COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..104153 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 378..2486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS 2826..4589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 4603..6291 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 CDS 6522..8144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 8158..9603 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 note possible pseudo, internal stop codon CDS 9610..11061 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803772.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS 11105..13324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 13417..14862 product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122594.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 14997..16928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 note possible pseudo, internal stop codon CDS 16938..17123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 note possible pseudo, internal stop codon CDS 17190..18719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 note possible pseudo, internal stop codon CDS 18855..20222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 20230..21732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS 21770..23248 product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120376.1 transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 23516..25123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 25302..27560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 27755..29425 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 transl_table 11 codon_start 1 locus_tag LOCUS_00170 gene atsA CDS 29448..29795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 note possible pseudo, internal stop codon CDS 29979..32099 product alpha-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108336.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 note possible pseudo, internal stop codon CDS 32303..34204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 34517..39097 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 note possible pseudo, frameshifted CDS 39091..46995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 note possible pseudo, frameshifted CDS 47002..47907 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS 47910..49712 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(49770..50042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 50312..50608 product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 50605..51720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 51717..53177 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene phrB2 CDS 53277..54788 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 transl_table 11 codon_start 1 locus_tag LOCUS_00290 CDS 54799..55221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00300 CDS 55286..56560 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 CDS 56691..57476 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902565.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(57473..59011) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 59216..60250 product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS complement(60344..61315) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene tktC CDS complement(61325..62170) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 gene tktA CDS complement(62174..62827) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 transl_table 11 codon_start 1 locus_tag LOCUS_00370 gene tal CDS complement(62881..64308) product D-xylose transporter XylE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097267.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 gene xylE CDS complement(64391..65722) product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 transl_table 11 codon_start 1 locus_tag LOCUS_00390 gene xylA CDS complement(65744..67228) product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 67639..68532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(68537..69967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(69989..73519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(73719..74387) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458063.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(75075..75803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(75806..76837) product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene paaE CDS complement(77341..78147) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(78181..78666) product hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085591.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(78699..79106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 79303..79491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 79495..79746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS complement(79810..81087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201988.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(81229..82035) product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324929.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 gene nrtD CDS complement(82054..82911) product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324928.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 gene nrtC CDS complement(82976..84112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(84182..85561) product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106412.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 85680..85865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS complement(85828..86400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS complement(86719..87918) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene crnA CDS complement(88341..89312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS complement(89373..91442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(91490..92083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS complement(92139..92618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(92643..93146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(93154..93735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS complement(93754..94434) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00660 CDS complement(94446..94892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(95169..95894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(95908..96507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(96514..97185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(97457..98161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS 98785..101301 product nitrite reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207014.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene nasB CDS 101465..101842 product nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197730.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 gene nirD-2 CDS 101952..102539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00740 CDS 102745..103944 product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 sequence002 source 1..90792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(251..415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(390..1013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 CDS complement(1130..1546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(1543..1827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(1857..2312) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 2555..2938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 2951..3286 product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962835.1 transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 3288..4871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 4849..5676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 5780..6313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(6314..7045) product methanol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964050.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(7124..7819) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005158923.1 transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(7840..8277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(8280..8876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(8999..9328) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(9328..10299) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 10457..13093 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene alaS CDS complement(13191..14237) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(14444..15778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(15771..17321) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(17321..18088) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(18085..18558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(18623..20176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(20185..21516) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812847.1 transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 21730..22614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01000 CDS 22615..23628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405471.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 23633..24898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(24959..25756) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011669024.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS complement(25940..26818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(26876..27844) product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(27899..28711) product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 transl_table 11 codon_start 1 locus_tag LOCUS_01060 gene deoD CDS complement(28708..29415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01070 CDS complement(29417..30022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS complement(30012..30512) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS complement(30522..31619) product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS complement(31679..32377) product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853568.1 transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(32438..33121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 33246..34127 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 transl_table 11 codon_start 1 locus_tag LOCUS_01130 gene fabD CDS complement(34206..35033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(35398..36408) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene galE CDS complement(36594..37706) product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 transl_table 11 codon_start 1 locus_tag LOCUS_01160 gene porR CDS complement(37932..38300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(38425..40641) product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962399.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(40649..42445) product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 transl_table 11 codon_start 1 locus_tag LOCUS_01190 gene uvrC CDS 42560..43129 product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 transl_table 11 codon_start 1 locus_tag LOCUS_01200 gene ygfA CDS 43253..45844 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPW5 transl_table 11 codon_start 1 locus_tag LOCUS_01210 gene ppc CDS 46797..49025 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS complement(49101..50231) product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162077.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene erg3 CDS 50480..51874 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 gene rpoN CDS 51954..52484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(52485..53162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(53260..53742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(53752..54387) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS complement(54393..54851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01290 CDS complement(54857..55582) product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 tRNA complement(55646..55733) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(55984..57327) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 gene accC CDS complement(57398..57889) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 gene accB CDS complement(57922..58920) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene fabH3 CDS complement(59099..59293) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 transl_table 11 codon_start 1 locus_tag LOCUS_01340 gene rpmF CDS complement(59265..59837) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS complement(59913..60956) product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 transl_table 11 codon_start 1 locus_tag LOCUS_01360 gene pdxA CDS 61019..61603 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 transl_table 11 codon_start 1 locus_tag LOCUS_01370 gene ribE CDS 61633..61917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 62023..62442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 tRNA complement(62910..62984) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS complement(63061..64032) product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 64103..64789 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 64792..66129 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 66149..67336 product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 67365..70835 product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS 70923..71396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS complement(71362..71922) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS 72131..72394 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS 72428..72910 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS complement(72912..73607) product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 transl_table 11 codon_start 1 locus_tag LOCUS_01490 gene truB CDS complement(73607..74401) product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 transl_table 11 codon_start 1 locus_tag LOCUS_01500 gene uppP CDS complement(74421..74660) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 transl_table 11 codon_start 1 locus_tag LOCUS_01510 gene fjo13 CDS complement(74687..75565) product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H241 transl_table 11 codon_start 1 locus_tag LOCUS_01520 gene ftsX CDS 75749..76144 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 transl_table 11 codon_start 1 locus_tag LOCUS_01530 gene rbfA CDS 76146..77342 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(77343..77882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS complement(78057..78998) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 79109..80164 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403126.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS 80267..82063 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 transl_table 11 codon_start 1 locus_tag LOCUS_01580 gene lepA CDS 82263..83006 product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU3 transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS 83300..84715 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FL65 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene glgA CDS 84727..85998 product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene glgC CDS 86056..87969 product 1,4-alpha-glucan branching enzyme GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHB1 transl_table 11 codon_start 1 locus_tag LOCUS_01620 gene glgB CDS 88143..90539 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582587.1 transl_table 11 codon_start 1 locus_tag LOCUS_01630 sequence003 source 1..66310 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(320..766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(846..1673) product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene batE CDS complement(1677..3455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 gene batD CDS complement(3483..4019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS complement(4019..4630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(4681..5727) product BatB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene batB CDS complement(5802..6812) product BatA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962311.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 gene batA CDS complement(6812..8410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 CDS complement(8439..9308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(9392..10396) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS 10973..11257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 note possible pseudo, internal stop codon CDS 11264..11875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 note possible pseudo, internal stop codon CDS 12443..13918 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K003 transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 13919..15043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(15513..16283) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 gene lpxH CDS complement(16432..17997) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS complement(17987..18418) product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(18660..19304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS 19399..20304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031741.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS 20312..22612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262018.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 CDS 22965..24356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS 24367..25557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(25630..26061) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 gene rpiB CDS 27245..29458 product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 transl_table 11 codon_start 1 locus_tag LOCUS_01870 gene rnr CDS 29514..30245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 30319..30513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 30808..33411 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS 33552..33914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS 33965..34468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 34496..34909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(34935..35996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS complement(36208..37137) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 CDS 37270..37656 product 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964092.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(37743..39269) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene gltX CDS 39404..39814 product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 transl_table 11 codon_start 1 locus_tag LOCUS_01980 gene ybeY CDS 39864..41741 product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 transl_table 11 codon_start 1 locus_tag LOCUS_01990 gene mnmG CDS 41950..42591 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085574.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 42755..43684 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS 43881..44261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS complement(44617..45012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS complement(45024..46319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS complement(46328..46783) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764619.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 note possible pseudo, internal stop codon CDS 46975..48798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203365.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(48867..49346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 49525..50250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS complement(50466..55970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(56234..57244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS 57417..58442 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWD9 transl_table 11 codon_start 1 locus_tag LOCUS_02110 gene fbp CDS complement(58439..58753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(58720..59397) product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762952.1 transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS 59533..60045 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108581.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS 60117..61031 product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203131.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 61021..63636 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS complement(63633..64775) product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene holB CDS 64953..66137 product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene pgk sequence004 source 1..55344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS complement(950..2878) product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS complement(2911..4221) product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038511.1 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene gluP CDS complement(4233..5294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(5296..6204) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 6426..7469 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS complement(7461..8105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 8380..10788 product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 10794..11636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 11735..12547 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 transl_table 11 codon_start 1 locus_tag LOCUS_02280 gene murQ CDS 12544..12762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS complement(12759..13256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS complement(13342..14802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(14802..15887) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(15888..17168) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(17165..18355) product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089037.1 transl_table 11 codon_start 1 locus_tag LOCUS_02340 CDS complement(18357..19322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(19336..21765) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(21781..23436) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 transl_table 11 codon_start 1 locus_tag LOCUS_02370 gene recN CDS complement(23567..24457) product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(24450..25661) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 gene coaBC CDS complement(25642..25992) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(26002..26694) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 gene bamD CDS complement(26925..27809) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene dapA CDS complement(27809..28216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS complement(28438..28722) product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene clpS CDS complement(28759..29598) product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02450 gene prmA CDS complement(29695..35115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS complement(35140..35973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 CDS complement(36060..36821) product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 transl_table 11 codon_start 1 locus_tag LOCUS_02480 gene tpiA CDS complement(36854..37351) product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963549.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 gene tlpA CDS complement(37478..38554) product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS 38696..41527 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene uvrA2 CDS 41620..42333 product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS 42348..45173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962879.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 45303..47756 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(48070..49374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS 49522..50151 product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02560 CDS 50166..51623 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 gene pepD CDS complement(51671..52690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 52762..53163 product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS 53226..53723 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_02600 gene pyrR2 tRNA 53890..53963 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA 54018..54102 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 54211..54999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 sequence005 source 1..52043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 129..1148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 1213..2487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS 2593..3366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964528.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 3366..4625 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(4845..5354) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 CDS complement(5420..7120) product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 gene recJ CDS complement(7249..7668) product OsmC-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811690.1 transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(7719..9215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(9216..9671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(9649..10245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(10283..10861) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 transl_table 11 codon_start 1 locus_tag LOCUS_02720 gene nadD CDS complement(10867..11439) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 transl_table 11 codon_start 1 locus_tag LOCUS_02730 gene gmk CDS complement(11463..12308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS complement(12424..13323) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 13473..14462 product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS complement(14464..15078) product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 transl_table 11 codon_start 1 locus_tag LOCUS_02770 gene lspA CDS complement(15136..15519) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 gene dksA CDS complement(15524..18931) product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 transl_table 11 codon_start 1 locus_tag LOCUS_02790 gene ileS CDS complement(19052..20206) product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962316.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(20208..20963) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(21070..21996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(22076..22537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 note possible pseudo, frameshifted CDS complement(22530..22769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS 22914..24389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 24445..24795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(24792..25247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(25381..26823) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 transl_table 11 codon_start 1 locus_tag LOCUS_02880 gene pykA CDS complement(26828..27313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(27450..28190) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene rnc CDS complement(28198..29448) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 transl_table 11 codon_start 1 locus_tag LOCUS_02910 gene fabF CDS complement(29456..29692) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene acpP CDS 29870..30430 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E5 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene purN CDS 30500..31132 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS complement(31181..32395) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene sufS CDS 32520..32864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(32861..33208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS complement(33379..33762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS complement(33868..34527) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS complement(34533..35882) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015670.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS complement(36057..38141) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene metG CDS 38297..39271 product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963742.1 transl_table 11 codon_start 1 locus_tag LOCUS_03020 gene lpsA CDS complement(39354..40661) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH08 transl_table 11 codon_start 1 locus_tag LOCUS_03030 gene amt CDS 40880..41791 product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(41829..42008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 42276..43409 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765765.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 43759..44118 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ6 transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS 44196..44783 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS 44822..45535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(46416..47705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(47781..48131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 48251..48775 product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962305.1 transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 49115..49846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS complement(49843..50763) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 50876..51715 product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796397.1 transl_table 11 codon_start 1 locus_tag LOCUS_03150 sequence006 source 1..50879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(119..1006) product KipI antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382245.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(1003..1674) product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889166.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(1674..2432) product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BQ3 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(2438..4186) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene sppA CDS 4308..4832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 4955..8824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(8893..9231) product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene gldC CDS 9394..9918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS 9919..10872 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS 10955..12670 product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(12728..14146) product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene cca CDS complement(14150..14701) product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 14862..15953 product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965647.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 CDS 15943..16566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS 16572..17612 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS complement(17811..19529) product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene msbA CDS 19847..20716 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963393.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS 20713..21723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03330 CDS 21725..22657 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475870.1 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene rfaG CDS 22977..23762 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 23752..24567 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 24564..25550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(25713..27749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 27958..28368 product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS 28451..29038 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene def CDS 29063..29479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963864.