>Feature sequence001 <1 777 gene locus_tag LOCUS_00010 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964168.1:gliding motility lipoprotein GldB 777 1115 gene locus_tag LOCUS_00020 gene gldC 777 1115 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_00020 1717 1112 gene locus_tag LOCUS_00030 gene engB 1717 1112 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UN4 protein_id gnl|my_center|LOCUS_00030 2522 1728 gene locus_tag LOCUS_00040 gene pcbD 2522 1728 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_00040 2666 3133 gene locus_tag LOCUS_00050 gene mraZ 2666 3133 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_00050 3141 4016 gene locus_tag LOCUS_00060 gene rsmH 3141 4016 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A2 protein_id gnl|my_center|LOCUS_00060 4013 4324 gene locus_tag LOCUS_00070 4013 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4326 6158 gene locus_tag LOCUS_00080 gene ftsI 4326 6158 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_00080 6142 7635 gene locus_tag LOCUS_00090 gene murE 6142 7635 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 protein_id gnl|my_center|LOCUS_00090 7639 8862 gene locus_tag LOCUS_00100 gene mraY 7639 8862 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_00100 8859 10199 gene locus_tag LOCUS_00110 gene murD 8859 10199 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_00110 10207 11409 gene locus_tag LOCUS_00120 gene ftsW 10207 11409 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_00120 11396 12478 gene locus_tag LOCUS_00130 gene murG 11396 12478 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_00130 12479 13816 gene locus_tag LOCUS_00140 gene murC 12479 13816 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 protein_id gnl|my_center|LOCUS_00140 13806 14513 gene locus_tag LOCUS_00150 13806 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 14524 15849 gene locus_tag LOCUS_00160 gene ftsA 14524 15849 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_00160 15862 17844 gene locus_tag LOCUS_00170 gene ftsZ 15862 17844 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_00170 17857 18309 gene locus_tag LOCUS_00180 17857 18309 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_00180 18834 18328 gene locus_tag LOCUS_00190 18834 18328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 19047 19121 gene locus_tag LOCUS_t00010 19047 19121 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20756 19344 gene locus_tag LOCUS_00200 20756 19344 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_00200 22435 20813 gene locus_tag LOCUS_00210 gene xynB2 22435 20813 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_00210 <23532 22437 gene locus_tag LOCUS_00220 <23532 22437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002288207.1:glycosyl transferase >Feature sequence002 <1 843 gene locus_tag LOCUS_00230 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWV7:transcription termination/antitermination protein NusA 890 3553 gene locus_tag LOCUS_00240 gene infB 890 3553 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV8 protein_id gnl|my_center|LOCUS_00240 3936 3550 gene locus_tag LOCUS_00250 3936 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4171 5397 gene locus_tag LOCUS_00260 gene actA 4171 5397 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_00260 5419 8499 gene locus_tag LOCUS_00270 gene actB 5419 8499 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_00270 8519 9904 gene locus_tag LOCUS_00280 gene actC 8519 9904 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_00280 9901 10440 gene locus_tag LOCUS_00290 gene actD 9901 10440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_00290 10433 10987 gene locus_tag LOCUS_00300 gene actE 10433 10987 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_00300 11000 12385 gene locus_tag LOCUS_00310 gene actF 11000 12385 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_00310 12405 13469 gene locus_tag LOCUS_00320 gene ctaC 12405 13469 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_00320 13491 15281 gene locus_tag LOCUS_00330 gene ctaD 13491 15281 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_00330 15369 16388 gene locus_tag LOCUS_00340 gene ruvB 15369 16388 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G3 protein_id gnl|my_center|LOCUS_00340 16398 17306 gene locus_tag LOCUS_00350 gene queG 16398 17306 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_00350 17379 17654 gene locus_tag LOCUS_00360 17379 17654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 >Feature sequence003 3481 632 gene locus_tag LOCUS_00370 gene carB 3481 632 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H128 protein_id gnl|my_center|LOCUS_00370 3705 4346 gene locus_tag LOCUS_00380 3705 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 5254 4343 gene locus_tag LOCUS_00390 5254 4343 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_00390 5951 5304 gene locus_tag LOCUS_00400 5951 5304 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964116.1 protein_id gnl|my_center|LOCUS_00400 6072 6365 gene locus_tag LOCUS_00410 6072 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 7716 6382 gene locus_tag LOCUS_00420 7716 6382 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_00420 7771 9402 gene locus_tag LOCUS_00430 7771 9402 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_00430 9712 9452 gene locus_tag LOCUS_00440 gene rpmE 9712 9452 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_00440 9809 10330 gene locus_tag LOCUS_00450 9809 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 10370 11320 gene locus_tag LOCUS_00460 10370 11320 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963275.1 protein_id gnl|my_center|LOCUS_00460 11310 13016 gene locus_tag LOCUS_00470 11310 13016 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963276.1 protein_id gnl|my_center|LOCUS_00470 13131 14837 gene locus_tag LOCUS_00480 gene msbA 13131 14837 CDS product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 protein_id gnl|my_center|LOCUS_00480 14884 15423 gene locus_tag LOCUS_00490 14884 15423 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_00490 15416 15886 gene locus_tag LOCUS_00500 15416 15886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 15873 16334 gene locus_tag LOCUS_00510 15873 16334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 16359 17576 gene locus_tag LOCUS_00520 gene rsmB 16359 17576 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence004 <1 5319 gene locus_tag LOCUS_00530 <1 5319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA 5360 5740 gene locus_tag LOCUS_00540 gene gcvH 5360 5740 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_00540 5820 6524 gene locus_tag LOCUS_00550 5820 6524 CDS product protein TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A627 protein_id gnl|my_center|LOCUS_00550 6603 7514 gene locus_tag LOCUS_00560 gene ctaB 6603 7514 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_00560 7505 8086 gene locus_tag LOCUS_00570 gene ctaE 7505 8086 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_00570 8126 9100 gene locus_tag LOCUS_00580 8126 9100 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_00580 9117 9500 gene locus_tag LOCUS_00590 9117 9500 CDS product cytochrome c oxidase subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964208.1 protein_id gnl|my_center|LOCUS_00590 9531 10184 gene locus_tag LOCUS_00600 9531 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964209.1 protein_id gnl|my_center|LOCUS_00600 10186 10884 gene locus_tag LOCUS_00610 gene ypmQ 10186 10884 CDS product photosynthetic protein synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964210.1 protein_id gnl|my_center|LOCUS_00610 10896 11429 gene locus_tag LOCUS_00620 gene yozB 10896 11429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_00620 11434 11640 gene locus_tag LOCUS_00630 11434 11640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 11787 12440 gene locus_tag LOCUS_00640 11787 12440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_00640 12445 13674 gene locus_tag LOCUS_00650 12445 13674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763621.1 protein_id gnl|my_center|LOCUS_00650 13667 14941 gene locus_tag LOCUS_00660 13667 14941 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_00660 14957 16081 gene locus_tag LOCUS_00670 14957 16081 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence005 1350 1078 gene locus_tag LOCUS_00680 1350 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 1548 1363 gene locus_tag LOCUS_00690 1548 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 3601 1754 gene locus_tag LOCUS_00700 gene glmS 3601 1754 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_00700 4007 3603 gene locus_tag LOCUS_00710 4007 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 4771 4031 gene locus_tag LOCUS_00720 gene lptB 4771 4031 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_00720 5595 4789 gene locus_tag LOCUS_00730 gene tatC 5595 4789 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_00730 6563 5595 gene locus_tag LOCUS_00740 gene kdsD 6563 5595 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_00740 6818 8842 gene locus_tag LOCUS_00750 gene recQ1 6818 8842 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 protein_id gnl|my_center|LOCUS_00750 8905 9837 gene locus_tag LOCUS_00760 gene ppiC 8905 9837 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V0 protein_id gnl|my_center|LOCUS_00760 10414 9830 gene locus_tag LOCUS_00770 10414 9830 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_00770 10858 10493 gene locus_tag LOCUS_00780 10858 10493 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_00780 12308 10926 gene locus_tag LOCUS_00790 12308 10926 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 protein_id gnl|my_center|LOCUS_00790 12689 12877 gene locus_tag LOCUS_00800 12689 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 13014 13751 gene locus_tag LOCUS_00810 gene nusB 13014 13751 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX17 protein_id gnl|my_center|LOCUS_00810 13791 14291 gene locus_tag LOCUS_00820 13791 14291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14300 14587 gene locus_tag LOCUS_00830 gene yajC 14300 14587 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962700.