510 74076 75584 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_12510 75596 76921 gene locus_tag LOCUS_12520 gene xylA 75596 76921 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_12520 77033 78049 gene locus_tag LOCUS_12530 77033 78049 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_12530 78061 79029 gene locus_tag LOCUS_12540 78061 79029 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038902.1 protein_id gnl|my_center|LOCUS_12540 80265 79042 gene locus_tag LOCUS_12550 80265 79042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 82031 80262 gene locus_tag LOCUS_12560 82031 80262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801402.1 protein_id gnl|my_center|LOCUS_12560 83262 82045 gene locus_tag LOCUS_12570 83262 82045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 86015 83262 gene locus_tag LOCUS_12580 86015 83262 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_12580 86698 86012 gene locus_tag LOCUS_12590 86698 86012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 87372 87491 gene locus_tag LOCUS_12600 87372 87491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 87737 88174 gene locus_tag LOCUS_12610 87737 88174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 88171 89154 gene locus_tag LOCUS_12620 gene apbE 88171 89154 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_12620 89151 89363 gene locus_tag LOCUS_12630 89151 89363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 89397 90710 gene locus_tag LOCUS_12640 89397 90710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963601.1 protein_id gnl|my_center|LOCUS_12640 91290 90760 gene locus_tag LOCUS_12650 91290 90760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 92160 91603 gene locus_tag LOCUS_12660 92160 91603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 94578 92179 gene locus_tag LOCUS_12670 94578 92179 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744482.1 protein_id gnl|my_center|LOCUS_12670 95526 95287 gene locus_tag LOCUS_12680 95526 95287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727907.1 protein_id gnl|my_center|LOCUS_12680 96075 95563 gene locus_tag LOCUS_12690 96075 95563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 96355 97002 gene locus_tag LOCUS_12700 96355 97002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 97002 97517 gene locus_tag LOCUS_12710 97002 97517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 97559 97945 gene locus_tag LOCUS_12720 97559 97945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 98236 99072 gene locus_tag LOCUS_12730 98236 99072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 99509 100909 gene locus_tag LOCUS_12740 99509 100909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 101617 101057 gene locus_tag LOCUS_12750 gene atsA 101617 101057 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973688.1 protein_id gnl|my_center|LOCUS_12750 101880 102689 gene locus_tag LOCUS_12760 101880 102689 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203124.1 protein_id gnl|my_center|LOCUS_12760 102826 103212 gene locus_tag LOCUS_12770 102826 103212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 103542 103243 gene locus_tag LOCUS_12780 103542 103243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 104140 103661 gene locus_tag LOCUS_12790 104140 103661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_12790 105736 104342 gene locus_tag LOCUS_12800 105736 104342 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228233.1 protein_id gnl|my_center|LOCUS_12800 106622 105816 gene locus_tag LOCUS_12810 106622 105816 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_12810 106852 107376 gene locus_tag LOCUS_12820 106852 107376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 107546 108109 gene locus_tag LOCUS_12830 107546 108109 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_12830 108962 108606 gene locus_tag LOCUS_12840 108962 108606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 109998 109165 gene locus_tag LOCUS_12850 109998 109165 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 protein_id gnl|my_center|LOCUS_12850 111039 110026 gene locus_tag LOCUS_12860 111039 110026 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972587.1 protein_id gnl|my_center|LOCUS_12860 113217 111271 gene locus_tag LOCUS_12870 113217 111271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 115072 113333 gene locus_tag LOCUS_12880 115072 113333 CDS product glycoside hydrolase 43 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920643.1 protein_id gnl|my_center|LOCUS_12880 116669 115101 gene locus_tag LOCUS_12890 116669 115101 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890798.1 protein_id gnl|my_center|LOCUS_12890 119116 116825 gene locus_tag LOCUS_12900 119116 116825 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107211.1 protein_id gnl|my_center|LOCUS_12900 121587 119134 gene locus_tag LOCUS_12910 121587 119134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107570.1 protein_id gnl|my_center|LOCUS_12910 122170 125181 gene locus_tag LOCUS_12920 122170 125181 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_12920 125195 126673 gene locus_tag LOCUS_12930 125195 126673 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 protein_id gnl|my_center|LOCUS_12930 126768 130076 gene locus_tag LOCUS_12940 126768 130076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 134341 130205 gene locus_tag LOCUS_12950 134341 130205 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203715.1 protein_id gnl|my_center|LOCUS_12950 136574 134679 gene locus_tag LOCUS_12960 136574 134679 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_12960 137715 136600 gene locus_tag LOCUS_12970 gene xsa 137715 136600 CDS product alpha-N-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039191.1 protein_id gnl|my_center|LOCUS_12970 138013 140190 gene locus_tag LOCUS_12980 138013 140190 CDS product xylan alpha-1,2-glucuronidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CDD7 protein_id gnl|my_center|LOCUS_12980 140215 140955 gene locus_tag LOCUS_12990 140215 140955 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_12990 141000 142178 gene locus_tag LOCUS_13000 gene uxuA 141000 142178 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7U2 protein_id gnl|my_center|LOCUS_13000 142185 143297 gene locus_tag LOCUS_13010 142185 143297 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E346 protein_id gnl|my_center|LOCUS_13010 144438 143401 gene locus_tag LOCUS_13020 144438 143401 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_13020 144766 146433 gene locus_tag LOCUS_13030 144766 146433 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_13030 146802 147650 gene locus_tag LOCUS_13040 gene yhxC 146802 147650 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432004.1 protein_id gnl|my_center|LOCUS_13040 147650 147913 gene locus_tag LOCUS_13050 147650 147913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125597.1 protein_id gnl|my_center|LOCUS_13050 148080 148502 gene locus_tag LOCUS_13060 148080 148502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 149773 148661 gene locus_tag LOCUS_13070 149773 148661 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247147.1 protein_id gnl|my_center|LOCUS_13070 150095 149823 gene locus_tag LOCUS_13080 150095 149823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 150288 150773 gene locus_tag LOCUS_13090 150288 150773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088607.1 protein_id gnl|my_center|LOCUS_13090 151417 150983 gene locus_tag LOCUS_13100 151417 150983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 151991 152299 gene locus_tag LOCUS_13110 151991 152299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 153846 152371 gene locus_tag LOCUS_13120 153846 152371 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119875.1 protein_id gnl|my_center|LOCUS_13120 155641 153836 gene locus_tag LOCUS_13130 155641 153836 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230810.1 protein_id gnl|my_center|LOCUS_13130 156655 155645 gene locus_tag LOCUS_13140 156655 155645 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119877.1 protein_id gnl|my_center|LOCUS_13140 159005 156837 gene locus_tag LOCUS_13150 gene katE 159005 156837 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87UN3 protein_id gnl|my_center|LOCUS_13150 159353 159904 gene locus_tag LOCUS_13160 159353 159904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 161207 160050 gene locus_tag LOCUS_13170 161207 160050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 161498 164068 gene locus_tag LOCUS_13180 161498 164068 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_13180 164982 164077 gene locus_tag LOCUS_13190 164982 164077 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888863.1 protein_id gnl|my_center|LOCUS_13190 165778 165026 gene locus_tag LOCUS_13200 gene surE 165778 165026 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q53W92 protein_id gnl|my_center|LOCUS_13200 166615 166085 gene locus_tag LOCUS_13210 166615 166085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124788.1 protein_id gnl|my_center|LOCUS_13210 167057 166815 gene locus_tag LOCUS_13220 167057 166815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 167276 167644 gene locus_tag LOCUS_13230 167276 167644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964581.1 protein_id gnl|my_center|LOCUS_13230 167863 168111 gene locus_tag LOCUS_13240 167863 168111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 168215 168664 gene locus_tag LOCUS_13250 168215 168664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 170918 168729 gene locus_tag LOCUS_13260 170918 168729 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975278.1 protein_id gnl|my_center|LOCUS_13260 171400 170921 gene locus_tag LOCUS_13270 171400 170921 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097907.1 protein_id gnl|my_center|LOCUS_13270 171739 177792 gene locus_tag LOCUS_13280 171739 177792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 177802 179151 gene locus_tag LOCUS_13290 177802 179151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 179335 179760 gene locus_tag LOCUS_13300 179335 179760 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_13300 179957 180391 gene locus_tag LOCUS_13310 179957 180391 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_13310 182475 180565 gene locus_tag LOCUS_13320 182475 180565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 185606 182493 gene locus_tag LOCUS_13330 185606 182493 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784823.1 protein_id gnl|my_center|LOCUS_13330 188569 186326 gene locus_tag LOCUS_13340 188569 186326 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107585.1 protein_id gnl|my_center|LOCUS_13340 190921 188603 gene locus_tag LOCUS_13350 190921 188603 CDS product beta-hexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203203.1 protein_id gnl|my_center|LOCUS_13350 192209 191142 gene locus_tag LOCUS_13360 192209 191142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 193178 192213 gene locus_tag LOCUS_13370 193178 192213 CDS product 1,4-beta-mannosyl-N-acetylglucosamine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8Y4 protein_id gnl|my_center|LOCUS_13370 195107 193230 gene locus_tag LOCUS_13380 195107 193230 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_13380 195456 196541 gene locus_tag LOCUS_13390 195456 196541 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 protein_id gnl|my_center|LOCUS_13390 196538 197263 gene locus_tag LOCUS_13400 196538 197263 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_13400 197687 197412 gene locus_tag LOCUS_13410 gene clpS 197687 197412 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_13410 198544 197708 gene locus_tag LOCUS_13420 gene prmA 198544 197708 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_13420 199361 198612 gene locus_tag LOCUS_13430 gene tpiA 199361 198612 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_13430 199863 199351 gene locus_tag LOCUS_13440 gene tlpA 199863 199351 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 protein_id gnl|my_center|LOCUS_13440 200951 199854 gene locus_tag LOCUS_13450 200951 199854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_13450 201521 200955 gene locus_tag LOCUS_13460 201521 200955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_13460 201672 202442 gene locus_tag LOCUS_13470 gene folP 201672 202442 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_13470 202496 203284 gene locus_tag LOCUS_13480 202496 203284 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108919.1 protein_id gnl|my_center|LOCUS_13480 205091 203325 gene locus_tag LOCUS_13490 205091 203325 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_13490 205755 205084 gene locus_tag LOCUS_13500 gene truA 205755 205084 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 protein_id gnl|my_center|LOCUS_13500 205930 206427 gene locus_tag LOCUS_13510 205930 206427 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_13510 206892 206482 gene locus_tag LOCUS_13520 206892 206482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 protein_id gnl|my_center|LOCUS_13520 207085 208791 gene locus_tag LOCUS_13530 gene rho 207085 208791 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 protein_id gnl|my_center|LOCUS_13530 209205 209849 gene locus_tag LOCUS_13540 209205 209849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 209879 210580 gene locus_tag LOCUS_13550 209879 210580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 210940 211746 gene locus_tag LOCUS_13560 gene proC 210940 211746 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_13560 211750 212520 gene locus_tag LOCUS_13570 211750 212520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 212531 213730 gene locus_tag LOCUS_13580 gene proA 212531 213730 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0D2 protein_id gnl|my_center|LOCUS_13580 214053 213802 gene locus_tag LOCUS_13590 gene rpsT 214053 213802 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_13590 214181 214109 gene locus_tag LOCUS_t00090 214181 214109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 214317 214245 gene locus_tag LOCUS_t00100 214317 214245 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 215872 214397 gene locus_tag LOCUS_13600 gene proS 215872 214397 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A988 protein_id gnl|my_center|LOCUS_13600 215972 217162 gene locus_tag LOCUS_13610 215972 217162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 217304 218812 gene locus_tag LOCUS_13620 217304 218812 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_13620 220215 218932 gene locus_tag LOCUS_13630 220215 218932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 220669 221349 gene locus_tag LOCUS_13640 gene folE2 220669 221349 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 protein_id gnl|my_center|LOCUS_13640 221364 222845 gene locus_tag LOCUS_13650 gene cysS 221364 222845 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_13650 223224 224192 gene locus_tag LOCUS_13660 gene lgt 223224 224192 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX82 protein_id gnl|my_center|LOCUS_13660 224325 224732 gene locus_tag LOCUS_13670 224325 224732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 224947 226167 gene locus_tag LOCUS_13680 224947 226167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 229192 226226 gene locus_tag LOCUS_13690 gene secDF 229192 226226 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_13690 230269 229343 gene locus_tag LOCUS_13700 gene mdh 230269 229343 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0W0 protein_id gnl|my_center|LOCUS_13700 230538 230888 gene locus_tag LOCUS_13710 230538 230888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 232056 231043 gene locus_tag LOCUS_13720 232056 231043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 234155 232200 gene locus_tag LOCUS_13730 gene gyrB 234155 232200 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_13730 236302 234632 gene locus_tag LOCUS_13740 gene asnB 236302 234632 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_13740 236539 237084 gene locus_tag LOCUS_13750 236539 237084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_13750 237217 239457 gene locus_tag LOCUS_13760 237217 239457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534567.1 protein_id gnl|my_center|LOCUS_13760 241081 239462 gene locus_tag LOCUS_13770 241081 239462 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_13770 241213 242004 gene locus_tag LOCUS_13780 241213 242004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121303.1 protein_id gnl|my_center|LOCUS_13780 243881 242052 gene locus_tag LOCUS_13790 243881 242052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071951.1 protein_id gnl|my_center|LOCUS_13790 244249 244058 gene locus_tag LOCUS_13800 gene cspC 244249 244058 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 protein_id gnl|my_center|LOCUS_13800 246175 244421 gene locus_tag LOCUS_13810 246175 244421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_13810 249222 246199 gene locus_tag LOCUS_13820 249222 246199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_13820 249613 250296 gene locus_tag LOCUS_13830 gene ftsE 249613 250296 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_13830 253805 250392 gene locus_tag LOCUS_13840 253805 250392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 254126 255634 gene locus_tag LOCUS_13850 254126 255634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 255656 256471 gene locus_tag LOCUS_13860 255656 256471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 256537 257274 gene locus_tag LOCUS_13870 256537 257274 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_13870 259173 257374 gene locus_tag LOCUS_13880 gene typA 259173 257374 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_13880 259500 260318 gene locus_tag LOCUS_13890 gene kdsA 259500 260318 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_13890 260353 262326 gene locus_tag LOCUS_13900 260353 262326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 263438 262329 gene locus_tag LOCUS_13910 263438 262329 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_13910 263395 265737 gene locus_tag LOCUS_13920 263395 265737 CDS product ferrichrome-iron receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140357.1 protein_id gnl|my_center|LOCUS_13920 265806 266576 gene locus_tag LOCUS_13930 265806 266576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 266589 266921 gene locus_tag LOCUS_13940 266589 266921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 266925 267227 gene locus_tag LOCUS_13950 266925 267227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 267230 268798 gene locus_tag LOCUS_13960 267230 268798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 268870 269229 gene locus_tag LOCUS_13970 268870 269229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 270502 269297 gene locus_tag LOCUS_13980 270502 269297 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_13980 270657 271053 gene locus_tag LOCUS_tm00010 270657 271053 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 <1 530 gene locus_tag LOCUS_13990 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109009.1:cell envelope biogenesis protein TonB 662 1054 gene locus_tag LOCUS_14000 662 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 1067 3670 gene locus_tag LOCUS_14010 1067 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4180 4569 gene locus_tag LOCUS_14020 4180 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 4566 5420 gene locus_tag LOCUS_14030 4566 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14030 5968 6114 gene locus_tag LOCUS_14040 5968 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 6604 7695 gene locus_tag LOCUS_14050 6604 7695 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963682.1 protein_id gnl|my_center|LOCUS_14050 8638 10329 gene locus_tag LOCUS_14060 8638 10329 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108622.1 protein_id gnl|my_center|LOCUS_14060 10357 11826 gene locus_tag LOCUS_14070 10357 11826 CDS product beta-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296814.1 protein_id gnl|my_center|LOCUS_14070 11828 12823 gene locus_tag LOCUS_14080 11828 12823 CDS product N-acylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_14080 12953 16072 gene locus_tag LOCUS_14090 12953 16072 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107964.1 protein_id gnl|my_center|LOCUS_14090 16100 17830 gene locus_tag LOCUS_14100 16100 17830 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_14100 18147 19562 gene locus_tag LOCUS_14110 18147 19562 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797467.1 protein_id gnl|my_center|LOCUS_14110 19747 21810 gene locus_tag LOCUS_14120 19747 21810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 22818 23852 gene locus_tag LOCUS_14130 22818 23852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 24350 24141 gene locus_tag LOCUS_14140 24350 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 25492 24407 gene locus_tag LOCUS_14150 gene paaE 25492 24407 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085679.1 protein_id gnl|my_center|LOCUS_14150 25998 25522 gene locus_tag LOCUS_14160 25998 25522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 26614 26024 gene locus_tag LOCUS_14170 26614 26024 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399299.1 protein_id gnl|my_center|LOCUS_14170 27234 26692 gene locus_tag LOCUS_14180 27234 26692 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786786.1 protein_id gnl|my_center|LOCUS_14180 27644 27456 gene locus_tag LOCUS_14190 27644 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 28264 27767 gene locus_tag LOCUS_14200 28264 27767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 28379 28227 gene locus_tag LOCUS_14210 28379 28227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 29061 28558 gene locus_tag LOCUS_14220 29061 28558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 29962 29114 gene locus_tag LOCUS_14230 29962 29114 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963150.1 protein_id gnl|my_center|LOCUS_14230 30452 30075 gene locus_tag LOCUS_14240 30452 30075 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388928.1 protein_id gnl|my_center|LOCUS_14240 30759 31610 gene locus_tag LOCUS_14250 30759 31610 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974350.1 protein_id gnl|my_center|LOCUS_14250 31635 33053 gene locus_tag LOCUS_14260 31635 33053 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_14260 33056 33481 gene locus_tag LOCUS_14270 33056 33481 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852401.1 protein_id gnl|my_center|LOCUS_14270 34031 33594 gene locus_tag LOCUS_14280 34031 33594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 34119 34637 gene locus_tag LOCUS_14290 34119 34637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 34823 35155 gene locus_tag LOCUS_14300 34823 35155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 35328 35498 gene locus_tag LOCUS_14310 35328 35498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 38152 36323 gene locus_tag LOCUS_14320 38152 36323 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_602099.1 protein_id gnl|my_center|LOCUS_14320 38537 38322 gene locus_tag LOCUS_14330 38537 38322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 39459 38668 gene locus_tag LOCUS_14340 39459 38668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 39837 39472 gene locus_tag LOCUS_14350 39837 39472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 40884 39844 gene locus_tag LOCUS_14360 40884 39844 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001060935.1 protein_id gnl|my_center|LOCUS_14360 41695 41396 gene locus_tag LOCUS_14370 41695 41396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 41984 42607 gene locus_tag LOCUS_14380 41984 42607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 44072 42963 gene locus_tag LOCUS_14390 44072 42963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_14390 45645 44167 gene locus_tag LOCUS_14400 45645 44167 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_14400 45919 47382 gene locus_tag LOCUS_14410 45919 47382 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109263.1 protein_id gnl|my_center|LOCUS_14410 47790 48356 gene locus_tag LOCUS_14420 47790 48356 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_14420 48435 48788 gene locus_tag LOCUS_14430 48435 48788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 48800 49216 gene locus_tag LOCUS_14440 48800 49216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719490.1 protein_id gnl|my_center|LOCUS_14440 50991 49840 gene locus_tag LOCUS_14450 50991 49840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 53307 51103 gene locus_tag LOCUS_14460 53307 51103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 54923 53307 gene locus_tag LOCUS_14470 54923 53307 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108256.1 protein_id gnl|my_center|LOCUS_14470 57905 54933 gene locus_tag LOCUS_14480 57905 54933 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760375.1 protein_id gnl|my_center|LOCUS_14480 61090 58181 gene locus_tag LOCUS_14490 61090 58181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_14490 61533 61288 gene locus_tag LOCUS_14500 61533 61288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 62713 61682 gene locus_tag LOCUS_14510 62713 61682 CDS product arabinan endo-1,5-alpha-L-arabinosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795630.1 protein_id gnl|my_center|LOCUS_14510 64205 62847 gene locus_tag LOCUS_14520 64205 62847 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764196.1 protein_id gnl|my_center|LOCUS_14520 64923 64258 gene locus_tag LOCUS_14530 64923 64258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 65837 64920 gene locus_tag LOCUS_14540 65837 64920 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108968.1 protein_id gnl|my_center|LOCUS_14540 68200 65855 gene locus_tag LOCUS_14550 68200 65855 CDS product sugar hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764202.1 protein_id gnl|my_center|LOCUS_14550 70502 68229 gene locus_tag LOCUS_14560 70502 68229 CDS product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762490.1 protein_id gnl|my_center|LOCUS_14560 71659 70628 gene locus_tag LOCUS_14570 gene rbsR 71659 70628 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860719.1 protein_id gnl|my_center|LOCUS_14570 73910 71961 gene locus_tag LOCUS_14580 73910 71961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122305.1 protein_id gnl|my_center|LOCUS_14580 75742 73904 gene locus_tag LOCUS_14590 75742 73904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 76267 76344 gene locus_tag LOCUS_t00110 76267 76344 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 77630 76356 gene locus_tag LOCUS_14600 gene murF 77630 76356 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 protein_id gnl|my_center|LOCUS_14600 79422 77767 gene locus_tag LOCUS_14610 gene gldJ 79422 77767 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_14610 79845 81002 gene locus_tag LOCUS_14620 gene porV 79845 81002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_14620 81073 81531 gene locus_tag LOCUS_14630 gene cdd 81073 81531 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_14630 81688 82686 gene locus_tag LOCUS_14640 gene pdhA 81688 82686 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_14640 82690 84339 gene locus_tag LOCUS_14650 gene pdhC 82690 84339 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_14650 84414 85460 gene locus_tag LOCUS_14660 84414 85460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 85460 86140 gene locus_tag LOCUS_14670 85460 86140 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_14670 86140 86742 gene locus_tag LOCUS_14680 86140 86742 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_14680 86747 87832 gene locus_tag LOCUS_14690 gene manC 86747 87832 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 protein_id gnl|my_center|LOCUS_14690 87836 89293 gene locus_tag LOCUS_14700 87836 89293 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762895.1 protein_id gnl|my_center|LOCUS_14700 90057 89290 gene locus_tag LOCUS_14710 90057 89290 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_14710 90794 90054 gene locus_tag LOCUS_14720 90794 90054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_14720 91025 92590 gene locus_tag LOCUS_14730 gene pafA 91025 92590 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_14730 93485 92631 gene locus_tag LOCUS_14740 93485 92631 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_14740 94075 93548 gene locus_tag LOCUS_14750 94075 93548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 95137 94082 gene locus_tag LOCUS_14760 gene fabH1 95137 94082 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_14760 98152 95309 gene locus_tag LOCUS_14770 gene gcvP 98152 95309 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_14770 98413 99237 gene locus_tag LOCUS_14780 98413 99237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362021.1 protein_id gnl|my_center|LOCUS_14780 99461 99234 gene locus_tag LOCUS_14790 99461 99234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 100019 99465 gene locus_tag LOCUS_14800 100019 99465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 100098 100457 gene locus_tag LOCUS_14810 100098 100457 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294651.1 protein_id gnl|my_center|LOCUS_14810 101551 100499 gene locus_tag LOCUS_14820 101551 100499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 103825 101807 gene locus_tag LOCUS_14830 gene dcp1 103825 101807 CDS product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 protein_id gnl|my_center|LOCUS_14830 104669 104181 gene locus_tag LOCUS_14840 gene purE 104669 104181 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_14840 105838 104657 gene locus_tag LOCUS_14850 gene purK 105838 104657 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_14850 106080 107186 gene locus_tag LOCUS_14860 106080 107186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 107256 108257 gene locus_tag LOCUS_14870 gene obg 107256 108257 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_14870 108382 108912 gene locus_tag LOCUS_14880 108382 108912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 109210 109569 gene locus_tag LOCUS_14890 109210 109569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 109638 109820 gene locus_tag LOCUS_14900 109638 109820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 109804 110862 gene locus_tag LOCUS_14910 109804 110862 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403193.1 protein_id gnl|my_center|LOCUS_14910 110859 111587 gene locus_tag LOCUS_14920 gene algR 110859 111587 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_14920 117684 111613 gene locus_tag LOCUS_14930 117684 111613 CDS product alpha-2-macroglobulin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_14930 118661 117876 gene locus_tag LOCUS_14940 118661 117876 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_14940 119028 118714 gene locus_tag LOCUS_14950 119028 118714 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_14950 119171 120076 gene locus_tag LOCUS_14960 119171 120076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 120240 120938 gene locus_tag LOCUS_14970 gene radC 120240 120938 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_14970 120981 122276 gene locus_tag LOCUS_14980 120981 122276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255207.1 protein_id gnl|my_center|LOCUS_14980 122269 122958 gene locus_tag LOCUS_14990 122269 122958 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_14990 123032 123565 gene locus_tag LOCUS_15000 123032 123565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 123562 124995 gene locus_tag LOCUS_15010 123562 124995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 125006 125812 gene locus_tag LOCUS_15020 125006 125812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 127086 125809 gene locus_tag LOCUS_15030 127086 125809 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 protein_id gnl|my_center|LOCUS_15030 127178 127924 gene locus_tag LOCUS_15040 127178 127924 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963478.1 protein_id gnl|my_center|LOCUS_15040 128664 127921 gene locus_tag LOCUS_15050 128664 127921 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_15050 130085 128739 gene locus_tag LOCUS_15060 130085 128739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_15060 131260 130376 gene locus_tag LOCUS_15070 131260 130376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 132952 131273 gene locus_tag LOCUS_15080 132952 131273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 136170 132964 gene locus_tag LOCUS_15090 136170 132964 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_15090 136731 136961 gene locus_tag LOCUS_15100 136731 136961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 136985 137461 gene locus_tag LOCUS_15110 gene rpsG 136985 137461 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_15110 137471 139603 gene locus_tag LOCUS_15120 gene fusA 137471 139603 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_15120 139614 139919 gene locus_tag LOCUS_15130 gene rpsJ 139614 139919 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_15130 140112 140702 gene locus_tag LOCUS_15140 gene rplC 140112 140702 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_15140 140702 141331 gene locus_tag LOCUS_15150 gene rplD 140702 141331 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_15150 141339 141629 gene locus_tag LOCUS_15160 gene rplW 141339 141629 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_15160 141639 142463 gene locus_tag LOCUS_15170 gene rplB 141639 142463 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_15170 142759 143166 gene locus_tag LOCUS_15180 gene rplV 142759 143166 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_15180 143177 143899 gene locus_tag LOCUS_15190 gene rpsC 143177 143899 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_15190 143920 144339 gene locus_tag LOCUS_15200 gene rplP 143920 144339 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_15200 144359 144550 gene locus_tag LOCUS_15210 gene rpmC 144359 144550 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_15210 144564 144821 gene locus_tag LOCUS_15220 gene rpsQ 144564 144821 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_15220 144824 145192 gene locus_tag LOCUS_15230 gene rplN 144824 145192 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_15230 145206 145520 gene locus_tag LOCUS_15240 gene rplX 145206 145520 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_15240 145523 146074 gene locus_tag LOCUS_15250 gene rplE 145523 146074 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_15250 146076 146345 gene locus_tag LOCUS_15260 gene rpsN 146076 146345 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_15260 146417 146815 gene locus_tag LOCUS_15270 gene rpsH 146417 146815 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_15270 146836 147378 gene locus_tag LOCUS_15280 gene rplF 146836 147378 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_15280 147390 147746 gene locus_tag LOCUS_15290 gene rplR 147390 147746 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_15290 147751 148275 gene locus_tag LOCUS_15300 gene rpsE 147751 148275 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_15300 148288 148467 gene locus_tag LOCUS_15310 gene rpmD 148288 148467 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_15310 148484 148936 gene locus_tag LOCUS_15320 gene rplO 148484 148936 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_15320 148949 150292 gene locus_tag LOCUS_15330 gene secY 148949 150292 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_15330 150299 150514 gene locus_tag LOCUS_15340 gene infA 150299 150514 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_15340 150643 151017 gene locus_tag LOCUS_15350 gene rpsM 150643 151017 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_15350 151031 151423 gene locus_tag LOCUS_15360 gene rpsK 151031 151423 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_15360 151524 152129 gene locus_tag LOCUS_15370 gene rpsD 151524 152129 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_15370 