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 CDS 29576..30355 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(30439..31203) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(31230..32543) product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS complement(32564..33529) product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(33590..34702) product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 34785..37466 product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 37499..38725 product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765689.1 transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 38823..39203 product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene yjgF CDS 39212..41494 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 gene mrcA CDS complement(41514..41876) product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42980 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene mgsA CDS complement(41993..42991) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZV8 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS complement(43028..44014) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 transl_table 11 codon_start 1 locus_tag LOCUS_03530 gene pfkA CDS complement(44281..45189) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(45208..49572) product DUF490 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS 49715..50773 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene tsaD sequence007 source 1..48449 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS complement(717..1742) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 1929..2717 product 4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S4 transl_table 11 codon_start 1 locus_tag LOCUS_03590 gene kduI1 CDS 2723..3499 product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288236.1 transl_table 11 codon_start 1 locus_tag LOCUS_03600 gene idnO CDS 3543..4682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(4722..5780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS complement(6034..7281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 7482..8237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(8263..8655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963100.1 transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(8652..10949) product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028088.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(10957..11748) product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 transl_table 11 codon_start 1 locus_tag LOCUS_03670 gene fdhD CDS complement(11863..12417) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964091.1 transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(12614..13792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963733.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(13808..14890) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS complement(14990..15601) product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(15657..16448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS complement(16562..17680) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene dnaN CDS complement(17897..19228) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(19389..20474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS complement(20476..22620) product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 22860..23630 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene surE CDS 23632..23916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 23918..25027 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 gene lpxB CDS complement(25029..26309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS 26552..27412 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 gene menB CDS 27456..28328 product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34990 transl_table 11 codon_start 1 locus_tag LOCUS_03820 gene purU CDS 28339..28950 product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 29110..30357 product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 30434..30670 product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 transl_table 11 codon_start 1 locus_tag LOCUS_03850 gene rpmB CDS 30699..30881 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 transl_table 11 codon_start 1 locus_tag LOCUS_03860 gene rpmG CDS 30890..31042 product DUF4295 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 31166..32119 product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 transl_table 11 codon_start 1 locus_tag LOCUS_03880 gene ftsY CDS 32239..33549 product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene rimO CDS 33610..34380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS complement(34567..35595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(36066..36476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 36602..38194 product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene bshC CDS complement(38274..38756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(38722..39129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(39399..41018) product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962729.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(41190..42746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962728.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS 43062..44375 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962730.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 gene norM CDS 44413..44649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962732.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS 44667..45902 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963811.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 CDS 46248..46382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(46512..48068) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 transl_table 11 codon_start 1 locus_tag LOCUS_04020 sequence008 source 1..46499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(177..1469) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 transl_table 11 codon_start 1 locus_tag LOCUS_04030 gene tyrS CDS 1574..2584 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(2577..3098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS complement(3138..4475) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 transl_table 11 codon_start 1 locus_tag LOCUS_04060 gene pyrC1 CDS complement(4485..5204) product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS complement(5717..5878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 CDS 5978..6724 product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(6778..8133) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene radA CDS complement(8178..9158) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(9160..9510) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene panD CDS complement(9584..10342) product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 transl_table 11 codon_start 1 locus_tag LOCUS_04130 gene panC CDS 10498..11340 product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS 11358..13010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962289.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 13023..14873 product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 transl_table 11 codon_start 1 locus_tag LOCUS_04160 gene glmS CDS complement(14934..15512) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 15616..16194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS 16624..17595 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 gene nrdB CDS 17726..20149 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene nrdA CDS 20269..21603 product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 gene dgt CDS 21614..24370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS 24489..25277 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene porP CDS complement(25279..26181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(26223..28007) product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWC0 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene dxs CDS 28121..28570 product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene tadA CDS 28692..28907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(28909..29142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS complement(29144..30916) product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791032.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS complement(30965..32740) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene aspS CDS 32908..33306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04310 note possible pseudo, frameshifted CDS 33315..33911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 note possible pseudo, frameshifted CDS 33982..34656 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene rsmI CDS complement(34658..35323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 note possible pseudo, internal stop codon CDS complement(35528..35674) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS complement(35995..37107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(37114..37701) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene tdk CDS 37804..38661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 38685..39287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(39422..39769) product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962523.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS 39877..40332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962524.1 transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(40329..41942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(42009..42260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS 42842..43717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS 43858..45402 product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2A9 transl_table 11 codon_start 1 locus_tag LOCUS_04450 gene glyS CDS 45508..46329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 sequence009 source 1..46461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS complement(831..1403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(1530..2822) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(2883..3524) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 gene pcm CDS 3697..4656 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 4667..5098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 transl_table 11 codon_start 1 locus_tag LOCUS_04520 gene yuxK CDS complement(5090..6424) product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 gene gltP CDS complement(6506..7045) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962996.1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS complement(7131..8321) product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(8621..9370) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426498.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 gene tuaG CDS complement(9370..10692) product adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942594.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(10679..11716) product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(11706..13034) product ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963377.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(13225..14361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS complement(14325..15353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS complement(15410..16498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS complement(16495..18075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(18068..19471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963386.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(19464..21167) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS complement(21172..22101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS complement(22151..23068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(23061..23855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(23956..25071) product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(25370..26290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(26283..26984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene neuA CDS complement(26984..28144) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289362.1 transl_table 11 codon_start 1 locus_tag LOCUS_04720 gene neuC CDS complement(28141..29139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546727.1 transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(29139..30329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(30326..31477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS complement(31474..32499) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS complement(32496..33284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS complement(33296..33595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(33592..34374) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902370.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(34442..35416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS complement(35413..36333) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963504.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(36330..37427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942154.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(37589..39310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(39361..40554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS complement(40666..41505) product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97GN7 transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS complement(41816..42232) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene aroQ CDS 42358..43254 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene xerD CDS complement(43261..44301) product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM3 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene lpxK CDS 44416..45513 product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX9 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene yqfO CDS 45516..46289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04900 sequence010 source 1..46371 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 293..4954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS 4964..5503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS complement(5552..6607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963770.1 transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(6653..8749) product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene glnS CDS complement(8842..9894) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 10079..10306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 10419..10778 product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene folB tRNA 10891..10964 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS 11221..12015 product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 12008..13159 product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 13167..14378 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118174.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 14371..16113 product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288137.1 transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS 16292..17152 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS 17171..18847 product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 18867..20702 product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 20921..22147 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YH8 transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS 22149..24518 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816115.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS 24515..25399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05070 CDS complement(25535..26584) product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene paaE CDS 26741..27694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05090 CDS 27865..30105 product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 gene sprE CDS 30119..30523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 30489..30710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS 30836..31114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS 31219..32331 product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene atpB CDS 32365..32556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS 32637..33137 product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 transl_table 11 codon_start 1 locus_tag LOCUS_05160 gene atpF CDS 33144..33701 product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene atpH CDS 33724..35304 product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 transl_table 11 codon_start 1 locus_tag LOCUS_05180 gene atpA CDS 35414..36274 product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 transl_table 11 codon_start 1 locus_tag LOCUS_05190 gene atpG CDS complement(36709..37386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 note possible pseudo, internal stop codon CDS complement(37408..37614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS complement(37727..37960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(38000..38218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS 38106..38525 product putative HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66625 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS 39001..39426 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963160.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 39428..39967 product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262973.1 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene hnoX CDS 39975..41963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS 41960..43093 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS 43093..43587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05290 note possible pseudo, internal stop codon CDS 43657..44148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 note possible pseudo, internal stop codon CDS 44151..44468 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963165.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 44864..46222 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817149.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 sequence011 source 1..45308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(1606..2118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(2248..2631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 note possible pseudo, internal stop codon CDS complement(2659..3060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 note possible pseudo, internal stop codon, frameshifted CDS complement(3148..3327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(3533..4015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 4328..7174 product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 transl_table 11 codon_start 1 locus_tag LOCUS_05390 gene gcvP CDS 7457..8464 product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene pdhA CDS 8533..10203 product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 transl_table 11 codon_start 1 locus_tag LOCUS_05410 gene pdhC CDS 10351..11367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962448.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS complement(11456..12052) product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY74 transl_table 11 codon_start 1 locus_tag LOCUS_05430 gene hisIE CDS complement(12138..12893) product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 transl_table 11 codon_start 1 locus_tag LOCUS_05440 gene hisF CDS complement(12951..13691) product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 transl_table 11 codon_start 1 locus_tag LOCUS_05450 gene hisA CDS complement(13726..14073) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS complement(14104..14691) product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 transl_table 11 codon_start 1 locus_tag LOCUS_05470 gene hisH CDS complement(14786..15925) product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 transl_table 11 codon_start 1 locus_tag LOCUS_05480 gene hisB CDS complement(15996..17039) product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 transl_table 11 codon_start 1 locus_tag LOCUS_05490 gene hisC CDS complement(17045..18337) product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene hisD CDS complement(18409..19269) product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 transl_table 11 codon_start 1 locus_tag LOCUS_05510 gene hisG CDS complement(19527..21107) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791107.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(21129..21728) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H133 transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS complement(21766..22719) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene accA CDS complement(22781..23869) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS complement(23901..25031) product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 transl_table 11 codon_start 1 locus_tag LOCUS_05560 gene tgt CDS complement(25095..25388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS complement(25444..25893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS complement(25918..26229) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 26690..27397 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 27511..28074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS complement(28066..29223) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962750.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(29293..29910) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 transl_table 11 codon_start 1 locus_tag LOCUS_05630 gene recR CDS 30045..31517 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 31560..32207 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene pdxH CDS 32316..32804 product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 gene sixA CDS 32817..33716 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene ppx CDS 33861..34307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 34211..34438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS complement(34456..34980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 35239..35871 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_05710 gene queE CDS 36030..39005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 39487..40686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS 40883..41674 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 transl_table 11 codon_start 1 locus_tag LOCUS_05740 gene ttcA CDS 41716..42138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963959.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 42313..42501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 note possible pseudo, internal stop codon CDS 42634..43914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 note possible pseudo, internal stop codon CDS 43925..44218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 44289..44810 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094859.1 transl_table 11 codon_start 1 locus_tag LOCUS_05790 gene blc sequence012 source 1..42257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..1556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS 1642..2472 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene porP CDS 2588..3610 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene ruvB CDS 3652..5373 product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS 5478..5993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS 6141..9419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 9441..9935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS 9937..10206 product sugar transporter SemiSWEET inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89G85 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 10222..11361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964258.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 11434..12855 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 12915..13700 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 transl_table 11 codon_start 1 locus_tag LOCUS_05900 gene crt CDS complement(14587..15231) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962231.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS 15626..16303 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 16330..17334 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 17335..18306 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 18318..19601 product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 gene wbpO CDS 19618..20667 product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 transl_table 11 codon_start 1 locus_tag LOCUS_05960 gene rmlB CDS 20742..21632 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3Y2R7 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene rfbA CDS 21619..22188 product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 gene rfbC CDS 22478..22831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 CDS 23114..24013 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 24557..24982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 25125..26453 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 gene ugd CDS 26709..27062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 27147..28172 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 28184..29140 product arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E8H2 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene kpsF CDS 29142..29900 product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RFA8 transl_table 11 codon_start 1 locus_tag LOCUS_06060 gene kdsB CDS 29890..30420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 30426..31211 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RE91 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene kdsA CDS 31240..32121 product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023669.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS 32122..33279 product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023668.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 33269..34774 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937653.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 35256..36173 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS 36170..37159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 37156..38478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 38650..39264 product putative lipopolysaccharide biosynthesis O-acetyl transferase WbbJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37750 transl_table 11 codon_start 1 locus_tag LOCUS_06150 gene wbbJ CDS 39251..40066 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 40080..40928 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 40903..41829 product nucleoside-diphosphate-sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786859.1 transl_table 11 codon_start 1 locus_tag LOCUS_06180 sequence013 source 1..40858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..834) product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962420.1 transl_table 11 codon_start 1 locus_tag LOCUS_06190 gene dinD CDS 1001..1219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 1238..1456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 1603..2091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 2194..2925 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 2977..3636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 3642..4031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06250 note possible pseudo, frameshifted CDS 3959..4363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06260 note possible pseudo, frameshifted CDS 4494..5759 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760938.1 transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 5890..11400 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964323.1 transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 11484..13769 product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene pbpC CDS complement(13771..14226) product 23S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418920.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS complement(14223..14858) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963973.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 15044..15208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 15299..16708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(16769..19381) product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWN3 transl_table 11 codon_start 1 locus_tag LOCUS_06340 gene mutS CDS complement(20079..20825) product molecular chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388716.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS 21031..21444 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene yqiW CDS complement(21509..21970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(22117..25452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(25579..26058) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN0 transl_table 11 codon_start 1 locus_tag LOCUS_06390 gene ogt1 CDS complement(26074..26841) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS 26946..27383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(27389..28705) product voltage-gated chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037141.1 transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS complement(28935..29573) product antioxidant protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06430 CDS complement(29729..31189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(31413..31817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(32319..33539) product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 transl_table 11 codon_start 1 locus_tag LOCUS_06460 gene sucB CDS complement(33762..36500) product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 gene sucA CDS complement(36725..37948) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(38043..38636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(38624..38977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 note possible pseudo, frameshifted tRNA 39233..39307 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 tRNA 39857..39931 product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS 40573..40812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06510 sequence014 source 1..39455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..1580) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HJ6 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(1633..3024) product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(3031..4317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS complement(4320..6602) product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(6758..7357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 note possible pseudo, internal stop codon CDS complement(7442..7741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 note possible pseudo, internal stop codon CDS complement(7771..9354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(9546..10877) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene arsA CDS complement(10958..12394) product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(12487..13473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS complement(13587..14993) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 gene arsA CDS complement(15151..16038) product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(16463..18160) product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS complement(18169..21360) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS complement(21737..23200) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS complement(23227..24594) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120117.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(24945..26603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(26647..26943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 note possible pseudo, frameshifted CDS complement(26945..27904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 note possible pseudo, frameshifted CDS complement(27917..29506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(29519..31759) product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108997.1 transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(31876..34479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764126.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(34575..36863) product alpha-1 2-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(37095..38405) product L-fucose permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44776 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene fucP sequence015 source 1..38968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1353 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS 1338..2120 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 2124..3002 product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966313.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(3047..4039) product acyl-ACP desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963293.1 transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(4066..4800) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962233.