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence006 1508 186 gene locus_tag LOCUS_00840 gene dgt 1508 186 CDS product dGTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962456.1 protein_id gnl|my_center|LOCUS_00840 1720 3024 gene locus_tag LOCUS_00850 1720 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 3168 5951 gene locus_tag LOCUS_00860 3168 5951 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_00860 5967 8243 gene locus_tag LOCUS_00870 5967 8243 CDS product phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PX3 protein_id gnl|my_center|LOCUS_00870 8598 8245 gene locus_tag LOCUS_00880 8598 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962526.1 protein_id gnl|my_center|LOCUS_00880 11235 8761 gene locus_tag LOCUS_00890 gene nrdA 11235 8761 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 protein_id gnl|my_center|LOCUS_00890 12303 11326 gene locus_tag LOCUS_00900 gene nrdB 12303 11326 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_00900 13084 12515 gene locus_tag LOCUS_00910 13084 12515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_00910 15091 13517 gene locus_tag LOCUS_00920 15091 13517 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962632.1 protein_id gnl|my_center|LOCUS_00920 >Feature sequence007 1821 418 gene locus_tag LOCUS_00930 1821 418 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_00930 4429 1856 gene locus_tag LOCUS_00940 4429 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 4963 4613 gene locus_tag LOCUS_00950 4963 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6455 4974 gene locus_tag LOCUS_00960 6455 4974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 9682 6524 gene locus_tag LOCUS_00970 9682 6524 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108634.1 protein_id gnl|my_center|LOCUS_00970 10629 9895 gene locus_tag LOCUS_00980 10629 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 13970 10626 gene locus_tag LOCUS_00990 13970 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 <14700 14029 gene locus_tag LOCUS_01000 <14700 14029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039191.1:alpha-N-arabinofuranosidase >Feature sequence008 183 608 gene locus_tag LOCUS_01010 gene aroQ 183 608 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 protein_id gnl|my_center|LOCUS_01010 1987 599 gene locus_tag LOCUS_01020 gene lpdA2 1987 599 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI6 protein_id gnl|my_center|LOCUS_01020 2459 2049 gene locus_tag LOCUS_01030 gene mrsB2 2459 2049 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963829.1 protein_id gnl|my_center|LOCUS_01030 2940 2449 gene locus_tag LOCUS_01040 gene mrsB1 2940 2449 CDS product peptide-methionine (R)-S-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963828.1 protein_id gnl|my_center|LOCUS_01040 3049 4377 gene locus_tag LOCUS_01050 3049 4377 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_01050 4505 6961 gene locus_tag LOCUS_01060 gene lon 4505 6961 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 protein_id gnl|my_center|LOCUS_01060 6966 7634 gene locus_tag LOCUS_01070 gene cmk 6966 7634 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 protein_id gnl|my_center|LOCUS_01070 7791 9968 gene locus_tag LOCUS_01080 gene rpsA 7791 9968 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963900.1 protein_id gnl|my_center|LOCUS_01080 10050 10592 gene locus_tag LOCUS_01090 gene pyrR1 10050 10592 CDS product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_01090 10593 11531 gene locus_tag LOCUS_01100 gene pyrB 10593 11531 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 protein_id gnl|my_center|LOCUS_01100 11528 11848 gene locus_tag LOCUS_01110 11528 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 11850 12755 gene locus_tag LOCUS_01120 gene rnz 11850 12755 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 protein_id gnl|my_center|LOCUS_01120 12806 13450 gene locus_tag LOCUS_01130 gene pdxH 12806 13450 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H098 protein_id gnl|my_center|LOCUS_01130 13457 13933 gene locus_tag LOCUS_01140 13457 13933 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_01140 >Feature sequence009 1682 2665 gene locus_tag LOCUS_01150 1682 2665 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729508.1 protein_id gnl|my_center|LOCUS_01150 2677 3837 gene locus_tag LOCUS_01160 2677 3837 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_01160 3875 4324 gene locus_tag LOCUS_01170 3875 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 4398 5114 gene locus_tag LOCUS_01180 4398 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01180 5278 5352 gene locus_tag LOCUS_t00020 5278 5352 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5385 5837 gene locus_tag LOCUS_01190 5385 5837 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_01190 5843 6817 gene locus_tag LOCUS_01200 5843 6817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_01200 7909 6827 gene locus_tag LOCUS_01210 7909 6827 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_01210 8649 7942 gene locus_tag LOCUS_01220 8649 7942 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_01220 9674 8652 gene locus_tag LOCUS_01230 gene tsaD 9674 8652 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_01230 >Feature sequence010 <1 804 gene locus_tag LOCUS_01240 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962309.1:BatB protein 804 1622 gene locus_tag LOCUS_01250 804 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 1633 3396 gene locus_tag LOCUS_01260 gene batD 1633 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962307.1 protein_id gnl|my_center|LOCUS_01260 3393 4160 gene locus_tag LOCUS_01270 gene batE 3393 4160 CDS product BatE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_01270 4662 4153 gene locus_tag LOCUS_01280 4662 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 4728 5096 gene locus_tag LOCUS_01290 4728 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_01290 5114 6130 gene locus_tag LOCUS_01300 gene pheS 5114 6130 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_01300 7197 6127 gene locus_tag LOCUS_01310 gene gpsA 7197 6127 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 protein_id gnl|my_center|LOCUS_01310 7616 7179 gene locus_tag LOCUS_01320 7616 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962370.1 protein_id gnl|my_center|LOCUS_01320 8129 7683 gene locus_tag LOCUS_01330 8129 7683 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962372.1 protein_id gnl|my_center|LOCUS_01330 9648 8221 gene locus_tag LOCUS_01340 gene pykA 9648 8221 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_01340 10119 9652 gene locus_tag LOCUS_01350 10119 9652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 10802 10119 gene locus_tag LOCUS_01360 gene rnc 10802 10119 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW45 protein_id gnl|my_center|LOCUS_01360 12109 10859 gene locus_tag LOCUS_01370 gene fabF 12109 10859 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW44 protein_id gnl|my_center|LOCUS_01370 12356 12123 gene locus_tag LOCUS_01380 gene acpP 12356 12123 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 protein_id gnl|my_center|LOCUS_01380 12506 13084 gene locus_tag LOCUS_01390 gene purN 12506 13084 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 protein_id gnl|my_center|LOCUS_01390 13088 13573 gene locus_tag LOCUS_01400 gene rnhA 13088 13573 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_01400 >Feature sequence011 674 321 gene locus_tag LOCUS_01410 674 321 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 protein_id gnl|my_center|LOCUS_01410 1158 814 gene locus_tag LOCUS_01420 gene rplT 1158 814 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_01420 1437 1240 gene locus_tag LOCUS_01430 gene rpmI 1437 1240 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_01430 3987 2041 gene locus_tag LOCUS_01440 gene thrS 3987 2041 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 protein_id gnl|my_center|LOCUS_01440 5075 4266 gene locus_tag LOCUS_01450 gene murQ 5075 4266 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 protein_id gnl|my_center|LOCUS_01450 6539 5313 gene locus_tag LOCUS_01460 gene icd 6539 5313 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_01460 6991 6647 gene locus_tag LOCUS_01470 gene rplS 6991 6647 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_01470 7786 7109 gene locus_tag LOCUS_01480 gene trmD 7786 7109 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 protein_id gnl|my_center|LOCUS_01480 9316 7922 gene locus_tag LOCUS_01490 gene degP/Q 9316 7922 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_01490 9426 10211 gene locus_tag LOCUS_01500 gene dapF 9426 10211 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_01500 10208 10726 gene locus_tag LOCUS_01510 10208 10726 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_01510 10762 11772 gene locus_tag LOCUS_01520 gene pabC 10762 11772 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963345.1 protein_id gnl|my_center|LOCUS_01520 12480 11773 gene locus_tag LOCUS_01530 12480 11773 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_01530 12862 12485 gene locus_tag LOCUS_01540 12862 12485 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 protein_id gnl|my_center|LOCUS_01540 <13659 12935 gene locus_tag LOCUS_01550 <13659 12935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW8:chromosomal replication initiator protein DnaA >Feature sequence012 1646 183 gene locus_tag LOCUS_01560 1646 183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 1718 2395 gene locus_tag LOCUS_01570 1718 2395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120859.1 protein_id gnl|my_center|LOCUS_01570 2695 3282 gene locus_tag LOCUS_01580 2695 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 3387 3896 gene locus_tag LOCUS_01590 3387 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 5066 3969 gene locus_tag LOCUS_01600 5066 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 6233 5292 gene locus_tag LOCUS_01610 6233 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 7094 6465 gene locus_tag LOCUS_01620 gene nucA 7094 6465 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964510.1 protein_id gnl|my_center|LOCUS_01620 7306 7671 gene locus_tag LOCUS_01630 7306 7671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_01630 7846 7774 gene locus_tag LOCUS_t00030 7846 7774 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 7927 7854 gene locus_tag LOCUS_t00040 7927 7854 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8063 7981 gene locus_tag LOCUS_t00050 8063 7981 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 8158 8084 gene locus_tag LOCUS_t00060 8158 8084 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9411 8395 gene locus_tag LOCUS_01640 9411 8395 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123934.1 protein_id gnl|my_center|LOCUS_01640 10925 9492 gene locus_tag LOCUS_01650 10925 9492 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_01650 <13538 10938 gene locus_tag LOCUS_01660 <13538 10938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108033.