152149 153141 gene locus_tag LOCUS_15380 gene rpoA 152149 153141 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_15380 153254 153721 gene locus_tag LOCUS_15390 gene rplQ 153254 153721 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 protein_id gnl|my_center|LOCUS_15390 153820 154944 gene locus_tag LOCUS_15400 gene carA 153820 154944 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_15400 155085 156383 gene locus_tag LOCUS_15410 gene eno 155085 156383 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_15410 156609 158150 gene locus_tag LOCUS_15420 gene glgA 156609 158150 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071682.1 protein_id gnl|my_center|LOCUS_15420 158296 159579 gene locus_tag LOCUS_15430 gene gltA 158296 159579 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_15430 159675 160589 gene locus_tag LOCUS_15440 159675 160589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 protein_id gnl|my_center|LOCUS_15440 161003 161938 gene locus_tag LOCUS_15450 161003 161938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_15450 162335 163660 gene locus_tag LOCUS_15460 162335 163660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 165148 163697 gene locus_tag LOCUS_15470 gene opuD 165148 163697 CDS product glycine betaine transporter OpuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54417 protein_id gnl|my_center|LOCUS_15470 165737 165312 gene locus_tag LOCUS_15480 165737 165312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 165863 167653 gene locus_tag LOCUS_15490 gene argS 165863 167653 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 protein_id gnl|my_center|LOCUS_15490 167802 170135 gene locus_tag LOCUS_15500 167802 170135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 170242 171510 gene locus_tag LOCUS_15510 170242 171510 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123802.1 protein_id gnl|my_center|LOCUS_15510 171531 174935 gene locus_tag LOCUS_15520 171531 174935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 175163 176500 gene locus_tag LOCUS_15530 gene ffh 175163 176500 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_15530 176592 177479 gene locus_tag LOCUS_15540 gene folD 176592 177479 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_15540 177651 177499 gene locus_tag LOCUS_15550 177651 177499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 178272 177847 gene locus_tag LOCUS_15560 178272 177847 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_15560 179144 178305 gene locus_tag LOCUS_15570 179144 178305 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963353.1 protein_id gnl|my_center|LOCUS_15570 179515 179153 gene locus_tag LOCUS_15580 179515 179153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 180116 179568 gene locus_tag LOCUS_15590 180116 179568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 181694 180120 gene locus_tag LOCUS_15600 181694 180120 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_15600 181883 182293 gene locus_tag LOCUS_15610 181883 182293 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762169.1 protein_id gnl|my_center|LOCUS_15610 183191 182295 gene locus_tag LOCUS_15620 183191 182295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 184298 183195 gene locus_tag LOCUS_15630 184298 183195 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918429.1 protein_id gnl|my_center|LOCUS_15630 184762 184935 gene locus_tag LOCUS_15640 184762 184935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 186071 185391 gene locus_tag LOCUS_15650 186071 185391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 186179 186865 gene locus_tag LOCUS_15660 186179 186865 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_15660 186862 189417 gene locus_tag LOCUS_15670 186862 189417 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_15670 190067 189414 gene locus_tag LOCUS_15680 190067 189414 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_15680 190299 190054 gene locus_tag LOCUS_15690 190299 190054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 191017 190304 gene locus_tag LOCUS_15700 191017 190304 CDS product prolyl 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085746.1 protein_id gnl|my_center|LOCUS_15700 191944 191078 gene locus_tag LOCUS_15710 gene ada 191944 191078 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_15710 192314 192946 gene locus_tag LOCUS_15720 gene queE 192314 192946 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_15720 193830 192988 gene locus_tag LOCUS_15730 193830 192988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 194615 193899 gene locus_tag LOCUS_15740 194615 193899 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 protein_id gnl|my_center|LOCUS_15740 194678 195172 gene locus_tag LOCUS_15750 194678 195172 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 protein_id gnl|my_center|LOCUS_15750 195256 196146 gene locus_tag LOCUS_15760 195256 196146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 197257 196118 gene locus_tag LOCUS_15770 197257 196118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_15770 197369 198610 gene locus_tag LOCUS_15780 197369 198610 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_15780 198687 199673 gene locus_tag LOCUS_15790 198687 199673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 199691 200470 gene locus_tag LOCUS_15800 199691 200470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 200513 200851 gene locus_tag LOCUS_15810 200513 200851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 200903 202633 gene locus_tag LOCUS_15820 200903 202633 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_15820 202743 204152 gene locus_tag LOCUS_15830 202743 204152 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_15830 205851 204451 gene locus_tag LOCUS_15840 205851 204451 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_15840 205992 206381 gene locus_tag LOCUS_15850 205992 206381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 206496 207752 gene locus_tag LOCUS_15860 206496 207752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 207730 208782 gene locus_tag LOCUS_15870 207730 208782 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_15870 208880 209728 gene locus_tag LOCUS_15880 208880 209728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 210068 209769 gene locus_tag LOCUS_15890 210068 209769 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 protein_id gnl|my_center|LOCUS_15890 210280 211137 gene locus_tag LOCUS_15900 gene uspA 210280 211137 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_15900 211149 211985 gene locus_tag LOCUS_15910 211149 211985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_15910 211990 213360 gene locus_tag LOCUS_15920 211990 213360 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552083.1 protein_id gnl|my_center|LOCUS_15920 213467 214123 gene locus_tag LOCUS_15930 213467 214123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 214104 215111 gene locus_tag LOCUS_15940 gene ldhA 214104 215111 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_15940 216579 215173 gene locus_tag LOCUS_15950 gene cls 216579 215173 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HLZ0 protein_id gnl|my_center|LOCUS_15950 >Feature sequence07 1330 689 gene locus_tag LOCUS_15960 gene pcm 1330 689 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_15960 1596 2561 gene locus_tag LOCUS_15970 1596 2561 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_15970 2695 3582 gene locus_tag LOCUS_15980 2695 3582 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_15980 3592 4824 gene locus_tag LOCUS_15990 3592 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_15990 4861 5520 gene locus_tag LOCUS_16000 4861 5520 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_16000 5543 6904 gene locus_tag LOCUS_16010 5543 6904 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_16010 6914 7747 gene locus_tag LOCUS_16020 6914 7747 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_16020 7747 9168 gene locus_tag LOCUS_16030 7747 9168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 9552 10145 gene locus_tag LOCUS_16040 9552 10145 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_16040 10139 10999 gene locus_tag LOCUS_16050 10139 10999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 12471 11416 gene locus_tag LOCUS_16060 gene kdnB 12471 11416 CDS product 3-deoxy-alpha-D-manno-octulosonate 8-oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEB0 protein_id gnl|my_center|LOCUS_16060 13237 12536 gene locus_tag LOCUS_16070 13237 12536 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 protein_id gnl|my_center|LOCUS_16070 13896 13228 gene locus_tag LOCUS_16080 gene kdsB 13896 13228 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 protein_id gnl|my_center|LOCUS_16080 14555 13980 gene locus_tag LOCUS_16090 14555 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_16090 16020 14581 gene locus_tag LOCUS_16100 16020 14581 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_16100 16125 16772 gene locus_tag LOCUS_16110 16125 16772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760896.1 protein_id gnl|my_center|LOCUS_16110 16750 17583 gene locus_tag LOCUS_16120 16750 17583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 17583 18131 gene locus_tag LOCUS_16130 17583 18131 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_16130 18128 19072 gene locus_tag LOCUS_16140 18128 19072 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_16140 19518 21293 gene locus_tag LOCUS_16150 19518 21293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 21643 21290 gene locus_tag LOCUS_16160 21643 21290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 23071 21692 gene locus_tag LOCUS_16170 23071 21692 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031019.1 protein_id gnl|my_center|LOCUS_16170 24264 23071 gene locus_tag LOCUS_16180 24264 23071 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_16180 25425 24286 gene locus_tag LOCUS_16190 gene aroB 25425 24286 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368549.1 protein_id gnl|my_center|LOCUS_16190 26311 25439 gene locus_tag LOCUS_16200 26311 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123872.1 protein_id gnl|my_center|LOCUS_16200 27254 26346 gene locus_tag LOCUS_16210 27254 26346 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_16210 28113 27259 gene locus_tag LOCUS_16220 28113 27259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 28288 28869 gene locus_tag LOCUS_16230 gene miaE 28288 28869 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_16230 29772 28885 gene locus_tag LOCUS_16240 gene ppx 29772 28885 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_16240 31858 29777 gene locus_tag LOCUS_16250 gene ppk 31858 29777 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_16250 32343 31855 gene locus_tag LOCUS_16260 32343 31855 CDS product putative phosphoglycerate/bisphosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702159.1 protein_id gnl|my_center|LOCUS_16260 33002 32355 gene locus_tag LOCUS_16270 gene pdxH 33002 32355 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_16270 34064 33153 gene locus_tag LOCUS_16280 gene rnz 34064 33153 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_16280 34521 34189 gene locus_tag LOCUS_16290 34521 34189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963901.1 protein_id gnl|my_center|LOCUS_16290 35454 34528 gene locus_tag LOCUS_16300 gene pyrB 35454 34528 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_16300 36060 35521 gene locus_tag LOCUS_16310 gene pyrR1 36060 35521 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_16310 38045 36207 gene locus_tag LOCUS_16320 gene rpsA 38045 36207 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_16320 38286 38699 gene locus_tag LOCUS_16330 38286 38699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 39460 38768 gene locus_tag LOCUS_16340 gene cmk 39460 38768 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_16340 42036 39586 gene locus_tag LOCUS_16350 gene lon 42036 39586 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_16350 42253 42810 gene locus_tag LOCUS_16360 42253 42810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 42807 43367 gene locus_tag LOCUS_16370 42807 43367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 43403 44494 gene locus_tag LOCUS_16380 43403 44494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 44668 45393 gene locus_tag LOCUS_16390 44668 45393 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680357.1 protein_id gnl|my_center|LOCUS_16390 46815 45472 gene locus_tag LOCUS_16400 46815 45472 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_16400 47706 46897 gene locus_tag LOCUS_16410 47706 46897 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_16410 50144 47745 gene locus_tag LOCUS_16420 50144 47745 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 protein_id gnl|my_center|LOCUS_16420 52145 50250 gene locus_tag LOCUS_16430 gene glgB 52145 50250 CDS product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 protein_id gnl|my_center|LOCUS_16430 52346 52882 gene locus_tag LOCUS_16440 52346 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 53045 53545 gene locus_tag LOCUS_16450 gene mrsB1 53045 53545 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_16450 53725 54129 gene locus_tag LOCUS_16460 gene mrsB2 53725 54129 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_16460 54508 55899 gene locus_tag LOCUS_16470 gene lpdA2 54508 55899 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_16470 55959 56252 gene locus_tag LOCUS_16480 gene ydzA 55959 56252 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 protein_id gnl|my_center|LOCUS_16480 56974 56249 gene locus_tag LOCUS_16490 56974 56249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_16490 57528 56974 gene locus_tag LOCUS_16500 gene aroQ 57528 56974 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_16500 57623 58588 gene locus_tag LOCUS_16510 gene xerD 57623 58588 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_16510 59856 58621 gene locus_tag LOCUS_16520 gene ndh 59856 58621 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_16520 60073 61464 gene locus_tag LOCUS_16530 60073 61464 CDS product glutamate carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860725.1 protein_id gnl|my_center|LOCUS_16530 61575 62069 gene locus_tag LOCUS_16540 61575 62069 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964036.1 protein_id gnl|my_center|LOCUS_16540 62074 62718 gene locus_tag LOCUS_16550 62074 62718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964037.1 protein_id gnl|my_center|LOCUS_16550 63897 63100 gene locus_tag LOCUS_16560 63897 63100 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_16560 64500 63937 gene locus_tag LOCUS_16570 64500 63937 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_16570 64679 65287 gene locus_tag LOCUS_16580 64679 65287 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_16580 65888 65277 gene locus_tag LOCUS_16590 65888 65277 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 protein_id gnl|my_center|LOCUS_16590 66617 65892 gene locus_tag LOCUS_16600 66617 65892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 66827 67807 gene locus_tag LOCUS_16610 66827 67807 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_16610 67776 68726 gene locus_tag LOCUS_16620 67776 68726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 68780 69451 gene locus_tag LOCUS_16630 68780 69451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 69451 70647 gene locus_tag LOCUS_16640 69451 70647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 70652 71653 gene locus_tag LOCUS_16650 70652 71653 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_16650 71712 73046 gene locus_tag LOCUS_16660 71712 73046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_16660 73331 75202 gene locus_tag LOCUS_16670 73331 75202 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975065.1 protein_id gnl|my_center|LOCUS_16670 75258 76010 gene locus_tag LOCUS_16680 gene bla 75258 76010 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFY5 protein_id gnl|my_center|LOCUS_16680 76182 77054 gene locus_tag LOCUS_16690 76182 77054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 77167 78069 gene locus_tag LOCUS_16700 77167 78069 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963796.1 protein_id gnl|my_center|LOCUS_16700 78118 78642 gene locus_tag LOCUS_16710 78118 78642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 78782 79363 gene locus_tag LOCUS_16720 gene miaE 78782 79363 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_16720 80445 79405 gene locus_tag LOCUS_16730 gene guaC 80445 79405 CDS product GMP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CFP5 protein_id gnl|my_center|LOCUS_16730 80607 81983 gene locus_tag LOCUS_16740 gene eutB 80607 81983 CDS product ethanolamine ammonia lyase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103255.1 protein_id gnl|my_center|LOCUS_16740 81980 82732 gene locus_tag LOCUS_16750 gene eutC 81980 82732 CDS product ethanolamine ammonia-lyase light chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WFC6 protein_id gnl|my_center|LOCUS_16750 83896 82940 gene locus_tag LOCUS_16760 83896 82940 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_16760 85205 84015 gene locus_tag LOCUS_16770 gene mnmA 85205 84015 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_16770 85538 87394 gene locus_tag LOCUS_16780 85538 87394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 88164 87862 gene locus_tag LOCUS_16790 88164 87862 CDS product toxin ParE1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_16790 88484 88161 gene locus_tag LOCUS_16800 88484 88161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 88641 89165 gene locus_tag LOCUS_16810 88641 89165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951608.1 protein_id gnl|my_center|LOCUS_16810 91205 89358 gene locus_tag LOCUS_16820 gene yidC 91205 89358 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 protein_id gnl|my_center|LOCUS_16820 92927 91311 gene locus_tag LOCUS_16830 gene pyrG 92927 91311 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_16830 93218 92982 gene locus_tag LOCUS_16840 93218 92982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 protein_id gnl|my_center|LOCUS_16840 93368 94144 gene locus_tag LOCUS_16850 93368 94144 CDS product hydroxypyruvate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123560.1 protein_id gnl|my_center|LOCUS_16850 96411 94261 gene locus_tag LOCUS_16860 96411 94261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_16860 97934 96402 gene locus_tag LOCUS_16870 gene guaA 97934 96402 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 protein_id gnl|my_center|LOCUS_16870 99532 98147 gene locus_tag LOCUS_16880 99532 98147 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803953.1 protein_id gnl|my_center|LOCUS_16880 99728 100273 gene locus_tag LOCUS_16890 99728 100273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 101724 100345 gene locus_tag LOCUS_16900 101724 100345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 103341 101734 gene locus_tag LOCUS_16910 gene bshC 103341 101734 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 protein_id gnl|my_center|LOCUS_16910 103467 105914 gene locus_tag LOCUS_16920 103467 105914 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_16920 105924 107033 gene locus_tag LOCUS_16930 105924 107033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 107216 107794 gene locus_tag LOCUS_16940 107216 107794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 109045 107873 gene locus_tag LOCUS_16950 109045 107873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 110377 109187 gene locus_tag LOCUS_16960 gene hisC 110377 109187 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL44 protein_id gnl|my_center|LOCUS_16960 110925 111389 gene locus_tag LOCUS_16970 110925 111389 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 protein_id gnl|my_center|LOCUS_16970 111559 112911 gene locus_tag LOCUS_16980 111559 112911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_16980 113151 114200 gene locus_tag LOCUS_16990 113151 114200 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_16990 115513 114233 gene locus_tag LOCUS_17000 gene rocD 115513 114233 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_17000 115791 116564 gene locus_tag LOCUS_17010 115791 116564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 116515 118068 gene locus_tag LOCUS_17020 116515 118068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 118055 118450 gene locus_tag LOCUS_17030 118055 118450 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_17030 118532 119962 gene locus_tag LOCUS_17040 gene trmA 118532 119962 CDS product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 protein_id gnl|my_center|LOCUS_17040 119966 120481 gene locus_tag LOCUS_17050 119966 120481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 protein_id gnl|my_center|LOCUS_17050 120462 121205 gene locus_tag LOCUS_17060 120462 121205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 protein_id gnl|my_center|LOCUS_17060 121441 121211 gene locus_tag LOCUS_17070 121441 121211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962889.1 protein_id gnl|my_center|LOCUS_17070 122618 121446 gene locus_tag LOCUS_17080 122618 121446 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_17080 122699 123370 gene locus_tag LOCUS_17090 122699 123370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_17090 123370 123798 gene locus_tag LOCUS_17100 123370 123798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 protein_id gnl|my_center|LOCUS_17100 124412 123795 gene locus_tag LOCUS_17110 gene yqfA 124412 123795 CDS product channel protein hemolysin III family subfamily YqfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072423.1 protein_id gnl|my_center|LOCUS_17110 124985 124518 gene locus_tag LOCUS_17120 124985 124518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 129804 125320 gene locus_tag LOCUS_17130 129804 125320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 130222 131400 gene locus_tag LOCUS_17140 130222 131400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 131695 132447 gene locus_tag LOCUS_17150 131695 132447 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209875.1 protein_id gnl|my_center|LOCUS_17150 132863 132474 gene locus_tag LOCUS_17160 132863 132474 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000791295.1 protein_id gnl|my_center|LOCUS_17160 133871 132867 gene locus_tag LOCUS_17170 133871 132867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 134304 133873 gene locus_tag LOCUS_17180 134304 133873 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977989.1 protein_id gnl|my_center|LOCUS_17180 139040 134301 gene locus_tag LOCUS_17190 139040 134301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 140637 139480 gene locus_tag LOCUS_17200 gene lldD 140637 139480 CDS product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220815.1 protein_id gnl|my_center|LOCUS_17200 140988 140650 gene locus_tag LOCUS_17210 140988 140650 CDS product L-fucose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P3K1 protein_id gnl|my_center|LOCUS_17210 142586 141120 gene locus_tag LOCUS_17220 142586 141120 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_17220 143735 142845 gene locus_tag LOCUS_17230 143735 142845 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338042.1 protein_id gnl|my_center|LOCUS_17230 144536 143760 gene locus_tag LOCUS_17240 144536 143760 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_17240 145861 144536 gene locus_tag LOCUS_17250 145861 144536 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769537.1 protein_id gnl|my_center|LOCUS_17250 147207 145885 gene locus_tag LOCUS_17260 147207 145885 CDS product L-fuconate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703671.1 protein_id gnl|my_center|LOCUS_17260 149118 147478 gene locus_tag LOCUS_17270 gene ccrB 149118 147478 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000031832.1 protein_id gnl|my_center|LOCUS_17270 147519 147603 gene locus_tag LOCUS_t00120 147519 147603 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 149269 149102 gene locus_tag LOCUS_17280 149269 149102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 149893 149651 gene locus_tag LOCUS_17290 149893 149651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 151328 150417 gene locus_tag LOCUS_17300 151328 150417 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_17300 151555 152541 gene locus_tag LOCUS_17310 151555 152541 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172285.1 protein_id gnl|my_center|LOCUS_17310 152638 153318 gene locus_tag LOCUS_17320 152638 153318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106556.1 protein_id gnl|my_center|LOCUS_17320 153320 154384 gene locus_tag LOCUS_17330 153320 154384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211252.1 protein_id gnl|my_center|LOCUS_17330 154381 154872 gene locus_tag LOCUS_17340 154381 154872 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 protein_id gnl|my_center|LOCUS_17340 155206 156000 gene locus_tag LOCUS_17350 155206 156000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 157182 156154 gene locus_tag LOCUS_17360 157182 156154 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_17360 157275 157727 gene locus_tag LOCUS_17370 157275 157727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 157864 158313 gene locus_tag LOCUS_17380 157864 158313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 158418 160004 gene locus_tag LOCUS_17390 158418 160004 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QPP6 protein_id gnl|my_center|LOCUS_17390 160050 161204 gene locus_tag LOCUS_17400 160050 161204 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817250.1 protein_id gnl|my_center|LOCUS_17400 161214 161819 gene locus_tag LOCUS_17410 161214 161819 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582689.1 protein_id gnl|my_center|LOCUS_17410 161919 162383 gene locus_tag LOCUS_17420 161919 162383 CDS product isoquinoline 1-oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920131.1 protein_id gnl|my_center|LOCUS_17420 162410 164668 gene locus_tag LOCUS_17430 162410 164668 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_17430 166040 164943 gene locus_tag LOCUS_17440 166040 164943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 166854 166042 gene locus_tag LOCUS_17450 166854 166042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 167206 166844 gene locus_tag LOCUS_17460 167206 166844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 167348 167746 gene locus_tag LOCUS_17470 167348 167746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 168012 168416 gene locus_tag LOCUS_17480 168012 168416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 168416 169159 gene locus_tag LOCUS_17490 168416 169159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 169390 171759 gene locus_tag LOCUS_17500 169390 171759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205278.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence08 981 1736 gene locus_tag LOCUS_17510 981 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 2551 1778 gene locus_tag LOCUS_17520 gene dltE 2551 1778 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_17520 2680 3030 gene locus_tag LOCUS_17530 2680 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 3383 4288 gene locus_tag LOCUS_17540 3383 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_17540 4389 5126 gene locus_tag LOCUS_17550 4389 5126 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_17550 5143 6060 gene locus_tag LOCUS_17560 5143 6060 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_17560 7120 6395 gene locus_tag LOCUS_17570 7120 6395 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_17570 7661 7290 gene locus_tag LOCUS_17580 7661 7290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 8046 7858 gene locus_tag LOCUS_17590 8046 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 8500 8760 gene locus_tag LOCUS_17600 8500 8760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 10526 8838 gene locus_tag LOCUS_17610 10526 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 11012 11602 gene locus_tag LOCUS_17620 11012 11602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 11899 12771 gene locus_tag LOCUS_17630 11899 12771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 12870 13547 gene locus_tag LOCUS_17640 12870 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 13847 14290 gene locus_tag LOCUS_17650 13847 14290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 14440 14763 gene locus_tag LOCUS_17660 14440 14763 CDS product conjugal transfer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040014.1 protein_id gnl|my_center|LOCUS_17660 14775 15224 gene locus_tag LOCUS_17670 14775 15224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 15316 15684 gene locus_tag LOCUS_17680 15316 15684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 15659 18136 gene locus_tag LOCUS_17690 15659 18136 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107104.1 protein_id gnl|my_center|LOCUS_17690 18181 18882 gene locus_tag LOCUS_17700 18181 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 18899 19558 gene locus_tag LOCUS_17710 18899 19558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 19625 20056 gene locus_tag LOCUS_17720 19625 20056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 20133 20771 gene locus_tag LOCUS_17730 20133 20771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 20755 21978 gene locus_tag LOCUS_17740 20755 21978 CDS product conjugative transposon protein TraJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009040012.1 protein_id gnl|my_center|LOCUS_17740 22021 22647 gene locus_tag LOCUS_17750 22021 22647 CDS product conjugative transposon protein TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776802.1 protein_id gnl|my_center|LOCUS_17750 22668 23021 gene locus_tag LOCUS_17760 22668 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 23024 24241 gene locus_tag LOCUS_17770 23024 24241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 24254 25090 gene locus_tag LOCUS_17780 24254 25090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 25121 25906 gene locus_tag LOCUS_17790 25121 25906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 25923 26969 gene locus_tag LOCUS_17800 25923 26969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 27037 27198 gene locus_tag LOCUS_17810 27037 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 27240 28793 gene locus_tag LOCUS_17820 27240 28793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 28827 28750 gene locus_tag LOCUS_t00130 28827 28750 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 30139 28928 gene locus_tag LOCUS_17830 gene folC 30139 28928 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_17830 30979 30146 gene locus_tag LOCUS_17840 30979 30146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_17840 31365 30979 gene locus_tag LOCUS_17850 31365 30979 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 protein_id gnl|my_center|LOCUS_17850 32067 31375 gene locus_tag LOCUS_17860 32067 31375 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_17860 33451 32117 gene locus_tag LOCUS_17870 33451 32117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883648.1 protein_id gnl|my_center|LOCUS_17870 34694 33468 gene locus_tag LOCUS_17880 34694 33468 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_17880 35056 36198 gene locus_tag LOCUS_17890 35056 36198 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_17890 36515 41023 gene locus_tag LOCUS_17900 gene gltA 36515 41023 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_17900 41037 42503 gene locus_tag LOCUS_17910 gene gltD 41037 42503 CDS product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000513713.1 protein_id gnl|my_center|LOCUS_17910 43484 42822 gene locus_tag LOCUS_17920 43484 42822 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_17920 44453 45517 gene locus_tag LOCUS_17930 44453 45517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_17930 47014 45551 gene locus_tag LOCUS_17940 47014 45551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 47537 48163 gene locus_tag LOCUS_17950 47537 48163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_17950 48160 48975 gene locus_tag LOCUS_17960 gene deoD 48160 48975 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_17960 48972 49937 gene locus_tag LOCUS_17970 48972 49937 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_17970 50171 50917 gene locus_tag LOCUS_17980 50171 50917 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_17980 50919 51617 gene locus_tag LOCUS_17990 50919 51617 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933083.1 protein_id gnl|my_center|LOCUS_17990 52600 51614 gene locus_tag LOCUS_18000 52600 51614 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797797.1 protein_id gnl|my_center|LOCUS_18000 53146 53343 gene locus_tag LOCUS_18010 53146 53343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 54522 53551 gene locus_tag LOCUS_18020 54522 53551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 protein_id gnl|my_center|LOCUS_18020 54716 56098 gene locus_tag LOCUS_18030 54716 56098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 56095 57687 gene locus_tag LOCUS_18040 56095 57687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 57754 58443 gene locus_tag LOCUS_18050 57754 58443 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_18050 58480 59964 gene locus_tag LOCUS_18060 58480 59964 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 protein_id gnl|my_center|LOCUS_18060 59965 61314 gene locus_tag LOCUS_18070 59965 61314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404247.1 protein_id gnl|my_center|LOCUS_18070 61534 62142 gene locus_tag LOCUS_18080 61534 62142 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108960.1 protein_id gnl|my_center|LOCUS_18080 62144 63334 gene locus_tag LOCUS_18090 62144 63334 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778881.1 protein_id gnl|my_center|LOCUS_18090 63291 64301 gene locus_tag LOCUS_18100 gene argC 63291 64301 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1A7 protein_id gnl|my_center|LOCUS_18100 64373 65167 gene locus_tag LOCUS_18110 gene proC 64373 65167 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR3 protein_id gnl|my_center|LOCUS_18110 65169 66293 gene locus_tag LOCUS_18120 65169 66293 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_18120 66293 67489 gene locus_tag LOCUS_18130 gene proA 66293 67489 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y156 protein_id gnl|my_center|LOCUS_18130 67493 68254 gene locus_tag LOCUS_18140 67493 68254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 68259 69200 gene locus_tag LOCUS_18150 gene argF' 68259 69200 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 protein_id gnl|my_center|LOCUS_18150 69305 69499 gene locus_tag LOCUS_18160 69305 69499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 69507 70286 gene locus_tag LOCUS_18170 gene argB 69507 70286 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT7 protein_id gnl|my_center|LOCUS_18170 70288 71355 gene locus_tag LOCUS_18180 70288 71355 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_18180 71621 72907 gene locus_tag LOCUS_18190 gene argH 71621 72907 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 protein_id gnl|my_center|LOCUS_18190 73794 72949 gene locus_tag LOCUS_18200 73794 72949 CDS product pseudouridylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962486.1 protein_id gnl|my_center|LOCUS_18200 74848 73943 gene locus_tag LOCUS_18210 74848 73943 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_18210 75797 74859 gene locus_tag LOCUS_18220 gene mvaK 75797 74859 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_18220 76979 75894 gene locus_tag LOCUS_18230 gene mvaD 76979 75894 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_18230 77084 77611 gene locus_tag LOCUS_18240 77084 77611 CDS product TspO/MBR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_18240 78138 77614 gene locus_tag LOCUS_18250 78138 77614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030649.1 protein_id gnl|my_center|LOCUS_18250 79414 78140 gene locus_tag LOCUS_18260 79414 78140 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_18260 