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 gene plsC CDS complement(4826..5251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS complement(5329..5847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964495.1 transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(5976..7538) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ0 transl_table 11 codon_start 1 locus_tag LOCUS_06830 gene pgi CDS complement(7569..8798) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(8841..9593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(9710..9955) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(9981..11129) product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 transl_table 11 codon_start 1 locus_tag LOCUS_06870 gene mrp CDS complement(11243..11587) product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene ogt2 CDS complement(11588..12325) product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS complement(12395..12733) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS complement(12935..15223) product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX3 transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS complement(15431..16489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764295.1 transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(16690..19476) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 19657..20349 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene phoP CDS 20339..21376 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene phoR CDS complement(21373..22476) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS complement(22519..23799) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene purD CDS complement(23811..24386) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617631.1 transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS complement(24418..24795) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS complement(24876..27368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141609.1 transl_table 11 codon_start 1 locus_tag LOCUS_07000 CDS complement(27368..28087) product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene recO CDS complement(28087..30399) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 30561..31031 product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS complement(31297..32490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS complement(32614..33354) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS complement(33439..34080) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989831.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS complement(34128..34808) product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 35010..35978 product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene trpS CDS complement(35967..36467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(37012..37335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 note possible pseudo, internal stop codon CDS complement(37348..37530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(37677..38714) product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962241.1 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene tas sequence016 source 1..37182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(424..1308) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene porP CDS complement(1341..6305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS complement(6489..7097) product microcystin dependent MdpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS complement(7211..7516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(8188..9372) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_07170 gene aspC1 CDS complement(9435..10526) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 10647..11276 product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene rsmG CDS complement(11280..11780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS complement(11793..12464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(12473..12994) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS complement(13127..13510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 13848..14555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS 14643..16799 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS 16900..17523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963764.1 transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 17526..18839 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963763.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 18841..19122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS 19136..19891 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963759.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(19958..20512) product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene frr CDS complement(20536..21249) product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_07310 gene pyrH CDS complement(21384..21749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 21969..23102 product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 gene porY CDS complement(23099..23497) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964456.1 transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(23617..24090) product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene greA CDS 24233..24694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 24746..25891 product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 transl_table 11 codon_start 1 locus_tag LOCUS_07370 gene purK CDS 25987..26472 product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene purE CDS complement(26698..27189) product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 CDS complement(27215..28330) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814856.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS 28526..29548 product glyceraldehyde 3-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878153.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 29555..30172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS complement(30241..31770) product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene cafA CDS complement(32077..32367) product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 gene hupA CDS 32541..33560 product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 gene mutY CDS 33625..34035 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene ssb CDS complement(34036..34284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS 34184..35347 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202475.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 35374..35907 product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene gldD CDS complement(35904..36659) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 transl_table 11 codon_start 1 locus_tag LOCUS_07500 tRNA 36869..36954 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 sequence017 source 1..36822 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(141..935) product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS complement(932..1870) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene acdS CDS complement(1882..3801) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(4178..4351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(4386..5432) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene fjo30 CDS complement(5507..6412) product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 gene gldN CDS complement(6493..8055) product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene gldM CDS complement(8091..8723) product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 gene gldL CDS complement(8770..10155) product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 gene gldK CDS complement(10274..11434) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 transl_table 11 codon_start 1 locus_tag LOCUS_07600 gene fjo29 CDS complement(11523..14054) product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene topA CDS 14304..15764 product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 transl_table 11 codon_start 1 locus_tag LOCUS_07620 gene miaB CDS 15782..17017 product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 17108..17611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 17621..18316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS 18319..18666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 18811..19089 product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 transl_table 11 codon_start 1 locus_tag LOCUS_07670 gene groS CDS 19137..20780 product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 transl_table 11 codon_start 1 locus_tag LOCUS_07680 gene groL CDS 20982..21917 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS 22082..23746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(23791..24135) product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(24147..26306) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(26460..26819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(27363..27977) product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 28124..29650 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 transl_table 11 codon_start 1 locus_tag LOCUS_07750 gene purH CDS 29727..30755 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 gene mreB CDS 30806..31606 product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964506.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 gene mreC CDS complement(31676..31909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 32165..34009 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 transl_table 11 codon_start 1 locus_tag LOCUS_07790 gene pbpA CDS 34074..35267 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 gene rodA CDS 35791..36714 product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005941495.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 sequence018 source 1..35929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(88..900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(1445..1804) product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DB15 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(1837..2001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS complement(2003..3340) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(3337..6495) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(6501..7619) product cation efflux system (czcB-like) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880852.1 transl_table 11 codon_start 1 locus_tag LOCUS_07870 gene czcB2 tRNA complement(7858..7935) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS 8195..11110 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 11181..11837 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 11852..12466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS 12459..12881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS 12931..14388 product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS 14459..15328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 15338..15649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(15684..17420) product putative multidrug export ATP-binding/permease protein YgaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71082 transl_table 11 codon_start 1 locus_tag LOCUS_07950 gene ygaD CDS 17586..18446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 18456..18614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 18750..18938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS 18941..19105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS complement(19124..19744) product peptide methionine sulfoxide reductase MsrA 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UJK0 transl_table 11 codon_start 1 locus_tag LOCUS_08000 gene msrA1 CDS 19934..21019 product DNA polymerase III, subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963113.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS 21046..21624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 21682..22524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS 22528..24729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 24732..25274 product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 25278..25859 product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 gene miaE CDS 25865..26629 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 CDS complement(26626..27600) product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261760.1 transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 27705..28598 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A0D1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 28753..29109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 29140..29949 product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 30068..31174 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261735.1 transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 31286..32395 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 32406..33092 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 33196..34245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS 34247..35734 product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253926.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 sequence019 source 1..35123 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(179..1279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(1298..3199) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(3553..4491) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123518.1 transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(4488..4946) product ElaA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962201.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 gene elaA CDS 5057..5560 product cobinamide kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963579.1 transl_table 11 codon_start 1 locus_tag LOCUS_08210 gene cobU CDS 5566..6600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS 6679..7047 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 CDS 7084..7848 product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZK9 transl_table 11 codon_start 1 locus_tag LOCUS_08240 gene cobS CDS 7830..8384 product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963576.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 gene gpmA CDS 8389..9519 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963581.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 9623..10555 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene ppiC tRNA 10767..10840 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS complement(10970..11869) product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362003.1 transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS complement(11952..12323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964284.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 tRNA complement(12482..12555) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 tRNA complement(12580..12661) product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 tRNA complement(12702..12775) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(12840..13607) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(13608..14348) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS 14476..14913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08320 note possible pseudo, internal stop codon CDS 15157..16116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 note possible pseudo, internal stop codon CDS complement(16113..17414) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene bfmBB CDS complement(18079..18477) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(18474..18641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(18645..19328) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS 19443..20105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS 20116..21429 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963623.1 transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 21426..22040 product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 22146..23462 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 23513..23863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(23963..24679) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(24766..25668) product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 transl_table 11 codon_start 1 locus_tag LOCUS_08440 gene hemF CDS complement(25744..26769) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene hemE CDS complement(26809..27159) product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963834.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(27204..28493) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHH6 transl_table 11 codon_start 1 locus_tag LOCUS_08470 gene hemL CDS complement(28577..29548) product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 transl_table 11 codon_start 1 locus_tag LOCUS_08480 gene hemB CDS complement(29568..30191) product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 transl_table 11 codon_start 1 locus_tag LOCUS_08490 gene hemD CDS complement(30257..31177) product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP0 transl_table 11 codon_start 1 locus_tag LOCUS_08500 gene hemC CDS complement(31161..32441) product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 transl_table 11 codon_start 1 locus_tag LOCUS_08510 gene hemA CDS 32749..33645 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 33650..34666 product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 transl_table 11 codon_start 1 locus_tag LOCUS_08530 gene hemH CDS 34804..34950 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 sequence020 source 1..35068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..1465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 1527..2351 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004304952.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(2406..2681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS complement(2700..3188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS complement(3369..5609) product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS complement(5785..6768) product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 6820..7233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(7258..9303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 note possible pseudo, internal stop codon CDS complement(9322..9642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08630 note possible pseudo, internal stop codon, frameshifted CDS complement(9828..9953) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(9947..10135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(10271..10630) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS 10762..12114 product putative malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E6 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene mqo CDS complement(12169..13050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123942.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS complement(13083..13541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS complement(13542..14648) product DNA polymerase IV 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UJK7 transl_table 11 codon_start 1 locus_tag LOCUS_08700 gene dinB2 CDS 14834..17641 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS 18141..21158 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 21169..22662 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 CDS 22673..23308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS 23348..24793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 24860..25711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 25824..27302 product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_636452.2 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene srfJ CDS 27327..28841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 28842..30137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 30180..33635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 33725..34909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08810 sequence021 source 1..34880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 416..1393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(1908..4280) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 gene fecA CDS complement(4425..5636) product iron-regulated protein A precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963605.1 transl_table 11 codon_start 1 locus_tag LOCUS_08840 gene irpA CDS complement(5816..6931) product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(7059..7928) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 gene mvaB CDS complement(8249..8746) product putative bacterial non-heme ferritin-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43708 transl_table 11 codon_start 1 locus_tag LOCUS_08870 gene ftnB CDS complement(8829..9863) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene pyrD CDS complement(10027..12453) product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene pheT CDS 12628..12918 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963096.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene ydzA CDS complement(12964..13542) product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 transl_table 11 codon_start 1 locus_tag LOCUS_08910 gene yceI CDS complement(13564..14025) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 14331..14579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS 14569..15219 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 15513..15758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 note possible pseudo, internal stop codon CDS complement(15766..16506) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 CDS complement(16510..17187) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(17289..20624) product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 transl_table 11 codon_start 1 locus_tag LOCUS_08980 gene secA CDS complement(20803..21024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(21128..21691) product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS complement(21693..22469) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 22566..23348 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963431.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 gene wza CDS 23358..25835 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene wzc CDS complement(25832..27931) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene recG CDS 28123..28989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 29021..29803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 29878..30504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09070 CDS 30584..33487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 33543..34757 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene rsmB sequence022 source 1..34696 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1163..1537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 CDS 1707..2855 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454985.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 CDS complement(2852..2974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 tRNA complement(3256..3327) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 3549..6623 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962469.1 transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 6637..7278 product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(7275..7571) product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS 7777..8295 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZJ6 transl_table 11 codon_start 1 locus_tag LOCUS_09160 gene aroK CDS 8428..11241 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 gene polA CDS 11451..11906 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene rplM CDS 11909..12295 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene rpsI CDS 12480..13259 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 transl_table 11 codon_start 1 locus_tag LOCUS_09200 gene rpsB CDS 13306..14274 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene tsf CDS 14361..15005 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H233 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene aat CDS 15097..15423 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 15426..15686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS 15688..16899 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW83 transl_table 11 codon_start 1 locus_tag LOCUS_09250 gene aroA CDS 17047..18096 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 transl_table 11 codon_start 1 locus_tag LOCUS_09260 gene queA CDS 18204..19253 product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene rlmN CDS 19321..20298 product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(20584..22047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 22321..23115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 23120..24067 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 24122..24472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(24523..24810) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 25000..26517 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 transl_table 11 codon_start 1 locus_tag LOCUS_09340 gene gpmI CDS 26691..27068 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS 27554..28381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(28590..28931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS 29143..29550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 CDS 29640..30458 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene map CDS 30470..31231 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(31228..32493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(32573..33568) product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 33673..34518 product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 sequence023 source 1..32674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(754..1419) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(1633..1950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS 1859..2053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS 2421..4124 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rho CDS complement(4182..5066) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D7 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene murI CDS complement(5083..5583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS complement(5621..6259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09500 CDS complement(6300..8888) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 gene bamA CDS complement(8881..9633) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 transl_table 11 codon_start 1 locus_tag LOCUS_09520 gene uppS CDS complement(9633..10334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS complement(10460..11356) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 gene nadK CDS complement(11382..12041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 12144..12863 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 transl_table 11 codon_start 1 locus_tag LOCUS_09560 gene pdxJ CDS 12874..13641 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS 13766..14134 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964186.1 transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 14207..15529 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene tig CDS complement(15631..16965) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene rhlE CDS complement(17088..17690) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS 17689..17889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS 17986..18648 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 transl_table 11 codon_start 1 locus_tag LOCUS_09630 gene clpP CDS 18700..19938 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 transl_table 11 codon_start 1 locus_tag LOCUS_09640 gene clpX CDS complement(19995..20609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 20702..22786 product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene dnaG CDS complement(22787..23284) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(23298..24761) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(24790..25860) product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963509.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene manC CDS complement(25974..26450) product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 note possible pseudo, internal stop codon CDS complement(26460..27140) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 CDS complement(27161..28678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(28757..29785) product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS 29909..30160 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 transl_table 11 codon_start 1 locus_tag LOCUS_09740 gene rpmE CDS complement(30238..32442) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 sequence024 source 1..32541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..991) product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942953.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 gene mscS-2 CDS complement(1055..1723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS complement(1727..7054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(7453..8169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS 8316..10436 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108019.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS complement(10437..11573) product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(11642..12565) product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(12666..13232) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 transl_table 11 codon_start 1 locus_tag LOCUS_09830 gene efp CDS complement(13245..14027) product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 transl_table 11 codon_start 1 locus_tag LOCUS_09840 gene lpxA CDS complement(14032..15420) product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 transl_table 11 codon_start 1 locus_tag LOCUS_09850 gene fabZ CDS complement(15422..16456) product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 transl_table 11 codon_start 1 locus_tag LOCUS_09860 gene lpxD CDS complement(16497..17726) product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 17840..19387 product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 gene porX CDS 19405..19815 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 19855..21054 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 transl_table 11 codon_start 1 locus_tag LOCUS_09900 gene ald CDS 21186..22565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09910 CDS 22803..23270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09920 note possible pseudo, internal stop codon CDS 23559..24377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 CDS complement(24374..25273) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347004.1 transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 25511..26128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 26420..27985 product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UKT5 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 28009..28398 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS 28545..29606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS 29652..29780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS 29820..30578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(30638..31729) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 transl_table 11 codon_start 1 locus_tag LOCUS_10010 gene engD CDS complement(31921..32271) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene fdx1 sequence025 source 1..32276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 163..417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS 535..1503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 1508..1831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 note possible pseudo, internal stop codon CDS 1859..2143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 note possible pseudo, internal stop codon, frameshifted CDS 2112..2432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 note possible pseudo, internal stop codon, frameshifted CDS complement(2429..3088) product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 transl_table 11 codon_start 1 locus_tag LOCUS_10080 gene nth CDS 3240..3695 product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(3698..6115) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(6175..7758) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS 8105..8395 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993398.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS 8406..8699 product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS 8899..10470 product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene rny CDS complement(10947..11495) product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS complement(11506..12612) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(12615..12845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(12857..14650) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(14681..15865) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS complement(15903..18305) product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(18324..18773) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 18914..19843 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 transl_table 11 codon_start 1 locus_tag LOCUS_10220 gene natA CDS 19849..21165 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene natB CDS 21226..22389 product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(22430..23155) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(23161..24312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880006.1 transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(24341..25216) product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(25348..26220) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963287.