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence013 <1 596 gene locus_tag LOCUS_01670 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964143.1:deoxyribodipyrimidine photo-lyase 593 2125 gene locus_tag LOCUS_01680 593 2125 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964142.1 protein_id gnl|my_center|LOCUS_01680 2115 3602 gene locus_tag LOCUS_01690 gene phrB2 2115 3602 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964141.1 protein_id gnl|my_center|LOCUS_01690 3599 3883 gene locus_tag LOCUS_01700 3599 3883 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_01700 5307 4003 gene locus_tag LOCUS_01710 gene murA 5307 4003 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_01710 5964 5320 gene locus_tag LOCUS_01720 5964 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 protein_id gnl|my_center|LOCUS_01720 6340 6050 gene locus_tag LOCUS_01730 6340 6050 CDS product DUF493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964112.1 protein_id gnl|my_center|LOCUS_01730 6396 6959 gene locus_tag LOCUS_01740 6396 6959 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964111.1 protein_id gnl|my_center|LOCUS_01740 6949 8670 gene locus_tag LOCUS_01750 gene recQ2 6949 8670 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_01750 8832 9776 gene locus_tag LOCUS_01760 gene fmt 8832 9776 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 protein_id gnl|my_center|LOCUS_01760 9907 10179 gene locus_tag LOCUS_01770 gene hupB 9907 10179 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_01770 10280 10825 gene locus_tag LOCUS_01780 10280 10825 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_01780 11645 10794 gene locus_tag LOCUS_01790 11645 10794 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_01790 12052 11660 gene locus_tag LOCUS_01800 12052 11660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_01800 12181 12255 gene locus_tag LOCUS_t00070 12181 12255 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12345 12938 gene locus_tag LOCUS_01810 12345 12938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence014 208 654 gene locus_tag LOCUS_01820 208 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263212.1 protein_id gnl|my_center|LOCUS_01820 1089 655 gene locus_tag LOCUS_01830 1089 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 1525 3231 gene locus_tag LOCUS_01840 1525 3231 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919507.1 protein_id gnl|my_center|LOCUS_01840 5459 3228 gene locus_tag LOCUS_01850 5459 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6966 5470 gene locus_tag LOCUS_01860 6966 5470 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776786.1 protein_id gnl|my_center|LOCUS_01860 7098 7322 gene locus_tag LOCUS_01870 7098 7322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 7509 9533 gene locus_tag LOCUS_01880 7509 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 10658 9534 gene locus_tag LOCUS_01890 10658 9534 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_01890 <12990 10665 gene locus_tag LOCUS_01900 <12990 10665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:beta-N-acetylglucosaminidase >Feature sequence015 1406 2224 gene locus_tag LOCUS_01910 gene panB 1406 2224 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_01910 2239 2913 gene locus_tag LOCUS_01920 2239 2913 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963043.1 protein_id gnl|my_center|LOCUS_01920 4447 2879 gene locus_tag LOCUS_01930 4447 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 4592 5746 gene locus_tag LOCUS_01940 4592 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5767 7164 gene locus_tag LOCUS_01950 gene leuC 5767 7164 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 protein_id gnl|my_center|LOCUS_01950 7167 7763 gene locus_tag LOCUS_01960 7167 7763 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 protein_id gnl|my_center|LOCUS_01960 7785 9302 gene locus_tag LOCUS_01970 7785 9302 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_01970 9316 10380 gene locus_tag LOCUS_01980 gene leuB 9316 10380 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 protein_id gnl|my_center|LOCUS_01980 >Feature sequence016 367 2 gene locus_tag LOCUS_01990 367 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 2890 548 gene locus_tag LOCUS_02000 2890 548 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 protein_id gnl|my_center|LOCUS_02000 3123 4616 gene locus_tag LOCUS_02010 3123 4616 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202061.1 protein_id gnl|my_center|LOCUS_02010 5485 4613 gene locus_tag LOCUS_02020 5485 4613 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_02020 5857 6270 gene locus_tag LOCUS_02030 5857 6270 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964139.1 protein_id gnl|my_center|LOCUS_02030 6700 6263 gene locus_tag LOCUS_02040 6700 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 6837 7241 gene locus_tag LOCUS_02050 gene rbfA 6837 7241 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW80 protein_id gnl|my_center|LOCUS_02050 7242 8453 gene locus_tag LOCUS_02060 7242 8453 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962414.1 protein_id gnl|my_center|LOCUS_02060 9423 8431 gene locus_tag LOCUS_02070 9423 8431 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_02070 10337 9465 gene locus_tag LOCUS_02080 gene tlpB 10337 9465 CDS product protein tlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963548.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence017 <1 808 gene locus_tag LOCUS_02090 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122622.1:arylsulfatase 810 2216 gene locus_tag LOCUS_02100 gene arsA 810 2216 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_02100 2723 2232 gene locus_tag LOCUS_02110 2723 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 2807 4570 gene locus_tag LOCUS_02120 2807 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 >Feature sequence018 1598 1837 gene locus_tag LOCUS_02130 1598 1837 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SHC7 protein_id gnl|my_center|LOCUS_02130 1961 2698 gene locus_tag LOCUS_02140 1961 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2707 4554 gene locus_tag LOCUS_02150 2707 4554 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118947.1 protein_id gnl|my_center|LOCUS_02150 7128 4672 gene locus_tag LOCUS_02160 7128 4672 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_02160 9391 8654 gene locus_tag LOCUS_02170 9391 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 10275 9679 gene locus_tag LOCUS_02180 gene ribE 10275 9679 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_02180 10331 11335 gene locus_tag LOCUS_02190 gene pdxA 10331 11335 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H263 protein_id gnl|my_center|LOCUS_02190 >Feature sequence019 6 419 gene locus_tag LOCUS_02200 6 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 483 1340 gene locus_tag LOCUS_02210 483 1340 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767392.1 protein_id gnl|my_center|LOCUS_02210 2004 1387 gene locus_tag LOCUS_02220 2004 1387 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_02220 4343 2007 gene locus_tag LOCUS_02230 gene uvrD 4343 2007 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_02230 4522 6621 gene locus_tag LOCUS_02240 gene recG 4522 6621 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_02240 6684 9107 gene locus_tag LOCUS_02250 gene pheT 6684 9107 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 protein_id gnl|my_center|LOCUS_02250 9183 9863 gene locus_tag LOCUS_02260 9183 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 10113 10811 gene locus_tag LOCUS_02270 10113 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 <11602 10949 gene locus_tag LOCUS_02280 <11602 10949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963187.1:ABC-F family ATPase >Feature sequence020 1686 1081 gene locus_tag LOCUS_02290 gene rpsD 1686 1081 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 protein_id gnl|my_center|LOCUS_02290 2122 1739 gene locus_tag LOCUS_02300 gene rpsK 2122 1739 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_02300 2506 2132 gene locus_tag LOCUS_02310 gene rpsM 2506 2132 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_02310 2852 2637 gene locus_tag LOCUS_02320 gene infA 2852 2637 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ78 protein_id gnl|my_center|LOCUS_02320 4210 2855 gene locus_tag LOCUS_02330 gene secY 4210 2855 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ79 protein_id gnl|my_center|LOCUS_02330 4673 4221 gene locus_tag LOCUS_02340 gene rplO 4673 4221 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ80 protein_id gnl|my_center|LOCUS_02340 4855 4676 gene locus_tag LOCUS_02350 gene rpmD 4855 4676 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ81 protein_id gnl|my_center|LOCUS_02350 5391 4867 gene locus_tag LOCUS_02360 gene rpsE 5391 4867 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 protein_id gnl|my_center|LOCUS_02360 5759 5400 gene locus_tag LOCUS_02370 gene rplR 5759 5400 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ83 protein_id gnl|my_center|LOCUS_02370 6307 5765 gene locus_tag LOCUS_02380 gene rplF 6307 5765 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 protein_id gnl|my_center|LOCUS_02380 6729 6328 gene locus_tag LOCUS_02390 gene rpsH 6729 6328 