80166 79414 gene locus_tag LOCUS_18270 80166 79414 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070923.1 protein_id gnl|my_center|LOCUS_18270 80498 80872 gene locus_tag LOCUS_18280 80498 80872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 82762 80969 gene locus_tag LOCUS_18290 82762 80969 CDS product O-glycosyl hydrolase family 13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 protein_id gnl|my_center|LOCUS_18290 85202 82896 gene locus_tag LOCUS_18300 85202 82896 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_18300 85859 85203 gene locus_tag LOCUS_18310 gene pgmB2 85859 85203 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_18310 87253 86237 gene locus_tag LOCUS_18320 87253 86237 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_18320 87637 90756 gene locus_tag LOCUS_18330 87637 90756 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403137.1 protein_id gnl|my_center|LOCUS_18330 90767 92350 gene locus_tag LOCUS_18340 90767 92350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_18340 92965 96198 gene locus_tag LOCUS_18350 92965 96198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 96191 99481 gene locus_tag LOCUS_18360 96191 99481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 99551 100915 gene locus_tag LOCUS_18370 99551 100915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 101075 101971 gene locus_tag LOCUS_18380 101075 101971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 102179 102691 gene locus_tag LOCUS_18390 102179 102691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 protein_id gnl|my_center|LOCUS_18390 103587 102682 gene locus_tag LOCUS_18400 103587 102682 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092195.1 protein_id gnl|my_center|LOCUS_18400 103659 105248 gene locus_tag LOCUS_18410 gene hutH 103659 105248 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 protein_id gnl|my_center|LOCUS_18410 105250 106515 gene locus_tag LOCUS_18420 gene hutI 105250 106515 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI05 protein_id gnl|my_center|LOCUS_18420 106505 108589 gene locus_tag LOCUS_18430 gene hutU 106505 108589 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_18430 108636 109628 gene locus_tag LOCUS_18440 gene hutG 108636 109628 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0C4 protein_id gnl|my_center|LOCUS_18440 110808 109651 gene locus_tag LOCUS_18450 gene hmgA 110808 109651 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_18450 112917 111619 gene locus_tag LOCUS_18460 gene ndh 112917 111619 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964035.1 protein_id gnl|my_center|LOCUS_18460 113965 113066 gene locus_tag LOCUS_18470 113965 113066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 115036 114350 gene locus_tag LOCUS_18480 115036 114350 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_18480 115154 117529 gene locus_tag LOCUS_18490 gene ccoI 115154 117529 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_18490 117644 117883 gene locus_tag LOCUS_18500 117644 117883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 117937 120138 gene locus_tag LOCUS_18510 gene ccoN/ccoO 117937 120138 CDS product bifunctional cbb3-type cytochrome C oxidase subunit I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_18510 120142 120336 gene locus_tag LOCUS_18520 120142 120336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 120333 121271 gene locus_tag LOCUS_18530 gene ccoP 120333 121271 CDS product cytochrome c oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_18530 121296 122705 gene locus_tag LOCUS_18540 gene ccoG 121296 122705 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_18540 122724 123218 gene locus_tag LOCUS_18550 gene ccoH 122724 123218 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_18550 123234 123938 gene locus_tag LOCUS_18560 123234 123938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_18560 124102 125481 gene locus_tag LOCUS_18570 124102 125481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 126362 125541 gene locus_tag LOCUS_18580 gene uspA 126362 125541 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_18580 127515 126388 gene locus_tag LOCUS_18590 gene hemN 127515 126388 CDS product coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYS7 protein_id gnl|my_center|LOCUS_18590 129153 127888 gene locus_tag LOCUS_18600 129153 127888 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_18600 129735 129226 gene locus_tag LOCUS_18610 129735 129226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 130231 129875 gene locus_tag LOCUS_18620 130231 129875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 133356 130372 gene locus_tag LOCUS_18630 gene dnaE 133356 130372 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180P3 protein_id gnl|my_center|LOCUS_18630 134594 133380 gene locus_tag LOCUS_18640 gene dinB 134594 133380 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MBE5 protein_id gnl|my_center|LOCUS_18640 135405 134695 gene locus_tag LOCUS_18650 135405 134695 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_18650 135735 135409 gene locus_tag LOCUS_18660 135735 135409 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 protein_id gnl|my_center|LOCUS_18660 138089 135735 gene locus_tag LOCUS_18670 138089 135735 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963162.1 protein_id gnl|my_center|LOCUS_18670 138624 138079 gene locus_tag LOCUS_18680 138624 138079 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490721.1 protein_id gnl|my_center|LOCUS_18680 139100 138702 gene locus_tag LOCUS_18690 139100 138702 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 protein_id gnl|my_center|LOCUS_18690 141000 139228 gene locus_tag LOCUS_18700 141000 139228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_18700 141427 141071 gene locus_tag LOCUS_18710 141427 141071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_18710 141915 141586 gene locus_tag LOCUS_18720 141915 141586 CDS product DabB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640452.1 protein_id gnl|my_center|LOCUS_18720 142822 142190 gene locus_tag LOCUS_18730 142822 142190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_18730 143174 142812 gene locus_tag LOCUS_18740 143174 142812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_18740 143923 143171 gene locus_tag LOCUS_18750 143923 143171 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_18750 145071 143935 gene locus_tag LOCUS_18760 145071 143935 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_18760 145654 145103 gene locus_tag LOCUS_18770 gene ruvC 145654 145103 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 protein_id gnl|my_center|LOCUS_18770 146135 145659 gene locus_tag LOCUS_18780 146135 145659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962388.1 protein_id gnl|my_center|LOCUS_18780 147377 146229 gene locus_tag LOCUS_18790 147377 146229 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 protein_id gnl|my_center|LOCUS_18790 149218 147470 gene locus_tag LOCUS_18800 149218 147470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 150942 149434 gene locus_tag LOCUS_18810 150942 149434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 151984 150992 gene locus_tag LOCUS_18820 151984 150992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 152285 154675 gene locus_tag LOCUS_18830 152285 154675 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_18830 155473 154751 gene locus_tag LOCUS_18840 155473 154751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 156702 155722 gene locus_tag LOCUS_18850 156702 155722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 156801 157373 gene locus_tag LOCUS_18860 156801 157373 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226555.1 protein_id gnl|my_center|LOCUS_18860 158001 157456 gene locus_tag LOCUS_18870 158001 157456 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_18870 158267 158686 gene locus_tag LOCUS_18880 158267 158686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 158827 159912 gene locus_tag LOCUS_18890 158827 159912 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_18890 159938 163102 gene locus_tag LOCUS_18900 159938 163102 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963080.1 protein_id gnl|my_center|LOCUS_18900 163095 164531 gene locus_tag LOCUS_18910 163095 164531 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963081.1 protein_id gnl|my_center|LOCUS_18910 165903 164650 gene locus_tag LOCUS_18920 165903 164650 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143506.1 protein_id gnl|my_center|LOCUS_18920 166492 166403 gene locus_tag LOCUS_r00010 166492 166403 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 75 percent of the 5S ribosomal RNA >Feature sequence09 454 245 gene locus_tag LOCUS_18930 454 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 830 2416 gene locus_tag LOCUS_18940 830 2416 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103470.1 protein_id gnl|my_center|LOCUS_18940 2550 2837 gene locus_tag LOCUS_18950 2550 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2909 3454 gene locus_tag LOCUS_18960 2909 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3530 5899 gene locus_tag LOCUS_18970 3530 5899 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108117.1 protein_id gnl|my_center|LOCUS_18970 5979 7235 gene locus_tag LOCUS_18980 5979 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 9084 7348 gene locus_tag LOCUS_18990 9084 7348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 10628 9096 gene locus_tag LOCUS_19000 10628 9096 CDS product glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919625.1 protein_id gnl|my_center|LOCUS_19000 11574 10762 gene locus_tag LOCUS_19010 11574 10762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 13314 11800 gene locus_tag LOCUS_19020 13314 11800 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_19020 16432 13325 gene locus_tag LOCUS_19030 16432 13325 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_19030 16781 19597 gene locus_tag LOCUS_19040 16781 19597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_19040 19837 20709 gene locus_tag LOCUS_19050 19837 20709 CDS product large multifunctional protein- glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120043.1 protein_id gnl|my_center|LOCUS_19050 21382 20765 gene locus_tag LOCUS_19060 21382 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 23395 21401 gene locus_tag LOCUS_19070 23395 21401 CDS product acyl-peptide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404763.1 protein_id gnl|my_center|LOCUS_19070 26653 23534 gene locus_tag LOCUS_19080 26653 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 26717 26902 gene locus_tag LOCUS_19090 26717 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 27895 27032 gene locus_tag LOCUS_19100 gene rpoD 27895 27032 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_19100 30331 28115 gene locus_tag LOCUS_19110 gene pnp 30331 28115 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_19110 30825 30556 gene locus_tag LOCUS_19120 gene rpsO 30825 30556 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 protein_id gnl|my_center|LOCUS_19120 31758 30898 gene locus_tag LOCUS_19130 gene accD 31758 30898 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_19130 32864 31797 gene locus_tag LOCUS_19140 gene fbaA 32864 31797 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_19140 35532 32926 gene locus_tag LOCUS_19150 35532 32926 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 protein_id gnl|my_center|LOCUS_19150 35557 36282 gene locus_tag LOCUS_19160 35557 36282 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_19160 36922 36311 gene locus_tag LOCUS_19170 gene porT 36922 36311 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_19170 37733 37005 gene locus_tag LOCUS_19180 gene menG 37733 37005 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_19180 38107 39456 gene locus_tag LOCUS_19190 38107 39456 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_19190 39457 40947 gene locus_tag LOCUS_19200 39457 40947 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_19200 42349 41165 gene locus_tag LOCUS_19210 gene aspC1 42349 41165 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 protein_id gnl|my_center|LOCUS_19210 43466 42363 gene locus_tag LOCUS_19220 43466 42363 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_19220 43576 44211 gene locus_tag LOCUS_19230 gene rsmG 43576 44211 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 protein_id gnl|my_center|LOCUS_19230 46591 44963 gene locus_tag LOCUS_19240 gene pruA 46591 44963 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_19240 47067 46681 gene locus_tag LOCUS_19250 gene apaG 47067 46681 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 protein_id gnl|my_center|LOCUS_19250 48201 47077 gene locus_tag LOCUS_19260 48201 47077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 49468 48224 gene locus_tag LOCUS_19270 49468 48224 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_19270 49621 50973 gene locus_tag LOCUS_19280 gene nqrA 49621 50973 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_19280 50977 52245 gene locus_tag LOCUS_19290 gene nqrB 50977 52245 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 protein_id gnl|my_center|LOCUS_19290 52248 53000 gene locus_tag LOCUS_19300 gene nqrC 52248 53000 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_19300 53004 53651 gene locus_tag LOCUS_19310 gene nqrD 53004 53651 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 protein_id gnl|my_center|LOCUS_19310 53676 54431 gene locus_tag LOCUS_19320 gene nqrE 53676 54431 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_19320 54434 55741 gene locus_tag LOCUS_19330 gene nqrF 54434 55741 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 protein_id gnl|my_center|LOCUS_19330 55808 56173 gene locus_tag LOCUS_19340 55808 56173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 56207 57238 gene locus_tag LOCUS_19350 56207 57238 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89Z17 protein_id gnl|my_center|LOCUS_19350 57980 57210 gene locus_tag LOCUS_19360 57980 57210 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_19360 58816 57998 gene locus_tag LOCUS_19370 gene map 58816 57998 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_19370 60466 58949 gene locus_tag LOCUS_19380 gene gpmI 60466 58949 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_19380 60738 61088 gene locus_tag LOCUS_19390 60738 61088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 61445 61278 gene locus_tag LOCUS_19400 61445 61278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 62457 61693 gene locus_tag LOCUS_19410 62457 61693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 63243 62509 gene locus_tag LOCUS_19420 63243 62509 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_19420 64605 63460 gene locus_tag LOCUS_19430 64605 63460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 66955 64607 gene locus_tag LOCUS_19440 66955 64607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 67821 67129 gene locus_tag LOCUS_19450 gene pepE 67821 67129 CDS product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 protein_id gnl|my_center|LOCUS_19450 68139 68843 gene locus_tag LOCUS_19460 68139 68843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 68857 69612 gene locus_tag LOCUS_19470 68857 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 70042 70548 gene locus_tag LOCUS_19480 70042 70548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_19480 70609 72918 gene locus_tag LOCUS_19490 70609 72918 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 protein_id gnl|my_center|LOCUS_19490 73090 73371 gene locus_tag LOCUS_19500 73090 73371 CDS product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_19500 73379 73951 gene locus_tag LOCUS_19510 73379 73951 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_19510 74558 73917 gene locus_tag LOCUS_19520 74558 73917 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_19520 74640 75116 gene locus_tag LOCUS_19530 74640 75116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 75216 76484 gene locus_tag LOCUS_19540 gene kynU 75216 76484 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_19540 76509 77648 gene locus_tag LOCUS_19550 76509 77648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 78360 77680 gene locus_tag LOCUS_19560 78360 77680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 78482 79030 gene locus_tag LOCUS_19570 gene clpP 78482 79030 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZF7 protein_id gnl|my_center|LOCUS_19570 79483 80781 gene locus_tag LOCUS_19580 gene kmo 79483 80781 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_19580 81592 80813 gene locus_tag LOCUS_19590 81592 80813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_19590 82693 81599 gene locus_tag LOCUS_19600 gene yqfO 82693 81599 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 protein_id gnl|my_center|LOCUS_19600 82794 83738 gene locus_tag LOCUS_19610 gene lpxK 82794 83738 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 protein_id gnl|my_center|LOCUS_19610 85847 83733 gene locus_tag LOCUS_19620 85847 83733 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963589.1 protein_id gnl|my_center|LOCUS_19620 86965 85955 gene locus_tag LOCUS_19630 gene gapA1 86965 85955 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963588.1 protein_id gnl|my_center|LOCUS_19630 87963 87088 gene locus_tag LOCUS_19640 gene lipA 87963 87088 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_19640 88668 88102 gene locus_tag LOCUS_19650 88668 88102 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_19650 88925 88701 gene locus_tag LOCUS_19660 88925 88701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 89747 88989 gene locus_tag LOCUS_19670 89747 88989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 90307 89744 gene locus_tag LOCUS_19680 gene rpoE4 90307 89744 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263593.1 protein_id gnl|my_center|LOCUS_19680 91537 90521 gene locus_tag LOCUS_19690 gene murB 91537 90521 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_19690 92703 91534 gene locus_tag LOCUS_19700 gene aspC2 92703 91534 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_19700 93013 94314 gene locus_tag LOCUS_19710 93013 94314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 94858 94469 gene locus_tag LOCUS_19720 94858 94469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_19720 95055 97685 gene locus_tag LOCUS_19730 gene valS 95055 97685 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_19730 97795 99369 gene locus_tag LOCUS_19740 97795 99369 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626351.1 protein_id gnl|my_center|LOCUS_19740 101986 99377 gene locus_tag LOCUS_19750 101986 99377 CDS product ligand-gated channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000769101.1 protein_id gnl|my_center|LOCUS_19750 103284 102136 gene locus_tag LOCUS_19760 103284 102136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 103572 104870 gene locus_tag LOCUS_19770 103572 104870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 104854 105564 gene locus_tag LOCUS_19780 104854 105564 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963527.1 protein_id gnl|my_center|LOCUS_19780 105849 105583 gene locus_tag LOCUS_19790 105849 105583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 106507 105839 gene locus_tag LOCUS_19800 gene psd 106507 105839 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_19800 107300 106497 gene locus_tag LOCUS_19810 gene cdsA 107300 106497 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_19810 107912 107304 gene locus_tag LOCUS_19820 107912 107304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 protein_id gnl|my_center|LOCUS_19820 109887 107983 gene locus_tag LOCUS_19830 gene ftsH 109887 107983 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 protein_id gnl|my_center|LOCUS_19830 110461 110087 gene locus_tag LOCUS_19840 gene rsfS 110461 110087 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_19840 110555 111286 gene locus_tag LOCUS_19850 gene birA 110555 111286 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_19850 111675 111283 gene locus_tag LOCUS_19860 111675 111283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 protein_id gnl|my_center|LOCUS_19860 112147 111686 gene locus_tag LOCUS_19870 112147 111686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 112332 112919 gene locus_tag LOCUS_19880 112332 112919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 114676 112916 gene locus_tag LOCUS_19890 114676 112916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_19890 115152 114748 gene locus_tag LOCUS_19900 115152 114748 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012319.1 protein_id gnl|my_center|LOCUS_19900 116986 115139 gene locus_tag LOCUS_19910 116986 115139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 117724 117266 gene locus_tag LOCUS_19920 gene coaD 117724 117266 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_19920 118740 117760 gene locus_tag LOCUS_19930 gene ddl 118740 117760 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_19930 118904 119497 gene locus_tag LOCUS_19940 118904 119497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 119497 120531 gene locus_tag LOCUS_19950 119497 120531 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_19950 120633 121394 gene locus_tag LOCUS_19960 120633 121394 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_19960 121451 121819 gene locus_tag LOCUS_19970 121451 121819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 122176 125628 gene locus_tag LOCUS_19980 gene pyc 122176 125628 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AE8 protein_id gnl|my_center|LOCUS_19980 125657 126346 gene locus_tag LOCUS_19990 125657 126346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 126589 126449 gene locus_tag LOCUS_20000 126589 126449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 128186 126693 gene locus_tag LOCUS_20010 128186 126693 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385794.1 protein_id gnl|my_center|LOCUS_20010 129226 128462 gene locus_tag LOCUS_20020 gene trpA 129226 128462 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 protein_id gnl|my_center|LOCUS_20020 130458 129271 gene locus_tag LOCUS_20030 gene trpB 130458 129271 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_20030 131213 130473 gene locus_tag LOCUS_20040 gene trpF 131213 130473 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 protein_id gnl|my_center|LOCUS_20040 132004 131222 gene locus_tag LOCUS_20050 gene trpC 132004 131222 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_20050 133081 132035 gene locus_tag LOCUS_20060 gene trpD 133081 132035 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_20060 133699 133130 gene locus_tag LOCUS_20070 gene pabA 133699 133130 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_20070 135143 133746 gene locus_tag LOCUS_20080 gene trpE 135143 133746 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_20080 135962 135384 gene locus_tag LOCUS_20090 gene yceI 135962 135384 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_20090 136638 136006 gene locus_tag LOCUS_20100 136638 136006 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 protein_id gnl|my_center|LOCUS_20100 137113 136667 gene locus_tag LOCUS_20110 137113 136667 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_20110 137875 137327 gene locus_tag LOCUS_20120 137875 137327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 138004 138315 gene locus_tag LOCUS_20130 138004 138315 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_20130 138396 139679 gene locus_tag LOCUS_20140 138396 139679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_20140 139689 139916 gene locus_tag LOCUS_20150 139689 139916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 140079 142148 gene locus_tag LOCUS_20160 140079 142148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 143738 143532 gene locus_tag LOCUS_20170 143738 143532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 143763 145328 gene locus_tag LOCUS_20180 143763 145328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20180 145325 145480 gene locus_tag LOCUS_20190 145325 145480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 145491 146351 gene locus_tag LOCUS_20200 145491 146351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 protein_id gnl|my_center|LOCUS_20200 146364 147527 gene locus_tag LOCUS_20210 146364 147527 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_20210 147599 147793 gene locus_tag LOCUS_20220 gene rpsU 147599 147793 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_20220 147913 148803 gene locus_tag LOCUS_20230 gene xerC 147913 148803 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_20230 148852 149154 gene locus_tag LOCUS_20240 148852 149154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_20240 149351 149425 gene locus_tag LOCUS_t00140 149351 149425 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 149449 149531 gene locus_tag LOCUS_t00150 149449 149531 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 149619 149692 gene locus_tag LOCUS_t00160 149619 149692 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 149869 149941 gene locus_tag LOCUS_t00170 149869 149941 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 149995 151182 gene locus_tag LOCUS_20250 gene tuf 149995 151182 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_20250 151251 151324 gene locus_tag LOCUS_t00180 151251 151324 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 151489 151677 gene locus_tag LOCUS_20260 gene secE 151489 151677 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU6 protein_id gnl|my_center|LOCUS_20260 151687 152238 gene locus_tag LOCUS_20270 gene nusG 151687 152238 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU5 protein_id gnl|my_center|LOCUS_20270 152312 152749 gene locus_tag LOCUS_20280 gene rplK 152312 152749 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_20280 152772 153461 gene locus_tag LOCUS_20290 gene rplA 152772 153461 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_20290 153483 153998 gene locus_tag LOCUS_20300 gene rplJ 153483 153998 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU2 protein_id gnl|my_center|LOCUS_20300 154052 154432 gene locus_tag LOCUS_20310 gene rplL 154052 154432 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_20310 154566 158375 gene locus_tag LOCUS_20320 gene rpoB 154566 158375 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_20320 158489 162730 gene locus_tag LOCUS_20330 gene rpoC 158489 162730 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT9 protein_id gnl|my_center|LOCUS_20330 162737 163042 gene locus_tag LOCUS_20340 162737 163042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_20340 164682 163093 gene locus_tag LOCUS_20350 gene prfC 164682 163093 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_20350 >Feature sequence10 430 179 gene locus_tag LOCUS_20360 430 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 845 771 gene locus_tag LOCUS_t00190 845 771 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1358 2242 gene locus_tag LOCUS_20370 1358 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2273 4501 gene locus_tag LOCUS_20380 2273 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20380 4594 6066 gene locus_tag LOCUS_20390 4594 6066 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_20390 8068 6272 gene locus_tag LOCUS_20400 8068 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 11030 8562 gene locus_tag LOCUS_20410 11030 8562 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964543.1 protein_id gnl|my_center|LOCUS_20410 11293 12075 gene locus_tag LOCUS_20420 11293 12075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794237.1 protein_id gnl|my_center|LOCUS_20420 12041 12436 gene locus_tag LOCUS_20430 12041 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760453.1 protein_id gnl|my_center|LOCUS_20430 12998 12537 gene locus_tag LOCUS_20440 12998 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 13362 15731 gene locus_tag LOCUS_20450 gene mrcA 13362 15731 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_20450 15887 16873 gene locus_tag LOCUS_20460 15887 16873 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 protein_id gnl|my_center|LOCUS_20460 16864 18255 gene locus_tag LOCUS_20470 16864 18255 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Q1 protein_id gnl|my_center|LOCUS_20470 18338 19381 gene locus_tag LOCUS_20480 18338 19381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 19528 22386 gene locus_tag LOCUS_20490 19528 22386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 23668 22409 gene locus_tag LOCUS_20500 23668 22409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 26579 23670 gene locus_tag LOCUS_20510 26579 23670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 27651 26914 gene locus_tag LOCUS_20520 27651 26914 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107985.1 protein_id gnl|my_center|LOCUS_20520 28690 27626 gene locus_tag LOCUS_20530 28690 27626 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786905.1 protein_id gnl|my_center|LOCUS_20530 29046 28702 gene locus_tag LOCUS_20540 29046 28702 CDS product DUF4907 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107979.1 protein_id gnl|my_center|LOCUS_20540 30139 29144 gene locus_tag LOCUS_20550 30139 29144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203251.1 protein_id gnl|my_center|LOCUS_20550 30379 31698 gene locus_tag LOCUS_20560 30379 31698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 31712 32938 gene locus_tag LOCUS_20570 31712 32938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_20570 33291 34256 gene locus_tag LOCUS_20580 gene trxB1 33291 34256 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_20580 34764 34315 gene locus_tag LOCUS_20590 34764 34315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 36110 35043 gene locus_tag LOCUS_20600 36110 35043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 37120 36107 gene locus_tag LOCUS_20610 gene ykfB 37120 36107 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121963.1 protein_id gnl|my_center|LOCUS_20610 38147 37386 gene locus_tag LOCUS_20620 38147 37386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 39906 38185 gene locus_tag LOCUS_20630 39906 38185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_20630 40242 39913 gene locus_tag LOCUS_20640 40242 39913 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 protein_id gnl|my_center|LOCUS_20640 40850 40377 gene locus_tag LOCUS_20650 40850 40377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962834.1 protein_id gnl|my_center|LOCUS_20650 41050 40865 gene locus_tag LOCUS_20660 41050 40865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 41049 41504 gene locus_tag LOCUS_20670 41049 41504 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_20670 41584 42381 gene locus_tag LOCUS_20680 41584 42381 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 protein_id gnl|my_center|LOCUS_20680 42403 43056 gene locus_tag LOCUS_20690 42403 43056 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_20690 43086 43682 gene locus_tag LOCUS_20700 43086 43682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 protein_id gnl|my_center|LOCUS_20700 45074 43809 gene locus_tag LOCUS_20710 gene dacB 45074 43809 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_20710 45291 45479 gene locus_tag LOCUS_20720 45291 45479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_20720 46550 45609 gene locus_tag LOCUS_20730 gene oxyR 46550 45609 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_20730 46655 47134 gene locus_tag LOCUS_20740 46655 47134 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705037.1 protein_id gnl|my_center|LOCUS_20740 47615 47199 gene locus_tag LOCUS_20750 47615 47199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 47856 48035 gene locus_tag LOCUS_20760 47856 48035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 48032 49612 gene locus_tag LOCUS_20770 48032 49612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 50244 49618 gene locus_tag LOCUS_20780 gene paiB 50244 49618 CDS product protease synthase and sporulation protein PAI 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21341 protein_id gnl|my_center|LOCUS_20780 51027 50281 gene locus_tag LOCUS_20790 51027 50281 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_20790 52622 51060 gene locus_tag LOCUS_20800 52622 51060 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_20800 53138 52740 gene locus_tag LOCUS_20810 53138 52740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 53900 55237 gene locus_tag LOCUS_20820 53900 55237 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 protein_id gnl|my_center|LOCUS_20820 55348 55644 gene locus_tag LOCUS_20830 55348 55644 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963761.1 protein_id gnl|my_center|LOCUS_20830 55635 55994 gene locus_tag LOCUS_20840 55635 55994 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877331.1 protein_id gnl|my_center|LOCUS_20840 56066 56374 gene locus_tag LOCUS_20850 56066 56374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 56416 57171 gene locus_tag LOCUS_20860 56416 57171 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_20860 58450 57263 gene locus_tag LOCUS_20870 58450 57263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 58787 60118 gene locus_tag LOCUS_20880 58787 60118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 61377 60565 gene locus_tag LOCUS_20890 61377 60565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 61787 64552 gene locus_tag LOCUS_20900 61787 64552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_20900 64847 67813 gene locus_tag LOCUS_20910 64847 67813 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_20910 67821 69359 gene locus_tag LOCUS_20920 67821 69359 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766873.1 protein_id gnl|my_center|LOCUS_20920 69387 71105 gene locus_tag LOCUS_20930 69387 71105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 71220 72566 gene locus_tag LOCUS_20940 71220 72566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_20940 72550 73926 gene locus_tag LOCUS_20950 72550 73926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796641.1 protein_id gnl|my_center|LOCUS_20950 74119 75855 gene locus_tag LOCUS_20960 74119 75855 CDS product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203676.1 protein_id gnl|my_center|LOCUS_20960 75915 76712 gene locus_tag LOCUS_20970 75915 76712 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108741.1 protein_id gnl|my_center|LOCUS_20970 77009 77263 gene locus_tag LOCUS_20980 77009 77263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 77293 78933 gene locus_tag LOCUS_20990 77293 78933 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_20990 78964 80277 gene locus_tag LOCUS_21000 gene tldD 78964 80277 CDS product TldD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_21000 80479 81099 gene locus_tag LOCUS_21010 80479 81099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920665.1 protein_id gnl|my_center|LOCUS_21010 81114 82109 gene locus_tag LOCUS_21020 81114 82109 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640601.1 protein_id gnl|my_center|LOCUS_21020 82120 83019 gene locus_tag LOCUS_21030 82120 83019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324190.1 protein_id gnl|my_center|LOCUS_21030 83016 84305 gene locus_tag LOCUS_21040 83016 84305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 84305 86530 gene locus_tag LOCUS_21050 84305 86530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640602.1 protein_id gnl|my_center|LOCUS_21050 86520 88274 gene locus_tag LOCUS_21060 86520 88274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 88994 88365 gene locus_tag LOCUS_21070 88994 88365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_21070 91056 89011 gene locus_tag LOCUS_21080 91056 89011 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_21080 91204 92103 gene locus_tag LOCUS_21090 91204 92103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_21090 92100 92663 gene locus_tag LOCUS_21100 92100 92663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 92669 93025 gene locus_tag LOCUS_21110 92669 93025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963615.1 protein_id gnl|my_center|LOCUS_21110 