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(26225..26956) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS complement(26963..28843) product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 transl_table 11 codon_start 1 locus_tag LOCUS_10300 gene mutL CDS complement(28843..29136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS complement(29261..29740) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 transl_table 11 codon_start 1 locus_tag LOCUS_10320 gene ribH CDS complement(29779..30546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759931.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS 30718..31800 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene recF CDS 31820..32116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 sequence026 source 1..31416 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS complement(574..933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10370 note possible pseudo, internal stop codon, frameshifted CDS complement(1030..1932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10380 note possible pseudo, internal stop codon, frameshifted CDS 2314..2922 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene sodA CDS complement(2994..8258) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(8279..11476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(11699..13594) product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 gene purF CDS complement(13646..14581) product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS 14680..15105 product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene sufE CDS 15184..15504 product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS 15518..16024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 15978..16946 product protein of unknown function precursor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362027.1 transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS 17093..17731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS 17752..18666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(18723..19934) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 transl_table 11 codon_start 1 locus_tag LOCUS_10500 gene hflX CDS 20068..21009 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(21061..21399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 CDS complement(21700..23727) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS complement(23738..26362) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964328.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS 26559..27599 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964327.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS 27625..27882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 27958..28479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 28597..29682 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z28 transl_table 11 codon_start 1 locus_tag LOCUS_10580 gene proB CDS 29734..30981 product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E8 transl_table 11 codon_start 1 locus_tag LOCUS_10590 gene proA CDS 31150..31335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 sequence027 source 1..30179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 434..1453 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 transl_table 11 codon_start 1 locus_tag LOCUS_10610 gene pheS CDS 1453..1854 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS 1956..3050 product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(3051..4046) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene gpsA CDS 4178..5626 product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(5629..6621) product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(6644..8185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS complement(8204..9154) product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS complement(9156..9920) product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962243.1 transl_table 11 codon_start 1 locus_tag LOCUS_10690 gene xth CDS complement(9928..11718) product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(11815..14136) product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 transl_table 11 codon_start 1 locus_tag LOCUS_10710 gene mrcA CDS complement(14184..14681) product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 gene gldH CDS complement(14662..16206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 CDS complement(16433..16663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(16663..17664) product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993821.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 note possible pseudo, frameshifted CDS complement(17661..17906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10760 note possible pseudo, frameshifted CDS complement(17911..18942) product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 transl_table 11 codon_start 1 locus_tag LOCUS_10770 gene yceA CDS 19098..20234 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705471.1 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS 20382..21371 product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene asd CDS 21780..23225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS 23726..24013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS 24015..25268 product toxin HipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173917.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 CDS complement(25391..27586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(27613..29445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(29420..29575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(29628..29852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 sequence028 source 1..29644 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 1138..1347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 1357..2028 product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 transl_table 11 codon_start 1 locus_tag LOCUS_10890 gene trmB CDS 2298..3590 product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS complement(3587..4555) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963622.1 transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(4561..5928) product alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962905.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 gene rimK CDS complement(6066..7076) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 transl_table 11 codon_start 1 locus_tag LOCUS_10930 gene recA CDS complement(7188..8111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(8311..9576) product adenosylmethionine--8-amino-7-oxononanoate aminotransferase BioA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964417.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 gene bioA CDS complement(9649..10266) product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H210 transl_table 11 codon_start 1 locus_tag LOCUS_10960 gene bioD CDS complement(10268..11392) product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962298.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 gene bioF CDS 11612..13315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 13327..14946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 15201..16874 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 16885..18510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(18578..18871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS complement(18939..20450) product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 transl_table 11 codon_start 1 locus_tag LOCUS_11030 gene atpD CDS complement(20803..23532) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(23631..26960) product metalloprotease Fpp1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962407.1 transl_table 11 codon_start 1 locus_tag LOCUS_11050 gene fpp1 CDS 27145..28071 product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene ribF CDS 28184..29458 product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene serS sequence029 source 1..28944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(369..617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 911..1750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS complement(1817..3853) product DUF4954 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 4151..6190 product UPF0313 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB57 transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 6210..7829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 7969..10236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11130 CDS complement(10301..11098) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263941.1 transl_table 11 codon_start 1 locus_tag LOCUS_11140 gene ybiV CDS 11574..12176 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 12183..13418 product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762697.1 transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS 13511..14488 product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YZ5 transl_table 11 codon_start 1 locus_tag LOCUS_11170 gene argC CDS 14625..15761 product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 15973..16932 product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1E9 transl_table 11 codon_start 1 locus_tag LOCUS_11190 gene argF' CDS 16997..17773 product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene argB CDS 18017..19078 product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 19217..20500 product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D3 transl_table 11 codon_start 1 locus_tag LOCUS_11220 gene argH CDS complement(20829..21050) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 note possible pseudo, internal stop codon, frameshifted CDS complement(21115..22518) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 transl_table 11 codon_start 1 locus_tag LOCUS_11240 gene lpdA1 CDS 23046..26930 product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS 26996..27214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 27350..28795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 sequence030 source 1..28843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 153..1658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 1673..2416 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902128.1 transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 3028..3291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 3663..4922 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene pyrC2 CDS 4939..5580 product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(5582..6361) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 transl_table 11 codon_start 1 locus_tag LOCUS_11330 gene phnP CDS 6472..7926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963238.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS 7952..8506 product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS 8537..9049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 9056..9523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS 9495..9998 product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS 10098..11621 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 11636..12811 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 gene argD CDS 12890..13219 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 13241..13711 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963708.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS 13723..14349 product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 gene arsC CDS 14353..15396 product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826549.1 transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 15490..15681 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 15872..16273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 16275..17261 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N5W7 transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 17266..17475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS 17479..18966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 19448..19762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS 19892..21301 product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS 21367..21564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11520 note possible pseudo, frameshifted CDS 21512..22375 product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI68 transl_table 11 codon_start 1 locus_tag LOCUS_11530 gene add note possible pseudo, frameshifted CDS 22377..22829 product beta-D-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964154.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS complement(22830..23360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(23487..23897) product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene ygcM CDS complement(23898..24116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(24113..24628) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 gene idi CDS complement(24660..25361) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene rprY CDS complement(25371..26903) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene rprX CDS complement(27063..27641) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 gene coaE CDS complement(27638..28606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 sequence031 source 1..28446 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 648..1091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 1079..2665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 2769..6023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS complement(6090..8171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(8176..8616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(8616..10538) product putative glucosamine-6-phosphate deaminase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AB53 transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(10649..12223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797527.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(12228..15323) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203657.1 transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 15917..16591 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(16711..18030) product glucose/galactose MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 18229..20367 product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964572.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(20390..20848) product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763774.1 transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(21087..21368) product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FX59 transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS complement(21671..22162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 22149..22331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 22280..23176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS complement(23234..23881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(24105..25442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 25654..26961 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(27170..28270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 sequence032 source 1..28177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 861..1262 product preprotein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812026.1 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 1375..1872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 1872..2630 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 2667..3233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 3374..4102 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000724514.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS complement(4108..5319) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7USY7 transl_table 11 codon_start 1 locus_tag LOCUS_11890 gene dinB CDS complement(5319..8306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS 8359..9132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 9129..10487 product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(10533..12050) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 transl_table 11 codon_start 1 locus_tag LOCUS_11930 gene dnaB CDS 12286..13350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964034.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 13532..14011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 14152..14961 product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 15040..16272 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 16303..18519 product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 transl_table 11 codon_start 1 locus_tag LOCUS_11980 gene relA CDS 18718..19164 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene fur CDS 19185..20456 product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 transl_table 11 codon_start 1 locus_tag LOCUS_12000 gene purA CDS complement(20522..20881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(21050..22669) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963187.1 transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(22758..23225) product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H134 transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS complement(23317..24471) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268774.1 transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS complement(24768..27395) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 transl_table 11 codon_start 1 locus_tag LOCUS_12050 gene valS CDS 27556..28002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962565.1 transl_table 11 codon_start 1 locus_tag LOCUS_12060 sequence033 source 1..27991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 774..3119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 3216..4880 product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 4927..6381 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119603.1 transl_table 11 codon_start 1 locus_tag LOCUS_12090 gene arsA CDS 6583..8883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(8966..10207) product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 transl_table 11 codon_start 1 locus_tag LOCUS_12110 gene ilvA CDS complement(10353..11825) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene ilvC CDS complement(12019..12537) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790699.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS complement(12544..14259) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 transl_table 11 codon_start 1 locus_tag LOCUS_12140 gene ilvB CDS complement(14311..15990) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 transl_table 11 codon_start 1 locus_tag LOCUS_12150 gene ilvD CDS complement(16295..16975) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGE4 transl_table 11 codon_start 1 locus_tag LOCUS_12160 gene truA CDS complement(17084..18625) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS 19006..20166 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L6 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene leuA CDS 20358..22514 product sucrose-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene sps CDS 22517..23983 product glycosyhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120634.1 transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS 24223..25020 product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993515.1 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene cysE CDS 25038..25925 product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I526 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene cysM CDS complement(25976..27595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 note possible pseudo, internal stop codon CDS complement(27614..27853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 note possible pseudo, internal stop codon sequence034 source 1..27671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 284..1819 product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 transl_table 11 codon_start 1 locus_tag LOCUS_12250 gene glpA CDS 1955..2515 product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI4 transl_table 11 codon_start 1 locus_tag LOCUS_12260 gene rpsP CDS 2530..3054 product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 transl_table 11 codon_start 1 locus_tag LOCUS_12270 gene rimM CDS 3143..3853 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI6 transl_table 11 codon_start 1 locus_tag LOCUS_12280 CDS complement(3870..4259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12290 CDS 4389..4769 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS complement(4756..5118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 5261..6181 product inward rectifier potassium channel Irk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964090.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 gene irk CDS complement(6178..6366) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 6455..6841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 6857..7288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 7251..7508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS complement(7975..9543) product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650Q3 transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(9577..10575) product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 transl_table 11 codon_start 1 locus_tag LOCUS_12380 gene nadA CDS complement(10666..11742) product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 11924..12595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(12647..13528) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(13606..14544) product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 transl_table 11 codon_start 1 locus_tag LOCUS_12420 CDS complement(14546..15472) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 gene mvaK CDS complement(15586..16164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(16170..17252) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 gene mvaD CDS 17382..17618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 17636..20503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(20500..21720) product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(21743..22642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(22642..23922) product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 transl_table 11 codon_start 1 locus_tag LOCUS_12500 gene mvaA CDS 24064..25764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 25781..27124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 tRNA 27325..27399 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 sequence035 source 1..26702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1385..2437 product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337335.1 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 2569..3828 product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962682.1 transl_table 11 codon_start 1 locus_tag LOCUS_12540 note possible pseudo, internal stop codon CDS 3962..4099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 4059..4562 product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 4691..6109 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 6096..7268 product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027010.1 transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 7308..7589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 note possible pseudo, internal stop codon CDS 7774..9165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS 9281..11062 product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 gene fadD CDS complement(11059..13470) product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 transl_table 11 codon_start 1 locus_tag LOCUS_12620 gene priA CDS 13688..13909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS 13911..14423 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 transl_table 11 codon_start 1 locus_tag LOCUS_12640 gene bsaA CDS complement(14504..15391) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 transl_table 11 codon_start 1 locus_tag LOCUS_12650 gene phuW CDS complement(15541..16185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS complement(16263..18374) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202268.1 transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS complement(18584..20749) product NADPH flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS complement(20776..21252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 CDS complement(21257..22702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(22879..23169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(23277..23537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 note possible pseudo, internal stop codon CDS complement(23589..24182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 note possible pseudo, internal stop codon CDS 24347..24889 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 24889..25314 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(25301..26482) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 transl_table 11 codon_start 1 locus_tag LOCUS_12760 sequence036 source 1..26530 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(419..3772) product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 transl_table 11 codon_start 1 locus_tag LOCUS_12780 gene mfd CDS 3888..4508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(4560..6875) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769027.1 transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 7021..7695 product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 transl_table 11 codon_start 1 locus_tag LOCUS_12810 gene sirR CDS 7689..8507 product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS 8571..8999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS 9072..12251 product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962336.1 transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS 12591..13172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS 13263..16007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS 16008..16856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS 16849..18186 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228111.1 transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 18230..18985 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS 19000..19452 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(19549..20124) product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 transl_table 11 codon_start 1 locus_tag LOCUS_12910 gene pth CDS complement(20242..20853) product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 transl_table 11 codon_start 1 locus_tag LOCUS_12920 gene rplY CDS complement(20882..21823) product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 gene prsA tRNA 21964..22046 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 22298..22693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 22759..23229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS 23288..24010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS 24055..24222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS 24275..25381 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 CDS 25404..26249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962741.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 sequence037 source 1..25716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(843..2525) product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087135.1 transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 2778..8996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 9119..9988 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene lipA CDS 10193..11101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(11098..12528) product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 12635..13360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 13341..14177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963132.1 transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 14207..14746 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(14780..16087) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 gene surA CDS complement(16131..16931) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(16978..18873) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(18956..19237) product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS 19405..19938 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 transl_table 11 codon_start 1 locus_tag LOCUS_13120 CDS 20034..21881 product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene recQ2 CDS 21958..22902 product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene fmt CDS 23083..23355 product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene hupB CDS 23454..24011 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(24008..24835) product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 CDS complement(24922..25302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 tRNA 25430..25504 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 sequence038 source 1..25660 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(143..652) product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308861.1 transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(825..1442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963263.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS complement(1452..3089) product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 gene lepB CDS complement(3146..3847) product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 gene dapB CDS complement(3849..4424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(4425..5303) product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 gene parB CDS complement(5303..6067) product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene parA CDS complement(6206..8449) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964226.1 transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(8501..8926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS 9090..9791 product dipeptidase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 gene pepE CDS complement(9864..11015) product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 gene ribBA CDS complement(11012..12394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963702.1 transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS complement(12479..13123) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 gene lolA CDS complement(13143..15623) product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene ftsK CDS complement(15665..16042) product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963705.1 transl_table 11 codon_start 1 locus_tag LOCUS_13330 gene dgkA CDS complement(16042..16539) product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZY8 transl_table 11 codon_start 1 locus_tag LOCUS_13340 gene tpx CDS complement(16669..17301) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS complement(17490..17786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS complement(18081..19667) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 transl_table 11 codon_start 1 locus_tag LOCUS_13370 gene prfC CDS complement(19802..20110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS complement(20334..21038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS complement(21035..21766) product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS 21901..22875 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 22890..23393 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906361.1 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene ywfD CDS 23407..24324 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207085.