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_02390 7015 6746 gene locus_tag LOCUS_02400 gene rpsN 7015 6746 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_02400 7569 7018 gene locus_tag LOCUS_02410 gene rplE 7569 7018 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_02410 7877 7569 gene locus_tag LOCUS_02420 gene rplX 7877 7569 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ88 protein_id gnl|my_center|LOCUS_02420 8254 7886 gene locus_tag LOCUS_02430 gene rplN 8254 7886 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_02430 8514 8257 gene locus_tag LOCUS_02440 gene rpsQ 8514 8257 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 protein_id gnl|my_center|LOCUS_02440 8720 8520 gene locus_tag LOCUS_02450 gene rpmC 8720 8520 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 protein_id gnl|my_center|LOCUS_02450 9153 8734 gene locus_tag LOCUS_02460 gene rplP 9153 8734 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_02460 9890 9159 gene locus_tag LOCUS_02470 gene rpsC 9890 9159 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_02470 10296 9892 gene locus_tag LOCUS_02480 gene rplV 10296 9892 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_02480 10584 10306 gene locus_tag LOCUS_02490 gene rpsS 10584 10306 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_02490 11414 10590 gene locus_tag LOCUS_02500 gene rplB 11414 10590 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_02500 >Feature sequence021 2633 267 gene locus_tag LOCUS_02510 2633 267 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107142.1 protein_id gnl|my_center|LOCUS_02510 2731 3177 gene locus_tag LOCUS_02520 2731 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3743 3174 gene locus_tag LOCUS_02530 3743 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 6228 3748 gene locus_tag LOCUS_02540 6228 3748 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_02540 6822 6229 gene locus_tag LOCUS_02550 6822 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 7224 6907 gene locus_tag LOCUS_02560 7224 6907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7290 8324 gene locus_tag LOCUS_02570 7290 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 protein_id gnl|my_center|LOCUS_02570 9738 8368 gene locus_tag LOCUS_02580 9738 8368 CDS product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFS4 protein_id gnl|my_center|LOCUS_02580 <11132 9743 gene locus_tag LOCUS_02590 <11132 9743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109117.1:hybrid sensor histidine kinase/response regulator >Feature sequence022 1434 862 gene locus_tag LOCUS_02600 1434 862 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_02600 2703 1438 gene locus_tag LOCUS_02610 gene wbpA 2703 1438 CDS product UDP-N-acetyl-d-glucosamine 6-dehydrogenase WbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_02610 4094 2700 gene locus_tag LOCUS_02620 gene ugd 4094 2700 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963427.1 protein_id gnl|my_center|LOCUS_02620 4491 4084 gene locus_tag LOCUS_02630 4491 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 7016 4695 gene locus_tag LOCUS_02640 7016 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7082 8014 gene locus_tag LOCUS_02650 7082 8014 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_02650 10358 8067 gene locus_tag LOCUS_02660 10358 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence023 2006 1713 gene locus_tag LOCUS_02670 2006 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2581 2108 gene locus_tag LOCUS_02680 gene ribH 2581 2108 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_02680 3345 2581 gene locus_tag LOCUS_02690 3345 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_02690 3478 4560 gene locus_tag LOCUS_02700 gene recF 3478 4560 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_02700 4561 4971 gene locus_tag LOCUS_02710 4561 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 4977 5279 gene locus_tag LOCUS_02720 4977 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963535.1 protein_id gnl|my_center|LOCUS_02720 5694 5266 gene locus_tag LOCUS_02730 gene ndk 5694 5266 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_02730 5814 6827 gene locus_tag LOCUS_02740 gene fjo19 5814 6827 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_02740 6820 7359 gene locus_tag LOCUS_02750 gene gldI 6820 7359 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T4 protein_id gnl|my_center|LOCUS_02750 7361 8440 gene locus_tag LOCUS_02760 gene ppiA 7361 8440 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963995.1 protein_id gnl|my_center|LOCUS_02760 8784 9527 gene locus_tag LOCUS_02770 8784 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9563 10351 gene locus_tag LOCUS_02780 9563 10351 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence024 1319 300 gene locus_tag LOCUS_02790 1319 300 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_02790 1382 1732 gene locus_tag LOCUS_02800 gene fdx1 1382 1732 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_02800 1746 2840 gene locus_tag LOCUS_02810 gene engD 1746 2840 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC6 protein_id gnl|my_center|LOCUS_02810 3389 3042 gene locus_tag LOCUS_02820 3389 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3594 5453 gene locus_tag LOCUS_02830 gene parE 3594 5453 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 protein_id gnl|my_center|LOCUS_02830 5457 8039 gene locus_tag LOCUS_02840 gene parC 5457 8039 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_02840 8589 8176 gene locus_tag LOCUS_02850 8589 8176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962882.1 protein_id gnl|my_center|LOCUS_02850 8950 8549 gene locus_tag LOCUS_02860 8950 8549 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_02860 9299 9162 gene locus_tag LOCUS_02870 9299 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 9274 10290 gene locus_tag LOCUS_02880 9274 10290 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence025 2014 503 gene locus_tag LOCUS_02890 2014 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3606 2041 gene locus_tag LOCUS_02900 3606 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4688 3633 gene locus_tag LOCUS_02910 4688 3633 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766053.1 protein_id gnl|my_center|LOCUS_02910 6323 4827 gene locus_tag LOCUS_02920 6323 4827 CDS product starch-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108773.1 protein_id gnl|my_center|LOCUS_02920 9349 6335 gene locus_tag LOCUS_02930 9349 6335 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_02930 <10796 9717 gene locus_tag LOCUS_02940 <10796 9717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S3W5:prolipoprotein diacylglyceryl transferase >Feature sequence026 238 1905 gene locus_tag LOCUS_02950 gene glnS 238 1905 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H2 protein_id gnl|my_center|LOCUS_02950 2850 1906 gene locus_tag LOCUS_02960 2850 1906 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_02960 4341 2854 gene locus_tag LOCUS_02970 gene gltX 4341 2854 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 protein_id gnl|my_center|LOCUS_02970 4425 4841 gene locus_tag LOCUS_02980 gene ybeY 4425 4841 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVJ9 protein_id gnl|my_center|LOCUS_02980 4845 6713 gene locus_tag LOCUS_02990 gene mnmG 4845 6713 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_02990 6735 7586 gene locus_tag LOCUS_03000 6735 7586 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962185.1 protein_id gnl|my_center|LOCUS_03000 8712 7567 gene locus_tag LOCUS_03010 gene holB 8712 7567 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962192.1 protein_id gnl|my_center|LOCUS_03010 8852 10039 gene locus_tag LOCUS_03020 gene pgk 8852 10039 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_03020 >Feature sequence027 316 2121 gene locus_tag LOCUS_03030 316 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 2556 2260 gene locus_tag LOCUS_03040 2556 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3543 3379 gene locus_tag LOCUS_03050 3543 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 3527 4123 gene locus_tag LOCUS_03060 3527 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4189 4836 gene locus_tag LOCUS_03070 4189 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098901.1 protein_id gnl|my_center|LOCUS_03070 5161 4931 gene locus_tag LOCUS_03080 5161 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 5481 6347 gene locus_tag LOCUS_03090 5481 6347 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074155.1 protein_id gnl|my_center|LOCUS_03090 7855 6356 gene locus_tag LOCUS_03100 7855 6356 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 protein_id gnl|my_center|LOCUS_03100 8556 7936 gene locus_tag LOCUS_03110 8556 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 8782 9819 gene locus_tag LOCUS_03120 8782 9819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 10252 9986 gene locus_tag LOCUS_03130 10252 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence028 3157 662 gene locus_tag LOCUS_03140 gene gyrA 3157 662 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_03140 3379 5925 gene locus_tag LOCUS_03150 gene clpA 3379 5925 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_03150 6262 8709 gene locus_tag LOCUS_03160 gene thrA 6262 8709 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_03160 8710 9639 gene locus_tag LOCUS_03170 gene thrB 8710 9639 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW7 protein_id gnl|my_center|LOCUS_03170 >Feature sequence029 1835 2974 gene locus_tag LOCUS_03180 1835 2974 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709443.1 protein_id gnl|my_center|LOCUS_03180 2950 4023 gene locus_tag LOCUS_03190 2950 4023 CDS product AP endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_03190 4032 4760 gene locus_tag LOCUS_03200 4032 4760 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120554.1 protein_id gnl|my_center|LOCUS_03200 4767 5624 gene locus_tag LOCUS_03210 4767 5624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_03210 5625 6194 gene locus_tag LOCUS_03220 gene gmk 5625 6194 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 protein_id gnl|my_center|LOCUS_03220 6208 6789 gene locus_tag