93193 93696 gene locus_tag LOCUS_21120 93193 93696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 93835 95364 gene locus_tag LOCUS_21130 93835 95364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 95449 96420 gene locus_tag LOCUS_21140 95449 96420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 96475 97311 gene locus_tag LOCUS_21150 96475 97311 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_21150 98560 97397 gene locus_tag LOCUS_21160 98560 97397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21160 99024 98554 gene locus_tag LOCUS_21170 99024 98554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21170 99105 99824 gene locus_tag LOCUS_21180 99105 99824 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_21180 100466 99834 gene locus_tag LOCUS_21190 100466 99834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 101343 100879 gene locus_tag LOCUS_21200 101343 100879 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940875.1 protein_id gnl|my_center|LOCUS_21200 101661 105812 gene locus_tag LOCUS_21210 101661 105812 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_21210 106359 109571 gene locus_tag LOCUS_21220 106359 109571 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_21220 109585 111306 gene locus_tag LOCUS_21230 109585 111306 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_21230 111300 112133 gene locus_tag LOCUS_21240 111300 112133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 113676 112279 gene locus_tag LOCUS_21250 gene mnmE 113676 112279 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_21250 114066 115199 gene locus_tag LOCUS_21260 114066 115199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 115482 119159 gene locus_tag LOCUS_21270 115482 119159 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_21270 119337 121046 gene locus_tag LOCUS_21280 119337 121046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 121793 121134 gene locus_tag LOCUS_21290 gene dnaQ 121793 121134 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 protein_id gnl|my_center|LOCUS_21290 123712 121790 gene locus_tag LOCUS_21300 123712 121790 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 protein_id gnl|my_center|LOCUS_21300 124152 124643 gene locus_tag LOCUS_21310 124152 124643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918302.1 protein_id gnl|my_center|LOCUS_21310 124768 125403 gene locus_tag LOCUS_21320 124768 125403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 125451 126281 gene locus_tag LOCUS_21330 125451 126281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 126815 126381 gene locus_tag LOCUS_21340 126815 126381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 128397 127039 gene locus_tag LOCUS_21350 gene nhaA 128397 127039 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92Y37 protein_id gnl|my_center|LOCUS_21350 128574 129251 gene locus_tag LOCUS_21360 128574 129251 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_21360 129248 130510 gene locus_tag LOCUS_21370 129248 130510 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_21370 130616 131329 gene locus_tag LOCUS_21380 130616 131329 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028999.1 protein_id gnl|my_center|LOCUS_21380 131451 131873 gene locus_tag LOCUS_21390 131451 131873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 132522 132019 gene locus_tag LOCUS_21400 132522 132019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 132994 133320 gene locus_tag LOCUS_21410 132994 133320 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_21410 133640 134641 gene locus_tag LOCUS_21420 gene lpxD 133640 134641 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZZ4 protein_id gnl|my_center|LOCUS_21420 135040 135291 gene locus_tag LOCUS_21430 gene parD-1 135040 135291 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918759.1 protein_id gnl|my_center|LOCUS_21430 135886 136242 gene locus_tag LOCUS_21440 135886 136242 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930808.1 protein_id gnl|my_center|LOCUS_21440 137132 136410 gene locus_tag LOCUS_21450 137132 136410 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268503.1 protein_id gnl|my_center|LOCUS_21450 137279 137623 gene locus_tag LOCUS_21460 137279 137623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 137755 138666 gene locus_tag LOCUS_21470 137755 138666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 138995 139558 gene locus_tag LOCUS_21480 138995 139558 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_21480 139555 141246 gene locus_tag LOCUS_21490 139555 141246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728790.1 protein_id gnl|my_center|LOCUS_21490 141512 141886 gene locus_tag LOCUS_21500 141512 141886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 142213 143163 gene locus_tag LOCUS_21510 142213 143163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 143781 144722 gene locus_tag LOCUS_21520 143781 144722 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_21520 146181 149273 gene locus_tag LOCUS_21530 146181 149273 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108195.1 protein_id gnl|my_center|LOCUS_21530 149326 150738 gene locus_tag LOCUS_21540 149326 150738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766448.1 protein_id gnl|my_center|LOCUS_21540 150938 152665 gene locus_tag LOCUS_21550 150938 152665 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_21550 152897 154645 gene locus_tag LOCUS_21560 152897 154645 CDS product X-Pro dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405524.1 protein_id gnl|my_center|LOCUS_21560 155619 154741 gene locus_tag LOCUS_21570 155619 154741 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119308.1 protein_id gnl|my_center|LOCUS_21570 156524 157366 gene locus_tag LOCUS_21580 156524 157366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 157453 157929 gene locus_tag LOCUS_21590 157453 157929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296181.1 protein_id gnl|my_center|LOCUS_21590 157933 160185 gene locus_tag LOCUS_21600 157933 160185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence11 1106 288 gene locus_tag LOCUS_21610 1106 288 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_21610 3189 1099 gene locus_tag LOCUS_21620 3189 1099 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_21620 4574 3303 gene locus_tag LOCUS_21630 gene cysN 4574 3303 CDS product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 protein_id gnl|my_center|LOCUS_21630 5559 4612 gene locus_tag LOCUS_21640 gene cysD 5559 4612 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 protein_id gnl|my_center|LOCUS_21640 6247 5624 gene locus_tag LOCUS_21650 6247 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 6540 6277 gene locus_tag LOCUS_21660 6540 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 7114 6704 gene locus_tag LOCUS_21670 7114 6704 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_21670 8345 7176 gene locus_tag LOCUS_21680 gene metZ 8345 7176 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 protein_id gnl|my_center|LOCUS_21680 11769 8383 gene locus_tag LOCUS_21690 11769 8383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 13097 11823 gene locus_tag LOCUS_21700 gene metY 13097 11823 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_21700 13096 13332 gene locus_tag LOCUS_21710 13096 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 14671 13415 gene locus_tag LOCUS_21720 gene metK 14671 13415 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_21720 15114 15728 gene locus_tag LOCUS_21730 15114 15728 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_21730 18198 15799 gene locus_tag LOCUS_21740 18198 15799 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_21740 18836 18312 gene locus_tag LOCUS_21750 gene ppa 18836 18312 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 protein_id gnl|my_center|LOCUS_21750 21409 18917 gene locus_tag LOCUS_21760 21409 18917 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962509.1 protein_id gnl|my_center|LOCUS_21760 22545 21568 gene locus_tag LOCUS_21770 gene pdhB 22545 21568 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_21770 22730 23476 gene locus_tag LOCUS_21780 gene etfB 22730 23476 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_21780 23536 24504 gene locus_tag LOCUS_21790 gene etfA 23536 24504 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_21790 24592 25224 gene locus_tag LOCUS_21800 24592 25224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_21800 25372 26703 gene locus_tag LOCUS_21810 25372 26703 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_21810 26964 27785 gene locus_tag LOCUS_21820 gene thyA 26964 27785 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_21820 27861 29018 gene locus_tag LOCUS_21830 27861 29018 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119788.1 protein_id gnl|my_center|LOCUS_21830 28719 28803 gene locus_tag LOCUS_t00200 28719 28803 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 29035 30015 gene locus_tag LOCUS_21840 29035 30015 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 protein_id gnl|my_center|LOCUS_21840 30414 30118 gene locus_tag LOCUS_21850 30414 30118 CDS product 1,4-alpha-glucan-branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_21850 31801 30719 gene locus_tag LOCUS_21860 31801 30719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_21860 31773 32258 gene locus_tag LOCUS_21870 31773 32258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 32261 32743 gene locus_tag LOCUS_21880 gene dfrA 32261 32743 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_21880 33729 32944 gene locus_tag LOCUS_21890 gene murI 33729 32944 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 protein_id gnl|my_center|LOCUS_21890 34360 33851 gene locus_tag LOCUS_21900 34360 33851 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_21900 35267 34419 gene locus_tag LOCUS_21910 35267 34419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 37932 35368 gene locus_tag LOCUS_21920 gene bamA 37932 35368 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_21920 38680 37937 gene locus_tag LOCUS_21930 gene uppS 38680 37937 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_21930 39335 38685 gene locus_tag LOCUS_21940 39335 38685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_21940 40376 39495 gene locus_tag LOCUS_21950 gene nadK 40376 39495 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_21950 41038 40382 gene locus_tag LOCUS_21960 41038 40382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_21960 41131 41844 gene locus_tag LOCUS_21970 gene pdxJ 41131 41844 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_21970 41844 42614 gene locus_tag LOCUS_21980 41844 42614 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_21980 42753 43097 gene locus_tag LOCUS_21990 42753 43097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_21990 43200 44522 gene locus_tag LOCUS_22000 gene tig 43200 44522 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_22000 44611 45291 gene locus_tag LOCUS_22010 gene clpP 44611 45291 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_22010 45388 46620 gene locus_tag LOCUS_22020 gene clpX 45388 46620 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 protein_id gnl|my_center|LOCUS_22020 47165 46617 gene locus_tag LOCUS_22030 47165 46617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 48738 47224 gene locus_tag LOCUS_22040 48738 47224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_22040 48880 49647 gene locus_tag LOCUS_22050 48880 49647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_22050 52349 49644 gene locus_tag LOCUS_22060 52349 49644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 protein_id gnl|my_center|LOCUS_22060 53145 52432 gene locus_tag LOCUS_22070 53145 52432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 protein_id gnl|my_center|LOCUS_22070 54838 53147 gene locus_tag LOCUS_22080 gene sppA 54838 53147 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_22080 55433 55636 gene locus_tag LOCUS_22090 55433 55636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 55642 56853 gene locus_tag LOCUS_22100 gene dcm 55642 56853 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6MU27 protein_id gnl|my_center|LOCUS_22100 56850 57950 gene locus_tag LOCUS_22110 56850 57950 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 protein_id gnl|my_center|LOCUS_22110 57928 58905 gene locus_tag LOCUS_22120 57928 58905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 59048 60187 gene locus_tag LOCUS_22130 59048 60187 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962567.1 protein_id gnl|my_center|LOCUS_22130 60898 60296 gene locus_tag LOCUS_22140 60898 60296 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_22140 61299 63875 gene locus_tag LOCUS_22150 gene mutS 61299 63875 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 protein_id gnl|my_center|LOCUS_22150 64061 64136 gene locus_tag LOCUS_t00210 64061 64136 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64182 64266 gene locus_tag LOCUS_t00220 64182 64266 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 66500 64416 gene locus_tag LOCUS_22160 66500 64416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 67197 67646 gene locus_tag LOCUS_22170 67197 67646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018094.1 protein_id gnl|my_center|LOCUS_22170 67798 68409 gene locus_tag LOCUS_22180 67798 68409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 68554 69144 gene locus_tag LOCUS_22190 68554 69144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 69355 70638 gene locus_tag LOCUS_22200 gene gltP 69355 70638 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_22200 71720 70635 gene locus_tag LOCUS_22210 71720 70635 CDS product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 protein_id gnl|my_center|LOCUS_22210 72433 73068 gene locus_tag LOCUS_22220 72433 73068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202947.1 protein_id gnl|my_center|LOCUS_22220 73259 74449 gene locus_tag LOCUS_22230 73259 74449 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_22230 74654 74845 gene locus_tag LOCUS_22240 74654 74845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 76776 74851 gene locus_tag LOCUS_22250 76776 74851 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_22250 77772 76789 gene locus_tag LOCUS_22260 77772 76789 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_22260 80116 77780 gene locus_tag LOCUS_22270 80116 77780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 81391 80510 gene locus_tag LOCUS_22280 gene fabD 81391 80510 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_22280 82087 81560 gene locus_tag LOCUS_22290 82087 81560 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_22290 82930 82193 gene locus_tag LOCUS_22300 82930 82193 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_22300 85149 82930 gene locus_tag LOCUS_22310 85149 82930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 85388 86569 gene locus_tag LOCUS_22320 85388 86569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 87637 86648 gene locus_tag LOCUS_22330 87637 86648 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_22330 87842 88744 gene locus_tag LOCUS_22340 87842 88744 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 protein_id gnl|my_center|LOCUS_22340 88818 89018 gene locus_tag LOCUS_22350 88818 89018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 89116 91155 gene locus_tag LOCUS_22360 gene yyaL 89116 91155 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_22360 91235 92059 gene locus_tag LOCUS_22370 91235 92059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_22370 92730 92056 gene locus_tag LOCUS_22380 92730 92056 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_22380 94089 92749 gene locus_tag LOCUS_22390 94089 92749 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_22390 95223 94102 gene locus_tag LOCUS_22400 95223 94102 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_22400 96515 95259 gene locus_tag LOCUS_22410 96515 95259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_22410 97746 96517 gene locus_tag LOCUS_22420 97746 96517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_22420 98440 97736 gene locus_tag LOCUS_22430 98440 97736 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_22430 99652 98540 gene locus_tag LOCUS_22440 99652 98540 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_22440 101024 99765 gene locus_tag LOCUS_22450 101024 99765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_22450 102317 101046 gene locus_tag LOCUS_22460 102317 101046 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_22460 102629 102411 gene locus_tag LOCUS_22470 102629 102411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 protein_id gnl|my_center|LOCUS_22470 103184 102651 gene locus_tag LOCUS_22480 gene yozB 103184 102651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_22480 103913 103185 gene locus_tag LOCUS_22490 gene ypmQ 103913 103185 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_22490 104542 103910 gene locus_tag LOCUS_22500 104542 103910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_22500 104994 104611 gene locus_tag LOCUS_22510 104994 104611 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_22510 106029 105052 gene locus_tag LOCUS_22520 106029 105052 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_22520 106762 106184 gene locus_tag LOCUS_22530 gene ctaE 106762 106184 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_22530 107670 106771 gene locus_tag LOCUS_22540 gene ctaB 107670 106771 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_22540 108683 107877 gene locus_tag LOCUS_22550 108683 107877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 109514 108810 gene locus_tag LOCUS_22560 109514 108810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 109968 109567 gene locus_tag LOCUS_22570 109968 109567 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762588.1 protein_id gnl|my_center|LOCUS_22570 110341 109961 gene locus_tag LOCUS_22580 gene gcvH 110341 109961 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_22580 117519 110464 gene locus_tag LOCUS_22590 gene sprA 117519 110464 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 protein_id gnl|my_center|LOCUS_22590 118184 117603 gene locus_tag LOCUS_22600 gene ruvA 118184 117603 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_22600 120490 118193 gene locus_tag LOCUS_22610 gene maeB 120490 118193 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_22610 122341 120650 gene locus_tag LOCUS_22620 122341 120650 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405542.1 protein_id gnl|my_center|LOCUS_22620 123456 122536 gene locus_tag LOCUS_22630 gene queG 123456 122536 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_22630 124784 123462 gene locus_tag LOCUS_22640 124784 123462 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_22640 125853 124831 gene locus_tag LOCUS_22650 gene ruvB 125853 124831 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_22650 126178 128442 gene locus_tag LOCUS_22660 126178 128442 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_22660 128569 128919 gene locus_tag LOCUS_22670 128569 128919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 128977 129741 gene locus_tag LOCUS_22680 128977 129741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 129852 132431 gene locus_tag LOCUS_22690 129852 132431 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 protein_id gnl|my_center|LOCUS_22690 133248 132457 gene locus_tag LOCUS_22700 133248 132457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 135250 133430 gene locus_tag LOCUS_22710 gene ctaD 135250 133430 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_22710 136297 135293 gene locus_tag LOCUS_22720 gene ctaC 136297 135293 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_22720 137734 136388 gene locus_tag LOCUS_22730 gene actF 137734 136388 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_22730 138314 137751 gene locus_tag LOCUS_22740 gene actE 138314 137751 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_22740 138843 138322 gene locus_tag LOCUS_22750 gene actD 138843 138322 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_22750 140575 138848 gene locus_tag LOCUS_22760 gene actC 140575 138848 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_22760 143732 140607 gene locus_tag LOCUS_22770 gene actB 143732 140607 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_22770 145144 143771 gene locus_tag LOCUS_22780 gene actA 145144 143771 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_22780 145560 145931 gene locus_tag LOCUS_22790 145560 145931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence12 1001 360 gene locus_tag LOCUS_22800 1001 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 protein_id gnl|my_center|LOCUS_22800 1142 2230 gene locus_tag LOCUS_22810 1142 2230 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_22810 2390 2938 gene locus_tag LOCUS_22820 2390 2938 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141374.1 protein_id gnl|my_center|LOCUS_22820 4315 2933 gene locus_tag LOCUS_22830 gene hisS 4315 2933 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_22830 4839 4369 gene locus_tag LOCUS_22840 4839 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 protein_id gnl|my_center|LOCUS_22840 5511 5056 gene locus_tag LOCUS_22850 gene rplI 5511 5056 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 protein_id gnl|my_center|LOCUS_22850 5821 5525 gene locus_tag LOCUS_22860 gene rpsR 5821 5525 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_22860 6164 5826 gene locus_tag LOCUS_22870 gene rpsF 6164 5826 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 protein_id gnl|my_center|LOCUS_22870 6401 7093 gene locus_tag LOCUS_22880 6401 7093 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_22880 9554 7098 gene locus_tag LOCUS_22890 gene priA 9554 7098 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_22890 9968 9567 gene locus_tag LOCUS_22900 9968 9567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 protein_id gnl|my_center|LOCUS_22900 10968 9991 gene locus_tag LOCUS_22910 gene yfkH 10968 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_22910 11826 10969 gene locus_tag LOCUS_22920 gene nadC 11826 10969 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 protein_id gnl|my_center|LOCUS_22920 11904 12395 gene locus_tag LOCUS_22930 gene rlmH 11904 12395 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_22930 13227 12415 gene locus_tag LOCUS_22940 13227 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 15328 13436 gene locus_tag LOCUS_22950 15328 13436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 16191 15490 gene locus_tag LOCUS_22960 16191 15490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 16799 16188 gene locus_tag LOCUS_22970 16799 16188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 17333 16878 gene locus_tag LOCUS_22980 17333 16878 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261733.1 protein_id gnl|my_center|LOCUS_22980 17420 18031 gene locus_tag LOCUS_22990 17420 18031 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 protein_id gnl|my_center|LOCUS_22990 18012 18641 gene locus_tag LOCUS_23000 18012 18641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 18808 20637 gene locus_tag LOCUS_23010 18808 20637 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_23010 20715 21494 gene locus_tag LOCUS_23020 20715 21494 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_23020 21604 23304 gene locus_tag LOCUS_23030 21604 23304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 24042 23374 gene locus_tag LOCUS_23040 gene trmH 24042 23374 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_23040 24100 24798 gene locus_tag LOCUS_23050 gene npdA 24100 24798 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 protein_id gnl|my_center|LOCUS_23050 24823 25374 gene locus_tag LOCUS_23060 24823 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963491.1 protein_id gnl|my_center|LOCUS_23060 25476 26819 gene locus_tag LOCUS_23070 gene purB 25476 26819 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_23070 26943 27848 gene locus_tag LOCUS_23080 gene mscS 26943 27848 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_23080 28588 28043 gene locus_tag LOCUS_23090 28588 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963570.1 protein_id gnl|my_center|LOCUS_23090 29259 28708 gene locus_tag LOCUS_23100 29259 28708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963571.1 protein_id gnl|my_center|LOCUS_23100 29693 29274 gene locus_tag LOCUS_23110 29693 29274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 30189 29680 gene locus_tag LOCUS_23120 30189 29680 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963573.1 protein_id gnl|my_center|LOCUS_23120 30649 32100 gene locus_tag LOCUS_23130 30649 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 33133 32216 gene locus_tag LOCUS_23140 33133 32216 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258980.1 protein_id gnl|my_center|LOCUS_23140 35022 33160 gene locus_tag LOCUS_23150 gene btuB 35022 33160 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32AE6 protein_id gnl|my_center|LOCUS_23150 35611 36720 gene locus_tag LOCUS_23160 35611 36720 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 protein_id gnl|my_center|LOCUS_23160 36721 37752 gene locus_tag LOCUS_23170 36721 37752 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 protein_id gnl|my_center|LOCUS_23170 37816 38583 gene locus_tag LOCUS_23180 37816 38583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 protein_id gnl|my_center|LOCUS_23180 38650 39996 gene locus_tag LOCUS_23190 gene rmuC 38650 39996 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_23190 40102 40467 gene locus_tag LOCUS_23200 40102 40467 CDS product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 protein_id gnl|my_center|LOCUS_23200 40473 41018 gene locus_tag LOCUS_23210 40473 41018 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 protein_id gnl|my_center|LOCUS_23210 41724 40999 gene locus_tag LOCUS_23220 41724 40999 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464630.1 protein_id gnl|my_center|LOCUS_23220 43247 41736 gene locus_tag LOCUS_23230 gene zwf 43247 41736 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87P08 protein_id gnl|my_center|LOCUS_23230 43495 44907 gene locus_tag LOCUS_23240 gene gndA 43495 44907 CDS product 6-phosphogluconate dehydrogenase, NADP(+)-dependent, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80859 protein_id gnl|my_center|LOCUS_23240 47828 45030 gene locus_tag LOCUS_23250 gene carB 47828 45030 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_23250 48397 49239 gene locus_tag LOCUS_23260 48397 49239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 49241 49756 gene locus_tag LOCUS_23270 49241 49756 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 protein_id gnl|my_center|LOCUS_23270 51213 49753 gene locus_tag LOCUS_23280 51213 49753 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YC9 protein_id gnl|my_center|LOCUS_23280 52173 51217 gene locus_tag LOCUS_23290 52173 51217 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_23290 52880 52203 gene locus_tag LOCUS_23300 52880 52203 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_23300 53041 53334 gene locus_tag LOCUS_23310 53041 53334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 54763 53363 gene locus_tag LOCUS_23320 54763 53363 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_23320 56007 54832 gene locus_tag LOCUS_23330 56007 54832 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_23330 56342 56091 gene locus_tag LOCUS_23340 gene rpmE 56342 56091 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_23340 56509 57030 gene locus_tag LOCUS_23350 56509 57030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 57064 58038 gene locus_tag LOCUS_23360 57064 58038 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_23360 58069 59787 gene locus_tag LOCUS_23370 58069 59787 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_23370 59787 61610 gene locus_tag LOCUS_23380 gene msbA 59787 61610 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_23380 61772 62323 gene locus_tag LOCUS_23390 61772 62323 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_23390 62348 62860 gene locus_tag LOCUS_23400 62348 62860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 62853 63302 gene locus_tag LOCUS_23410 62853 63302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 64897 63905 gene locus_tag LOCUS_23420 64897 63905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_23420 65005 66216 gene locus_tag LOCUS_23430 gene rsmB 65005 66216 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_23430 67818 66223 gene locus_tag LOCUS_23440 67818 66223 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919430.1 protein_id gnl|my_center|LOCUS_23440 68152 71820 gene locus_tag LOCUS_23450 gene purL 68152 71820 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 protein_id gnl|my_center|LOCUS_23450 71918 72382 gene locus_tag LOCUS_23460 71918 72382 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029305.1 protein_id gnl|my_center|LOCUS_23460 73554 72445 gene locus_tag LOCUS_23470 73554 72445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 73959 75740 gene locus_tag LOCUS_23480 gene fadD 73959 75740 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_23480 75921 76370 gene locus_tag LOCUS_23490 75921 76370 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_23490 76382 78787 gene locus_tag LOCUS_23500 76382 78787 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_23500 78948 80138 gene locus_tag LOCUS_23510 78948 80138 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_23510 80160 81971 gene locus_tag LOCUS_23520 80160 81971 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_23520 83071 83259 gene locus_tag LOCUS_23530 83071 83259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 85094 83361 gene locus_tag LOCUS_23540 85094 83361 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186147.1 protein_id gnl|my_center|LOCUS_23540 85421 87640 gene locus_tag LOCUS_23550 85421 87640 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_23550 87823 89154 gene locus_tag LOCUS_23560 87823 89154 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_23560 89219 90010 gene locus_tag LOCUS_23570 89219 90010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 89980 91641 gene locus_tag LOCUS_23580 89980 91641 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_23580 91748 92200 gene locus_tag LOCUS_23590 91748 92200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_23590 92574 93368 gene locus_tag LOCUS_23600 gene thiM 92574 93368 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JW7 protein_id gnl|my_center|LOCUS_23600 93398 94000 gene locus_tag LOCUS_23610 gene thiE 93398 94000 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0Q4 protein_id gnl|my_center|LOCUS_23610 94080 94916 gene locus_tag LOCUS_23620 94080 94916 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_23620 94900 95550 gene locus_tag LOCUS_23630 94900 95550 CDS product aminopyrimidine aminohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGB4 protein_id gnl|my_center|LOCUS_23630 97015 95702 gene locus_tag LOCUS_23640 97015 95702 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_23640 100073 96996 gene locus_tag LOCUS_23650 100073 96996 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403494.1 protein_id gnl|my_center|LOCUS_23650 101115 100084 gene locus_tag LOCUS_23660 101115 100084 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_23660 102195 103421 gene locus_tag LOCUS_23670 102195 103421 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_23670 103553 104812 gene locus_tag LOCUS_23680 103553 104812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 105121 105795 gene locus_tag LOCUS_23690 105121 105795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 105964 106557 gene locus_tag LOCUS_23700 105964 106557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 106640 107170 gene locus_tag LOCUS_23710 106640 107170 CDS product RNA polymerase sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027940.1 protein_id gnl|my_center|LOCUS_23710 107172 107960 gene locus_tag LOCUS_23720 107172 107960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 108119 108610 gene locus_tag LOCUS_23730 108119 108610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 108645 109067 gene locus_tag LOCUS_23740 108645 109067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 109319 109125 gene locus_tag LOCUS_23750 109319 109125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 109711 109409 gene locus_tag LOCUS_23760 109711 109409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 109906 110700 gene locus_tag LOCUS_23770 109906 110700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 110824 111399 gene locus_tag LOCUS_23780 gene phnA 110824 111399 CDS product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_23780 111883 111434 gene locus_tag LOCUS_23790 111883 111434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 113211 111892 gene locus_tag LOCUS_23800 gene purD 113211 111892 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DRM0 protein_id gnl|my_center|LOCUS_23800 113732 114427 gene locus_tag LOCUS_23810 113732 114427 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_23810 114777 115808 gene locus_tag LOCUS_23820 114777 115808 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_23820 116291 117553 gene locus_tag LOCUS_23830 gene ugd 116291 117553 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_23830 117558 118844 gene locus_tag LOCUS_23840 gene wbpO 117558 118844 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_23840 119960 125452 gene locus_tag LOCUS_23850 119960 125452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 126420 125536 gene locus_tag LOCUS_23860 126420 125536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence13 615 1619 gene locus_tag LOCUS_23870 615 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 1639 1920 gene locus_tag LOCUS_23880 gene yczJ 1639 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31484 protein_id gnl|my_center|LOCUS_23880 1921 4614 gene locus_tag LOCUS_23890 1921 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4830 5783 gene locus_tag LOCUS_23900 4830 5783 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 protein_id gnl|my_center|LOCUS_23900 5926 6993 gene locus_tag LOCUS_23910 5926 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6994 7818 gene locus_tag LOCUS_23920 6994 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 7881 8975 gene locus_tag LOCUS_23930 7881 8975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23930 9292 12447 gene locus_tag LOCUS_23940 9292 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_23940 13433 12483 gene locus_tag LOCUS_23950 gene gldA 13433 12483 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_23950 13704 13495 gene locus_tag LOCUS_23960 13704 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 13797 14627 gene locus_tag LOCUS_23970 gene pheA 13797 14627 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962426.1 protein_id gnl|my_center|LOCUS_23970 14624 15766 gene locus_tag LOCUS_23980 gene aspC3 14624 15766 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW92 protein_id gnl|my_center|LOCUS_23980 15790 16653 gene locus_tag LOCUS_23990 gene tyrA 15790 16653 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_23990 16665 17747 gene locus_tag LOCUS_24000 16665 17747 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_24000 17965 18639 gene locus_tag LOCUS_24010 17965 18639 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964577.1 protein_id gnl|my_center|LOCUS_24010 19144 18704 gene locus_tag LOCUS_24020 19144 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 19243 20193 gene locus_tag LOCUS_24030 gene rsgA 19243 20193 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_24030 20194 20646 gene locus_tag LOCUS_24040 gene dtd 20194 20646 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_24040 20786 22645 gene locus_tag LOCUS_24050 20786 22645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 22647 24656 gene locus_tag LOCUS_24060 22647 24656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 24662 24988 gene locus_tag LOCUS_24070 24662 24988 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_24070 