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 24455..25009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 sequence039 source 1..25512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(144..1037) product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene gldA CDS 1181..1876 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene lipB CDS complement(1880..2950) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene fabH1 CDS complement(3101..4243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene porV CDS complement(4264..8094) product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 transl_table 11 codon_start 1 locus_tag LOCUS_13490 gene porU CDS 8292..9998 product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 gene gldJ CDS 10069..11319 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF0 transl_table 11 codon_start 1 locus_tag LOCUS_13510 gene murF CDS complement(11308..12162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(12309..14111) product O-glycosyl hydrolase family 13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072207.1 transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(14169..15776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(15824..18151) product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108625.1 transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS complement(18200..19141) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 CDS complement(19172..19735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 note possible pseudo, internal stop codon CDS complement(19802..20917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 note possible pseudo, internal stop codon CDS complement(21051..23375) product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS complement(23509..24162) product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 transl_table 11 codon_start 1 locus_tag LOCUS_13600 gene pgmB2 CDS complement(24165..25385) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 sequence040 source 1..24692 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 593..1318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 1439..2206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 2300..2890 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 2892..4964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964216.1 transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(4967..6925) product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 gene dsbD CDS complement(6956..8266) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 transl_table 11 codon_start 1 locus_tag LOCUS_13670 gene tilS CDS complement(8343..9635) product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene pabB CDS 9807..10160 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 note possible pseudo, internal stop codon CDS 10167..10544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 note possible pseudo, internal stop codon CDS 10537..11550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(11547..11996) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962585.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 gene apaG CDS complement(12035..13237) product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 transl_table 11 codon_start 1 locus_tag LOCUS_13730 CDS 13567..14919 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene nqrA CDS 14919..16088 product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64US0 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene nqrB CDS 16092..16802 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene nqrC CDS 16805..17476 product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene nqrD CDS 17490..18119 product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene nqrE CDS 18138..19424 product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 transl_table 11 codon_start 1 locus_tag LOCUS_13790 gene nqrF CDS 19605..19817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13800 CDS complement(19932..20198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13810 CDS complement(20198..20905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(21245..21415) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(21476..21838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(21898..22215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS complement(22303..22509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 note possible pseudo, internal stop codon CDS 22629..23489 product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962538.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS 23496..24521 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13880 sequence041 source 1..24442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(200..275) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS 401..1129 product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B4 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene coaX CDS 1171..2382 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964521.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS 2406..3758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785453.1 transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 3800..4369 product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 4369..4548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS 4571..5833 product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS 5996..8092 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(8380..10599) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 transl_table 11 codon_start 1 locus_tag LOCUS_13960 gene pnp CDS complement(10729..10998) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H184 transl_table 11 codon_start 1 locus_tag LOCUS_13970 gene rpsO CDS 11175..12029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964178.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 CDS complement(12072..12929) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene accD CDS complement(13031..14098) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 gene fbaA CDS complement(14246..16702) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962495.1 transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS 16932..17666 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(17669..18388) product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene porT CDS complement(18419..19150) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene menG CDS complement(19164..20060) product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964201.1 transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(20174..21586) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(21608..21910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 22651..24129 product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 transl_table 11 codon_start 1 locus_tag LOCUS_14080 gene proS tRNA 24317..24389 product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 sequence042 source 1..22549 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(124..624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 949..1956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(2036..2593) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS complement(2750..3661) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 gene aroB CDS 4185..4457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS 4587..8948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS 9031..10263 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 CDS 10265..10780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 10864..11922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 11926..12975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(13199..13339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14190 CDS complement(13318..13824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 note possible pseudo, internal stop codon, frameshifted CDS complement(13869..14129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14210 note possible pseudo, internal stop codon, frameshifted CDS 14800..16569 product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 gene typA CDS complement(16650..17096) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 17374..18162 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(18266..18937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(18934..19881) product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056913.1 transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(19883..21073) product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088458.1 transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS complement(21330..21497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 note possible pseudo, internal stop codon CDS complement(21879..22313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14290 sequence043 source 1..22226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(139..621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 CDS complement(618..1301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(1308..1757) product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14320 gene crtZ CDS complement(1754..2188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14330 CDS complement(2191..3030) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 transl_table 11 codon_start 1 locus_tag LOCUS_14340 gene crtB CDS complement(3027..4496) product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene crtI CDS complement(4537..5433) product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(5631..8204) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene parC CDS complement(8292..10142) product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene parE CDS complement(10473..10811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(10832..11257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 11485..12828 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 transl_table 11 codon_start 1 locus_tag LOCUS_14410 gene purB CDS 12939..13313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 13353..14123 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962881.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS 14548..18219 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXH5 transl_table 11 codon_start 1 locus_tag LOCUS_14440 gene purL CDS 18499..19578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 19736..20215 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 20337..21170 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442797.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS complement(21194..21385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(21530..21976) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 sequence044 source 1..22003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(87..1304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 1957..2472 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(2524..4506) product competence protein ComEC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964423.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(4641..5072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS complement(5078..6748) product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H070 transl_table 11 codon_start 1 locus_tag LOCUS_14540 gene menD CDS complement(6824..7879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962818.1 transl_table 11 codon_start 1 locus_tag LOCUS_14550 gene menF CDS complement(7890..8312) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 8456..8974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS complement(9054..10151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS complement(10278..10595) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS complement(10743..11702) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A146 transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(11946..12533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS complement(12667..15357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS complement(15441..16442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 16715..17170 product ecotin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CP09 transl_table 11 codon_start 1 locus_tag LOCUS_14640 gene eco CDS 17171..17659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 17632..17775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 17785..18924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(19095..20501) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(20545..21759) product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene fucA sequence045 source 1..21533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..1646) product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 transl_table 11 codon_start 1 locus_tag LOCUS_14700 gene fumC CDS 1890..2051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963717.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 2163..2639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS complement(3284..6112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(7529..8197) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962785.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(8187..9491) product L-gulonolactone oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS complement(9728..10072) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS complement(10113..10736) product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971156.1 transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(10744..11850) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene prfB CDS 12012..12545 product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 transl_table 11 codon_start 1 locus_tag LOCUS_14790 gene msrA CDS complement(12576..15059) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108606.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(15279..16667) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene lpdA2 CDS complement(16957..17568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS complement(17578..19371) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZP8 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene argS CDS 19526..20065 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964287.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 20072..20422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS 20466..20744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 20758..21069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 21080..21373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 sequence046 source 1..21375 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 355..1470 product MexX family efflux pump subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040155.1 transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS 1475..4690 product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706758.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 4680..6284 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798684.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 6396..8396 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 transl_table 11 codon_start 1 locus_tag LOCUS_14920 gene ligA CDS complement(8393..8743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(8821..9342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(9405..10877) product maltoporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JRU8 transl_table 11 codon_start 1 locus_tag LOCUS_14950 gene lamB CDS 11328..11741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 note possible pseudo, internal stop codon, frameshifted CDS 11815..12024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(12307..13131) product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 gene pyrF CDS 13290..13517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963325.1 transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 13507..14526 product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 14645..16225 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 gene dagA CDS 16296..17087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963324.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 17101..18285 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 18408..18605 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 transl_table 11 codon_start 1 locus_tag LOCUS_15040 gene rpsU CDS 18707..19585 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 gene xerC CDS 19592..19897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 tRNA 19997..20071 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 tRNA 20158..20239 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 tRNA 20284..20357 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 tRNA 20372..20444 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 sequence047 source 1..21239 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(108..548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(972..2450) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088384.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS complement(2443..3120) product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 transl_table 11 codon_start 1 locus_tag LOCUS_15090 gene trmD CDS complement(3223..4074) product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene prmC CDS 4179..5228 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 transl_table 11 codon_start 1 locus_tag LOCUS_15110 gene ribD CDS 5243..5500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 note possible pseudo, internal stop codon CDS 5528..5872 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 note possible pseudo, internal stop codon CDS complement(5878..6282) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 transl_table 11 codon_start 1 locus_tag LOCUS_15140 CDS 6446..7873 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 transl_table 11 codon_start 1 locus_tag LOCUS_15150 gene dnaA CDS 7877..8332 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 8344..9051 product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(9058..9723) product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963343.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(9765..10667) product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(10699..11733) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 transl_table 11 codon_start 1 locus_tag LOCUS_15200 gene pabC CDS complement(11726..12268) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(12283..13062) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene dapF CDS complement(13143..14705) product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(14739..16721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 16918..17511 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene rnhB CDS complement(17754..18584) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene folP CDS 18757..19299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS 19317..20285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(20409..21002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 sequence048 source 1..21182 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(258..1184) product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0W0 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene mdh CDS complement(1516..3453) product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 transl_table 11 codon_start 1 locus_tag LOCUS_15310 gene gyrB CDS 3830..5095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 5686..5955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS 5957..7357 product glutamyl-tRNA(Gln) amidotransferase subunit A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EX8 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene gatA2 CDS 7357..10692 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 11018..12412 product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 transl_table 11 codon_start 1 locus_tag LOCUS_15360 gene trpE CDS 12494..13069 product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 transl_table 11 codon_start 1 locus_tag LOCUS_15370 gene pabA CDS 13118..14104 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 transl_table 11 codon_start 1 locus_tag LOCUS_15380 gene trpD CDS 14267..15058 product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene trpC CDS 15142..15753 product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ2 transl_table 11 codon_start 1 locus_tag LOCUS_15400 gene trpF CDS 15784..16971 product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 transl_table 11 codon_start 1 locus_tag LOCUS_15410 gene trpB CDS 17148..18119 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS 18145..18912 product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ0 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene trpA CDS 19027..19161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS 19177..19827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 note possible pseudo, internal stop codon CDS 19949..21106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 sequence049 source 1..20482 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 127..972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS 1005..2729 product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 2814..4223 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS 4230..4895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS 5095..5865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 note possible pseudo, frameshifted CDS 5862..6236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 note possible pseudo, frameshifted CDS 6242..7798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 7817..8413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 8481..9761 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767556.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 note possible pseudo, frameshifted CDS 9775..10047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 10059..11720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 11831..14317 product chondroitin sulfate ABC lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2F5 transl_table 11 codon_start 1 locus_tag LOCUS_15580 note possible pseudo, internal stop codon CDS 14360..15688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 15898..17316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 17523..18926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 19077..20360 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15620 sequence050 source 1..20333 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..1308 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 1327..2649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 2819..4687 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 note possible pseudo, internal stop codon CDS 4727..6115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 note possible pseudo, internal stop codon CDS 6120..6806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS 6891..7631 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(7635..9518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(9622..11154) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 transl_table 11 codon_start 1 locus_tag LOCUS_15700 gene guaA CDS complement(11274..11786) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS 11962..14127 product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 gene pepX1 CDS 14140..15909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS 15929..16438 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(16433..17494) product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 transl_table 11 codon_start 1 locus_tag LOCUS_15750 gene menE CDS complement(17481..18434) product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 transl_table 11 codon_start 1 locus_tag LOCUS_15760 gene yyaK CDS complement(18436..19476) product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY1 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene menC CDS complement(19486..20163) product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 transl_table 11 codon_start 1 locus_tag LOCUS_15780 sequence051 source 1..20303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 420..809 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS 932..1840 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS 1837..2346 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15820 note possible pseudo, internal stop codon CDS 2467..2736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 2820..3521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 tRNA complement(3592..3666) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(3676..4125) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS complement(4253..6391) product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene ftsZ CDS complement(6441..7811) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 transl_table 11 codon_start 1 locus_tag LOCUS_15870 gene ftsA CDS complement(7815..8537) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964154.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene ftsQ CDS complement(8576..9922) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 transl_table 11 codon_start 1 locus_tag LOCUS_15890 gene murC CDS complement(9924..11015) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 transl_table 11 codon_start 1 locus_tag LOCUS_15900 gene murG CDS complement(11028..12230) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene ftsW CDS complement(12243..13580) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene murD CDS complement(13594..14823) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene mraY CDS complement(14837..16300) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 transl_table 11 codon_start 1 locus_tag LOCUS_15940 gene murE CDS complement(16301..18319) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 gene ftsI CDS complement(18321..18635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(18637..19545) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 transl_table 11 codon_start 1 locus_tag LOCUS_15970 gene rsmH CDS complement(19529..19954) product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 transl_table 11 codon_start 1 locus_tag LOCUS_15980 gene mraZ sequence052 source 1..19971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(173..1291) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963093.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(1400..2086) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_16000 gene folE2 CDS complement(2110..3486) product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 transl_table 11 codon_start 1 locus_tag LOCUS_16010 gene hisS CDS complement(3757..5151) product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 transl_table 11 codon_start 1 locus_tag LOCUS_16020 gene pntB CDS complement(5202..5510) product NADP transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 gene pntA CDS complement(5522..6622) product NAD(P) transhydrogenase subunit alpha part 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSB2 transl_table 11 codon_start 1 locus_tag LOCUS_16040 gene pntAA CDS complement(7322..7600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(7634..8356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(8407..8934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(9015..9917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 transl_table 11 codon_start 1 locus_tag LOCUS_16080 gene yfkH CDS complement(9938..10795) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963961.1 transl_table 11 codon_start 1 locus_tag LOCUS_16090 gene nadC CDS 10925..11398 product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene rlmH CDS 11858..12052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 12062..12214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(12215..13447) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962902.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(13447..15738) product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS 16000..16593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(16595..17143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 17261..17893 product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 17945..18760 product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 18869..19813 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene oxyR sequence053 source 1..19801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..1105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 1233..2435 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene aspC2 CDS 2441..3451 product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene murB CDS 3460..4644 product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208260.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS complement(5010..5843) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001013490.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS complement(5860..6144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS complement(6145..6612) product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790230.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS complement(6634..7617) product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 gene manA CDS complement(7692..8441) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS complement(8616..9488) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 transl_table 11 codon_start 1 locus_tag LOCUS_16290 gene sucD CDS 9952..11049 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS 11063..12298 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS 12311..12661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 note possible pseudo, internal stop codon CDS 12671..12979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 note possible pseudo, internal stop codon CDS 12918..13745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 13782..14684 product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS 14694..14834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 note possible pseudo, internal stop codon CDS 14838..15326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 note possible pseudo, frameshifted CDS 15363..15590 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 note possible pseudo, frameshifted CDS complement(15644..15793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS complement(15849..16433) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 16712..19534 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 transl_table 11 codon_start 1 locus_tag LOCUS_16410 gene uvrA1 sequence054 source 1..19098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(133..696) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079938.1 transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(709..1791) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene gcvT CDS complement(2088..3386) product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS complement(3432..4355) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 transl_table 11 codon_start 1 locus_tag LOCUS_16450 gene thrB CDS complement(4437..6887) product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 7456..8907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(8970..10175) product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(10349..10747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 note possible pseudo, internal stop codon CDS complement(10814..11575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 note possible pseudo, internal stop codon CDS 11855..12259 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 12468..12809 product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P3 transl_table 11 codon_start 1 locus_tag LOCUS_16520 gene rpsF CDS 12815..13111 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 transl_table 11 codon_start 1 locus_tag LOCUS_16530 gene rpsR CDS 13127..13573 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P1 transl_table 11 codon_start 1 locus_tag LOCUS_16540 gene rplI CDS 13695..14321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS 14337..14810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963953.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS 14811..15251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 note possible pseudo, frameshifted CDS 15248..15487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 note possible pseudo, frameshifted CDS 16214..16468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 note possible pseudo, internal stop codon CDS 16987..17376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 17465..17701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS 17734..18291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS 18302..18685 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 sequence055 source 1..18542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 125..583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 673..1026 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 transl_table 11 codon_start 1 locus_tag LOCUS_16650 gene rplS CDS complement(1045..2577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 CDS complement(2587..3240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 3656..5866 product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS complement(5922..6947) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS 7194..7622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 note possible pseudo, internal stop codon CDS 7689..8240 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 note possible pseudo, internal stop codon CDS 8314..8982 product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(9053..10042) product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 10414..10755 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 note possible pseudo, frameshifted CDS 10679..11428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 note possible pseudo, frameshifted CDS 11440..13092 product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene garD CDS 13149..14585 product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 transl_table 11 codon_start 1 locus_tag LOCUS_16770 gene uxaB CDS 14638..15465 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122505.