LOCUS_03230 gene nadD 6208 6789 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_03230 6874 7221 gene locus_tag LOCUS_03240 gene kdgF 6874 7221 CDS product pectin degradation protein kdgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170147.1 protein_id gnl|my_center|LOCUS_03240 8457 7222 gene locus_tag LOCUS_03250 8457 7222 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_03250 9018 8509 gene locus_tag LOCUS_03260 9018 8509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_03260 9346 9020 gene locus_tag LOCUS_03270 9346 9020 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_03270 9777 9352 gene locus_tag LOCUS_03280 gene sufE 9777 9352 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence030 207 491 gene locus_tag LOCUS_03290 207 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963282.1 protein_id gnl|my_center|LOCUS_03290 495 785 gene locus_tag LOCUS_03300 495 785 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_03300 962 2560 gene locus_tag LOCUS_03310 gene rny 962 2560 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR0 protein_id gnl|my_center|LOCUS_03310 3298 2561 gene locus_tag LOCUS_03320 3298 2561 CDS product anion permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461288.1 protein_id gnl|my_center|LOCUS_03320 4239 3490 gene locus_tag LOCUS_03330 gene madM 4239 3490 CDS product malonate transporter subunit MadM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765415.1 protein_id gnl|my_center|LOCUS_03330 4616 4236 gene locus_tag LOCUS_03340 4616 4236 CDS product malonate transporter MadL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112671.1 protein_id gnl|my_center|LOCUS_03340 6109 4616 gene locus_tag LOCUS_03350 6109 4616 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141122.1 protein_id gnl|my_center|LOCUS_03350 6252 6500 gene locus_tag LOCUS_03360 6252 6500 CDS product RNA polymerase subunit sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933465.1 protein_id gnl|my_center|LOCUS_03360 6500 8170 gene locus_tag LOCUS_03370 6500 8170 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262768.1 protein_id gnl|my_center|LOCUS_03370 8160 8903 gene locus_tag LOCUS_03380 8160 8903 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203544.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence031 1006 353 gene locus_tag LOCUS_03390 1006 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963624.1 protein_id gnl|my_center|LOCUS_03390 1143 3020 gene locus_tag LOCUS_03400 gene htpG 1143 3020 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_03400 3132 3737 gene locus_tag LOCUS_03410 3132 3737 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_03410 4222 4869 gene locus_tag LOCUS_03420 4222 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963060.1 protein_id gnl|my_center|LOCUS_03420 5139 4870 gene locus_tag LOCUS_03430 5139 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 5574 5167 gene locus_tag LOCUS_03440 gene ygcM 5574 5167 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 protein_id gnl|my_center|LOCUS_03440 6101 5571 gene locus_tag LOCUS_03450 gene idi 6101 5571 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_03450 6196 7782 gene locus_tag LOCUS_03460 gene prfC 6196 7782 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYT6 protein_id gnl|my_center|LOCUS_03460 8127 7813 gene locus_tag LOCUS_03470 8127 7813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_03470 <9764 8130 gene locus_tag LOCUS_03480 <9764 8130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT9:DNA-directed RNA polymerase subunit beta' >Feature sequence032 <1 1212 gene locus_tag LOCUS_03490 <1 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVR4:magnesium transporter MgtE 1216 2160 gene locus_tag LOCUS_03500 1216 2160 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_03500 3413 2157 gene locus_tag LOCUS_03510 gene lysC 3413 2157 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 protein_id gnl|my_center|LOCUS_03510 3925 3413 gene locus_tag LOCUS_03520 3925 3413 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_03520 4764 3991 gene locus_tag LOCUS_03530 4764 3991 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_03530 5477 4764 gene locus_tag LOCUS_03540 gene pdxJ 5477 4764 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 protein_id gnl|my_center|LOCUS_03540 5588 6469 gene locus_tag LOCUS_03550 gene nadK 5588 6469 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_03550 6549 7244 gene locus_tag LOCUS_03560 6549 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964193.1 protein_id gnl|my_center|LOCUS_03560 7247 7978 gene locus_tag LOCUS_03570 gene uppS 7247 7978 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 protein_id gnl|my_center|LOCUS_03570 >Feature sequence033 3900 2272 gene locus_tag LOCUS_03580 3900 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 4477 3947 gene locus_tag LOCUS_03590 4477 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5418 4504 gene locus_tag LOCUS_03600 5418 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5493 6293 gene locus_tag LOCUS_03610 5493 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 6745 6317 gene locus_tag LOCUS_03620 6745 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7037 7966 gene locus_tag LOCUS_03630 7037 7966 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124073.1 protein_id gnl|my_center|LOCUS_03630 8126 9508 gene locus_tag LOCUS_03640 8126 9508 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence034 1211 546 gene locus_tag LOCUS_03650 1211 546 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405245.1 protein_id gnl|my_center|LOCUS_03650 2674 1274 gene locus_tag LOCUS_03660 gene nagA 2674 1274 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_03660 2982 2764 gene locus_tag LOCUS_03670 2982 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3686 2994 gene locus_tag LOCUS_03680 3686 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4753 3707 gene locus_tag LOCUS_03690 gene pam 4753 3707 CDS product peptidylglycine monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122516.1 protein_id gnl|my_center|LOCUS_03690 4902 6785 gene locus_tag LOCUS_03700 4902 6785 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767207.1 protein_id gnl|my_center|LOCUS_03700 6808 7944 gene locus_tag LOCUS_03710 6808 7944 CDS product aldose 1-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N14 protein_id gnl|my_center|LOCUS_03710 8810 8016 gene locus_tag LOCUS_03720 gene idnO 8810 8016 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288236.1 protein_id gnl|my_center|LOCUS_03720 <9437 8816 gene locus_tag LOCUS_03730 <9437 8816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650K4:4-deoxy-L-threo-5-hexosulose-uronate ketol-isomerase >Feature sequence035 5478 6413 gene locus_tag LOCUS_03740 5478 6413 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence036 <1 1342 gene locus_tag LOCUS_03750 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H000:fumarate hydratase class II 3039 1345 gene locus_tag LOCUS_03760 3039 1345 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 protein_id gnl|my_center|LOCUS_03760 3146 4774 gene locus_tag LOCUS_03770 3146 4774 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_03770 5844 4771 gene locus_tag LOCUS_03780 gene menE 5844 4771 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963713.1 protein_id gnl|my_center|LOCUS_03780 6749 5841 gene locus_tag LOCUS_03790 gene yyaK 6749 5841 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_03790 8105 6759 gene locus_tag LOCUS_03800 8105 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 8538 8116 gene locus_tag LOCUS_03810 8538 8116 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962819.1 protein_id gnl|my_center|LOCUS_03810 <9268 8612 gene locus_tag LOCUS_03820 <9268 8612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXZ1:chaperone protein DnaK >Feature sequence037 1326 391 gene locus_tag LOCUS_03830 1326 391 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_03830 3945 1390 gene locus_tag LOCUS_03840 3945 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4142 4069 gene locus_tag LOCUS_t00080 4142 4069 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4280 5389 gene locus_tag LOCUS_03850 4280 5389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03850 5513 7810 gene locus_tag LOCUS_03860 5513 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03860 8106 7807 gene locus_tag LOCUS_03870 8106 7807 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962464.1 protein_id gnl|my_center|LOCUS_03870 <9266 8158 gene locus_tag LOCUS_03880 <9266 8158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962463.1:phosphoesterase >Feature sequence038 <1 859 gene locus_tag LOCUS_03890 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY93:succinate--CoA ligase [ADP-forming] subunit alpha 869 1618 gene locus_tag LOCUS_03900 869 1618 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_03900 1630 2448 gene locus_tag LOCUS_03910 1630 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2619 3470 gene locus_tag LOCUS_03920 gene hisG 2619 3470 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY81 protein_id gnl|my_center|LOCUS_03920 3470 4753 gene locus_tag LOCUS_03930 gene hisD 3470 4753 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY80 protein_id gnl|my_center|LOCUS_03930 4753 5802 gene locus_tag LOCUS_03940 gene hisC 4753 5802 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY79 protein_id gnl|my_center|LOCUS_03940 5799 6929 gene locus_tag LOCUS_03950 gene hisB 5799 6929 CDS product histidine biosynthesis bifunctional protein HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY78 protein_id gnl|my_center|LOCUS_03950 6931 7512 gene locus_tag LOCUS_03960 gene hisH 6931 7512 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY77 protein_id gnl|my_center|LOCUS_03960 7514 8242 gene locus_tag LOCUS_03970 gene hisA 7514 8242 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY76 protein_id gnl|my_center|LOCUS_03970 8246 9016 gene locus_tag LOCUS_03980 gene hisF 8246 9016 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY75 protein_id gnl|my_center|LOCUS_03980 >Feature sequence039 1583 645 gene locus_tag LOCUS_03990 gene rbsK 1583 645 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87H82 protein_id gnl|my_center|LOCUS_03990 2594 1590 gene locus_tag LOCUS_04000 2594 1590 CDS product multidrug DMT transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_04000 4569 2629 gene locus_tag LOCUS_04010 4569 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082989.1 protein_id gnl|my_center|LOCUS_04010 6462 4582 gene locus_tag LOCUS_04020 6462 4582 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118507.1 protein_id gnl|my_center|LOCUS_04020 8021 6510 gene locus_tag LOCUS_04030 8021 6510 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 protein_id gnl|my_center|LOCUS_04030 <9211 8024 gene locus_tag LOCUS_04040 <9211 8024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118263.1:iduronate-2-sulfatase >Feature sequence040 491 1843 gene locus_tag LOCUS_04050 491 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3129 1969 gene locus_tag LOCUS_04060 3129 1969 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765517.