25087 26319 gene locus_tag LOCUS_24080 gene aroA 25087 26319 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 protein_id gnl|my_center|LOCUS_24080 26411 27613 gene locus_tag LOCUS_24090 gene queA 26411 27613 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_24090 27690 28751 gene locus_tag LOCUS_24100 gene rlmN 27690 28751 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_24100 28998 29933 gene locus_tag LOCUS_24110 28998 29933 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_24110 30070 30636 gene locus_tag LOCUS_24120 30070 30636 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_24120 30724 31458 gene locus_tag LOCUS_24130 30724 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 31621 32643 gene locus_tag LOCUS_24140 31621 32643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964174.1 protein_id gnl|my_center|LOCUS_24140 32824 34071 gene locus_tag LOCUS_24150 32824 34071 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_24150 34877 36850 gene locus_tag LOCUS_24160 gene dnaG 34877 36850 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_24160 37538 36909 gene locus_tag LOCUS_24170 37538 36909 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964170.1 protein_id gnl|my_center|LOCUS_24170 38494 37706 gene locus_tag LOCUS_24180 gene nadE 38494 37706 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_24180 38586 39548 gene locus_tag LOCUS_24190 gene gldB 38586 39548 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964168.1 protein_id gnl|my_center|LOCUS_24190 39590 39925 gene locus_tag LOCUS_24200 gene gldC 39590 39925 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_24200 39948 40340 gene locus_tag LOCUS_24210 39948 40340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 40973 40347 gene locus_tag LOCUS_24220 gene engB 40973 40347 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_24220 41836 41072 gene locus_tag LOCUS_24230 gene pcbD 41836 41072 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_24230 42107 42571 gene locus_tag LOCUS_24240 gene mraZ 42107 42571 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_24240 42552 43454 gene locus_tag LOCUS_24250 gene rsmH 42552 43454 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_24250 43473 43802 gene locus_tag LOCUS_24260 43473 43802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964162.1 protein_id gnl|my_center|LOCUS_24260 43802 45808 gene locus_tag LOCUS_24270 gene ftsI 43802 45808 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_24270 45805 47268 gene locus_tag LOCUS_24280 gene murE 45805 47268 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_24280 47304 48524 gene locus_tag LOCUS_24290 gene mraY 47304 48524 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_24290 48525 49859 gene locus_tag LOCUS_24300 gene murD 48525 49859 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_24300 49860 51059 gene locus_tag LOCUS_24310 gene ftsW 49860 51059 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_24310 51046 52143 gene locus_tag LOCUS_24320 gene murG 51046 52143 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_24320 52133 53485 gene locus_tag LOCUS_24330 gene murC 52133 53485 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_24330 53475 54194 gene locus_tag LOCUS_24340 gene ftsQ 53475 54194 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 protein_id gnl|my_center|LOCUS_24340 54198 55526 gene locus_tag LOCUS_24350 gene ftsA 54198 55526 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_24350 55574 57538 gene locus_tag LOCUS_24360 gene ftsZ 55574 57538 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_24360 57633 58082 gene locus_tag LOCUS_24370 57633 58082 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_24370 58183 58257 gene locus_tag LOCUS_t00230 58183 58257 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 58489 59757 gene locus_tag LOCUS_24380 58489 59757 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 protein_id gnl|my_center|LOCUS_24380 60522 61076 gene locus_tag LOCUS_24390 60522 61076 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_24390 61226 62395 gene locus_tag LOCUS_24400 61226 62395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 62580 65984 gene locus_tag LOCUS_24410 62580 65984 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_24410 66001 67395 gene locus_tag LOCUS_24420 66001 67395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_24420 67626 68468 gene locus_tag LOCUS_24430 67626 68468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 68851 68558 gene locus_tag LOCUS_24440 68851 68558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 68865 69785 gene locus_tag LOCUS_24450 68865 69785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 69782 70627 gene locus_tag LOCUS_24460 69782 70627 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_24460 70647 73295 gene locus_tag LOCUS_24470 70647 73295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 73371 74828 gene locus_tag LOCUS_24480 73371 74828 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_24480 76359 77291 gene locus_tag LOCUS_24490 76359 77291 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_24490 77919 79055 gene locus_tag LOCUS_24500 77919 79055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 79648 82260 gene locus_tag LOCUS_24510 79648 82260 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107962.1 protein_id gnl|my_center|LOCUS_24510 82498 83847 gene locus_tag LOCUS_24520 gene xylE 82498 83847 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_24520 83887 85503 gene locus_tag LOCUS_24530 83887 85503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 85515 88571 gene locus_tag LOCUS_24540 85515 88571 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783448.1 protein_id gnl|my_center|LOCUS_24540 88583 90265 gene locus_tag LOCUS_24550 88583 90265 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_24550 90482 92728 gene locus_tag LOCUS_24560 90482 92728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 92749 94740 gene locus_tag LOCUS_24570 92749 94740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 94774 97092 gene locus_tag LOCUS_24580 94774 97092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 97169 97501 gene locus_tag LOCUS_24590 97169 97501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24590 97538 98053 gene locus_tag LOCUS_24600 97538 98053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24600 99101 99484 gene locus_tag LOCUS_24610 99101 99484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 99584 99883 gene locus_tag LOCUS_24620 99584 99883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 102021 99871 gene locus_tag LOCUS_24630 102021 99871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 103132 101987 gene locus_tag LOCUS_24640 103132 101987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_24640 104747 103644 gene locus_tag LOCUS_24650 104747 103644 CDS product cobalamin synthesis protein P47K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272563.1 protein_id gnl|my_center|LOCUS_24650 107456 104802 gene locus_tag LOCUS_24660 107456 104802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_24660 109441 107768 gene locus_tag LOCUS_24670 gene araB 109441 107768 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58543 protein_id gnl|my_center|LOCUS_24670 110660 109491 gene locus_tag LOCUS_24680 gene fucP 110660 109491 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120628.1 protein_id gnl|my_center|LOCUS_24680 112552 110783 gene locus_tag LOCUS_24690 gene fucI 112552 110783 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZS4 protein_id gnl|my_center|LOCUS_24690 113717 112572 gene locus_tag LOCUS_24700 113717 112572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124068.1 protein_id gnl|my_center|LOCUS_24700 115086 114052 gene locus_tag LOCUS_24710 115086 114052 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584055.1 protein_id gnl|my_center|LOCUS_24710 116063 116902 gene locus_tag LOCUS_24720 116063 116902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 118341 117124 gene locus_tag LOCUS_24730 118341 117124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 118522 118343 gene locus_tag LOCUS_24740 118522 118343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 119518 118745 gene locus_tag LOCUS_24750 119518 118745 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703580.1 protein_id gnl|my_center|LOCUS_24750 119887 123192 gene locus_tag LOCUS_24760 119887 123192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 123715 123494 gene locus_tag LOCUS_24770 123715 123494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence14 3351 541 gene locus_tag LOCUS_24780 3351 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3735 3355 gene locus_tag LOCUS_24790 3735 3355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 4301 3789 gene locus_tag LOCUS_24800 4301 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 4777 4421 gene locus_tag LOCUS_24810 4777 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 5834 4905 gene locus_tag LOCUS_24820 5834 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 6842 6369 gene locus_tag LOCUS_24830 6842 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 7711 6854 gene locus_tag LOCUS_24840 7711 6854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 8957 8001 gene locus_tag LOCUS_24850 gene traP 8957 8001 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361991.1 protein_id gnl|my_center|LOCUS_24850 10371 9166 gene locus_tag LOCUS_24860 10371 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 10723 10436 gene locus_tag LOCUS_24870 10723 10436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 11348 11272 gene locus_tag LOCUS_t00240 11348 11272 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11473 11865 gene locus_tag LOCUS_24880 11473 11865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_24880 11921 12769 gene locus_tag LOCUS_24890 11921 12769 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_24890 13406 12846 gene locus_tag LOCUS_24900 13406 12846 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_24900 13775 13503 gene locus_tag LOCUS_24910 gene hupB 13775 13503 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_24910 14899 13952 gene locus_tag LOCUS_24920 gene fmt 14899 13952 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_24920 16802 14901 gene locus_tag LOCUS_24930 gene recQ2 16802 14901 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_24930 17248 16799 gene locus_tag LOCUS_24940 17248 16799 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_24940 17447 17734 gene locus_tag LOCUS_24950 17447 17734 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_24950 17823 18473 gene locus_tag LOCUS_24960 17823 18473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_24960 18488 19795 gene locus_tag LOCUS_24970 gene murA 18488 19795 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_24970 20069 20323 gene locus_tag LOCUS_24980 20069 20323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 20777 20367 gene locus_tag LOCUS_24990 20777 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118347.1 protein_id gnl|my_center|LOCUS_24990 21775 20777 gene locus_tag LOCUS_25000 21775 20777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_25000 22422 22024 gene locus_tag LOCUS_25010 22422 22024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 22848 24695 gene locus_tag LOCUS_25020 22848 24695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 25139 24747 gene locus_tag LOCUS_25030 25139 24747 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 protein_id gnl|my_center|LOCUS_25030 25599 25231 gene locus_tag LOCUS_25040 25599 25231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760318.1 protein_id gnl|my_center|LOCUS_25040 26307 25648 gene locus_tag LOCUS_25050 26307 25648 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963474.1 protein_id gnl|my_center|LOCUS_25050 27703 26495 gene locus_tag LOCUS_25060 27703 26495 CDS product aminobenzoyl-glutamate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861828.1 protein_id gnl|my_center|LOCUS_25060 29343 28033 gene locus_tag LOCUS_25070 gene phrB1 29343 28033 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_25070 30039 29350 gene locus_tag LOCUS_25080 30039 29350 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_25080 30596 30093 gene locus_tag LOCUS_25090 30596 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_25090 31063 32109 gene locus_tag LOCUS_25100 31063 32109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 32188 33036 gene locus_tag LOCUS_25110 32188 33036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_25110 34136 33123 gene locus_tag LOCUS_25120 34136 33123 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJH8 protein_id gnl|my_center|LOCUS_25120 35317 34133 gene locus_tag LOCUS_25130 35317 34133 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAU4 protein_id gnl|my_center|LOCUS_25130 36210 35497 gene locus_tag LOCUS_25140 36210 35497 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_25140 36429 36220 gene locus_tag LOCUS_25150 36429 36220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 38251 36545 gene locus_tag LOCUS_25160 38251 36545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 40903 38351 gene locus_tag LOCUS_25170 40903 38351 CDS product PIG-L domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974050.1 protein_id gnl|my_center|LOCUS_25170 41514 40972 gene locus_tag LOCUS_25180 41514 40972 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071240.1 protein_id gnl|my_center|LOCUS_25180 42465 41518 gene locus_tag LOCUS_25190 42465 41518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 43088 42501 gene locus_tag LOCUS_25200 43088 42501 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 protein_id gnl|my_center|LOCUS_25200 43619 43092 gene locus_tag LOCUS_25210 gene kdsC 43619 43092 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_25210 44367 43603 gene locus_tag LOCUS_25220 44367 43603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_25220 44546 47671 gene locus_tag LOCUS_25230 gene ccsBA 44546 47671 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_25230 47867 49024 gene locus_tag LOCUS_25240 gene mccB 47867 49024 CDS product cystathionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05394 protein_id gnl|my_center|LOCUS_25240 49062 49784 gene locus_tag LOCUS_25250 49062 49784 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_25250 51871 49781 gene locus_tag LOCUS_25260 51871 49781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 54105 52048 gene locus_tag LOCUS_25270 54105 52048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 54334 54408 gene locus_tag LOCUS_t00250 54334 54408 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 56763 55201 gene locus_tag LOCUS_25280 56763 55201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 57143 58036 gene locus_tag LOCUS_25290 57143 58036 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107998.1 protein_id gnl|my_center|LOCUS_25290 58047 58340 gene locus_tag LOCUS_25300 58047 58340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 58497 59453 gene locus_tag LOCUS_25310 58497 59453 CDS product phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CLB6 protein_id gnl|my_center|LOCUS_25310 59649 61742 gene locus_tag LOCUS_25320 gene pta 59649 61742 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S7 protein_id gnl|my_center|LOCUS_25320 61756 62955 gene locus_tag LOCUS_25330 gene ackA 61756 62955 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYB1 protein_id gnl|my_center|LOCUS_25330 63132 63899 gene locus_tag LOCUS_25340 63132 63899 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768801.1 protein_id gnl|my_center|LOCUS_25340 64117 64773 gene locus_tag LOCUS_25350 64117 64773 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972835.1 protein_id gnl|my_center|LOCUS_25350 65686 65048 gene locus_tag LOCUS_25360 65686 65048 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963076.1 protein_id gnl|my_center|LOCUS_25360 66272 65709 gene locus_tag LOCUS_25370 66272 65709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 66271 67158 gene locus_tag LOCUS_25380 66271 67158 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787896.1 protein_id gnl|my_center|LOCUS_25380 67235 68074 gene locus_tag LOCUS_25390 67235 68074 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765729.1 protein_id gnl|my_center|LOCUS_25390 68415 69230 gene locus_tag LOCUS_25400 68415 69230 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_25400 69227 70423 gene locus_tag LOCUS_25410 gene uxuA 69227 70423 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JLS2 protein_id gnl|my_center|LOCUS_25410 70617 71927 gene locus_tag LOCUS_25420 gene fucP 70617 71927 CDS product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 protein_id gnl|my_center|LOCUS_25420 72072 74729 gene locus_tag LOCUS_25430 72072 74729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 75005 76243 gene locus_tag LOCUS_25440 75005 76243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 76686 76444 gene locus_tag LOCUS_25450 76686 76444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 76879 77403 gene locus_tag LOCUS_25460 76879 77403 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405466.1 protein_id gnl|my_center|LOCUS_25460 77406 78203 gene locus_tag LOCUS_25470 77406 78203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 78224 78982 gene locus_tag LOCUS_25480 78224 78982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 78994 79716 gene locus_tag LOCUS_25490 78994 79716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 80878 80462 gene locus_tag LOCUS_25500 gene rcp1 80878 80462 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_25500 81109 82140 gene locus_tag LOCUS_25510 81109 82140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 82198 82695 gene locus_tag LOCUS_25520 82198 82695 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_25520 83695 82817 gene locus_tag LOCUS_25530 83695 82817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993022.1 protein_id gnl|my_center|LOCUS_25530 83749 84723 gene locus_tag LOCUS_25540 83749 84723 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887835.1 protein_id gnl|my_center|LOCUS_25540 85804 84767 gene locus_tag LOCUS_25550 85804 84767 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107469.1 protein_id gnl|my_center|LOCUS_25550 85985 87088 gene locus_tag LOCUS_25560 85985 87088 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_25560 87108 87983 gene locus_tag LOCUS_25570 87108 87983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 88047 89975 gene locus_tag LOCUS_25580 gene gpi2 88047 89975 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_25580 90101 90637 gene locus_tag LOCUS_25590 90101 90637 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 protein_id gnl|my_center|LOCUS_25590 90726 91898 gene locus_tag LOCUS_25600 90726 91898 CDS product iron dicitrate transporter FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108728.1 protein_id gnl|my_center|LOCUS_25600 92181 95600 gene locus_tag LOCUS_25610 92181 95600 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202065.1 protein_id gnl|my_center|LOCUS_25610 95612 97081 gene locus_tag LOCUS_25620 95612 97081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784504.1 protein_id gnl|my_center|LOCUS_25620 97156 98517 gene locus_tag LOCUS_25630 gene nagA 97156 98517 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_25630 98545 99915 gene locus_tag LOCUS_25640 98545 99915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108588.1 protein_id gnl|my_center|LOCUS_25640 99941 100789 gene locus_tag LOCUS_25650 99941 100789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 101095 102135 gene locus_tag LOCUS_25660 101095 102135 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_25660 102559 103104 gene locus_tag LOCUS_25670 102559 103104 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764449.1 protein_id gnl|my_center|LOCUS_25670 103230 104174 gene locus_tag LOCUS_25680 103230 104174 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202057.1 protein_id gnl|my_center|LOCUS_25680 104291 107644 gene locus_tag LOCUS_25690 104291 107644 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_25690 107695 109104 gene locus_tag LOCUS_25700 107695 109104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_25700 109156 110703 gene locus_tag LOCUS_25710 109156 110703 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_25710 111135 113099 gene locus_tag LOCUS_25720 111135 113099 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962869.1 protein_id gnl|my_center|LOCUS_25720 113099 113740 gene locus_tag LOCUS_25730 113099 113740 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_25730 113878 114291 gene locus_tag LOCUS_25740 113878 114291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 114521 117610 gene locus_tag LOCUS_25750 114521 117610 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_25750 117621 119243 gene locus_tag LOCUS_25760 117621 119243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_25760 119580 119825 gene locus_tag LOCUS_25770 119580 119825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 119809 119952 gene locus_tag LOCUS_25780 119809 119952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 119961 120131 gene locus_tag LOCUS_25790 119961 120131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 121710 120415 gene locus_tag LOCUS_25800 121710 120415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence15 1091 414 gene locus_tag LOCUS_25810 1091 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 1481 1095 gene locus_tag LOCUS_25820 1481 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 1607 2590 gene locus_tag LOCUS_25830 1607 2590 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 protein_id gnl|my_center|LOCUS_25830 2737 4932 gene locus_tag LOCUS_25840 2737 4932 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_25840 6039 4921 gene locus_tag LOCUS_25850 6039 4921 CDS product glucose-fructose oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919107.1 protein_id gnl|my_center|LOCUS_25850 6327 7562 gene locus_tag LOCUS_25860 6327 7562 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 protein_id gnl|my_center|LOCUS_25860 7587 8792 gene locus_tag LOCUS_25870 7587 8792 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_25870 8857 9519 gene locus_tag LOCUS_25880 gene rpe 8857 9519 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_25880 9516 10481 gene locus_tag LOCUS_25890 9516 10481 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_25890 11711 10542 gene locus_tag LOCUS_25900 11711 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 12666 11797 gene locus_tag LOCUS_25910 12666 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 13587 12742 gene locus_tag LOCUS_25920 13587 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 15678 13753 gene locus_tag LOCUS_25930 15678 13753 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_25930 16653 15691 gene locus_tag LOCUS_25940 16653 15691 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_25940 21950 16650 gene locus_tag LOCUS_25950 21950 16650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 22339 23214 gene locus_tag LOCUS_25960 22339 23214 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389744.1 protein_id gnl|my_center|LOCUS_25960 23211 23600 gene locus_tag LOCUS_25970 23211 23600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 25215 23641 gene locus_tag LOCUS_25980 25215 23641 CDS product sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203528.1 protein_id gnl|my_center|LOCUS_25980 28006 25379 gene locus_tag LOCUS_25990 28006 25379 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119311.1 protein_id gnl|my_center|LOCUS_25990 28966 28043 gene locus_tag LOCUS_26000 gene nanA 28966 28043 CDS product N-acetylneuraminate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119312.1 protein_id gnl|my_center|LOCUS_26000 30569 29115 gene locus_tag LOCUS_26010 30569 29115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791097.1 protein_id gnl|my_center|LOCUS_26010 33841 30590 gene locus_tag LOCUS_26020 33841 30590 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203530.1 protein_id gnl|my_center|LOCUS_26020 34058 34774 gene locus_tag LOCUS_26030 34058 34774 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203531.1 protein_id gnl|my_center|LOCUS_26030 35069 35368 gene locus_tag LOCUS_26040 35069 35368 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_26040 35371 35721 gene locus_tag LOCUS_26050 35371 35721 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_26050 36554 35838 gene locus_tag LOCUS_26060 36554 35838 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EM74 protein_id gnl|my_center|LOCUS_26060 37105 36551 gene locus_tag LOCUS_26070 37105 36551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 38200 37115 gene locus_tag LOCUS_26080 38200 37115 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582709.1 protein_id gnl|my_center|LOCUS_26080 39915 38215 gene locus_tag LOCUS_26090 39915 38215 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_26090 40839 39940 gene locus_tag LOCUS_26100 40839 39940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 41926 40874 gene locus_tag LOCUS_26110 gene gshB 41926 40874 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CU65 protein_id gnl|my_center|LOCUS_26110 43665 41923 gene locus_tag LOCUS_26120 43665 41923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 45026 44103 gene locus_tag LOCUS_26130 45026 44103 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119250.1 protein_id gnl|my_center|LOCUS_26130 45738 45193 gene locus_tag LOCUS_26140 45738 45193 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_26140 47203 45971 gene locus_tag LOCUS_26150 47203 45971 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355251.1 protein_id gnl|my_center|LOCUS_26150 48475 47366 gene locus_tag LOCUS_26160 48475 47366 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329925.1 protein_id gnl|my_center|LOCUS_26160 49391 48528 gene locus_tag LOCUS_26170 49391 48528 CDS product tagatose 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974400.1 protein_id gnl|my_center|LOCUS_26170 53077 49532 gene locus_tag LOCUS_26180 53077 49532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 54493 53483 gene locus_tag LOCUS_26190 54493 53483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 56628 55690 gene locus_tag LOCUS_26200 56628 55690 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083209.1 protein_id gnl|my_center|LOCUS_26200 57936 56653 gene locus_tag LOCUS_26210 57936 56653 CDS product mandelate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225007.1 protein_id gnl|my_center|LOCUS_26210 59019 57982 gene locus_tag LOCUS_26220 59019 57982 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_26220 59572 59099 gene locus_tag LOCUS_26230 59572 59099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245307.1 protein_id gnl|my_center|LOCUS_26230 60563 59598 gene locus_tag LOCUS_26240 60563 59598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 62238 60739 gene locus_tag LOCUS_26250 62238 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 63808 62273 gene locus_tag LOCUS_26260 63808 62273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_26260 67325 63819 gene locus_tag LOCUS_26270 67325 63819 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_26270 68298 67453 gene locus_tag LOCUS_26280 68298 67453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 69226 68729 gene locus_tag LOCUS_26290 69226 68729 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_26290 69817 71394 gene locus_tag LOCUS_26300 69817 71394 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064271.1 protein_id gnl|my_center|LOCUS_26300 71400 72590 gene locus_tag LOCUS_26310 71400 72590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205727.1 protein_id gnl|my_center|LOCUS_26310 74121 73111 gene locus_tag LOCUS_26320 74121 73111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 75680 74415 gene locus_tag LOCUS_26330 75680 74415 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_26330 77067 75814 gene locus_tag LOCUS_26340 77067 75814 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335856.1 protein_id gnl|my_center|LOCUS_26340 78130 77225 gene locus_tag LOCUS_26350 78130 77225 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FH7 protein_id gnl|my_center|LOCUS_26350 78689 78267 gene locus_tag LOCUS_26360 78689 78267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 79904 78879 gene locus_tag LOCUS_26370 79904 78879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_26370 80233 81384 gene locus_tag LOCUS_26380 80233 81384 CDS product tagatose-6-phosphate ketose inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898687.1 protein_id gnl|my_center|LOCUS_26380 81396 82328 gene locus_tag LOCUS_26390 gene lacC 81396 82328 CDS product tagatose-6-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F04 protein_id gnl|my_center|LOCUS_26390 82330 83277 gene locus_tag LOCUS_26400 82330 83277 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_26400 83281 84105 gene locus_tag LOCUS_26410 83281 84105 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861804.1 protein_id gnl|my_center|LOCUS_26410 84173 85294 gene locus_tag LOCUS_26420 84173 85294 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266619.1 protein_id gnl|my_center|LOCUS_26420 85291 86328 gene locus_tag LOCUS_26430 85291 86328 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121661.1 protein_id gnl|my_center|LOCUS_26430 86346 87401 gene locus_tag LOCUS_26440 86346 87401 CDS product dihydrodipicolinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121662.1 protein_id gnl|my_center|LOCUS_26440 87578 88339 gene locus_tag LOCUS_26450 87578 88339 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891912.1 protein_id gnl|my_center|LOCUS_26450 89651 88554 gene locus_tag LOCUS_26460 89651 88554 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_26460 92731 89672 gene locus_tag LOCUS_26470 92731 89672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_26470 94797 93049 gene locus_tag LOCUS_26480 94797 93049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120539.1 protein_id gnl|my_center|LOCUS_26480 97969 95168 gene locus_tag LOCUS_26490 97969 95168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 99755 98199 gene locus_tag LOCUS_26500 99755 98199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 100577 101779 gene locus_tag LOCUS_26510 100577 101779 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108782.1 protein_id gnl|my_center|LOCUS_26510 102969 101962 gene locus_tag LOCUS_26520 102969 101962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 104060 103059 gene locus_tag LOCUS_26530 104060 103059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 105723 104119 gene locus_tag LOCUS_26540 105723 104119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 107495 105915 gene locus_tag LOCUS_26550 107495 105915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109269.1 protein_id gnl|my_center|LOCUS_26550 110684 107508 gene locus_tag LOCUS_26560 110684 107508 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 protein_id gnl|my_center|LOCUS_26560 >Feature sequence16 370 1188 gene locus_tag LOCUS_26570 370 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1344 1919 gene locus_tag LOCUS_26580 1344 1919 CDS product NAD(P)H dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683439.1 protein_id gnl|my_center|LOCUS_26580 3238 2018 gene locus_tag LOCUS_26590 3238 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6802 3434 gene locus_tag LOCUS_26600 gene secA 6802 3434 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 protein_id gnl|my_center|LOCUS_26600 7320 7096 gene locus_tag LOCUS_26610 7320 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_26610 8112 7534 gene locus_tag LOCUS_26620 8112 7534 CDS product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_26620 8999 8481 gene locus_tag LOCUS_26630 8999 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 10887 9007 gene locus_tag LOCUS_26640 10887 9007 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_26640 12027 10897 gene locus_tag LOCUS_26650 12027 10897 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813038.1 protein_id gnl|my_center|LOCUS_26650 12397 13143 gene locus_tag LOCUS_26660 gene pssA 12397 13143 CDS product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 protein_id gnl|my_center|LOCUS_26660 13966 13226 gene locus_tag LOCUS_26670 gene lptB 13966 13226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_26670 14381 14031 gene locus_tag LOCUS_26680 14381 14031 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ6 protein_id gnl|my_center|LOCUS_26680 15201 14365 gene locus_tag LOCUS_26690 gene tatC 15201 14365 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_26690 16166 15201 gene locus_tag LOCUS_26700 gene kdsD 16166 15201 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_26700 16379 18580 gene locus_tag LOCUS_26710 gene recQ1 16379 18580 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_26710 19003 18701 gene locus_tag LOCUS_26720 19003 18701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 19407 19069 gene locus_tag LOCUS_26730 19407 19069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 19727 19422 gene locus_tag LOCUS_26740 19727 19422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 19925 20515 gene locus_tag LOCUS_26750 19925 20515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_26750 21028 20531 gene locus_tag LOCUS_26760 21028 20531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 21144 22292 gene locus_tag LOCUS_26770 21144 22292 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_26770 22942 22283 gene locus_tag LOCUS_26780 22942 22283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 25373 22953 gene locus_tag LOCUS_26790 25373 22953 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_26790 27062 25410 gene locus_tag LOCUS_26800 27062 25410 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_26800 27296 27586 gene locus_tag LOCUS_26810 27296 27586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_26810 27600 27896 gene locus_tag LOCUS_26820 27600 27896 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_26820 28121 29674 gene locus_tag LOCUS_26830 gene rny 28121 29674 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_26830 30264 29794 gene locus_tag LOCUS_26840 30264 29794 CDS product ketosteroid isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266812.1 protein_id gnl|my_center|LOCUS_26840 30369 31094 gene locus_tag LOCUS_26850 30369 31094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_26850 31237 32496 gene locus_tag LOCUS_26860 gene rhlE 31237 32496 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_26860 34106 32613 gene locus_tag LOCUS_26870 34106 32613 CDS product K+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_26870 36364 34328 gene locus_tag LOCUS_26880 36364 34328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 protein_id gnl|my_center|LOCUS_26880 37296 36541 gene locus_tag LOCUS_26890 37296 36541 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_26890 38287 37268 gene locus_tag LOCUS_26900 38287 37268 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_26900 39218 38301 gene locus_tag LOCUS_26910 39218 38301 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_26910 40735 39338 gene locus_tag LOCUS_26920 40735 39338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_26920 42020 40821 gene locus_tag LOCUS_26930 gene argD 42020 40821 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_26930 43699 42014 gene locus_tag LOCUS_26940 43699 42014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_26940 45113 43842 gene locus_tag LOCUS_26950 gene purA 45113 43842 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_26950 45588 45133 gene locus_tag LOCUS_26960 gene fur 45588 45133 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_26960 47837 45630 gene locus_tag LOCUS_26970 gene relA 47837 45630 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_26970 49131 47878 gene locus_tag LOCUS_26980 49131 47878 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_26980 49995 49171 gene locus_tag LOCUS_26990 49995 49171 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_26990 50162 50971 gene locus_tag LOCUS_27000 50162 50971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 