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS 15476..15688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS 15803..16267 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 note possible pseudo, internal stop codon CDS 16355..17260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 note possible pseudo, internal stop codon CDS 17276..17677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 note possible pseudo, internal stop codon CDS 17684..18028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767034.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 sequence056 source 1..18389 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..1180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 note possible pseudo, frameshifted CDS complement(1149..1559) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 2332..2916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932797.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS complement(3499..5814) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 CDS complement(5977..8319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS complement(8564..11416) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 11798..13309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 13332..16349 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108774.1 transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 16495..18222 product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 transl_table 11 codon_start 1 locus_tag LOCUS_16920 sequence057 source 1..18351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 794..2389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS 2542..2973 product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene dut CDS 3022..4389 product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964479.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(4476..5798) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene sufD CDS complement(5810..6562) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene sufC CDS complement(6643..8091) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 transl_table 11 codon_start 1 locus_tag LOCUS_16980 gene sufB CDS complement(8122..8451) product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene sufA CDS complement(8612..8977) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS 9344..10399 product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene thiL CDS complement(10461..11741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 CDS complement(11902..12360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(13335..15200) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 CDS 15470..17086 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 gene gsiA CDS 17279..17842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 17899..18231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17070 sequence058 source 1..18228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..575) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 transl_table 11 codon_start 1 locus_tag LOCUS_17080 gene ndk CDS complement(677..853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(854..1825) product alpha-hydroxy-acid oxidizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972226.1 transl_table 11 codon_start 1 locus_tag LOCUS_17100 gene lldA note possible pseudo, internal stop codon CDS complement(2086..2943) product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039137.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS complement(2962..3741) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(3768..5429) product D-galactarate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 gene garD CDS complement(5572..6393) product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767385.1 transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(6642..6962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(7134..7373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS complement(7488..7706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS complement(7955..8242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(8281..9201) product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362003.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(9254..9601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963519.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(9761..10414) product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 transl_table 11 codon_start 1 locus_tag LOCUS_17210 gene tal CDS 10842..11591 product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 transl_table 11 codon_start 1 locus_tag LOCUS_17220 gene truA CDS 11584..13365 product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(13362..14195) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202009.1 transl_table 11 codon_start 1 locus_tag LOCUS_17240 CDS complement(14199..14990) product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 transl_table 11 codon_start 1 locus_tag LOCUS_17250 gene nadE CDS 15363..16064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(16305..17822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 rRNA complement(18113..18216) product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 locus_tag LOCUS_r00010 sequence059 source 1..18202 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(278..622) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 transl_table 11 codon_start 1 locus_tag LOCUS_17280 gene rplT CDS complement(716..913) product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene rpmI CDS complement(963..1421) product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 gene infC CDS complement(1560..3500) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 transl_table 11 codon_start 1 locus_tag LOCUS_17310 gene thrS CDS 3669..4442 product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 4448..4933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962916.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 5003..7876 product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS complement(7883..8590) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 transl_table 11 codon_start 1 locus_tag LOCUS_17350 CDS complement(8593..11340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 11404..11745 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 11842..12657 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 12777..13730 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963936.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(13787..13915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS complement(13928..14401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 note possible pseudo, internal stop codon CDS complement(14411..14728) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(14725..15342) product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYN3 transl_table 11 codon_start 1 locus_tag LOCUS_17430 gene udk CDS complement(15483..15917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(15947..16309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31580 transl_table 11 codon_start 1 locus_tag LOCUS_17450 gene yfhL CDS complement(16659..17333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(17665..17943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 sequence060 source 1..17788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(159..401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS complement(460..726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963895.1 transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS complement(800..1504) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962235.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(1495..2223) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYA2 transl_table 11 codon_start 1 locus_tag LOCUS_17510 gene kdsB CDS 2497..3198 product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E4S2 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene aqpZ CDS 3221..3823 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000622462.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 3933..4082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS 4287..4622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS complement(4637..4837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 CDS 4743..5993 product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 gene deaD-2 CDS 6142..6333 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017957.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene cspC CDS complement(6506..8143) product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 8226..9542 product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS 9563..10216 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS 10286..11173 product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 11190..11561 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MF2 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 11568..11963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(11972..12913) product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(12950..14446) product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(14644..17100) product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 transl_table 11 codon_start 1 locus_tag LOCUS_17670 gene lon CDS complement(17284..17634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 sequence061 source 1..17478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(1043..2638) product phosphonate monoester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083258.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(2743..3900) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763274.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(3905..4339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 note possible pseudo, internal stop codon CDS complement(4379..4519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(4529..5671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 note possible pseudo, internal stop codon CDS complement(5676..8351) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767769.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 note possible pseudo, frameshifted CDS complement(8362..8904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17760 note possible pseudo, frameshifted CDS 9513..9971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 10169..11095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS complement(11375..12784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS complement(12874..14247) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118376.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(14343..15551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(15636..16328) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17820 note possible pseudo, frameshifted CDS complement(16330..17013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 note possible pseudo, frameshifted sequence062 source 1..17079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(372..1295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(1305..2972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(3091..5583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(5750..6514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(6518..6772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(6777..7979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(7979..10252) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963893.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(10378..10770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(10803..11696) product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 transl_table 11 codon_start 1 locus_tag LOCUS_17920 gene menA CDS complement(11708..12895) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 transl_table 11 codon_start 1 locus_tag LOCUS_17930 gene mnmA CDS complement(12983..13669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(13719..14720) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene holA CDS 14879..15226 product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 15341..16333 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 16371..16973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 sequence063 source 1..16991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(91..765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(951..1412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(1466..2656) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(2661..3281) product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765040.1 transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS complement(3272..4486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS complement(4497..5669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 transl_table 11 codon_start 1 locus_tag LOCUS_18040 CDS complement(5653..6855) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765881.1 transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS complement(6879..7820) product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS complement(7892..9373) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS complement(9517..10881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 CDS complement(10882..13245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794512.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS complement(13256..13951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS complement(14273..15460) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793362.1 transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS complement(15499..15885) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(15902..16840) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 transl_table 11 codon_start 1 locus_tag LOCUS_18130 sequence064 source 1..16541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(318..392) product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS complement(447..1163) product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(1167..1820) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene bsaA CDS 1819..2583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2567..3094 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 gene kdsC CDS complement(3091..3852) product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene pssA CDS 4030..4929 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404958.1 transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS 5009..6115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 6120..7706 product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 transl_table 11 codon_start 1 locus_tag LOCUS_18210 gene lnt CDS 7908..9542 product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(9543..10337) product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS 10439..10891 product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MS5 transl_table 11 codon_start 1 locus_tag LOCUS_18240 gene msrB CDS 10895..11290 product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 gene mrsB2 CDS 11569..11754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 CDS 11835..13163 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene ffh CDS 13194..14066 product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene folD CDS complement(14100..15119) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS complement(15132..16058) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458367.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS complement(16149..16349) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18310 sequence065 source 1..16208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 141..530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 679..2010 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 gene cydA CDS 2014..3090 product cytochrome D oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 gene cydB CDS 3093..3806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531709.1 transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(3795..4196) product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(4193..4915) product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 transl_table 11 codon_start 1 locus_tag LOCUS_18370 gene pcrB CDS complement(4920..5543) product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18380 gene sfp CDS 5600..6916 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 transl_table 11 codon_start 1 locus_tag LOCUS_18390 gene ahcY CDS 7112..7624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS 7608..7907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18410 note possible pseudo, internal stop codon CDS 8136..8549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 8603..9121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS 9209..9778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS 9802..10389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 note possible pseudo, frameshifted CDS 10561..13881 product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108634.1 transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS 13887..15401 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS 15432..15938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 sequence066 source 1..16029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 99..326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 547..1806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 1870..3213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895440.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 3316..4368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 4390..5817 product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(6317..7666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 note possible pseudo, frameshifted CDS complement(7720..10479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 note possible pseudo, frameshifted CDS complement(10604..11923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS 12579..13514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 note possible pseudo, internal stop codon CDS 13596..15815 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 note possible pseudo, internal stop codon sequence067 source 1..15948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 note possible pseudo, frameshifted CDS complement(737..880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(914..1267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18610 note possible pseudo, internal stop codon CDS complement(1289..1654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18620 note possible pseudo, internal stop codon CDS complement(2026..2844) product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(3068..4777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(4811..7867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 8026..8709 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene ftsE CDS complement(8712..9944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255207.1 transl_table 11 codon_start 1 locus_tag LOCUS_18670 CDS complement(10082..11380) product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene phrB1 CDS complement(11391..12293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18690 CDS complement(12360..13466) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986993.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(13889..14302) product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TD72 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene hisI CDS 15307..15534 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964002.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(15531..15800) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 sequence068 source 1..15484 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 171..1106 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 1276..1497 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18750 CDS complement(1501..2643) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS 2768..3676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(3677..4231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(4234..5022) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 CDS complement(5068..5946) product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS complement(5959..8208) product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene recQ1 CDS 8237..9148 product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 transl_table 11 codon_start 1 locus_tag LOCUS_18820 gene kdsD CDS 9235..10041 product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene tatC CDS 10061..10798 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 gene lptB CDS complement(10867..11874) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 gene fabH2 CDS complement(11956..12093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS complement(12103..12420) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18870 note possible pseudo, internal stop codon CDS complement(12523..14865) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene uvrD CDS 15021..15368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence069 source 1..15404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 102..710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS complement(716..1816) product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 transl_table 11 codon_start 1 locus_tag LOCUS_18910 gene smf CDS 1914..2813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS complement(2817..3596) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962331.1 transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS complement(3611..4414) product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KNF3 transl_table 11 codon_start 1 locus_tag LOCUS_18940 gene proC CDS complement(4496..5788) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene pepP CDS 5885..6511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS 6669..8531 product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795334.1 transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS 8859..9455 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 transl_table 11 codon_start 1 locus_tag LOCUS_18980 gene sdhC CDS 9468..11489 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 transl_table 11 codon_start 1 locus_tag LOCUS_18990 gene sdhA CDS 11497..12237 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 transl_table 11 codon_start 1 locus_tag LOCUS_19000 gene sdhB CDS complement(12417..12677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 12634..13668 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 note possible pseudo, internal stop codon CDS 13892..14779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 15080..15298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 sequence070 source 1..15370 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(369..611) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 note possible pseudo, frameshifted CDS complement(598..3066) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962441.1 transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(3073..3879) product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 4041..4754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962437.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 4790..5404 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 transl_table 11 codon_start 1 locus_tag LOCUS_19090 CDS complement(5416..6957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(7052..9358) product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 transl_table 11 codon_start 1 locus_tag LOCUS_19110 gene hppA1 CDS complement(9489..10016) product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH9 transl_table 11 codon_start 1 locus_tag LOCUS_19120 gene ppa CDS complement(10193..11182) product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene pdhB CDS 11493..12239 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene etfB CDS 12289..13248 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 transl_table 11 codon_start 1 locus_tag LOCUS_19150 gene etfA CDS 13351..13959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 14098..14922 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 transl_table 11 codon_start 1 locus_tag LOCUS_19170 gene thyA sequence071 source 1..15144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(72..248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 402..1235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS 1245..1541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(1586..1966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS complement(2445..3449) product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 3726..6533 product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS 6537..7022 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS complement(7026..8378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS complement(8403..9221) product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 transl_table 11 codon_start 1 locus_tag LOCUS_19260 gene panB CDS complement(9363..9857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS complement(9926..10234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 CDS 11238..11657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS 11666..11923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS 11943..12584 product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(12677..12949) product Sec-independent protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 CDS 13191..14168 product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107708.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 CDS 14161..14856 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 sequence072 source 1..14913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS complement(399..806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS complement(867..3080) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG0 transl_table 11 codon_start 1 locus_tag LOCUS_19370 CDS 3234..3899 product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 transl_table 11 codon_start 1 locus_tag LOCUS_19380 gene ung2 CDS complement(3914..4264) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(4274..4453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS complement(4456..5406) product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS complement(5412..6146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962891.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(6157..6606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962892.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS complement(6699..7469) product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(7469..8656) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS 8715..8873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 CDS 8839..10887 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 tRNA 11149..11236 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 tRNA 11261..11336 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 tRNA 11379..11453 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 CDS 11771..13036 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS 13083..13604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 note possible pseudo, internal stop codon CDS 13671..13934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19500 note possible pseudo, internal stop codon CDS 14157..14432 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963652.1 transl_table 11 codon_start 1 locus_tag LOCUS_19510 sequence073 source 1..14678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(192..971) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_19520 gene fjo11 CDS 1157..1606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 2206..3237 product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880041.1 transl_table 11 codon_start 1 locus_tag LOCUS_19540 gene ctaA CDS 3330..4391 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 transl_table 11 codon_start 1 locus_tag LOCUS_19550 gene aroC CDS complement(4388..5077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 5288..5719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 5762..6022 product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 transl_table 11 codon_start 1 locus_tag LOCUS_19580 gene rpmA CDS 6125..7381 product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 transl_table 11 codon_start 1 locus_tag LOCUS_19590 gene kdtA CDS 7550..8545 product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747W9 transl_table 11 codon_start 1 locus_tag LOCUS_19600 gene moaA CDS 8556..9017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 9050..10264 product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 transl_table 11 codon_start 1 locus_tag LOCUS_19620 gene moeA CDS 10347..10781 product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIP3 transl_table 11 codon_start 1 locus_tag LOCUS_19630 gene moaC CDS 10782..11903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 11910..12797 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001376869.1 transl_table 11 codon_start 1 locus_tag LOCUS_19650 gene yneE CDS 12804..14576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 transl_table 11 codon_start 1 locus_tag LOCUS_19660 sequence074 source 1..13126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 tRNA complement(1345..1427) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS 1523..2911 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(3041..3769) product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970873.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(3799..4416) product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974692.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS complement(4498..4848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(4895..5365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS complement(5417..6547) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS complement(6654..11153) product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 transl_table 11 codon_start 1 locus_tag LOCUS_19740 gene dnaE CDS complement(11657..12193) product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705037.1 transl_table 11 codon_start 1 locus_tag LOCUS_19750 CDS 12287..12931 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19760 sequence075 source 1..12973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(288..363) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(420..1640) product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene folC CDS complement(1700..2458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(2545..2937) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203536.1 transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS complement(2950..3639) product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(3802..5331) product Na(+)/H(+) antiporter NhaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2S5 transl_table 11 codon_start 1 locus_tag LOCUS_19810 gene nhaB CDS complement(5566..6624) product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS 6746..7885 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 7979..9085 product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS complement(9182..9796) product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z749 transl_table 11 codon_start 1 locus_tag LOCUS_19850 gene pcgL CDS 9935..10174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 10200..10373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS 10384..11193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263015.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS 11217..11924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS complement(12017..12814) product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147838.