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04060 4603 3269 gene locus_tag LOCUS_04070 4603 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 5523 4663 gene locus_tag LOCUS_04080 gene tesB 5523 4663 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_04080 6904 5567 gene locus_tag LOCUS_04090 6904 5567 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120094.1 protein_id gnl|my_center|LOCUS_04090 8576 7059 gene locus_tag LOCUS_04100 8576 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence041 <1 1548 gene locus_tag LOCUS_04110 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258585.1:glycosyl hydrolase family 32 1725 3536 gene locus_tag LOCUS_04120 1725 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 3677 5104 gene locus_tag LOCUS_04130 3677 5104 CDS product heparan N-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_04130 5548 5462 gene locus_tag LOCUS_t00090 5548 5462 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7659 5614 gene locus_tag LOCUS_04140 7659 5614 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762019.1 protein_id gnl|my_center|LOCUS_04140 7802 8545 gene locus_tag LOCUS_04150 7802 8545 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence042 2498 420 gene locus_tag LOCUS_04160 2498 420 CDS product 2,6-beta-D-fructofuranosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_04160 2995 4194 gene locus_tag LOCUS_04170 2995 4194 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142387.1 protein_id gnl|my_center|LOCUS_04170 4208 5383 gene locus_tag LOCUS_04180 4208 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730860.1 protein_id gnl|my_center|LOCUS_04180 5482 7014 gene locus_tag LOCUS_04190 5482 7014 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767669.1 protein_id gnl|my_center|LOCUS_04190 7240 7650 gene locus_tag LOCUS_04200 7240 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 <9081 7768 gene locus_tag LOCUS_04210 <9081 7768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence043 2505 334 gene locus_tag LOCUS_04220 gene rnr 2505 334 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 protein_id gnl|my_center|LOCUS_04220 3002 3433 gene locus_tag LOCUS_04230 gene rpiB 3002 3433 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 protein_id gnl|my_center|LOCUS_04230 3824 3465 gene locus_tag LOCUS_04240 3824 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 5551 3827 gene locus_tag LOCUS_04250 5551 3827 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 protein_id gnl|my_center|LOCUS_04250 7226 5631 gene locus_tag LOCUS_04260 7226 5631 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964485.1 protein_id gnl|my_center|LOCUS_04260 8041 7223 gene locus_tag LOCUS_04270 8041 7223 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_04270 <8915 8082 gene locus_tag LOCUS_04280 <8915 8082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123882.1:gluconolactonase >Feature sequence044 <1 671 gene locus_tag LOCUS_04290 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119648.1:arylsulfatase 684 2108 gene locus_tag LOCUS_04300 684 2108 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118996.1 protein_id gnl|my_center|LOCUS_04300 2195 4123 gene locus_tag LOCUS_04310 2195 4123 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203328.1 protein_id gnl|my_center|LOCUS_04310 4125 6176 gene locus_tag LOCUS_04320 4125 6176 CDS product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_04320 6185 7471 gene locus_tag LOCUS_04330 6185 7471 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120406.1 protein_id gnl|my_center|LOCUS_04330 7473 8867 gene locus_tag LOCUS_04340 gene arsA 7473 8867 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122622.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence045 <1 2464 gene locus_tag LOCUS_04350 <1 2464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein 2551 2477 gene locus_tag LOCUS_t00100 2551 2477 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2741 4330 gene locus_tag LOCUS_04360 2741 4330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 4505 4430 gene locus_tag LOCUS_t00110 4505 4430 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4670 4879 gene locus_tag LOCUS_04370 4670 4879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 5811 4876 gene locus_tag LOCUS_04380 gene oxyR 5811 4876 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_04380 6613 5918 gene locus_tag LOCUS_04390 6613 5918 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DSX6 protein_id gnl|my_center|LOCUS_04390 6612 7256 gene locus_tag LOCUS_04400 6612 7256 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_04400 7350 8081 gene locus_tag LOCUS_04410 7350 8081 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence046 <1 1755 gene locus_tag LOCUS_04420 <1 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump 2815 1835 gene locus_tag LOCUS_04430 gene pdhB 2815 1835 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_04430 2966 3589 gene locus_tag LOCUS_04440 2966 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_04440 3673 4497 gene locus_tag LOCUS_04450 gene thyA 3673 4497 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 protein_id gnl|my_center|LOCUS_04450 5470 4499 gene locus_tag LOCUS_04460 5470 4499 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980220.1 protein_id gnl|my_center|LOCUS_04460 5702 6220 gene locus_tag LOCUS_04470 gene dfrA 5702 6220 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG8 protein_id gnl|my_center|LOCUS_04470 6223 7104 gene locus_tag LOCUS_04480 gene fabD 6223 7104 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_04480 8231 7101 gene locus_tag LOCUS_04490 gene porR 8231 7101 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_04490 >Feature sequence047 1079 60 gene locus_tag LOCUS_04500 gene mreB 1079 60 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 protein_id gnl|my_center|LOCUS_04500 2642 1119 gene locus_tag LOCUS_04510 gene purH 2642 1119 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 protein_id gnl|my_center|LOCUS_04510 2855 3571 gene locus_tag LOCUS_04520 2855 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3590 3994 gene locus_tag LOCUS_04530 3590 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4037 6271 gene locus_tag LOCUS_04540 4037 6271 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_04540 6287 6613 gene locus_tag LOCUS_04550 6287 6613 CDS product metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964132.1 protein_id gnl|my_center|LOCUS_04550 8307 6670 gene locus_tag LOCUS_04560 gene groL 8307 6670 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_04560 >Feature sequence048 516 1007 gene locus_tag LOCUS_04570 516 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1070 2398 gene locus_tag LOCUS_04580 gene ffh 1070 2398 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 protein_id gnl|my_center|LOCUS_04580 2402 3280 gene locus_tag LOCUS_04590 gene folD 2402 3280 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 protein_id gnl|my_center|LOCUS_04590 4170 3283 gene locus_tag LOCUS_04600 4170 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 protein_id gnl|my_center|LOCUS_04600 4258 4890 gene locus_tag LOCUS_04610 gene queE 4258 4890 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_04610 5026 4877 gene locus_tag LOCUS_04620 5026 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 5319 5071 gene locus_tag LOCUS_04630 5319 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 6482 5325 gene locus_tag LOCUS_04640 6482 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 protein_id gnl|my_center|LOCUS_04640 6527 7732 gene locus_tag LOCUS_04650 6527 7732 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence049 <1 1305 gene locus_tag LOCUS_04660 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVZ0:glucose-6-phosphate isomerase 2983 1295 gene locus_tag LOCUS_04670 gene recJ 2983 1295 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_04670 3666 2983 gene locus_tag LOCUS_04680 gene rsmI 3666 2983 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL7 protein_id gnl|my_center|LOCUS_04680 4347 3694 gene locus_tag LOCUS_04690 4347 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963207.1 protein_id gnl|my_center|LOCUS_04690 4407 4991 gene locus_tag LOCUS_04700 gene tdk 4407 4991 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 protein_id gnl|my_center|LOCUS_04700 5091 6098 gene locus_tag LOCUS_04710 5091 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 6209 7198 gene locus_tag LOCUS_04720 gene asd 6209 7198 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_04720 <8398 7353 gene locus_tag LOCUS_04730 <8398 7353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964466.