52336 51044 gene locus_tag LOCUS_27010 52336 51044 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073038.1 protein_id gnl|my_center|LOCUS_27010 55325 52374 gene locus_tag LOCUS_27020 55325 52374 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_27020 56573 55506 gene locus_tag LOCUS_27030 56573 55506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 protein_id gnl|my_center|LOCUS_27030 56698 58164 gene locus_tag LOCUS_27040 gene pepD 56698 58164 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_27040 59375 58251 gene locus_tag LOCUS_27050 gene ppiA 59375 58251 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_27050 59940 59386 gene locus_tag LOCUS_27060 gene gldI 59940 59386 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_27060 60953 59937 gene locus_tag LOCUS_27070 gene fjo19 60953 59937 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_27070 61246 62043 gene locus_tag LOCUS_27080 61246 62043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106675.1 protein_id gnl|my_center|LOCUS_27080 63080 63241 gene locus_tag LOCUS_27090 63080 63241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 63355 63750 gene locus_tag LOCUS_27100 gene ndk 63355 63750 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_27100 64190 63894 gene locus_tag LOCUS_27110 64190 63894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_27110 64609 64190 gene locus_tag LOCUS_27120 64609 64190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963536.1 protein_id gnl|my_center|LOCUS_27120 65741 64662 gene locus_tag LOCUS_27130 gene recF 65741 64662 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_27130 65864 66628 gene locus_tag LOCUS_27140 65864 66628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_27140 66635 67117 gene locus_tag LOCUS_27150 gene ribH 66635 67117 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_27150 67304 67606 gene locus_tag LOCUS_27160 67304 67606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 67606 69453 gene locus_tag LOCUS_27170 gene mutL 67606 69453 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_27170 69454 70197 gene locus_tag LOCUS_27180 69454 70197 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_27180 70188 71069 gene locus_tag LOCUS_27190 70188 71069 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 protein_id gnl|my_center|LOCUS_27190 71093 72106 gene locus_tag LOCUS_27200 71093 72106 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_27200 72406 72098 gene locus_tag LOCUS_27210 72406 72098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 73031 72399 gene locus_tag LOCUS_27220 73031 72399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 protein_id gnl|my_center|LOCUS_27220 74742 73048 gene locus_tag LOCUS_27230 gene lepB 74742 73048 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 protein_id gnl|my_center|LOCUS_27230 75551 74850 gene locus_tag LOCUS_27240 gene dapB 75551 74850 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_27240 76202 75555 gene locus_tag LOCUS_27250 76202 75555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_27250 77103 76195 gene locus_tag LOCUS_27260 gene parB 77103 76195 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 protein_id gnl|my_center|LOCUS_27260 77884 77105 gene locus_tag LOCUS_27270 gene parA 77884 77105 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_27270 78124 77939 gene locus_tag LOCUS_27280 78124 77939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 80313 78172 gene locus_tag LOCUS_27290 gene mutB 80313 78172 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 protein_id gnl|my_center|LOCUS_27290 81688 80306 gene locus_tag LOCUS_27300 gene mutA 81688 80306 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963259.1 protein_id gnl|my_center|LOCUS_27300 82013 81681 gene locus_tag LOCUS_27310 82013 81681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 protein_id gnl|my_center|LOCUS_27310 82629 82021 gene locus_tag LOCUS_27320 gene udk 82629 82021 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 protein_id gnl|my_center|LOCUS_27320 83755 82679 gene locus_tag LOCUS_27330 83755 82679 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_27330 85326 83737 gene locus_tag LOCUS_27340 85326 83737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 86602 85328 gene locus_tag LOCUS_27350 86602 85328 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_27350 86904 87320 gene locus_tag LOCUS_27360 86904 87320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 87593 87841 gene locus_tag LOCUS_27370 87593 87841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 87834 90008 gene locus_tag LOCUS_27380 87834 90008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence17 146 955 gene locus_tag LOCUS_27390 146 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1252 1884 gene locus_tag LOCUS_27400 1252 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 3742 2729 gene locus_tag LOCUS_27410 3742 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 4178 3771 gene locus_tag LOCUS_27420 4178 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 4918 4226 gene locus_tag LOCUS_27430 4918 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 5124 4909 gene locus_tag LOCUS_27440 5124 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 5639 5205 gene locus_tag LOCUS_27450 5639 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 6031 5636 gene locus_tag LOCUS_27460 6031 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 6431 6189 gene locus_tag LOCUS_27470 6431 6189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 6649 7071 gene locus_tag LOCUS_27480 6649 7071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 7074 7238 gene locus_tag LOCUS_27490 7074 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 7642 7250 gene locus_tag LOCUS_27500 7642 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 7872 7663 gene locus_tag LOCUS_27510 7872 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 8880 8179 gene locus_tag LOCUS_27520 8880 8179 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963683.1 protein_id gnl|my_center|LOCUS_27520 9554 8883 gene locus_tag LOCUS_27530 9554 8883 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963684.1 protein_id gnl|my_center|LOCUS_27530 9863 9588 gene locus_tag LOCUS_27540 9863 9588 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963685.1 protein_id gnl|my_center|LOCUS_27540 11468 10629 gene locus_tag LOCUS_27550 11468 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963653.1 protein_id gnl|my_center|LOCUS_27550 12883 11651 gene locus_tag LOCUS_27560 12883 11651 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362024.1 protein_id gnl|my_center|LOCUS_27560 13183 13109 gene locus_tag LOCUS_t00260 13183 13109 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15784 13436 gene locus_tag LOCUS_27570 gene ladS 15784 13436 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114327.1 protein_id gnl|my_center|LOCUS_27570 16743 16021 gene locus_tag LOCUS_27580 16743 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 17687 16908 gene locus_tag LOCUS_27590 17687 16908 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073578.1 protein_id gnl|my_center|LOCUS_27590 18540 17770 gene locus_tag LOCUS_27600 18540 17770 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_27600 18720 18550 gene locus_tag LOCUS_27610 18720 18550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 19353 18913 gene locus_tag LOCUS_27620 19353 18913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 20435 19410 gene locus_tag LOCUS_27630 20435 19410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 20838 20500 gene locus_tag LOCUS_27640 20838 20500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 21120 22052 gene locus_tag LOCUS_27650 21120 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 22927 22241 gene locus_tag LOCUS_27660 gene lolD 22927 22241 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY43 protein_id gnl|my_center|LOCUS_27660 24172 22928 gene locus_tag LOCUS_27670 gene lolC 24172 22928 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963073.1 protein_id gnl|my_center|LOCUS_27670 25301 24174 gene locus_tag LOCUS_27680 25301 24174 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963074.1 protein_id gnl|my_center|LOCUS_27680 26574 25276 gene locus_tag LOCUS_27690 26574 25276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 26839 26630 gene locus_tag LOCUS_27700 26839 26630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 28034 27261 gene locus_tag LOCUS_27710 28034 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 29173 28622 gene locus_tag LOCUS_27720 29173 28622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 29434 29985 gene locus_tag LOCUS_27730 29434 29985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 32032 30080 gene locus_tag LOCUS_27740 32032 30080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 34338 32044 gene locus_tag LOCUS_27750 34338 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 35451 34663 gene locus_tag LOCUS_27760 35451 34663 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225865.1 protein_id gnl|my_center|LOCUS_27760 36255 35512 gene locus_tag LOCUS_27770 gene dltE 36255 35512 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_27770 37346 36303 gene locus_tag LOCUS_27780 37346 36303 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103700.1 protein_id gnl|my_center|LOCUS_27780 37757 38014 gene locus_tag LOCUS_27790 37757 38014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 38606 38004 gene locus_tag LOCUS_27800 38606 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 38784 40031 gene locus_tag LOCUS_27810 38784 40031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 40056 43151 gene locus_tag LOCUS_27820 40056 43151 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_27820 43163 44614 gene locus_tag LOCUS_27830 43163 44614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_27830 45558 45310 gene locus_tag LOCUS_27840 45558 45310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 47217 45802 gene locus_tag LOCUS_27850 47217 45802 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932955.1 protein_id gnl|my_center|LOCUS_27850 50420 47256 gene locus_tag LOCUS_27860 50420 47256 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932956.1 protein_id gnl|my_center|LOCUS_27860 51657 50452 gene locus_tag LOCUS_27870 51657 50452 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932957.1 protein_id gnl|my_center|LOCUS_27870 52478 51888 gene locus_tag LOCUS_27880 52478 51888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 52829 53761 gene locus_tag LOCUS_27890 52829 53761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 53795 54592 gene locus_tag LOCUS_27900 gene fabG 53795 54592 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121677.1 protein_id gnl|my_center|LOCUS_27900 56958 55564 gene locus_tag LOCUS_27910 56958 55564 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_27910 57438 56968 gene locus_tag LOCUS_27920 57438 56968 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142813.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27920 58203 57460 gene locus_tag LOCUS_27930 58203 57460 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403965.1 protein_id gnl|my_center|LOCUS_27930 58674 58273 gene locus_tag LOCUS_27940 58674 58273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_27940 59023 58721 gene locus_tag LOCUS_27950 59023 58721 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814535.1 protein_id gnl|my_center|LOCUS_27950 59798 59118 gene locus_tag LOCUS_27960 gene nonF 59798 59118 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035300.1 protein_id gnl|my_center|LOCUS_27960 60611 60042 gene locus_tag LOCUS_27970 60611 60042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 61118 61900 gene locus_tag LOCUS_27980 61118 61900 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266249.1 protein_id gnl|my_center|LOCUS_27980 61902 62663 gene locus_tag LOCUS_27990 61902 62663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 62846 63760 gene locus_tag LOCUS_28000 62846 63760 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_28000 63868 64437 gene locus_tag LOCUS_28010 63868 64437 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_28010 64517 65380 gene locus_tag LOCUS_28020 64517 65380 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975353.1 protein_id gnl|my_center|LOCUS_28020 65734 66537 gene locus_tag LOCUS_28030 65734 66537 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245058.1 protein_id gnl|my_center|LOCUS_28030 66886 67731 gene locus_tag LOCUS_28040 66886 67731 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_28040 68690 67935 gene locus_tag LOCUS_28050 68690 67935 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369251.1 protein_id gnl|my_center|LOCUS_28050 69706 68786 gene locus_tag LOCUS_28060 69706 68786 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207883.1 protein_id gnl|my_center|LOCUS_28060 70649 70065 gene locus_tag LOCUS_28070 70649 70065 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_28070 71484 70729 gene locus_tag LOCUS_28080 71484 70729 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086767.1 protein_id gnl|my_center|LOCUS_28080 72816 71839 gene locus_tag LOCUS_28090 72816 71839 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227567.1 protein_id gnl|my_center|LOCUS_28090 73720 72878 gene locus_tag LOCUS_28100 73720 72878 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174466.1 protein_id gnl|my_center|LOCUS_28100 74630 73785 gene locus_tag LOCUS_28110 74630 73785 CDS product 2,5-diketo-D-gluconic acid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080532.1 protein_id gnl|my_center|LOCUS_28110 75547 74705 gene locus_tag LOCUS_28120 75547 74705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 76164 75592 gene locus_tag LOCUS_28130 76164 75592 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_28130 76874 76236 gene locus_tag LOCUS_28140 76874 76236 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547287.1 protein_id gnl|my_center|LOCUS_28140 77859 77104 gene locus_tag LOCUS_28150 77859 77104 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 protein_id gnl|my_center|LOCUS_28150 78935 77856 gene locus_tag LOCUS_28160 78935 77856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 79209 81557 gene locus_tag LOCUS_28170 79209 81557 CDS product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 protein_id gnl|my_center|LOCUS_28170 81942 83012 gene locus_tag LOCUS_28180 81942 83012 CDS product glycosyl hydrolase family 43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784057.1 protein_id gnl|my_center|LOCUS_28180 83292 83603 gene locus_tag LOCUS_28190 83292 83603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 84693 85322 gene locus_tag LOCUS_28200 84693 85322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 85863 88004 gene locus_tag LOCUS_28210 85863 88004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 88479 88661 gene locus_tag LOCUS_28220 88479 88661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence18 981 1736 gene locus_tag LOCUS_28230 981 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 2367 1780 gene locus_tag LOCUS_28240 2367 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 3191 2445 gene locus_tag LOCUS_28250 3191 2445 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_28250 3717 3343 gene locus_tag LOCUS_28260 3717 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 3978 4322 gene locus_tag LOCUS_28270 3978 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 4513 4295 gene locus_tag LOCUS_28280 4513 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 4742 5215 gene locus_tag LOCUS_28290 4742 5215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 5345 5953 gene locus_tag LOCUS_28300 5345 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 6373 6741 gene locus_tag LOCUS_28310 6373 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 6914 7189 gene locus_tag LOCUS_28320 6914 7189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 7194 7430 gene locus_tag LOCUS_28330 7194 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 8361 7507 gene locus_tag LOCUS_28340 8361 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 8836 8759 gene locus_tag LOCUS_t00270 8836 8759 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8954 8870 gene locus_tag LOCUS_t00280 8954 8870 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11095 9068 gene locus_tag LOCUS_28350 11095 9068 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_28350 11237 12412 gene locus_tag LOCUS_28360 11237 12412 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_28360 12434 13186 gene locus_tag LOCUS_28370 12434 13186 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_28370 14659 13418 gene locus_tag LOCUS_28380 14659 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 17305 14723 gene locus_tag LOCUS_28390 gene gyrA 17305 14723 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_28390 17341 17601 gene locus_tag LOCUS_28400 17341 17601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 17565 20117 gene locus_tag LOCUS_28410 gene clpA 17565 20117 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_28410 20318 20722 gene locus_tag LOCUS_28420 20318 20722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 22253 20724 gene locus_tag LOCUS_28430 22253 20724 CDS product bifunctional NAD(P)H-hydrate repair enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZJ4 protein_id gnl|my_center|LOCUS_28430 22587 25031 gene locus_tag LOCUS_28440 22587 25031 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_28440 25035 25958 gene locus_tag LOCUS_28450 gene thrB 25035 25958 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_28450 25995 27287 gene locus_tag LOCUS_28460 25995 27287 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_28460 27432 27791 gene locus_tag LOCUS_28470 27432 27791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 29404 27797 gene locus_tag LOCUS_28480 29404 27797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 29575 30669 gene locus_tag LOCUS_28490 gene gcvT 29575 30669 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_28490 30745 31659 gene locus_tag LOCUS_28500 gene glsA 30745 31659 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63MM2 protein_id gnl|my_center|LOCUS_28500 31659 32483 gene locus_tag LOCUS_28510 31659 32483 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_28510 32559 32846 gene locus_tag LOCUS_28520 gene pcbD 32559 32846 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92L66 protein_id gnl|my_center|LOCUS_28520 32913 33623 gene locus_tag LOCUS_28530 32913 33623 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_28530 35807 33798 gene locus_tag LOCUS_28540 35807 33798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 36738 36031 gene locus_tag LOCUS_28550 gene rprY 36738 36031 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_28550 38325 36745 gene locus_tag LOCUS_28560 gene rprX 38325 36745 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_28560 38992 38390 gene locus_tag LOCUS_28570 gene coaE 38992 38390 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_28570 39945 38989 gene locus_tag LOCUS_28580 39945 38989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 40958 39945 gene locus_tag LOCUS_28590 40958 39945 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 protein_id gnl|my_center|LOCUS_28590 41845 41027 gene locus_tag LOCUS_28600 41845 41027 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_28600 43633 41975 gene locus_tag LOCUS_28610 gene recN 43633 41975 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 protein_id gnl|my_center|LOCUS_28610 44582 43692 gene locus_tag LOCUS_28620 44582 43692 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_28620 45780 44575 gene locus_tag LOCUS_28630 gene coaBC 45780 44575 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_28630 46116 45784 gene locus_tag LOCUS_28640 46116 45784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_28640 46950 46129 gene locus_tag LOCUS_28650 gene bamD 46950 46129 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_28650 47982 47089 gene locus_tag LOCUS_28660 gene dapA 47982 47089 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_28660 48515 47979 gene locus_tag LOCUS_28670 48515 47979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 48582 49346 gene locus_tag LOCUS_28680 48582 49346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963939.1 protein_id gnl|my_center|LOCUS_28680 49356 50288 gene locus_tag LOCUS_28690 49356 50288 CDS product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 protein_id gnl|my_center|LOCUS_28690 50675 50373 gene locus_tag LOCUS_28700 50675 50373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_28700 50902 51489 gene locus_tag LOCUS_28710 50902 51489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 51549 52775 gene locus_tag LOCUS_28720 51549 52775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 52882 53472 gene locus_tag LOCUS_28730 52882 53472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 55543 53534 gene locus_tag LOCUS_28740 gene ligA 55543 53534 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 protein_id gnl|my_center|LOCUS_28740 56124 55543 gene locus_tag LOCUS_28750 56124 55543 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_28750 57073 56225 gene locus_tag LOCUS_28760 gene prmC 57073 56225 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_28760 57563 57078 gene locus_tag LOCUS_28770 gene yjgM 57563 57078 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964124.1 protein_id gnl|my_center|LOCUS_28770 57682 58671 gene locus_tag LOCUS_28780 gene ribD 57682 58671 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_28780 58649 59251 gene locus_tag LOCUS_28790 58649 59251 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 protein_id gnl|my_center|LOCUS_28790 59254 60114 gene locus_tag LOCUS_28800 59254 60114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44170 protein_id gnl|my_center|LOCUS_28800 60117 60731 gene locus_tag LOCUS_28810 60117 60731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964127.1 protein_id gnl|my_center|LOCUS_28810 61184 60786 gene locus_tag LOCUS_28820 61184 60786 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_28820 61392 62816 gene locus_tag LOCUS_28830 gene dnaA 61392 62816 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 protein_id gnl|my_center|LOCUS_28830 62876 63283 gene locus_tag LOCUS_28840 62876 63283 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_28840 63301 64026 gene locus_tag LOCUS_28850 63301 64026 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_28850 64615 64076 gene locus_tag LOCUS_28860 64615 64076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 65908 64865 gene locus_tag LOCUS_28870 gene pabC 65908 64865 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_28870 66432 65899 gene locus_tag LOCUS_28880 66432 65899 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_28880 67202 66426 gene locus_tag LOCUS_28890 gene dapF 67202 66426 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_28890 67330 68721 gene locus_tag LOCUS_28900 gene degP/Q 67330 68721 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_28900 68844 70292 gene locus_tag LOCUS_28910 gene gapA2 68844 70292 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX7 protein_id gnl|my_center|LOCUS_28910 70476 71099 gene locus_tag LOCUS_28920 70476 71099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 71336 72010 gene locus_tag LOCUS_28930 gene trmD 71336 72010 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_28930 72157 72507 gene locus_tag LOCUS_28940 gene rplS 72157 72507 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_28940 73193 75412 gene locus_tag LOCUS_28950 73193 75412 CDS product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_28950 75549 77924 gene locus_tag LOCUS_28960 75549 77924 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_28960 77928 78743 gene locus_tag LOCUS_28970 77928 78743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962851.1 protein_id gnl|my_center|LOCUS_28970 80086 78749 gene locus_tag LOCUS_28980 80086 78749 CDS product gluconate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392414.1 protein_id gnl|my_center|LOCUS_28980 81237 80083 gene locus_tag LOCUS_28990 81237 80083 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476530.1 protein_id gnl|my_center|LOCUS_28990 81353 81580 gene locus_tag LOCUS_29000 81353 81580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 81668 82189 gene locus_tag LOCUS_29010 gene yorS 81668 82189 CDS product 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P68522 protein_id gnl|my_center|LOCUS_29010 >Feature sequence19 1282 2145 gene locus_tag LOCUS_29020 1282 2145 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 protein_id gnl|my_center|LOCUS_29020 2747 2941 gene locus_tag LOCUS_29030 2747 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 2938 5907 gene locus_tag LOCUS_29040 2938 5907 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 protein_id gnl|my_center|LOCUS_29040 5925 7667 gene locus_tag LOCUS_29050 5925 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 7753 8895 gene locus_tag LOCUS_29060 7753 8895 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202554.1 protein_id gnl|my_center|LOCUS_29060 9360 9100 gene locus_tag LOCUS_29070 9360 9100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 9490 13827 gene locus_tag LOCUS_29080 9490 13827 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_29080 13830 15029 gene locus_tag LOCUS_29090 13830 15029 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_29090 15034 15450 gene locus_tag LOCUS_29100 15034 15450 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202354.1 protein_id gnl|my_center|LOCUS_29100 15701 16582 gene locus_tag LOCUS_29110 15701 16582 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933484.1 protein_id gnl|my_center|LOCUS_29110 17592 16609 gene locus_tag LOCUS_29120 17592 16609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 17820 19886 gene locus_tag LOCUS_29130 17820 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 20043 20330 gene locus_tag LOCUS_29140 gene nirD-2 20043 20330 CDS product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 protein_id gnl|my_center|LOCUS_29140 20351 20944 gene locus_tag LOCUS_29150 20351 20944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 22777 23382 gene locus_tag LOCUS_29160 22777 23382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 23384 24577 gene locus_tag LOCUS_29170 23384 24577 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028814.1 protein_id gnl|my_center|LOCUS_29170 24745 25188 gene locus_tag LOCUS_29180 24745 25188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 25192 26100 gene locus_tag LOCUS_29190 gene moaCB 25192 26100 CDS product bifunctional molybdenum cofactor biosynthesis protein MoaC/MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207007.1 protein_id gnl|my_center|LOCUS_29190 26952 26227 gene locus_tag LOCUS_29200 26952 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 27374 28774 gene locus_tag LOCUS_29210 gene speA 27374 28774 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A2 protein_id gnl|my_center|LOCUS_29210 28761 29705 gene locus_tag LOCUS_29220 28761 29705 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_29220 29692 30669 gene locus_tag LOCUS_29230 29692 30669 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_29230 30673 30987 gene locus_tag LOCUS_29240 30673 30987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 30993 31769 gene locus_tag LOCUS_29250 30993 31769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 32288 33664 gene locus_tag LOCUS_29260 gene rimK 32288 33664 CDS product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 protein_id gnl|my_center|LOCUS_29260 34637 33699 gene locus_tag LOCUS_29270 gene ltd 34637 33699 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_29270 34703 35212 gene locus_tag LOCUS_29280 34703 35212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 35190 35699 gene locus_tag LOCUS_29290 35190 35699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962259.1 protein_id gnl|my_center|LOCUS_29290 36440 35736 gene locus_tag LOCUS_29300 36440 35736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 37553 36663 gene locus_tag LOCUS_29310 37553 36663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 38541 37534 gene locus_tag LOCUS_29320 gene yhdN 38541 37534 CDS product general stress protein 69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80874 protein_id gnl|my_center|LOCUS_29320 39680 38565 gene locus_tag LOCUS_29330 39680 38565 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976168.1 protein_id gnl|my_center|LOCUS_29330 40535 39714 gene locus_tag LOCUS_29340 40535 39714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 41399 40566 gene locus_tag LOCUS_29350 41399 40566 CDS product L-proline 4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_29350 41532 42434 gene locus_tag LOCUS_29360 41532 42434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 44663 42540 gene locus_tag LOCUS_29370 44663 42540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 46782 44707 gene locus_tag LOCUS_29380 46782 44707 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921329.1 protein_id gnl|my_center|LOCUS_29380 48952 46823 gene locus_tag LOCUS_29390 48952 46823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 49618 49040 gene locus_tag LOCUS_29400 49618 49040 CDS product twin-arginine translocation pathway signal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383266.1 protein_id gnl|my_center|LOCUS_29400 51436 49667 gene locus_tag LOCUS_29410 51436 49667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 53185 51455 gene locus_tag LOCUS_29420 53185 51455 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537425.1 protein_id gnl|my_center|LOCUS_29420 53863 53189 gene locus_tag LOCUS_29430 53863 53189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 53744 53980 gene locus_tag LOCUS_29440 53744 53980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 55765 54287 gene locus_tag LOCUS_29450 55765 54287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_29450 58875 55858 gene locus_tag LOCUS_29460 58875 55858 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_29460 60965 59202 gene locus_tag LOCUS_29470 60965 59202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 63355 61337 gene locus_tag LOCUS_29480 63355 61337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 63633 63561 gene locus_tag LOCUS_t00290 63633 63561 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63788 65335 gene locus_tag LOCUS_29490 63788 65335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 65914 65399 gene locus_tag LOCUS_29500 65914 65399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 66118 68415 gene locus_tag LOCUS_29510 66118 68415 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228501.1 protein_id gnl|my_center|LOCUS_29510 69490 68504 gene locus_tag LOCUS_29520 69490 68504 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968596.1 protein_id gnl|my_center|LOCUS_29520 70527 69670 gene locus_tag LOCUS_29530 gene rhaT 70527 69670 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124908.1 protein_id gnl|my_center|LOCUS_29530 70857 72029 gene locus_tag LOCUS_29540 70857 72029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782250.1 protein_id gnl|my_center|LOCUS_29540 72421 72095 gene locus_tag LOCUS_29550 72421 72095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 74451 73117 gene locus_tag LOCUS_29560 74451 73117 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195858.1 protein_id gnl|my_center|LOCUS_29560 75339 74749 gene locus_tag LOCUS_29570 75339 74749 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796768.1 protein_id gnl|my_center|LOCUS_29570 75457 76620 gene locus_tag LOCUS_29580 75457 76620 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795956.1 protein_id gnl|my_center|LOCUS_29580 76780 80124 gene locus_tag LOCUS_29590 76780 80124 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_29590 80226 81920 gene locus_tag LOCUS_29600 80226 81920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence20 975 556 gene locus_tag LOCUS_29610 975 556 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_29610 1111 1428 gene locus_tag LOCUS_29620 1111 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 2423 2815 gene locus_tag LOCUS_29630 2423 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 2896 3339 gene locus_tag LOCUS_29640 2896 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 3387 3680 gene locus_tag LOCUS_29650 3387 3680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 3723 4334 gene locus_tag LOCUS_29660 3723 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29660 4429 5103 gene locus_tag LOCUS_29670 4429 5103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 5567 6055 gene locus_tag LOCUS_29680 5567 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 7170 7694 gene locus_tag LOCUS_29690 7170 7694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 9580 9080 gene locus_tag LOCUS_29700 9580 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883081.1 protein_id gnl|my_center|LOCUS_29700 9947 10642 gene locus_tag LOCUS_29710 9947 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 11221 11000 gene locus_tag LOCUS_29720 11221 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963662.1 protein_id gnl|my_center|LOCUS_29720 11639 11232 gene locus_tag LOCUS_29730 11639 11232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964411.1 protein_id gnl|my_center|LOCUS_29730 12397 11639 gene locus_tag LOCUS_29740 12397 11639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963660.1 protein_id gnl|my_center|LOCUS_29740 12644 12832 gene locus_tag LOCUS_29750 12644 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963659.1 protein_id gnl|my_center|LOCUS_29750 13459 13854 gene locus_tag LOCUS_29760 13459 13854 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010535380.1 protein_id gnl|my_center|LOCUS_29760 14624 13971 gene locus_tag LOCUS_29770 gene clpP 14624 13971 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAW6 protein_id gnl|my_center|LOCUS_29770 14890 14624 gene locus_tag LOCUS_29780 14890 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 15428 14871 gene locus_tag LOCUS_29790 15428 14871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 16508 15690 gene locus_tag LOCUS_29800 16508 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29800 17957 17214 gene locus_tag LOCUS_29810 17957 17214 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_29810 18735 18121 gene locus_tag LOCUS_29820 18735 18121 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948144.1 protein_id gnl|my_center|LOCUS_29820 19240 18740 gene locus_tag LOCUS_29830 19240 18740 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993326.1 protein_id gnl|my_center|LOCUS_29830 19720 19412 gene locus_tag LOCUS_29840 19720 19412 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_29840 20288 19977 gene locus_tag LOCUS_29850 20288 19977 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201973.1 protein_id gnl|my_center|LOCUS_29850 20613 20269 gene locus_tag LOCUS_29860 20613 20269 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_29860 21132 20803 gene locus_tag LOCUS_29870 21132 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 22017 21466 gene locus_tag LOCUS_29880 22017 21466 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970075.1 protein_id gnl|my_center|LOCUS_29880 23958 22276 gene locus_tag LOCUS_29890 23958 22276 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533474.1 protein_id gnl|my_center|LOCUS_29890 25947 24685 gene locus_tag LOCUS_29900 25947 24685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 27591 26131 gene locus_tag LOCUS_29910 27591 26131 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122518.1 protein_id gnl|my_center|LOCUS_29910 29938 27596 gene locus_tag LOCUS_29920 29938 27596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 30078 31265 gene locus_tag LOCUS_29930 30078 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 34527 31279 gene locus_tag LOCUS_29940 34527 31279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 36591 34795 gene locus_tag LOCUS_29950 36591 34795 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107269.1 protein_id gnl|my_center|LOCUS_29950 39819 