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 sequence076 source 1..12920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 128..907 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 1261..2418 product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 transl_table 11 codon_start 1 locus_tag LOCUS_19920 gene gci CDS 2433..3203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 note possible pseudo, frameshifted CDS 3148..3888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 note possible pseudo, frameshifted CDS 3891..4652 product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814132.1 transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 4680..5396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 note possible pseudo, internal stop codon CDS 5457..5675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(5814..6044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 5959..6273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 note possible pseudo, frameshifted CDS 6246..7124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20000 note possible pseudo, internal stop codon, frameshifted CDS 7215..7904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 note possible pseudo, frameshifted CDS 7911..8585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 note possible pseudo, internal stop codon CDS 8592..9380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 note possible pseudo, internal stop codon CDS 9730..9930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 9961..10284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 10490..11923 product carbon starvation protein CstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS 11993..12154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(12211..12750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 sequence077 source 1..12913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS complement(503..3358) product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 transl_table 11 codon_start 1 locus_tag LOCUS_20100 gene carB CDS 4037..5950 product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene htpG CDS complement(6179..7426) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 CDS 7742..8479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS complement(8671..8838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 9231..9857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 CDS complement(9987..10325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20160 note possible pseudo, internal stop codon, frameshifted CDS complement(10333..10713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 note possible pseudo, frameshifted CDS complement(10748..11038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20180 note possible pseudo, internal stop codon CDS complement(11014..12219) product sugar phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 CDS complement(12216..12617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20200 sequence078 source 1..12890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(214..1965) product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_20210 gene ctaD CDS complement(2025..3092) product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 gene ctaC CDS complement(3130..4551) product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene actF CDS complement(4580..5134) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene actE CDS complement(5139..5663) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 gene actD CDS complement(5656..7053) product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 gene actC CDS complement(7085..10150) product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 transl_table 11 codon_start 1 locus_tag LOCUS_20270 gene actB CDS complement(10186..11370) product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 transl_table 11 codon_start 1 locus_tag LOCUS_20280 gene actA CDS 11859..12200 product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(12233..12577) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 sequence079 source 1..12878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(200..1453) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 CDS 1584..2705 product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2779..3201) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 transl_table 11 codon_start 1 locus_tag LOCUS_20330 gene ndk CDS 3395..4426 product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 transl_table 11 codon_start 1 locus_tag LOCUS_20340 gene fjo19 CDS 4416..4949 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 transl_table 11 codon_start 1 locus_tag LOCUS_20350 gene gldI CDS 4974..5945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS 5950..6807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20370 CDS 6896..7930 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963994.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene ppiB CDS 7930..8490 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 CDS complement(8549..8911) product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 CDS complement(8996..10747) product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS 10925..11863 product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 transl_table 11 codon_start 1 locus_tag LOCUS_20420 gene nusB CDS 11934..12383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS 12410..12709 product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 transl_table 11 codon_start 1 locus_tag LOCUS_20440 gene yajC sequence080 source 1..12572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 247..1128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 1242..2516 product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 transl_table 11 codon_start 1 locus_tag LOCUS_20460 gene glyA CDS 2606..2953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20470 CDS 3027..3188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20480 CDS 3309..3587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20490 CDS 3654..4133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20500 note possible pseudo, internal stop codon, frameshifted CDS 4807..5379 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS 5455..6207 product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 transl_table 11 codon_start 1 locus_tag LOCUS_20520 gene aroE CDS 6325..8247 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963876.1 transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(8463..10367) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U2 transl_table 11 codon_start 1 locus_tag LOCUS_20540 gene yidC CDS complement(10398..12026) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 transl_table 11 codon_start 1 locus_tag LOCUS_20550 gene pyrG sequence081 source 1..12546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20560 note possible pseudo, internal stop codon CDS 641..1915 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(1917..2720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS 2844..3989 product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048106.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS 4007..5260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 CDS complement(5281..6180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(6173..7483) product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582954.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(7519..8214) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 gene radC CDS 8343..9692 product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 9696..11201 product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109098.1 transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 11277..11816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(11909..12382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 sequence082 source 1..12377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20680 CDS complement(558..1439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS complement(1755..1970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2587..2709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 2721..3281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS complement(3290..3538) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(3809..4081) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS 4705..4956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(5136..5852) product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(6021..6185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(6415..6765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 CDS complement(6792..7982) product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460506.1 transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS complement(7982..10078) product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q726S7 transl_table 11 codon_start 1 locus_tag LOCUS_20800 gene pta CDS complement(10288..11916) product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 12048..12257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 sequence083 source 1..12264 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..1080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS complement(1138..1488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS complement(1607..2551) product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 transl_table 11 codon_start 1 locus_tag LOCUS_20850 CDS 2871..3071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20860 CDS 3173..5035 product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR6 transl_table 11 codon_start 1 locus_tag LOCUS_20870 gene thiC CDS 5056..5721 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962598.1 transl_table 11 codon_start 1 locus_tag LOCUS_20880 gene thiE1 CDS 5759..6094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS 6081..6875 product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962599.1 transl_table 11 codon_start 1 locus_tag LOCUS_20900 gene thiD CDS 7006..7659 product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWR9 transl_table 11 codon_start 1 locus_tag LOCUS_20910 gene thiE CDS 7671..8081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS 8157..8927 product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS0 transl_table 11 codon_start 1 locus_tag LOCUS_20930 gene thiG CDS 8970..9323 product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963769.1 transl_table 11 codon_start 1 locus_tag LOCUS_20940 CDS 9323..10489 product thiamine biosynthesis protein ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 gene thiH CDS 10710..11540 product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 transl_table 11 codon_start 1 locus_tag LOCUS_20960 gene kdsA CDS 11540..12166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 sequence084 source 1..11567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..2691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS 3311..4963 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962591.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 CDS 4970..6325 product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962590.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 CDS 6328..7812 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS complement(7816..9546) product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207455.1 transl_table 11 codon_start 1 locus_tag LOCUS_21020 gene phoD CDS complement(9695..10348) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798355.1 transl_table 11 codon_start 1 locus_tag LOCUS_21030 note possible pseudo, internal stop codon CDS complement(10354..11382) product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203499.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 sequence085 source 1..11026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(191..571) product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 transl_table 11 codon_start 1 locus_tag LOCUS_21050 gene gcvH CDS complement(689..7720) product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 transl_table 11 codon_start 1 locus_tag LOCUS_21060 gene sprA CDS complement(7796..8377) product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 transl_table 11 codon_start 1 locus_tag LOCUS_21070 gene ruvA CDS complement(8411..10684) product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 gene maeB sequence086 source 1..10983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 583..996 product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388926.1 transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS complement(993..1493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS complement(1655..2185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21120 CDS 2443..2700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21130 CDS 2700..3329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 3393..4295 product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ4 transl_table 11 codon_start 1 locus_tag LOCUS_21150 gene cysD CDS 4408..5655 product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 transl_table 11 codon_start 1 locus_tag LOCUS_21160 gene cysN CDS 5811..7907 product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 CDS 7967..8728 product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS 8728..9306 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS 9380..10435 product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 10440..10766 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 transl_table 11 codon_start 1 locus_tag LOCUS_21210 sequence087 source 1..10847 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(276..1082) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene lgt CDS complement(1079..1279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21230 CDS complement(1339..2817) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene cysS CDS complement(2965..3444) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962999.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS complement(3534..4613) product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 CDS 4910..5362 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 CDS complement(5449..7911) product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS complement(8001..8912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 CDS 8994..9563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS 9566..10675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121267.1 transl_table 11 codon_start 1 locus_tag LOCUS_21310 sequence088 source 1..10843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 591..1463 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205074.1 transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 1729..2205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 2365..5343 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 transl_table 11 codon_start 1 locus_tag LOCUS_21340 gene secDF CDS 5431..5967 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 transl_table 11 codon_start 1 locus_tag LOCUS_21350 gene hpt CDS 5973..6548 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 transl_table 11 codon_start 1 locus_tag LOCUS_21360 gene adk CDS 6589..7578 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 transl_table 11 codon_start 1 locus_tag LOCUS_21370 gene obg CDS complement(7604..8083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS 8211..8714 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962389.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 CDS 8974..10671 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 transl_table 11 codon_start 1 locus_tag LOCUS_21400 gene lysS sequence089 source 1..10833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(172..1692) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(1776..2255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(2348..3292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(3534..4736) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123170.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 gene bcr CDS complement(4936..5241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS complement(5430..5609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(5612..6406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS complement(6422..7702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 CDS complement(7814..8071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS complement(8129..8590) product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947704.1 transl_table 11 codon_start 1 locus_tag LOCUS_21500 note possible pseudo, internal stop codon CDS complement(8693..9040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS complement(9285..9509) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS complement(9573..10022) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(9956..10180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21540 CDS complement(10445..10708) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 note possible pseudo, internal stop codon sequence090 source 1..10809 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..738) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963018.1 transl_table 11 codon_start 1 locus_tag LOCUS_21560 CDS 1099..1881 product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS 1892..3544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(3550..4950) product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(5140..6933) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 gene rpsA CDS 7307..9133 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS 9223..10635 product tRNA (uracil-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962893.1 transl_table 11 codon_start 1 locus_tag LOCUS_21620 gene trmA sequence091 source 1..10774 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 194..721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS 767..1042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS 1367..1597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS 1608..1859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21660 CDS complement(1938..3194) product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 transl_table 11 codon_start 1 locus_tag LOCUS_21670 gene metK CDS 3580..4854 product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 gene metY CDS 5229..5570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 5868..6842 product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 transl_table 11 codon_start 1 locus_tag LOCUS_21700 gene metX CDS 6890..9310 product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095509.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 9384..10556 product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JM6 transl_table 11 codon_start 1 locus_tag LOCUS_21720 gene metZ sequence092 source 1..10682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(168..1409) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 transl_table 11 codon_start 1 locus_tag LOCUS_21730 CDS complement(1431..1769) product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 transl_table 11 codon_start 1 locus_tag LOCUS_21740 CDS complement(1882..3189) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDS3 transl_table 11 codon_start 1 locus_tag LOCUS_21750 gene amtB CDS complement(3264..4280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(4756..5520) product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C6S5 transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 5760..6014 product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS 6042..7730 product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933466.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS 7758..9662 product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 transl_table 11 codon_start 1 locus_tag LOCUS_21800 gene acsA CDS complement(9713..10390) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932717.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene dnaQ sequence093 source 1..10391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS complement(572..1156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21830 CDS complement(1223..1822) product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 CDS complement(1835..3241) product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene leuC CDS 3658..4365 product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393787.1 transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(4864..5037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS complement(5206..5943) product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene pphA CDS 6069..6608 product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762785.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS complement(6597..7949) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR4 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene mgtE CDS complement(7936..8709) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene rsmA CDS complement(8774..9100) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS 9289..9633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 9833..10270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 sequence094 source 1..10390 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 182..382 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gagacttcgacaggctcagcctccg CDS 457..750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404971.1 transl_table 11 codon_start 1 locus_tag LOCUS_21950 CDS complement(709..897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS complement(968..1816) product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 gene tktA CDS 2069..3217 product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 3479..3706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 3707..5758 product restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071650.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS 5791..7233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 7226..8056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 8311..10269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 sequence095 source 1..10285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 note possible pseudo, internal stop codon CDS 706..912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 CDS 967..1191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS complement(1522..1785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(1804..3735) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22080 note possible pseudo, internal stop codon CDS 3895..4755 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767033.1 transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 4854..5492 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS 5517..6602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 6613..7431 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS 7435..8355 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 transl_table 11 codon_start 1 locus_tag LOCUS_22130 gene miaA CDS 8367..8858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS 8947..10113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 sequence096 source 1..10025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS complement(457..939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 CDS complement(1693..2298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS complement(2301..3008) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964288.1 transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(3073..3612) product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261608.1 transl_table 11 codon_start 1 locus_tag LOCUS_22200 gene rpoE2 CDS complement(4217..5050) product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RQ5 transl_table 11 codon_start 1 locus_tag LOCUS_22210 gene rlmF CDS complement(5499..6464) product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2H9 transl_table 11 codon_start 1 locus_tag LOCUS_22220 CDS 6920..8008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457949.1 transl_table 11 codon_start 1 locus_tag LOCUS_22230 CDS 8023..9051 product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000735359.1 transl_table 11 codon_start 1 locus_tag LOCUS_22240 gene metE CDS 9081..9917 product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KEX2 transl_table 11 codon_start 1 locus_tag LOCUS_22250 sequence097 source 1..9896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(582..944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 note possible pseudo, internal stop codon CDS complement(1041..1661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22280 note possible pseudo, internal stop codon CDS complement(1900..2514) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738964.1 transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(2517..2780) product acyl-CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962768.1 transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(2793..3443) product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 transl_table 11 codon_start 1 locus_tag LOCUS_22310 gene psd CDS complement(3433..4245) product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 transl_table 11 codon_start 1 locus_tag LOCUS_22320 gene cdsA CDS complement(4250..4843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962765.1 transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(4886..6892) product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene ftsH CDS complement(6919..7290) product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 transl_table 11 codon_start 1 locus_tag LOCUS_22350 gene rsfS CDS 7376..8110 product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 gene birA CDS complement(8124..8513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962824.1 transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS complement(8535..9176) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 transl_table 11 codon_start 1 locus_tag LOCUS_22380 gene pyrE CDS 9061..9774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22390 sequence098 source 1..9778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 CDS complement(570..3344) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974111.1 transl_table 11 codon_start 1 locus_tag LOCUS_22410 gene acnB CDS complement(4109..5236) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 transl_table 11 codon_start 1 locus_tag LOCUS_22420 gene dnaJ CDS complement(5320..5880) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF2 transl_table 11 codon_start 1 locus_tag LOCUS_22430 gene grpE CDS complement(6024..7334) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 transl_table 11 codon_start 1 locus_tag LOCUS_22440 gene murA CDS complement(7383..8060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS complement(8226..8960) product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887469.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS complement(9009..9605) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 sequence099 source 1..9773 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..1757) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963094.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(1943..2368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 transl_table 11 codon_start 1 locus_tag LOCUS_22490 CDS complement(2449..4428) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene dnaK CDS complement(4526..5743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22510 CDS complement(5740..6105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074110.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(6114..6872) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(6891..7934) product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(7936..8490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 8582..9556 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 transl_table 11 codon_start 1 locus_tag LOCUS_22560 gene ddl sequence100 source 1..9762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(121..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS complement(2672..3523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS complement(3763..5193) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22590 CDS complement(5252..6709) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22600 CDS complement(6963..7208) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS complement(7267..9615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22620 sequence101 source 1..9668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 440..4954 product glutamate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807931.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 4957..6423 product dihydropyrimidine dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886828.1 transl_table 11 codon_start 1 locus_tag LOCUS_22640 gene gltD CDS 6581..7246 product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962592.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 7266..8864 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947902.1 transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 8885..9490 product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 transl_table 11 codon_start 1 locus_tag LOCUS_22670 sequence102 source 1..9402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS complement(440..1843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22690 CDS 1852..2172 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 CDS complement(2169..2384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(2494..3240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22720 note possible pseudo, frameshifted CDS complement(3311..3541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22730 note possible pseudo, frameshifted CDS complement(3842..6202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22740 CDS complement(6246..7085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene fjo14 CDS 7228..8175 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 transl_table 11 codon_start 1 locus_tag LOCUS_22760 gene phoH CDS 8278..9231 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYJ4 transl_table 11 codon_start 1 locus_tag LOCUS_22770 gene purC sequence103 source 1..9217 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 173..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS 2140..3624 product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(3659..4015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS 4310..5731 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 transl_table 11 codon_start 1 locus_tag LOCUS_22810 CDS 5766..7658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS complement(7785..8993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 sequence104 source 1..8896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..1088 product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H3 transl_table 11 codon_start 1 locus_tag LOCUS_22840 gene corA CDS 1123..2286 product beta-ketoacyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964416.1 transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS 2369..3478 product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW77 transl_table 11 codon_start 1 locus_tag LOCUS_22860 gene bioB CDS complement(3686..5032) product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 transl_table 11 codon_start 1 locus_tag LOCUS_22870 CDS 5201..5869 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22880 CDS 5982..6224 product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22890 gene feoA CDS 6214..8316 product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 transl_table 11 codon_start 1 locus_tag LOCUS_22900 gene feoB CDS 8555..8758 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22910 sequence105 source 1..8817 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..2945) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 transl_table 11 codon_start 1 locus_tag LOCUS_22920 gene infB CDS complement(3063..4313) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV7 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene nusA CDS complement(4327..4788) product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 transl_table 11 codon_start 1 locus_tag LOCUS_22940 gene rimP CDS complement(5011..5211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22950 CDS 5522..6598 product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768795.1 transl_table 11 codon_start 1 locus_tag LOCUS_22960 CDS 6615..8645 product peptidase M3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963494.