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence050 851 777 gene locus_tag LOCUS_t00120 851 777 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2243 993 gene locus_tag LOCUS_04740 gene ilvA 2243 993 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT3 protein_id gnl|my_center|LOCUS_04740 3411 2374 gene locus_tag LOCUS_04750 3411 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3640 3903 gene locus_tag LOCUS_04760 3640 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3854 4510 gene locus_tag LOCUS_04770 3854 4510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5460 4576 gene locus_tag LOCUS_04780 5460 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5573 6322 gene locus_tag LOCUS_04790 5573 6322 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_04790 <8345 6357 gene locus_tag LOCUS_04800 <8345 6357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962206.1:penicillin-binding protein 1A >Feature sequence051 103 288 gene locus_tag LOCUS_04810 103 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 275 1708 gene locus_tag LOCUS_04820 275 1708 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 protein_id gnl|my_center|LOCUS_04820 1797 2402 gene locus_tag LOCUS_04830 gene arsC 1797 2402 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_04830 2851 2399 gene locus_tag LOCUS_04840 2851 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3606 2851 gene locus_tag LOCUS_04850 3606 2851 CDS product large, multifunctional secreted protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_04850 4822 3665 gene locus_tag LOCUS_04860 4822 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 6193 4880 gene locus_tag LOCUS_04870 gene xylA 6193 4880 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M2 protein_id gnl|my_center|LOCUS_04870 7665 6196 gene locus_tag LOCUS_04880 7665 6196 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765651.1 protein_id gnl|my_center|LOCUS_04880 >Feature sequence052 1664 2416 gene locus_tag LOCUS_04890 1664 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 protein_id gnl|my_center|LOCUS_04890 2409 2936 gene locus_tag LOCUS_04900 gene kdsC 2409 2936 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 protein_id gnl|my_center|LOCUS_04900 2940 3524 gene locus_tag LOCUS_04910 2940 3524 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_04910 3684 6095 gene locus_tag LOCUS_04920 3684 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6331 7848 gene locus_tag LOCUS_04930 6331 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence053 6994 476 gene locus_tag LOCUS_04940 6994 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence054 334 840 gene locus_tag LOCUS_04950 334 840 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_04950 1353 2870 gene locus_tag LOCUS_04960 1353 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3166 2915 gene locus_tag LOCUS_04970 gene rpsT 3166 2915 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 protein_id gnl|my_center|LOCUS_04970 3472 3400 gene locus_tag LOCUS_t00130 3472 3400 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5041 3563 gene locus_tag LOCUS_04980 gene proS 5041 3563 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 protein_id gnl|my_center|LOCUS_04980 5198 6190 gene locus_tag LOCUS_04990 5198 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 6254 7711 gene locus_tag LOCUS_05000 6254 7711 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963523.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence055 1193 570 gene locus_tag LOCUS_05010 1193 570 CDS product metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963510.1 protein_id gnl|my_center|LOCUS_05010 1864 1190 gene locus_tag LOCUS_05020 1864 1190 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_05020 3516 1894 gene locus_tag LOCUS_05030 gene pdhC 3516 1894 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_05030 4520 3519 gene locus_tag LOCUS_05040 gene pdhA 4520 3519 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_05040 5743 4649 gene locus_tag LOCUS_05050 gene porV 5743 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_05050 6016 7719 gene locus_tag LOCUS_05060 gene gldJ 6016 7719 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence056 388 3171 gene locus_tag LOCUS_05070 gene uvrA1 388 3171 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_05070 4637 3168 gene locus_tag LOCUS_05080 4637 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7059 4621 gene locus_tag LOCUS_05090 7059 4621 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_05090 7282 7043 gene locus_tag LOCUS_05100 7282 7043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence057 <1 1966 gene locus_tag LOCUS_05110 <1 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0F9:chaperone protein ClpB 1984 2448 gene locus_tag LOCUS_05120 gene smpB 1984 2448 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0S6 protein_id gnl|my_center|LOCUS_05120 3089 2445 gene locus_tag LOCUS_05130 gene pcm 3089 2445 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 protein_id gnl|my_center|LOCUS_05130 3067 4122 gene locus_tag LOCUS_05140 3067 4122 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_05140 4179 4829 gene locus_tag LOCUS_05150 4179 4829 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788686.1 protein_id gnl|my_center|LOCUS_05150 4833 6209 gene locus_tag LOCUS_05160 4833 6209 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_05160 6226 7047 gene locus_tag LOCUS_05170 6226 7047 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence058 <1 940 gene locus_tag LOCUS_05180 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760040.1:hemolysin 1060 3171 gene locus_tag LOCUS_05190 1060 3171 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2B0 protein_id gnl|my_center|LOCUS_05190 4075 3176 gene locus_tag LOCUS_05200 4075 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_05200 5394 4081 gene locus_tag LOCUS_05210 gene mvaA 5394 4081 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 protein_id gnl|my_center|LOCUS_05210 5513 6868 gene locus_tag LOCUS_05220 5513 6868 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418260.1 protein_id gnl|my_center|LOCUS_05220 6865 7431 gene locus_tag LOCUS_05230 6865 7431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence059 600 1466 gene locus_tag LOCUS_05240 600 1466 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAK1 protein_id gnl|my_center|LOCUS_05240 1474 2046 gene locus_tag LOCUS_05250 1474 2046 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 protein_id gnl|my_center|LOCUS_05250 2039 2902 gene locus_tag LOCUS_05260 gene rmlD 2039 2902 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964565.1 protein_id gnl|my_center|LOCUS_05260 2903 3907 gene locus_tag LOCUS_05270 gene rmlB 2903 3907 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 protein_id gnl|my_center|LOCUS_05270 4006 4551 gene locus_tag LOCUS_05280 gene rplU 4006 4551 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P9 protein_id gnl|my_center|LOCUS_05280 4577 4837 gene locus_tag LOCUS_05290 gene rpmA 4577 4837 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 protein_id gnl|my_center|LOCUS_05290 6044 4863 gene locus_tag LOCUS_05300 6044 4863 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085582.1 protein_id gnl|my_center|LOCUS_05300 7519 6197 gene locus_tag LOCUS_05310 gene ahcY 7519 6197 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_05310 >Feature sequence060 41 289 gene locus_tag LOCUS_05320 41 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 374 1309 gene locus_tag LOCUS_05330 gene wbmH 374 1309 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807090.1 protein_id gnl|my_center|LOCUS_05330 1315 2241 gene locus_tag LOCUS_05340 gene wbmG 1315 2241 CDS product nucleotide sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038685.1 protein_id gnl|my_center|LOCUS_05340 2234 3268 gene locus_tag LOCUS_05350 gene wbmF 2234 3268 CDS product nucleotide sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807093.1 protein_id gnl|my_center|LOCUS_05350 3298 4494 gene locus_tag LOCUS_05360 3298 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4525 5655 gene locus_tag LOCUS_05370 gene wbpG 4525 5655 CDS product LPS biosynthesis protein WbpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119728.1 protein_id gnl|my_center|LOCUS_05370 5664 6281 gene locus_tag LOCUS_05380 gene hisH2 5664 6281 CDS product imidazole glycerol phosphate synthase subunit HisH 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72138 protein_id gnl|my_center|LOCUS_05380 6271 7035 gene locus_tag LOCUS_05390 gene hisF2 6271 7035 CDS product putative imidazole glycerol phosphate synthase subunit hisF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P72139 protein_id gnl|my_center|LOCUS_05390 >Feature sequence061 943 2004 gene locus_tag LOCUS_05400 943 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2474 2001 gene locus_tag LOCUS_05410 2474 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963768.1 protein_id gnl|my_center|LOCUS_05410 3483 2482 gene locus_tag LOCUS_05420 gene ctaA 3483 2482 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_05420 4906 3473 gene locus_tag LOCUS_05430 gene cca 4906 3473 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_05430 5453 4908 gene locus_tag LOCUS_05440 5453 4908 CDS product translation factor Sua5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_05440 6543 5737 gene locus_tag LOCUS_05450 gene dapD 6543 5737 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_05450 6627 7052 gene locus_tag LOCUS_05460 6627 7052 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 protein_id gnl|my_center|LOCUS_05460 >Feature sequence062 119 754 gene locus_tag LOCUS_05470 gene wbmP 119 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064741.1 protein_id gnl|my_center|LOCUS_05470 744 2183 gene locus_tag LOCUS_05480 744 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2180 3319 gene locus_tag LOCUS_05490 2180 3319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3385 4236 gene locus_tag LOCUS_05500 3385 4236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038683.1 protein_id gnl|my_center|LOCUS_05500 4264 6162 gene locus_tag LOCUS_05510 gene wbmI 4264 6162 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_05510 6380 6997 gene locus_tag LOCUS_05520 6380 6997 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455373.