36643 gene locus_tag LOCUS_29960 39819 36643 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791675.1 protein_id gnl|my_center|LOCUS_29960 43029 40288 gene locus_tag LOCUS_29970 43029 40288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 44325 43219 gene locus_tag LOCUS_29980 gene pam 44325 43219 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_29980 45644 44475 gene locus_tag LOCUS_29990 45644 44475 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_29990 46601 45654 gene locus_tag LOCUS_30000 46601 45654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 48995 46617 gene locus_tag LOCUS_30010 48995 46617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 49808 49071 gene locus_tag LOCUS_30020 49808 49071 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766589.1 protein_id gnl|my_center|LOCUS_30020 51203 49911 gene locus_tag LOCUS_30030 51203 49911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 54463 51212 gene locus_tag LOCUS_30040 54463 51212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108138.1 protein_id gnl|my_center|LOCUS_30040 56223 54454 gene locus_tag LOCUS_30050 56223 54454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 57003 56446 gene locus_tag LOCUS_30060 57003 56446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_30060 57169 57900 gene locus_tag LOCUS_30070 57169 57900 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285450.1 protein_id gnl|my_center|LOCUS_30070 58027 58464 gene locus_tag LOCUS_30080 58027 58464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 59106 61427 gene locus_tag LOCUS_30090 59106 61427 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022354.1 protein_id gnl|my_center|LOCUS_30090 61424 62443 gene locus_tag LOCUS_30100 61424 62443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 63964 62507 gene locus_tag LOCUS_30110 63964 62507 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119131.1 protein_id gnl|my_center|LOCUS_30110 64249 64698 gene locus_tag LOCUS_30120 64249 64698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 64925 65263 gene locus_tag LOCUS_30130 64925 65263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 65614 66723 gene locus_tag LOCUS_30140 65614 66723 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_30140 67673 66792 gene locus_tag LOCUS_30150 67673 66792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 68425 67769 gene locus_tag LOCUS_30160 68425 67769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 68821 70407 gene locus_tag LOCUS_30170 68821 70407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 71094 71498 gene locus_tag LOCUS_30180 71094 71498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 74063 71676 gene locus_tag LOCUS_30190 74063 71676 CDS product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 protein_id gnl|my_center|LOCUS_30190 74858 74088 gene locus_tag LOCUS_30200 74858 74088 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_30200 76830 74896 gene locus_tag LOCUS_30210 76830 74896 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_30210 >Feature sequence21 255 896 gene locus_tag LOCUS_30220 255 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 1137 1406 gene locus_tag LOCUS_30230 1137 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 1406 1561 gene locus_tag LOCUS_30240 1406 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 2129 2362 gene locus_tag LOCUS_30250 2129 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964043.1 protein_id gnl|my_center|LOCUS_30250 2494 2679 gene locus_tag LOCUS_30260 2494 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30260 2922 3737 gene locus_tag LOCUS_30270 2922 3737 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_30270 3784 4683 gene locus_tag LOCUS_30280 3784 4683 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_30280 4902 5447 gene locus_tag LOCUS_30290 4902 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 5564 5785 gene locus_tag LOCUS_30300 5564 5785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 5799 6242 gene locus_tag LOCUS_30310 5799 6242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 6499 6846 gene locus_tag LOCUS_30320 6499 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089353.1 protein_id gnl|my_center|LOCUS_30320 6836 8047 gene locus_tag LOCUS_30330 6836 8047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 8064 8507 gene locus_tag LOCUS_30340 8064 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 9104 9556 gene locus_tag LOCUS_30350 9104 9556 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89D50 protein_id gnl|my_center|LOCUS_30350 10071 10274 gene locus_tag LOCUS_30360 10071 10274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 10734 10435 gene locus_tag LOCUS_30370 10734 10435 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206336.1 protein_id gnl|my_center|LOCUS_30370 10898 11671 gene locus_tag LOCUS_30380 10898 11671 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389403.1 protein_id gnl|my_center|LOCUS_30380 11692 12525 gene locus_tag LOCUS_30390 11692 12525 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227679.1 protein_id gnl|my_center|LOCUS_30390 12865 13233 gene locus_tag LOCUS_30400 12865 13233 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208086.1 protein_id gnl|my_center|LOCUS_30400 13475 14065 gene locus_tag LOCUS_30410 13475 14065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110820.1 protein_id gnl|my_center|LOCUS_30410 14337 15467 gene locus_tag LOCUS_30420 14337 15467 CDS product multidrug MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964038.1 protein_id gnl|my_center|LOCUS_30420 15719 15967 gene locus_tag LOCUS_30430 15719 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 15964 16386 gene locus_tag LOCUS_30440 15964 16386 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_30440 16938 17240 gene locus_tag LOCUS_30450 16938 17240 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_30450 17819 18565 gene locus_tag LOCUS_30460 17819 18565 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223997.1 protein_id gnl|my_center|LOCUS_30460 19184 19780 gene locus_tag LOCUS_30470 19184 19780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951353.1 protein_id gnl|my_center|LOCUS_30470 20176 19808 gene locus_tag LOCUS_30480 20176 19808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 20288 21166 gene locus_tag LOCUS_30490 20288 21166 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385588.1 protein_id gnl|my_center|LOCUS_30490 21417 21956 gene locus_tag LOCUS_30500 21417 21956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 21959 22183 gene locus_tag LOCUS_30510 gene yozG 21959 22183 CDS product putative HTH-type transcriptional regulator YozG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31834 protein_id gnl|my_center|LOCUS_30510 22400 22894 gene locus_tag LOCUS_30520 22400 22894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 23215 24141 gene locus_tag LOCUS_30530 23215 24141 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974548.1 protein_id gnl|my_center|LOCUS_30530 24215 24577 gene locus_tag LOCUS_30540 24215 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 25547 26401 gene locus_tag LOCUS_30550 25547 26401 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_30550 26548 27117 gene locus_tag LOCUS_30560 26548 27117 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 protein_id gnl|my_center|LOCUS_30560 27192 28163 gene locus_tag LOCUS_30570 27192 28163 CDS product aldehyde oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088295.1 protein_id gnl|my_center|LOCUS_30570 28346 28828 gene locus_tag LOCUS_30580 28346 28828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 28879 29688 gene locus_tag LOCUS_30590 28879 29688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 29753 31414 gene locus_tag LOCUS_30600 29753 31414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 31823 32257 gene locus_tag LOCUS_30610 31823 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 32568 32954 gene locus_tag LOCUS_30620 32568 32954 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070933.1 protein_id gnl|my_center|LOCUS_30620 34970 33030 gene locus_tag LOCUS_30630 gene gpi2 34970 33030 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_30630 35186 35935 gene locus_tag LOCUS_30640 35186 35935 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706132.1 protein_id gnl|my_center|LOCUS_30640 35935 36759 gene locus_tag LOCUS_30650 gene murQ 35935 36759 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABH7 protein_id gnl|my_center|LOCUS_30650 37219 36815 gene locus_tag LOCUS_30660 37219 36815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 38381 37260 gene locus_tag LOCUS_30670 38381 37260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926684.1 protein_id gnl|my_center|LOCUS_30670 38655 47015 gene locus_tag LOCUS_30680 38655 47015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 47139 47216 gene locus_tag LOCUS_t00300 47139 47216 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 48587 47772 gene locus_tag LOCUS_30690 48587 47772 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237656.1 protein_id gnl|my_center|LOCUS_30690 50573 48987 gene locus_tag LOCUS_30700 50573 48987 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202442.1 protein_id gnl|my_center|LOCUS_30700 51536 50724 gene locus_tag LOCUS_30710 51536 50724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 52527 51634 gene locus_tag LOCUS_30720 52527 51634 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727421.1 protein_id gnl|my_center|LOCUS_30720 53092 52757 gene locus_tag LOCUS_30730 53092 52757 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365536.1 protein_id gnl|my_center|LOCUS_30730 53208 53948 gene locus_tag LOCUS_30740 53208 53948 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096539.1 protein_id gnl|my_center|LOCUS_30740 54152 54592 gene locus_tag LOCUS_30750 54152 54592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404760.1 protein_id gnl|my_center|LOCUS_30750 54594 55592 gene locus_tag LOCUS_30760 54594 55592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 55599 56072 gene locus_tag LOCUS_30770 55599 56072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 57299 56481 gene locus_tag LOCUS_30780 57299 56481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 protein_id gnl|my_center|LOCUS_30780 58596 57460 gene locus_tag LOCUS_30790 58596 57460 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_30790 59380 58577 gene locus_tag LOCUS_30800 59380 58577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962739.1 protein_id gnl|my_center|LOCUS_30800 59854 59537 gene locus_tag LOCUS_30810 59854 59537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962738.1 protein_id gnl|my_center|LOCUS_30810 59978 60127 gene locus_tag LOCUS_30820 59978 60127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 61543 60140 gene locus_tag LOCUS_30830 61543 60140 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_30830 64657 61676 gene locus_tag LOCUS_30840 64657 61676 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_30840 67290 65155 gene locus_tag LOCUS_30850 67290 65155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 67999 68409 gene locus_tag LOCUS_30860 67999 68409 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383325.1 protein_id gnl|my_center|LOCUS_30860 68557 71079 gene locus_tag LOCUS_30870 68557 71079 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918074.1 protein_id gnl|my_center|LOCUS_30870 71080 71940 gene locus_tag LOCUS_30880 71080 71940 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE5 protein_id gnl|my_center|LOCUS_30880 72081 72584 gene locus_tag LOCUS_30890 72081 72584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285028.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence22 1036 848 gene locus_tag LOCUS_30900 1036 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1078 1467 gene locus_tag LOCUS_30910 1078 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 protein_id gnl|my_center|LOCUS_30910 2582 1518 gene locus_tag LOCUS_30920 2582 1518 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_30920 2649 3191 gene locus_tag LOCUS_30930 2649 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 3193 3855 gene locus_tag LOCUS_30940 3193 3855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_30940 4308 5240 gene locus_tag LOCUS_30950 4308 5240 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_30950 5381 5971 gene locus_tag LOCUS_30960 gene grpE 5381 5971 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 protein_id gnl|my_center|LOCUS_30960 5981 7087 gene locus_tag LOCUS_30970 gene dnaJ 5981 7087 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_30970 7584 8519 gene locus_tag LOCUS_30980 gene natA 7584 8519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_30980 8512 9843 gene locus_tag LOCUS_30990 gene natB 8512 9843 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_30990 10025 10837 gene locus_tag LOCUS_31000 10025 10837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 11034 12197 gene locus_tag LOCUS_31010 11034 12197 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_31010 12892 12209 gene locus_tag LOCUS_31020 12892 12209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 13129 14013 gene locus_tag LOCUS_31030 13129 14013 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962727.1 protein_id gnl|my_center|LOCUS_31030 14010 15407 gene locus_tag LOCUS_31040 14010 15407 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_31040 15605 16546 gene locus_tag LOCUS_31050 gene ppiC 15605 16546 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_31050 17223 17032 gene locus_tag LOCUS_31060 17223 17032 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_31060 18644 17679 gene locus_tag LOCUS_31070 18644 17679 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HZL8 protein_id gnl|my_center|LOCUS_31070 19526 18660 gene locus_tag LOCUS_31080 19526 18660 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9L4R7 protein_id gnl|my_center|LOCUS_31080 20566 19928 gene locus_tag LOCUS_31090 20566 19928 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207606.1 protein_id gnl|my_center|LOCUS_31090 20907 21449 gene locus_tag LOCUS_31100 gene yfiT 20907 21449 CDS product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 protein_id gnl|my_center|LOCUS_31100 22014 21460 gene locus_tag LOCUS_31110 22014 21460 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_31110 22258 22569 gene locus_tag LOCUS_31120 22258 22569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 22566 22901 gene locus_tag LOCUS_31130 gene csaA 22566 22901 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962694.1 protein_id gnl|my_center|LOCUS_31130 25470 22957 gene locus_tag LOCUS_31140 25470 22957 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404296.1 protein_id gnl|my_center|LOCUS_31140 25946 25569 gene locus_tag LOCUS_31150 25946 25569 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_31150 27769 26012 gene locus_tag LOCUS_31160 27769 26012 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_31160 27948 28895 gene locus_tag LOCUS_31170 gene nusB 27948 28895 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_31170 28943 29413 gene locus_tag LOCUS_31180 28943 29413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 protein_id gnl|my_center|LOCUS_31180 29431 29724 gene locus_tag LOCUS_31190 gene yajC 29431 29724 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_31190 29984 31336 gene locus_tag LOCUS_31200 29984 31336 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_31200 31923 31333 gene locus_tag LOCUS_31210 31923 31333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 33154 31925 gene locus_tag LOCUS_31220 gene pepT 33154 31925 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W1 protein_id gnl|my_center|LOCUS_31220 33439 33861 gene locus_tag LOCUS_31230 33439 33861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 33945 34982 gene locus_tag LOCUS_31240 gene pyrD 33945 34982 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_31240 35604 35179 gene locus_tag LOCUS_31250 35604 35179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 35680 36312 gene locus_tag LOCUS_31260 35680 36312 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_31260 36320 37207 gene locus_tag LOCUS_31270 gene mvaB 36320 37207 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_31270 37349 38821 gene locus_tag LOCUS_31280 gene guaB 37349 38821 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_31280 39752 40603 gene locus_tag LOCUS_31290 39752 40603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 40600 41430 gene locus_tag LOCUS_31300 40600 41430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 41427 42086 gene locus_tag LOCUS_31310 41427 42086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 43052 42522 gene locus_tag LOCUS_31320 43052 42522 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_31320 44355 43114 gene locus_tag LOCUS_31330 gene lysA 44355 43114 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFI0 protein_id gnl|my_center|LOCUS_31330 44567 45157 gene locus_tag LOCUS_31340 44567 45157 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_31340 45237 46430 gene locus_tag LOCUS_31350 gene sucC 45237 46430 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_31350 46840 47181 gene locus_tag LOCUS_31360 46840 47181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 47590 47216 gene locus_tag LOCUS_31370 47590 47216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963057.1 protein_id gnl|my_center|LOCUS_31370 47858 48259 gene locus_tag LOCUS_31380 47858 48259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963055.1 protein_id gnl|my_center|LOCUS_31380 48384 48809 gene locus_tag LOCUS_31390 48384 48809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 49313 49501 gene locus_tag LOCUS_31400 49313 49501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 51989 50001 gene locus_tag LOCUS_31410 gene uvrB 51989 50001 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_31410 52929 52096 gene locus_tag LOCUS_31420 52929 52096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_31420 53857 52940 gene locus_tag LOCUS_31430 53857 52940 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963771.1 protein_id gnl|my_center|LOCUS_31430 53947 55026 gene locus_tag LOCUS_31440 53947 55026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 56149 55091 gene locus_tag LOCUS_31450 56149 55091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 protein_id gnl|my_center|LOCUS_31450 56710 56219 gene locus_tag LOCUS_31460 56710 56219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_31460 57769 56735 gene locus_tag LOCUS_31470 57769 56735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 59314 57875 gene locus_tag LOCUS_31480 gene cca 59314 57875 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_31480 59871 59311 gene locus_tag LOCUS_31490 59871 59311 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_31490 60689 59868 gene locus_tag LOCUS_31500 60689 59868 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795870.1 protein_id gnl|my_center|LOCUS_31500 61000 61821 gene locus_tag LOCUS_31510 61000 61821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 62594 61800 gene locus_tag LOCUS_31520 62594 61800 CDS product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038826.1 protein_id gnl|my_center|LOCUS_31520 63506 62691 gene locus_tag LOCUS_31530 gene dapD 63506 62691 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_31530 63580 64023 gene locus_tag LOCUS_31540 63580 64023 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_31540 64025 64615 gene locus_tag LOCUS_31550 gene def 64025 64615 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_31550 64670 65095 gene locus_tag LOCUS_31560 64670 65095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 66910 65279 gene locus_tag LOCUS_31570 66910 65279 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228450.1 protein_id gnl|my_center|LOCUS_31570 67581 66937 gene locus_tag LOCUS_31580 67581 66937 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201970.1 protein_id gnl|my_center|LOCUS_31580 68597 67731 gene locus_tag LOCUS_31590 68597 67731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 69461 68619 gene locus_tag LOCUS_31600 69461 68619 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203698.1 protein_id gnl|my_center|LOCUS_31600 70201 69527 gene locus_tag LOCUS_31610 gene rpiA 70201 69527 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y8D3 protein_id gnl|my_center|LOCUS_31610 72012 70234 gene locus_tag LOCUS_31620 72012 70234 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001161615.1 protein_id gnl|my_center|LOCUS_31620 72136 72909 gene locus_tag LOCUS_31630 72136 72909 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence23 5280 4795 gene locus_tag LOCUS_31640 5280 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 6463 5843 gene locus_tag LOCUS_31650 6463 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 6681 7769 gene locus_tag LOCUS_31660 6681 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 7766 9100 gene locus_tag LOCUS_31670 7766 9100 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545725.1 protein_id gnl|my_center|LOCUS_31670 9361 9726 gene locus_tag LOCUS_31680 9361 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 10197 11489 gene locus_tag LOCUS_31690 10197 11489 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEM0 protein_id gnl|my_center|LOCUS_31690 11647 12066 gene locus_tag LOCUS_31700 11647 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 12283 12122 gene locus_tag LOCUS_31710 12283 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 12242 12952 gene locus_tag LOCUS_31720 12242 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 14016 13000 gene locus_tag LOCUS_31730 gene yvbT 14016 13000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32254 protein_id gnl|my_center|LOCUS_31730 15425 14265 gene locus_tag LOCUS_31740 15425 14265 CDS product glucuronyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767198.1 protein_id gnl|my_center|LOCUS_31740 15835 15491 gene locus_tag LOCUS_31750 15835 15491 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108621.1 protein_id gnl|my_center|LOCUS_31750 18189 15970 gene locus_tag LOCUS_31760 gene metE 18189 15970 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AMV8 protein_id gnl|my_center|LOCUS_31760 18307 18101 gene locus_tag LOCUS_31770 18307 18101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 18439 18900 gene locus_tag LOCUS_31780 18439 18900 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 protein_id gnl|my_center|LOCUS_31780 20782 18968 gene locus_tag LOCUS_31790 20782 18968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 22028 21207 gene locus_tag LOCUS_31800 22028 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 24790 22097 gene locus_tag LOCUS_31810 24790 22097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 25330 26379 gene locus_tag LOCUS_31820 gene degA 25330 26379 CDS product HTH-type transcriptional regulator DegA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37947 protein_id gnl|my_center|LOCUS_31820 27987 26374 gene locus_tag LOCUS_31830 gene uxaA 27987 26374 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34673 protein_id gnl|my_center|LOCUS_31830 29442 27994 gene locus_tag LOCUS_31840 gene uxaB 29442 27994 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_31840 30759 29464 gene locus_tag LOCUS_31850 30759 29464 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 protein_id gnl|my_center|LOCUS_31850 31227 30769 gene locus_tag LOCUS_31860 31227 30769 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_31860 32210 31230 gene locus_tag LOCUS_31870 32210 31230 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_31870 32885 32211 gene locus_tag LOCUS_31880 32885 32211 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 protein_id gnl|my_center|LOCUS_31880 33928 32897 gene locus_tag LOCUS_31890 33928 32897 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_31890 35351 33942 gene locus_tag LOCUS_31900 gene uxaC 35351 33942 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_31900 36231 35443 gene locus_tag LOCUS_31910 36231 35443 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_31910 37072 36236 gene locus_tag LOCUS_31920 gene kduI 37072 36236 CDS product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650K4 protein_id gnl|my_center|LOCUS_31920 39176 38484 gene locus_tag LOCUS_31930 39176 38484 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_31930 39471 41018 gene locus_tag LOCUS_31940 gene abf2 39471 41018 CDS product intracellular exo-alpha-L-arabinofuranosidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94552 protein_id gnl|my_center|LOCUS_31940 41064 43055 gene locus_tag LOCUS_31950 41064 43055 CDS product alpha-L-arabinofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107222.1 protein_id gnl|my_center|LOCUS_31950 43146 44849 gene locus_tag LOCUS_31960 gene araB 43146 44849 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EEY8 protein_id gnl|my_center|LOCUS_31960 44833 45534 gene locus_tag LOCUS_31970 44833 45534 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262722.1 protein_id gnl|my_center|LOCUS_31970 45506 47065 gene locus_tag LOCUS_31980 gene araA 45506 47065 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JMB6 protein_id gnl|my_center|LOCUS_31980 47125 48318 gene locus_tag LOCUS_31990 gene galM 47125 48318 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UQ38 protein_id gnl|my_center|LOCUS_31990 48323 49942 gene locus_tag LOCUS_32000 48323 49942 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_32000 50965 52254 gene locus_tag LOCUS_32010 50965 52254 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919442.1 protein_id gnl|my_center|LOCUS_32010 53580 52336 gene locus_tag LOCUS_32020 gene dadA 53580 52336 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_32020 54603 53602 gene locus_tag LOCUS_32030 54603 53602 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_32030 56169 54607 gene locus_tag LOCUS_32040 gene aldH 56169 54607 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_32040 57103 56189 gene locus_tag LOCUS_32050 57103 56189 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_32050 57942 57289 gene locus_tag LOCUS_32060 gene upp 57942 57289 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964558.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence24 1182 346 gene locus_tag LOCUS_32070 1182 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 2159 1281 gene locus_tag LOCUS_32080 2159 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 2791 3444 gene locus_tag LOCUS_32090 2791 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 3985 3536 gene locus_tag LOCUS_32100 3985 3536 CDS product activator of HSP90 ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704236.1 protein_id gnl|my_center|LOCUS_32100 4429 4052 gene locus_tag LOCUS_32110 4429 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 5169 6167 gene locus_tag LOCUS_32120 5169 6167 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_32120 6230 6703 gene locus_tag LOCUS_32130 6230 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 6833 7663 gene locus_tag LOCUS_32140 6833 7663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 8570 7701 gene locus_tag LOCUS_32150 8570 7701 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141281.1 protein_id gnl|my_center|LOCUS_32150 8742 9617 gene locus_tag LOCUS_32160 gene yusT 8742 9617 CDS product putative HTH-type transcriptional regulator YusT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32186 protein_id gnl|my_center|LOCUS_32160 10057 10461 gene locus_tag LOCUS_32170 10057 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 10536 11396 gene locus_tag LOCUS_32180 10536 11396 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107892.1 protein_id gnl|my_center|LOCUS_32180 11512 14865 gene locus_tag LOCUS_32190 11512 14865 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766148.1 protein_id gnl|my_center|LOCUS_32190 14947 16521 gene locus_tag LOCUS_32200 14947 16521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403146.1 protein_id gnl|my_center|LOCUS_32200 16629 17798 gene locus_tag LOCUS_32210 gene uxuA 16629 17798 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E0M8 protein_id gnl|my_center|LOCUS_32210 17871 18770 gene locus_tag LOCUS_32220 17871 18770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 19054 21306 gene locus_tag LOCUS_32230 19054 21306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 21379 22491 gene locus_tag LOCUS_32240 21379 22491 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486810.1 protein_id gnl|my_center|LOCUS_32240 22525 22995 gene locus_tag LOCUS_32250 22525 22995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 23009 24013 gene locus_tag LOCUS_32260 23009 24013 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_32260 24018 24683 gene locus_tag LOCUS_32270 24018 24683 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_32270 25557 25039 gene locus_tag LOCUS_32280 25557 25039 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_32280 26007 27590 gene locus_tag LOCUS_32290 26007 27590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 27871 30996 gene locus_tag LOCUS_32300 27871 30996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_32300 31092 32237 gene locus_tag LOCUS_32310 31092 32237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32310 32424 35927 gene locus_tag LOCUS_32320 32424 35927 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_32320 35946 37367 gene locus_tag LOCUS_32330 35946 37367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_32330 37705 40092 gene locus_tag LOCUS_32340 37705 40092 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_32340 40098 41600 gene locus_tag LOCUS_32350 40098 41600 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_32350 41621 43126 gene locus_tag LOCUS_32360 41621 43126 CDS product carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403159.1 protein_id gnl|my_center|LOCUS_32360 43208 44806 gene locus_tag LOCUS_32370 43208 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 44947 46206 gene locus_tag LOCUS_32380 gene putA 44947 46206 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_32380 47128 46232 gene locus_tag LOCUS_32390 47128 46232 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764893.1 protein_id gnl|my_center|LOCUS_32390 48189 47185 gene locus_tag LOCUS_32400 48189 47185 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140840.1 protein_id gnl|my_center|LOCUS_32400 49822 48341 gene locus_tag LOCUS_32410 49822 48341 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 protein_id gnl|my_center|LOCUS_32410 51020 50139 gene locus_tag LOCUS_32420 gene ydbC 51020 50139 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000097798.1 protein_id gnl|my_center|LOCUS_32420 51721 51110 gene locus_tag LOCUS_32430 51721 51110 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454679.1 protein_id gnl|my_center|LOCUS_32430 51861 52790 gene locus_tag LOCUS_32440 51861 52790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932762.1 protein_id gnl|my_center|LOCUS_32440 52821 53741 gene locus_tag LOCUS_32450 52821 53741 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_32450 54385 53831 gene locus_tag LOCUS_32460 gene ywrO 54385 53831 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207877.1 protein_id gnl|my_center|LOCUS_32460 54464 54841 gene locus_tag LOCUS_32470 gene yybR 54464 54841 CDS product putative HTH-type transcriptional regulator YybR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37486 protein_id gnl|my_center|LOCUS_32470 55151 57214 gene locus_tag LOCUS_32480 gene ppk 55151 57214 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS12 protein_id gnl|my_center|LOCUS_32480 57705 57232 gene locus_tag LOCUS_32490 57705 57232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 >Feature sequence25 2003 366 gene locus_tag LOCUS_32500 2003 366 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962719.1 protein_id gnl|my_center|LOCUS_32500 2205 3104 gene locus_tag LOCUS_32510 2205 3104 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709054.1 protein_id gnl|my_center|LOCUS_32510 4423 3119 gene locus_tag LOCUS_32520 gene rimO 4423 3119 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_32520 4514 5632 gene locus_tag LOCUS_32530 4514 5632 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_32530 6752 5790 gene locus_tag LOCUS_32540 gene ftsY 6752 5790 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_32540 7182 7000 gene locus_tag LOCUS_32550 gene rpmG 7182 7000 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_32550 7440 7204 gene locus_tag LOCUS_32560 gene rpmB 7440 7204 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_32560 8761 7514 gene locus_tag LOCUS_32570 8761 7514 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_32570 9099 8761 gene locus_tag LOCUS_32580 9099 8761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 9710 9099 gene locus_tag LOCUS_32590 9710 9099 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_32590 10637 9864 gene locus_tag LOCUS_32600 10637 9864 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_32600 12064 10718 gene locus_tag LOCUS_32610 gene bfmBB 12064 10718 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_32610 12782 12162 gene locus_tag LOCUS_32620 gene recR 12782 12162 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_32620 12848 14308 gene locus_tag LOCUS_32630 12848 14308 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_32630 14671 14312 gene locus_tag LOCUS_32640 14671 14312 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_32640 15056 17506 gene locus_tag LOCUS_32650 15056 17506 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_32650 18604 17594 gene locus_tag LOCUS_32660 gene fabH2 18604 17594 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_32660 20270 18876 gene locus_tag LOCUS_32670 20270 18876 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 protein_id gnl|my_center|LOCUS_32670 20895 20236 gene locus_tag LOCUS_32680 20895 20236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_32680 21278 23164 gene locus_tag LOCUS_32690 gene htpG 21278 23164 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_32690 23370 23693 gene locus_tag LOCUS_32700 23370 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001281604.1 protein_id gnl|my_center|LOCUS_32700 24115 23696 gene locus_tag LOCUS_32710 24115 23696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 24710 24102 gene locus_tag LOCUS_32720 24710 24102 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_32720 24824 25180 gene locus_tag LOCUS_32730 24824 25180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 25370 26002 gene locus_tag LOCUS_32740 25370 26002 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141283.1 protein_id gnl|my_center|LOCUS_32740 26670 26143 gene locus_tag LOCUS_32750 26670 26143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 26669 26839 gene locus_tag LOCUS_32760 26669 26839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 26943 27815 gene locus_tag LOCUS_32770 26943 27815 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_32770 27815 28414 gene locus_tag LOCUS_32780 27815 28414 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_32780 29393 28533 gene locus_tag LOCUS_32790 29393 28533 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702575.1 protein_id gnl|my_center|LOCUS_32790 29500 31764 gene locus_tag LOCUS_32800 gene mrcA 29500 31764 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_32800 31920 32783 gene locus_tag LOCUS_32810 31920 32783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_32810 32788 33294 gene locus_tag LOCUS_32820 32788 33294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 33396 34265 gene locus_tag LOCUS_32830 33396 34265 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682158.1 protein_id gnl|my_center|LOCUS_32830 34258 34431 gene locus_tag LOCUS_32840 34258 34431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 34532 35335 gene locus_tag LOCUS_32850 34532 35335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 protein_id gnl|my_center|LOCUS_32850 35367 36629 gene locus_tag LOCUS_32860 35367 36629 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_32860 36770 37480 gene locus_tag LOCUS_32870 36770 37480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_32870 37859 