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 gene dcp1 sequence106 source 1..8732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(185..529) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(478..804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS complement(1027..2817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 note possible pseudo, internal stop codon CDS complement(2848..3939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23010 note possible pseudo, internal stop codon, frameshifted CDS complement(4493..4675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 5488..5886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 6030..6191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 CDS 6586..6978 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 7147..7503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23060 CDS 7613..8245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(8320..8448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23080 sequence107 source 1..8720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS 1069..1323 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23100 CDS complement(1387..3567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(3668..4333) product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS complement(4564..5112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS complement(5112..5933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 CDS 6108..6698 product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L2 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS 6702..7733 product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963582.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 7733..8527 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964096.1 transl_table 11 codon_start 1 locus_tag LOCUS_23170 sequence108 source 1..8630 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 253..990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS 1179..2609 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 2618..3868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(3949..4833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS 5383..5655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(5713..7062) product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 transl_table 11 codon_start 1 locus_tag LOCUS_23230 gene gdhA CDS 7202..7663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23240 CDS 8213..8524 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 sequence109 source 1..8624 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(110..1156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS complement(1248..2615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 2932..3474 product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 transl_table 11 codon_start 1 locus_tag LOCUS_23280 gene pyrR1 CDS 3478..4407 product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 transl_table 11 codon_start 1 locus_tag LOCUS_23290 gene pyrB CDS 4431..4760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS 4775..5695 product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 transl_table 11 codon_start 1 locus_tag LOCUS_23310 gene rnz CDS 5810..7240 product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 gene rmuC CDS 7258..7890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 CDS 7976..8203 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 8255..8518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23350 sequence110 source 1..8354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(136..558) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(617..889) product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31706 transl_table 11 codon_start 1 locus_tag LOCUS_23370 gene moaD CDS 969..1895 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 transl_table 11 codon_start 1 locus_tag LOCUS_23380 gene queG CDS 2301..2696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS 2999..3136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS 3138..4985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 5005..5835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 CDS 6122..6676 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 6964..7182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 7182..7487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23450 sequence111 source 1..8154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..1178) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS complement(1180..2358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(2464..3180) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 transl_table 11 codon_start 1 locus_tag LOCUS_23480 CDS 3565..4764 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 4877..6046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 6228..6389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 6382..6966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037689.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 CDS complement(7134..8027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23530 sequence112 source 1..8048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(245..835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23540 CDS complement(1011..2402) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 transl_table 11 codon_start 1 locus_tag LOCUS_23550 gene mnmE CDS 2645..3586 product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 gene porQ CDS 3590..4288 product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 transl_table 11 codon_start 1 locus_tag LOCUS_23570 gene cmk CDS complement(4289..4600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS 4662..6827 product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 transl_table 11 codon_start 1 locus_tag LOCUS_23590 gene ptrB CDS 6829..7440 product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 transl_table 11 codon_start 1 locus_tag LOCUS_23600 sequence113 source 1..7890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(323..1537) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 CDS complement(2210..2920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23620 CDS complement(3008..4264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783495.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS complement(4293..6542) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203741.1 transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 6728..7684 product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963006.1 transl_table 11 codon_start 1 locus_tag LOCUS_23650 sequence114 source 1..7818 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(622..1182) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene ruvC CDS complement(1985..2134) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 2194..3294 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 CDS complement(3518..4033) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964088.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS complement(4144..7443) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 gene ccsBA sequence115 source 1..7363 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 450..2153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23710 CDS complement(2243..2437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(2376..3230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS complement(3249..3437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS complement(3415..3987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 note possible pseudo, internal stop codon, frameshifted CDS complement(4175..4378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 note possible pseudo, internal stop codon CDS complement(4505..5074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23770 note possible pseudo, internal stop codon CDS complement(5143..5952) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122375.1 transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 6333..6734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 6715..7227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 note possible pseudo, frameshifted sequence116 source 1..7246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS 700..1791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS 1881..2090 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS 2163..2795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 2852..3307 product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 transl_table 11 codon_start 1 locus_tag LOCUS_23850 gene smpB CDS 3308..4201 product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS 4204..4791 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 transl_table 11 codon_start 1 locus_tag LOCUS_23870 CDS 4923..5894 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 transl_table 11 codon_start 1 locus_tag LOCUS_23880 gene tktC CDS 5932..6618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 CDS complement(6734..6925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS complement(6901..7095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 sequence117 source 1..7208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(272..1012) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(1089..1607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759578.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 CDS complement(1619..2275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS complement(2292..3755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107590.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS complement(3774..6929) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759576.1 transl_table 11 codon_start 1 locus_tag LOCUS_23960 sequence118 source 1..6765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(220..2619) product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963407.1 transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS complement(2630..3409) product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107357.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS complement(3463..5355) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS complement(5355..6431) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963410.1 transl_table 11 codon_start 1 locus_tag LOCUS_24000 sequence119 source 1..6723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 172..567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 CDS 750..1523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS complement(1896..2558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS complement(2603..5017) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS 5546..5962 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964269.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS complement(5976..6557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 sequence120 source 1..6706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 347..2749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24070 note possible pseudo, internal stop codon CDS 2810..4597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 note possible pseudo, internal stop codon sequence121 source 1..6668 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 211..669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(835..1005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 991..1233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS 1377..1667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 1680..2165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 2203..2805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24140 CDS 2928..3245 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 3473..4390 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770039.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 CDS 4468..5814 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS 6085..6384 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24180 sequence122 source 1..6609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1120) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS complement(1144..2595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(2896..6222) product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 sequence123 source 1..6597 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(301..1773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24220 CDS complement(2214..3326) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 CDS complement(3404..3772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS complement(3847..4881) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS complement(4888..5400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS complement(5351..6262) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 sequence124 source 1..6588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS complement(657..1226) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962853.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS complement(1226..1765) product putative metal-dependent hydrolase YfiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31562 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene yfiT CDS complement(1767..3581) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24310 CDS complement(3841..4788) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 transl_table 11 codon_start 1 locus_tag LOCUS_24320 gene trxB1 CDS complement(4888..5070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24330 tRNA 5079..5154 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(5231..6079) product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 transl_table 11 codon_start 1 locus_tag LOCUS_24340 gene yeeZ CDS complement(6300..6551) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 transl_table 11 codon_start 1 locus_tag LOCUS_24350 gene rpsT sequence125 source 1..6518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..1997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477586.1 transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS complement(2025..3251) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(3333..5048) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969438.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(5041..6045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948543.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(6035..6370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24400 sequence126 source 1..6355 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(522..2414) product alpha-1,3-galactosidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZX0 transl_table 11 codon_start 1 locus_tag LOCUS_24410 gene glaB CDS complement(2425..3903) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119682.1 transl_table 11 codon_start 1 locus_tag LOCUS_24420 gene atsG CDS complement(3951..6080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 sequence127 source 1..6207 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(216..512) product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012710067.1 transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(900..2006) product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957841.1 transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS complement(2023..3369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS complement(3362..4597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(4587..5552) product UDP-GlcNAc--UDP-phosphate GlcNAc-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202921.1 transl_table 11 codon_start 1 locus_tag LOCUS_24480 sequence128 source 1..5602 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..379) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964212.1 transl_table 11 codon_start 1 locus_tag LOCUS_24490 CDS complement(389..904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 transl_table 11 codon_start 1 locus_tag LOCUS_24500 gene yozB CDS complement(907..1548) product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 transl_table 11 codon_start 1 locus_tag LOCUS_24510 gene ypmQ CDS complement(1549..2106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 CDS complement(2295..2639) product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(2694..3671) product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(3728..4309) product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 transl_table 11 codon_start 1 locus_tag LOCUS_24550 gene ctaE CDS complement(4325..5236) product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 transl_table 11 codon_start 1 locus_tag LOCUS_24560 gene ctaB CDS complement(5388..5570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24570 sequence129 source 1..5510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24580 CDS complement(920..1357) product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS complement(1554..1931) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 gene ytxJ CDS 2149..4734 product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 transl_table 11 codon_start 1 locus_tag LOCUS_24610 gene clpB CDS 4871..5368 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 sequence130 source 1..5323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(252..2816) product type III restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476565.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(2819..4807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(4804..5004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 sequence131 source 1..5296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 332..1960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 CDS 2165..3055 product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS 3063..3530 product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 3530..4825 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461370.1 transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(4998..5156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 sequence132 source 1..5238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 CDS complement(1057..2007) product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 transl_table 11 codon_start 1 locus_tag LOCUS_24720 gene serA CDS complement(2069..3130) product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 transl_table 11 codon_start 1 locus_tag LOCUS_24730 gene serC CDS complement(3224..4282) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS 4586..4873 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894377.1 transl_table 11 codon_start 1 locus_tag LOCUS_24750 sequence133 source 1..5110 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 162..734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24760 CDS 916..2460 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 2878..3876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 note possible pseudo, frameshifted CDS 3993..5027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 sequence134 source 1..4848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 142..354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24800 CDS complement(464..1039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS complement(1135..1554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS complement(1727..2359) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919325.1 transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS complement(2371..2988) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963139.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 CDS complement(3175..3438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24850 CDS 3540..4706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24860 sequence135 source 1..4808 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1440) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759755.1 transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(1455..3863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS complement(3984..4661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24890 sequence136 source 1..4747 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 359..1906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 CDS 2028..2510 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 transl_table 11 codon_start 1 locus_tag LOCUS_24910 gene dfrA CDS complement(2640..4145) product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454162.1 transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS complement(4266..4610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 sequence137 source 1..4628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(78..749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963216.1 transl_table 11 codon_start 1 locus_tag LOCUS_24940 CDS 981..2072 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS 2139..2684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS 2690..4486 product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963092.1 transl_table 11 codon_start 1 locus_tag LOCUS_24970 sequence138 source 1..4528 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(122..793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(847..2712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074412.1 transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(3136..3384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 note possible pseudo, internal stop codon CDS complement(3394..3603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 sequence139 source 1..4518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(473..1732) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 note possible pseudo, internal stop codon CDS complement(1733..2854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 note possible pseudo, internal stop codon, frameshifted CDS complement(2996..4378) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 sequence140 source 1..4512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 346..2502 product isoquinoline 1-oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920130.1 transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 2502..3545 product xanthine and CO dehydrogenase family maturation factor XdhC/CoxF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 3542..4141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 tRNA 4213..4287 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 sequence141 source 1..4461 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..1177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25080 CDS 2409..2930 product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIG9 transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS 2948..3292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 3393..3611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(3745..4194) product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 transl_table 11 codon_start 1 locus_tag LOCUS_25120 sequence142 source 1..4343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..725 product PhnA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 transl_table 11 codon_start 1 locus_tag LOCUS_25130 gene phnA CDS 835..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964040.1 transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS 1337..1792 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 transl_table 11 codon_start 1 locus_tag LOCUS_25150 gene coaD CDS complement(1789..2397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25160 CDS complement(2410..4065) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482406.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 sequence143 source 1..4017 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(363..1802) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS complement(1959..2225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(2207..2365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 CDS complement(2486..2623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25210 CDS complement(2673..2897) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(2831..3412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25230 sequence144 source 1..3996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 124..396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS 499..2028 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 2098..3153 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6M0 transl_table 11 codon_start 1 locus_tag LOCUS_25260 gene leuB CDS 3227..3823 product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 transl_table 11 codon_start 1 locus_tag LOCUS_25270 gene miaE sequence145 source 1..3920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(159..614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(709..3216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962569.1 transl_table 11 codon_start 1 locus_tag LOCUS_25290 sequence146 source 1..3805 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 126..1331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25300 CDS complement(1474..2799) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25310 note possible pseudo, frameshifted CDS complement(2741..3520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25320 note possible pseudo, frameshifted sequence147 source 1..3724 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(274..1311) product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31764 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene galT CDS complement(1317..2489) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHD0 transl_table 11 codon_start 1 locus_tag LOCUS_25340 gene galK CDS 2594..3295 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS complement(3296..3463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25360 sequence148 source 1..3706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..997 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962869.1:two-component sensor histidine kinase locus_tag LOCUS_25370 CDS 1134..1997 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 gene rpoD CDS 2098..2754 product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 transl_table 11 codon_start 1 locus_tag LOCUS_25390 gene rpe CDS complement(2898..3428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25400 sequence149 source 1..3633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..1980) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(2129..3346) product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362010.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 sequence150 source 1..3442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(270..926) product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785068.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 CDS complement(926..1663) product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63TJ0 transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS complement(1663..2367) product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 transl_table 11 codon_start 1 locus_tag LOCUS_25450 gene lolD sequence151 source 1..3381 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 139..585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 590..1564 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 transl_table 11 codon_start 1 locus_tag LOCUS_25470 gene manA CDS 1729..2922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25480 tRNA 3074..3148 product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 sequence152 source 1..3197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..1006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(1049..1495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(1565..2848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS 2927..3091 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 sequence153 source 1..3192 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 103..345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25530 CDS 342..1220 product potassium transporter KefA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262214.1 transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 1294..2649 product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 2754..3101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25560 sequence154 source 1..3141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(203..757) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964064.1 transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(862..1677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS 1770..2390 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS complement(2401..3030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25600 sequence155 source 1..3119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 274..1686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 CDS 1718..2965 product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D3H8J4 transl_table 11 codon_start 1 locus_tag LOCUS_25620 sequence156 source 1..2954 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 262..1026 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 gene pcbD CDS 1087..1695 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 transl_table 11 codon_start 1 locus_tag LOCUS_25640 gene engB CDS 1718..2401 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS complement(2438..2830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 sequence157 source 1..2865 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(129..617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 CDS 882..2711 product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072494.1 transl_table 11 codon_start 1 locus_tag LOCUS_25680 sequence158 source 1..2731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25690 CDS 324..1121 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 1139..1648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 1651..2574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 sequence159 source 1..2726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 478..1800 product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 transl_table 11 codon_start 1 locus_tag LOCUS_25730 gene der CDS complement(1978..2571) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25740 sequence160 source 1..2709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(113..649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 CDS complement(659..895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25760 CDS complement(1120..1458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25770 CDS complement(1635..2486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 sequence161 source 1..2673 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..1097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25790 misc_feature complement(1495..>2673) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962777.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_25800 sequence162 source 1..2634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(479..2464) product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 transl_table 11 codon_start 1 locus_tag LOCUS_25810 gene uvrB sequence163 source 1..2611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 354..1679 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016983.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS 1663..2367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 sequence164 source 1..2611 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(282..941) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS 1086..2438 product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z9 transl_table 11 codon_start 1 locus_tag LOCUS_25850 sequence165 source 1..2467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 206..2185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25860 sequence166 source 1..2404 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 489..923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(947..1213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(1191..2249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25890 sequence167 source 1..2356 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(212..883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25900 tRNA complement(1077..1150) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS 1335..2216 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H104 transl_table 11 codon_start 1 locus_tag LOCUS_25910 gene era sequence168 source 1..2290 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(281..442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS complement(452..2146) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 sequence169 source 1..2257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(118..321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS complement(323..1963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 sequence170 source 1..2096 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(299..385) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS 615..944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS complement(957..1808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25970 sequence171 source 1..1967 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 130..498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 584..1834 product L-rhamnose catabolism isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973080.1 transl_table 11 codon_start 1 locus_tag LOCUS_25990 sequence172 source 1..1927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..1000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036264.1 transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS complement(990..1514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26010 sequence173 source 1..1715 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 169..1578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26020