37587 gene locus_tag LOCUS_32880 37859 37587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 protein_id gnl|my_center|LOCUS_32880 38949 37981 gene locus_tag LOCUS_32890 gene manA 38949 37981 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_32890 39619 39209 gene locus_tag LOCUS_32900 gene ygcM 39619 39209 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_32900 40149 39616 gene locus_tag LOCUS_32910 gene idi 40149 39616 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_32910 41301 40342 gene locus_tag LOCUS_32920 41301 40342 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_32920 43336 41312 gene locus_tag LOCUS_32930 43336 41312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 44016 43366 gene locus_tag LOCUS_32940 44016 43366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 44216 44079 gene locus_tag LOCUS_32950 44216 44079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 >Feature sequence26 1760 1686 gene locus_tag LOCUS_t00310 1760 1686 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2034 1882 gene locus_tag LOCUS_32960 2034 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32960 4258 2558 gene locus_tag LOCUS_32970 4258 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 4620 4255 gene locus_tag LOCUS_32980 4620 4255 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_32980 4796 5737 gene locus_tag LOCUS_32990 gene yrbG 4796 5737 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_32990 6818 5808 gene locus_tag LOCUS_33000 gene glnII 6818 5808 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_33000 7020 9206 gene locus_tag LOCUS_33010 gene glnA 7020 9206 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_33010 9239 10468 gene locus_tag LOCUS_33020 gene purM 9239 10468 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_33020 10629 11069 gene locus_tag LOCUS_33030 10629 11069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 11280 12188 gene locus_tag LOCUS_33040 gene apbE 11280 12188 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZN4 protein_id gnl|my_center|LOCUS_33040 12368 13444 gene locus_tag LOCUS_33050 gene prfA 12368 13444 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_33050 13493 14323 gene locus_tag LOCUS_33060 gene pyrF 13493 14323 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 protein_id gnl|my_center|LOCUS_33060 14510 14316 gene locus_tag LOCUS_33070 14510 14316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 14729 15511 gene locus_tag LOCUS_33080 14729 15511 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_33080 17192 15762 gene locus_tag LOCUS_33090 17192 15762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963476.1 protein_id gnl|my_center|LOCUS_33090 20370 17197 gene locus_tag LOCUS_33100 20370 17197 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_33100 22260 20740 gene locus_tag LOCUS_33110 22260 20740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 24012 22654 gene locus_tag LOCUS_33120 24012 22654 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108256.1 protein_id gnl|my_center|LOCUS_33120 27054 24025 gene locus_tag LOCUS_33130 27054 24025 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108255.1 protein_id gnl|my_center|LOCUS_33130 28120 27413 gene locus_tag LOCUS_33140 28120 27413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_33140 29661 28294 gene locus_tag LOCUS_33150 29661 28294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 30931 30041 gene locus_tag LOCUS_33160 gene purU 30931 30041 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_33160 31032 34472 gene locus_tag LOCUS_33170 gene icmF 31032 34472 CDS product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 protein_id gnl|my_center|LOCUS_33170 34913 34476 gene locus_tag LOCUS_33180 34913 34476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 35034 35489 gene locus_tag LOCUS_33190 35034 35489 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869023.1 protein_id gnl|my_center|LOCUS_33190 35646 37058 gene locus_tag LOCUS_33200 35646 37058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 38459 37233 gene locus_tag LOCUS_33210 38459 37233 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963858.1 protein_id gnl|my_center|LOCUS_33210 38791 39438 gene locus_tag LOCUS_33220 38791 39438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_33220 40629 39493 gene locus_tag LOCUS_33230 40629 39493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 41925 40747 gene locus_tag LOCUS_33240 41925 40747 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_33240 42356 42018 gene locus_tag LOCUS_33250 42356 42018 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence27 947 1333 gene locus_tag LOCUS_33260 947 1333 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_33260 3726 1489 gene locus_tag LOCUS_33270 gene feoB 3726 1489 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_33270 3968 3723 gene locus_tag LOCUS_33280 gene feoA 3968 3723 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_33280 4731 4054 gene locus_tag LOCUS_33290 4731 4054 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_33290 4890 6245 gene locus_tag LOCUS_33300 4890 6245 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_33300 6598 6676 gene locus_tag LOCUS_t00320 6598 6676 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 7099 7566 gene locus_tag LOCUS_33310 7099 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 7826 8179 gene locus_tag LOCUS_33320 7826 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 8777 10909 gene locus_tag LOCUS_33330 8777 10909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_33330 10914 11954 gene locus_tag LOCUS_33340 10914 11954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 12053 13597 gene locus_tag LOCUS_33350 12053 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 14627 14001 gene locus_tag LOCUS_33360 14627 14001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 15508 14624 gene locus_tag LOCUS_33370 15508 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 15736 18162 gene locus_tag LOCUS_33380 gene fhuA 15736 18162 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964026.1 protein_id gnl|my_center|LOCUS_33380 18164 19462 gene locus_tag LOCUS_33390 18164 19462 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267342.1 protein_id gnl|my_center|LOCUS_33390 19616 19374 gene locus_tag LOCUS_33400 19616 19374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 21463 19910 gene locus_tag LOCUS_33410 21463 19910 CDS product microcystin degradation protein MlrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030661.1 protein_id gnl|my_center|LOCUS_33410 23984 21798 gene locus_tag LOCUS_33420 23984 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_33420 25505 24078 gene locus_tag LOCUS_33430 25505 24078 CDS product meiotically up-regulated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762491.1 protein_id gnl|my_center|LOCUS_33430 26691 25522 gene locus_tag LOCUS_33440 26691 25522 CDS product alpha-1,6-mannanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108035.1 protein_id gnl|my_center|LOCUS_33440 28026 26902 gene locus_tag LOCUS_33450 28026 26902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 29685 28057 gene locus_tag LOCUS_33460 29685 28057 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801521.1 protein_id gnl|my_center|LOCUS_33460 33087 29695 gene locus_tag LOCUS_33470 33087 29695 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658407.1 protein_id gnl|my_center|LOCUS_33470 34374 33211 gene locus_tag LOCUS_33480 34374 33211 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203444.1 protein_id gnl|my_center|LOCUS_33480 34580 35176 gene locus_tag LOCUS_33490 34580 35176 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765464.1 protein_id gnl|my_center|LOCUS_33490 36685 35237 gene locus_tag LOCUS_33500 36685 35237 CDS product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_33500 38502 36790 gene locus_tag LOCUS_33510 38502 36790 CDS product protein-xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123507.1 protein_id gnl|my_center|LOCUS_33510 40135 38486 gene locus_tag LOCUS_33520 40135 38486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 >Feature sequence28 549 845 gene locus_tag LOCUS_33530 549 845 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_33530 1010 1669 gene locus_tag LOCUS_33540 1010 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 1659 2441 gene locus_tag LOCUS_33550 1659 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 3106 2576 gene locus_tag LOCUS_33560 3106 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 4210 3335 gene locus_tag LOCUS_33570 4210 3335 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974995.1 protein_id gnl|my_center|LOCUS_33570 5170 4727 gene locus_tag LOCUS_33580 5170 4727 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642733.1 protein_id gnl|my_center|LOCUS_33580 6161 5511 gene locus_tag LOCUS_33590 6161 5511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33590 6410 6168 gene locus_tag LOCUS_33600 6410 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 6764 9922 gene locus_tag LOCUS_33610 6764 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 10343 11563 gene locus_tag LOCUS_33620 10343 11563 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919381.1 protein_id gnl|my_center|LOCUS_33620 12299 11592 gene locus_tag LOCUS_33630 12299 11592 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107796.1 protein_id gnl|my_center|LOCUS_33630 13345 12296 gene locus_tag LOCUS_33640 13345 12296 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_33640 13693 14493 gene locus_tag LOCUS_33650 13693 14493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 16113 14587 gene locus_tag LOCUS_33660 16113 14587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120384.1 protein_id gnl|my_center|LOCUS_33660 17546 16179 gene locus_tag LOCUS_33670 17546 16179 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119292.1 protein_id gnl|my_center|LOCUS_33670 18190 17633 gene locus_tag LOCUS_33680 18190 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919508.1 protein_id gnl|my_center|LOCUS_33680 19935 18229 gene locus_tag LOCUS_33690 19935 18229 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_33690 20620 23745 gene locus_tag LOCUS_33700 20620 23745 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783448.1 protein_id gnl|my_center|LOCUS_33700 23749 25476 gene locus_tag LOCUS_33710 23749 25476 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_33710 25681 29028 gene locus_tag LOCUS_33720 25681 29028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 30609 29107 gene locus_tag LOCUS_33730 30609 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 30927 33131 gene locus_tag LOCUS_33740 30927 33131 CDS product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 protein_id gnl|my_center|LOCUS_33740 35604 33430 gene locus_tag LOCUS_33750 35604 33430 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706200.1 protein_id gnl|my_center|LOCUS_33750 36621 35635 gene locus_tag LOCUS_33760 36621 35635 CDS product FAD-binding molybdopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105102.1 protein_id gnl|my_center|LOCUS_33760 37455 36655 gene locus_tag LOCUS_33770 37455 36655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence29 115 42 gene locus_tag LOCUS_t00330 115 42 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 236 1603 gene locus_tag LOCUS_33780 236 1603 CDS product sodium:alanine symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_33780 1590 2471 gene locus_tag LOCUS_33790 gene era 1590 2471 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 protein_id gnl|my_center|LOCUS_33790 2594 3901 gene locus_tag LOCUS_33800 gene der 2594 3901 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 protein_id gnl|my_center|LOCUS_33800 4153 6837 gene locus_tag LOCUS_33810 4153 6837 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_33810 7768 6962 gene locus_tag LOCUS_33820 7768 6962 CDS product methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 protein_id gnl|my_center|LOCUS_33820 8186 7749 gene locus_tag LOCUS_33830 8186 7749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_33830 8803 8204 gene locus_tag LOCUS_33840 8803 8204 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964048.1 protein_id gnl|my_center|LOCUS_33840 9157 8828 gene locus_tag LOCUS_33850 9157 8828 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_33850 10136 9159 gene locus_tag LOCUS_33860 10136 9159 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_33860 10240 12855 gene locus_tag LOCUS_33870 gene alaS 10240 12855 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_33870 12881 13855 gene locus_tag LOCUS_33880 12881 13855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_33880 13934 14560 gene locus_tag LOCUS_33890 13934 14560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964057.1 protein_id gnl|my_center|LOCUS_33890 16285 14534 gene locus_tag LOCUS_33900 gene phhA 16285 14534 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_33900 16918 16361 gene locus_tag LOCUS_33910 16918 16361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964059.1 protein_id gnl|my_center|LOCUS_33910 17344 17673 gene locus_tag LOCUS_33920 17344 17673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964062.1 protein_id gnl|my_center|LOCUS_33920 17664 18590 gene locus_tag LOCUS_33930 gene acdS 17664 18590 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 protein_id gnl|my_center|LOCUS_33930 18587 19435 gene locus_tag LOCUS_33940 18587 19435 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_33940 19440 20729 gene locus_tag LOCUS_33950 gene hemL 19440 20729 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_33950 21246 20797 gene locus_tag LOCUS_33960 21246 20797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 21850 21551 gene locus_tag LOCUS_33970 21850 21551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 24512 22068 gene locus_tag LOCUS_33980 24512 22068 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_33980 26281 24851 gene locus_tag LOCUS_33990 26281 24851 CDS product di- and tricarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_599478.1 protein_id gnl|my_center|LOCUS_33990 28070 26379 gene locus_tag LOCUS_34000 gene lysS 28070 26379 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_34000 28528 29247 gene locus_tag LOCUS_34010 gene lipB 28528 29247 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_34010 29428 31395 gene locus_tag LOCUS_34020 29428 31395 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963992.1 protein_id gnl|my_center|LOCUS_34020 32206 31517 gene locus_tag LOCUS_34030 32206 31517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 34775 32313 gene locus_tag LOCUS_34040 34775 32313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 35394 34804 gene locus_tag LOCUS_34050 gene rnhB 35394 34804 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN7 protein_id gnl|my_center|LOCUS_34050 35670 37664 gene locus_tag LOCUS_34060 35670 37664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_34060 >Feature sequence30 1701 97 gene locus_tag LOCUS_34070 1701 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_34070 4607 1713 gene locus_tag LOCUS_34080 4607 1713 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_34080 5387 7633 gene locus_tag LOCUS_34090 5387 7633 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084771.1 protein_id gnl|my_center|LOCUS_34090 7724 10804 gene locus_tag LOCUS_34100 7724 10804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 10841 13531 gene locus_tag LOCUS_34110 10841 13531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 13660 14124 gene locus_tag LOCUS_34120 13660 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34120 14561 14214 gene locus_tag LOCUS_34130 14561 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 15914 14925 gene locus_tag LOCUS_34140 15914 14925 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016754.1 protein_id gnl|my_center|LOCUS_34140 16416 16045 gene locus_tag LOCUS_34150 16416 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 17000 16413 gene locus_tag LOCUS_34160 gene azoR 17000 16413 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IVU8 protein_id gnl|my_center|LOCUS_34160 17872 17048 gene locus_tag LOCUS_34170 gene rpoE 17872 17048 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228190.1 protein_id gnl|my_center|LOCUS_34170 19044 18544 gene locus_tag LOCUS_34180 19044 18544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117698.1 protein_id gnl|my_center|LOCUS_34180 19934 19170 gene locus_tag LOCUS_34190 gene mapB 19934 19170 CDS product methionine aminopeptidase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34484 protein_id gnl|my_center|LOCUS_34190 20803 20201 gene locus_tag LOCUS_34200 20803 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 21634 21230 gene locus_tag LOCUS_34210 21634 21230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 22873 21668 gene locus_tag LOCUS_34220 22873 21668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 24050 23052 gene locus_tag LOCUS_34230 24050 23052 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973989.1 protein_id gnl|my_center|LOCUS_34230 24720 24160 gene locus_tag LOCUS_34240 24720 24160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 24869 25057 gene locus_tag LOCUS_34250 24869 25057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 26055 25300 gene locus_tag LOCUS_34260 26055 25300 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268503.1 protein_id gnl|my_center|LOCUS_34260 26161 26529 gene locus_tag LOCUS_34270 26161 26529 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476381.1 protein_id gnl|my_center|LOCUS_34270 27800 26985 gene locus_tag LOCUS_34280 27800 26985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 29148 28111 gene locus_tag LOCUS_34290 29148 28111 CDS product cytochrome D ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_34290 30452 29151 gene locus_tag LOCUS_34300 30452 29151 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730651.1 protein_id gnl|my_center|LOCUS_34300 >Feature sequence31 212 397 gene locus_tag LOCUS_34310 212 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 3277 845 gene locus_tag LOCUS_34320 3277 845 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958551.1 protein_id gnl|my_center|LOCUS_34320 4139 3369 gene locus_tag LOCUS_34330 4139 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 5620 4487 gene locus_tag LOCUS_34340 5620 4487 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_34340 9951 5617 gene locus_tag LOCUS_34350 9951 5617 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963036.1 protein_id gnl|my_center|LOCUS_34350 10599 10201 gene locus_tag LOCUS_34360 10599 10201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 11087 12157 gene locus_tag LOCUS_34370 11087 12157 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_34370 12166 15255 gene locus_tag LOCUS_34380 12166 15255 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764017.1 protein_id gnl|my_center|LOCUS_34380 15278 16555 gene locus_tag LOCUS_34390 15278 16555 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_34390 17586 16681 gene locus_tag LOCUS_34400 17586 16681 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_34400 17996 17643 gene locus_tag LOCUS_34410 17996 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 19317 18019 gene locus_tag LOCUS_34420 19317 18019 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919685.1 protein_id gnl|my_center|LOCUS_34420 19766 19332 gene locus_tag LOCUS_34430 19766 19332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 20562 19768 gene locus_tag LOCUS_34440 20562 19768 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103613.1 protein_id gnl|my_center|LOCUS_34440 23012 20580 gene locus_tag LOCUS_34450 23012 20580 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_34450 24552 23524 gene locus_tag LOCUS_34460 24552 23524 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404739.1 protein_id gnl|my_center|LOCUS_34460 24873 24562 gene locus_tag LOCUS_34470 24873 24562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_34470 26217 24877 gene locus_tag LOCUS_34480 26217 24877 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_34480 27527 26226 gene locus_tag LOCUS_34490 27527 26226 CDS product citrate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267876.1 protein_id gnl|my_center|LOCUS_34490 29152 27524 gene locus_tag LOCUS_34500 29152 27524 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89N41 protein_id gnl|my_center|LOCUS_34500 >Feature sequence32 <1 1962 gene locus_tag LOCUS_34510 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000791146.1:peptidase M4 1988 2875 gene locus_tag LOCUS_34520 1988 2875 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_34520 3172 4674 gene locus_tag LOCUS_34530 3172 4674 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001070148.1 protein_id gnl|my_center|LOCUS_34530 4890 5300 gene locus_tag LOCUS_34540 4890 5300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 5823 6299 gene locus_tag LOCUS_34550 5823 6299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 6389 6673 gene locus_tag LOCUS_34560 6389 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 9624 6769 gene locus_tag LOCUS_34570 9624 6769 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_34570 11141 9726 gene locus_tag LOCUS_34580 11141 9726 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760507.1 protein_id gnl|my_center|LOCUS_34580 14146 11153 gene locus_tag LOCUS_34590 14146 11153 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 protein_id gnl|my_center|LOCUS_34590 14825 15082 gene locus_tag LOCUS_34600 14825 15082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 15538 16509 gene locus_tag LOCUS_34610 15538 16509 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F5D8 protein_id gnl|my_center|LOCUS_34610 16506 17252 gene locus_tag LOCUS_34620 16506 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 17700 20933 gene locus_tag LOCUS_34630 17700 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 21164 21463 gene locus_tag LOCUS_34640 21164 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 21669 22142 gene locus_tag LOCUS_34650 21669 22142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 22235 23383 gene locus_tag LOCUS_34660 22235 23383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 23481 23873 gene locus_tag LOCUS_34670 23481 23873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 24762 24586 gene locus_tag LOCUS_34680 24762 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence33 500 2440 gene locus_tag LOCUS_34690 gene thrS 500 2440 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_34690 2559 3026 gene locus_tag LOCUS_34700 gene infC 2559 3026 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_34700 3109 3306 gene locus_tag LOCUS_34710 gene rpmI 3109 3306 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_34710 3455 3748 gene locus_tag LOCUS_34720 gene rplT 3455 3748 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_34720 4230 3808 gene locus_tag LOCUS_34730 4230 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119621.1 protein_id gnl|my_center|LOCUS_34730 4351 5154 gene locus_tag LOCUS_34740 4351 5154 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464970.1 protein_id gnl|my_center|LOCUS_34740 6652 5339 gene locus_tag LOCUS_34750 6652 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_34750 8177 6630 gene locus_tag LOCUS_34760 gene dnaB 8177 6630 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_34760 9298 8345 gene locus_tag LOCUS_34770 gene accA 9298 8345 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_34770 10251 9355 gene locus_tag LOCUS_34780 10251 9355 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_34780 11320 10238 gene locus_tag LOCUS_34790 11320 10238 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_34790 12522 11320 gene locus_tag LOCUS_34800 gene tgt 12522 11320 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_34800 12614 13459 gene locus_tag LOCUS_34810 gene tktA 12614 13459 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 protein_id gnl|my_center|LOCUS_34810 13517 14473 gene locus_tag LOCUS_34820 gene tktC 13517 14473 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_34820 14526 15098 gene locus_tag LOCUS_34830 14526 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 16037 15183 gene locus_tag LOCUS_34840 16037 15183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 16215 16607 gene locus_tag LOCUS_34850 16215 16607 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_34850 16617 17234 gene locus_tag LOCUS_34860 gene tpm 16617 17234 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 protein_id gnl|my_center|LOCUS_34860 17297 17794 gene locus_tag LOCUS_34870 gene pyrR2 17297 17794 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_34870 18301 17786 gene locus_tag LOCUS_34880 gene aroK 18301 17786 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 protein_id gnl|my_center|LOCUS_34880 18440 18513 gene locus_tag LOCUS_t00340 18440 18513 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 19211 18855 gene locus_tag LOCUS_34890 19211 18855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 20381 19368 gene locus_tag LOCUS_34900 20381 19368 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence34 805 122 gene locus_tag LOCUS_34910 805 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 2839 815 gene locus_tag LOCUS_34920 2839 815 CDS product folate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141367.1 protein_id gnl|my_center|LOCUS_34920 3130 3765 gene locus_tag LOCUS_34930 gene msrA 3130 3765 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_34930 3810 4553 gene locus_tag LOCUS_34940 3810 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 5987 4545 gene locus_tag LOCUS_34950 5987 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 6540 5959 gene locus_tag LOCUS_34960 6540 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 7072 6524 gene locus_tag LOCUS_34970 7072 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 7278 8180 gene locus_tag LOCUS_34980 7278 8180 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDP4 protein_id gnl|my_center|LOCUS_34980 8675 8247 gene locus_tag LOCUS_34990 gene ohrB 8675 8247 CDS product organic hydroperoxide resistance protein OhrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80242 protein_id gnl|my_center|LOCUS_34990 8912 10003 gene locus_tag LOCUS_35000 gene argK 8912 10003 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962733.1 protein_id gnl|my_center|LOCUS_35000 10041 10991 gene locus_tag LOCUS_35010 10041 10991 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_35010 10981 11853 gene locus_tag LOCUS_35020 10981 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932053.1 protein_id gnl|my_center|LOCUS_35020 13548 11884 gene locus_tag LOCUS_35030 13548 11884 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_35030 14125 13538 gene locus_tag LOCUS_35040 14125 13538 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_35040 14342 14115 gene locus_tag LOCUS_35050 14342 14115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 protein_id gnl|my_center|LOCUS_35050 15788 14352 gene locus_tag LOCUS_35060 gene norM 15788 14352 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 protein_id gnl|my_center|LOCUS_35060 15955 18483 gene locus_tag LOCUS_35070 15955 18483 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086596.1 protein_id gnl|my_center|LOCUS_35070 >Feature sequence35 1580 225 gene locus_tag LOCUS_35080 1580 225 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941467.1 protein_id gnl|my_center|LOCUS_35080 2737 1718 gene locus_tag LOCUS_35090 2737 1718 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975961.1 protein_id gnl|my_center|LOCUS_35090 3074 2760 gene locus_tag LOCUS_35100 3074 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 4622 3204 gene locus_tag LOCUS_35110 4622 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140823.1 protein_id gnl|my_center|LOCUS_35110 5158 4784 gene locus_tag LOCUS_35120 5158 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 5586 5176 gene locus_tag LOCUS_35130 gene osmC 5586 5176 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_35130 6404 5634 gene locus_tag LOCUS_35140 6404 5634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 8474 6651 gene locus_tag LOCUS_35150 8474 6651 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009879790.1 protein_id gnl|my_center|LOCUS_35150 9346 8474 gene locus_tag LOCUS_35160 9346 8474 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705015.1 protein_id gnl|my_center|LOCUS_35160 9718 9353 gene locus_tag LOCUS_35170 9718 9353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 10435 9779 gene locus_tag LOCUS_35180 10435 9779 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031861.1 protein_id gnl|my_center|LOCUS_35180 10662 12785 gene locus_tag LOCUS_35190 10662 12785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35190 12955 15078 gene locus_tag LOCUS_35200 12955 15078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 15624 15235 gene locus_tag LOCUS_35210 15624 15235 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169716.1 protein_id gnl|my_center|LOCUS_35210 15989 16294 gene locus_tag LOCUS_35220 gene arsR 15989 16294 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226731.1 protein_id gnl|my_center|LOCUS_35220 16355 17329 gene locus_tag LOCUS_35230 16355 17329 CDS product NADPH:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119496.1 protein_id gnl|my_center|LOCUS_35230 17506 18441 gene locus_tag LOCUS_35240 17506 18441 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978080.1 protein_id gnl|my_center|LOCUS_35240 >Feature sequence36 1947 2954 gene locus_tag LOCUS_35250 1947 2954 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_35250 2980 4434 gene locus_tag LOCUS_35260 gene crtI 2980 4434 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_35260 4448 5290 gene locus_tag LOCUS_35270 gene crtB 4448 5290 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_35270 5287 5760 gene locus_tag LOCUS_35280 gene crtZ 5287 5760 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_35280 6403 5843 gene locus_tag LOCUS_35290 gene yneN 6403 5843 CDS product thioredoxin-like protein YneN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31820 protein_id gnl|my_center|LOCUS_35290 6968 6408 gene locus_tag LOCUS_35300 6968 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 9465 7198 gene locus_tag LOCUS_35310 gene acnA 9465 7198 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_35310 10701 9748 gene locus_tag LOCUS_35320 10701 9748 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_35320 12121 10706 gene locus_tag LOCUS_35330 gene surA 12121 10706 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 protein_id gnl|my_center|LOCUS_35330 12980 12141 gene locus_tag LOCUS_35340 12980 12141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 13276 13518 gene locus_tag LOCUS_35350 13276 13518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_35350 13705 14145 gene locus_tag LOCUS_35360 13705 14145 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_35360 14233 14427 gene locus_tag LOCUS_35370 14233 14427 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_35370 >Feature sequence37 1938 439 gene locus_tag LOCUS_35380 1938 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 3150 3989 gene locus_tag LOCUS_35390 3150 3989 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 protein_id gnl|my_center|LOCUS_35390 4094 4492 gene locus_tag LOCUS_35400 4094 4492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_35400 4868 5287 gene locus_tag LOCUS_35410 gene osmC 4868 5287 CDS product peroxiredoxin OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C0L2 protein_id gnl|my_center|LOCUS_35410 5392 6444 gene locus_tag LOCUS_35420 5392 6444 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198300.1 protein_id gnl|my_center|LOCUS_35420 6576 8471 gene locus_tag LOCUS_35430 6576 8471 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918824.1 protein_id gnl|my_center|LOCUS_35430 9190 8576 gene locus_tag LOCUS_35440 9190 8576 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 protein_id gnl|my_center|LOCUS_35440 9336 9908 gene locus_tag LOCUS_35450 9336 9908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 9962 11095 gene locus_tag LOCUS_35460 9962 11095 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_35460 11106 11312 gene locus_tag LOCUS_35470 11106 11312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 12287 11415 gene locus_tag LOCUS_35480 12287 11415 CDS product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109261.1 protein_id gnl|my_center|LOCUS_35480 13191 12370 gene locus_tag LOCUS_35490 13191 12370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 >Feature sequence38 186 452 gene locus_tag LOCUS_35500 186 452 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948267.1 protein_id gnl|my_center|LOCUS_35500 527 1306 gene locus_tag LOCUS_35510 527 1306 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939294.1 protein_id gnl|my_center|LOCUS_35510 1773 1303 gene locus_tag LOCUS_35520 1773 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 2679 2200 gene locus_tag LOCUS_35530 2679 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 4080 3085 gene locus_tag LOCUS_35540 4080 3085 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_35540 4694 4098 gene locus_tag LOCUS_35550 4694 4098 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967188.1 protein_id gnl|my_center|LOCUS_35550 5658 4789 gene locus_tag LOCUS_35560 5658 4789 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560563.1 protein_id gnl|my_center|LOCUS_35560 5888 6223 gene locus_tag LOCUS_35570 5888 6223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 7351 6434 gene locus_tag LOCUS_35580 7351 6434 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765597.1 protein_id gnl|my_center|LOCUS_35580 8214 7423 gene locus_tag LOCUS_35590 8214 7423 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036631.1 protein_id gnl|my_center|LOCUS_35590 9089 9781 gene locus_tag LOCUS_35600 9089 9781 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763958.1 protein_id gnl|my_center|LOCUS_35600 9971 10498 gene locus_tag LOCUS_35610 9971 10498 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_35610 10502 11152 gene locus_tag LOCUS_35620 10502 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 11291 11740 gene locus_tag LOCUS_35630 11291 11740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 11740 12963 gene locus_tag LOCUS_35640 11740 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_35640 >Feature sequence39 3246 388 gene locus_tag LOCUS_35650 3246 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 3695 3246 gene locus_tag LOCUS_35660 3695 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 4983 4375 gene locus_tag LOCUS_35670 4983 4375 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 protein_id gnl|my_center|LOCUS_35670 5593 5048 gene locus_tag LOCUS_35680 5593 5048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974526.1 protein_id gnl|my_center|LOCUS_35680 6361 6528 gene locus_tag LOCUS_35690 6361 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 >Feature sequence40 1315 629 gene locus_tag LOCUS_35700 1315 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1871 3535 gene locus_tag LOCUS_35710 1871 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 3538 4203 gene locus_tag LOCUS_35720 3538 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 >Feature sequence41 930 532 gene locus_tag LOCUS_35730 930 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 2176 938 gene locus_tag LOCUS_35740 2176 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 2479 2180 gene locus_tag LOCUS_35750 2479 2180 CDS product KaiB 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_35750 2808 2482 gene locus_tag LOCUS_35760 2808 2482 CDS product KaiB 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390296.1 protein_id gnl|my_center|LOCUS_35760 4333 2798 gene locus_tag LOCUS_35770 gene kaiC2 4333 2798 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331300.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence42 <1 964 gene locus_tag LOCUS_35780 <1 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175019.1:transcriptional regulator 1036 2097 gene locus_tag LOCUS_35790 1036 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790