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence063 1032 793 gene locus_tag LOCUS_05530 1032 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1119 2537 gene locus_tag LOCUS_05540 gene uxaB 1119 2537 CDS product altronate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97L67 protein_id gnl|my_center|LOCUS_05540 2534 4135 gene locus_tag LOCUS_05550 gene uxaA 2534 4135 CDS product altronate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34673 protein_id gnl|my_center|LOCUS_05550 4201 5667 gene locus_tag LOCUS_05560 4201 5667 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_05560 5734 6216 gene locus_tag LOCUS_05570 5734 6216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence064 1291 95 gene locus_tag LOCUS_05580 gene hemA 1291 95 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP1 protein_id gnl|my_center|LOCUS_05580 1489 2346 gene locus_tag LOCUS_05590 1489 2346 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962226.1 protein_id gnl|my_center|LOCUS_05590 2357 3391 gene locus_tag LOCUS_05600 gene hemH 2357 3391 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVP3 protein_id gnl|my_center|LOCUS_05600 3388 4725 gene locus_tag LOCUS_05610 3388 4725 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 protein_id gnl|my_center|LOCUS_05610 4825 5379 gene locus_tag LOCUS_05620 4825 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_05620 5441 6823 gene locus_tag LOCUS_05630 5441 6823 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_05630 <7418 6807 gene locus_tag LOCUS_05640 <7418 6807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962233.1:1-acyl-sn-glycerol-3-phosphate acyltransferase >Feature sequence065 <1 1395 gene locus_tag LOCUS_05650 <1 1395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963302.1:aconitate hydratase 1514 2599 gene locus_tag LOCUS_05660 1514 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 2659 2811 gene locus_tag LOCUS_05670 2659 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2914 3408 gene locus_tag LOCUS_05680 2914 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3418 5112 gene locus_tag LOCUS_05690 3418 5112 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973790.1 protein_id gnl|my_center|LOCUS_05690 6275 5148 gene locus_tag LOCUS_05700 6275 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120378.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence066 <1 1255 gene locus_tag LOCUS_05710 <1 1255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW04:tyrosine--tRNA ligase 2244 1252 gene locus_tag LOCUS_05720 2244 1252 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_05720 2582 2250 gene locus_tag LOCUS_05730 2582 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 2738 3430 gene locus_tag LOCUS_05740 gene phoP 2738 3430 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_05740 3476 4561 gene locus_tag LOCUS_05750 gene phoR 3476 4561 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_05750 4601 5275 gene locus_tag LOCUS_05760 gene trmB 4601 5275 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWK8 protein_id gnl|my_center|LOCUS_05760 5275 5616 gene locus_tag LOCUS_05770 gene ogt2 5275 5616 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_05770 5677 6807 gene locus_tag LOCUS_05780 gene mrp 5677 6807 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_05780 6813 7055 gene locus_tag LOCUS_05790 6813 7055 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence067 1389 97 gene locus_tag LOCUS_05800 gene radA 1389 97 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_05800 2357 1407 gene locus_tag LOCUS_05810 2357 1407 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_05810 2712 2359 gene locus_tag LOCUS_05820 gene panD 2712 2359 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_05820 3491 2730 gene locus_tag LOCUS_05830 gene panC 3491 2730 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 protein_id gnl|my_center|LOCUS_05830 3670 4473 gene locus_tag LOCUS_05840 3670 4473 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_05840 4483 6309 gene locus_tag LOCUS_05850 4483 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 7160 6477 gene locus_tag LOCUS_05860 7160 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence068 2262 31 gene locus_tag LOCUS_05870 2262 31 CDS product maltose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_05870 2936 2274 gene locus_tag LOCUS_05880 gene pgmB2 2936 2274 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_05880 4257 2926 gene locus_tag LOCUS_05890 4257 2926 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_05890 5441 4404 gene locus_tag LOCUS_05900 5441 4404 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence069 290 114 gene locus_tag LOCUS_05910 290 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 586 1203 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccaactgcctatatcttgattaaa 6404 1860 gene locus_tag LOCUS_05920 6404 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence070 161 934 gene locus_tag LOCUS_05930 161 934 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_05930 2313 931 gene locus_tag LOCUS_05940 2313 931 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_05940 2581 5418 gene locus_tag LOCUS_05950 gene uvrA2 2581 5418 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_05950 >Feature sequence071 <1 1248 gene locus_tag LOCUS_05960 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123097.1:iduronate-2-sulfatase 2764 1343 gene locus_tag LOCUS_05970 gene GALNS 2764 1343 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121448.1 protein_id gnl|my_center|LOCUS_05970 2915 3817 gene locus_tag LOCUS_05980 2915 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5066 3840 gene locus_tag LOCUS_05990 5066 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5985 5071 gene locus_tag LOCUS_06000 5985 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 6932 5997 gene locus_tag LOCUS_06010 6932 5997 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence072 5712 5353 gene locus_tag LOCUS_06020 5712 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 <7012 5823 gene locus_tag LOCUS_06030 <7012 5823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:choline-sulfatase >Feature sequence073 1249 989 gene locus_tag LOCUS_06040 1249 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2036 1260 gene locus_tag LOCUS_06050 gene surE 2036 1260 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_06050 2170 4281 gene locus_tag LOCUS_06060 2170 4281 CDS product tail-specific protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_06060 4291 5358 gene locus_tag LOCUS_06070 4291 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6621 5362 gene locus_tag LOCUS_06080 gene rodA 6621 5362 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence074 1359 697 gene locus_tag LOCUS_06090 1359 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1425 1637 gene locus_tag LOCUS_06100 1425 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1757 2458 gene locus_tag LOCUS_06110 1757 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2455 3936 gene locus_tag LOCUS_06120 2455 3936 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258272.1 protein_id gnl|my_center|LOCUS_06120 3923 4573 gene locus_tag LOCUS_06130 3923 4573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 4591 5157 gene locus_tag LOCUS_06140 4591 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5558 5118 gene locus_tag LOCUS_06150 5558 5118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 6417 5611 gene locus_tag LOCUS_06160 gene yeeZ 6417 5611 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962265.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence075 1470 934 gene locus_tag LOCUS_06170 gene atpH 1470 934 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_06170 1964 1467 gene locus_tag LOCUS_06180 gene atpF 1964 1467 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 protein_id gnl|my_center|LOCUS_06180 2210 2019 gene locus_tag LOCUS_06190 2210 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3294 2242 gene locus_tag LOCUS_06200 gene atpB 3294 2242 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_06200 4390 3992 gene locus_tag LOCUS_06210 4390 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964553.1 protein_id gnl|my_center|LOCUS_06210 6821 4377 gene locus_tag LOCUS_06220 gene sprE 6821 4377 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence076 <1 1442 gene locus_tag LOCUS_06230 <1 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I 1502 2113 gene locus_tag LOCUS_06240 1502 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2114 2500 gene locus_tag LOCUS_06250 gene rpsI 2114 2500 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_06250 2565 3464 gene locus_tag LOCUS_06260 gene rpsB 2565 3464 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU2 protein_id gnl|my_center|LOCUS_06260 3497 4318 gene locus_tag LOCUS_06270 gene tsf 3497 4318 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_06270 4534 4950 gene locus_tag LOCUS_06280 4534 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5316 4939 gene locus_tag LOCUS_06290 5316 4939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964440.1 protein_id gnl|my_center|LOCUS_06290 5632 6672 gene locus_tag LOCUS_06300 gene porY 5632 6672 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence077 1047 562 gene locus_tag LOCUS_06310 gene purE 1047 562 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_06310 2203 1049 gene locus_tag LOCUS_06320 gene purK 2203 1049 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_06320 2290 2865 gene locus_tag LOCUS_06330 gene adk 2290 2865 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_06330 2873 3883 gene locus_tag LOCUS_06340 gene obg 2873 3883 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB7 protein_id gnl|my_center|LOCUS_06340 3912 4772 gene locus_tag LOCUS_06350 3912 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4769 6127 gene locus_tag LOCUS_06360 4769 6127 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence078 1135 59 gene locus_tag LOCUS_06370 gene prfA 1135 59 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0W3 protein_id gnl|my_center|LOCUS_06370 1718 1185 gene locus_tag LOCUS_06380 1718 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 2351 1722 gene locus_tag LOCUS_06390 2351 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3551 2385 gene locus_tag LOCUS_06400 gene purM 3551 2385 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 protein_id gnl|my_center|LOCUS_06400 3902 4909 gene locus_tag LOCUS_06410 gene glnII 3902 4909 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 protein_id gnl|my_center|LOCUS_06410 5897 4962 gene locus_tag LOCUS_06420 gene yrbG 5897 4962 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_06420 6190 6753 gene locus_tag LOCUS_06430 6190 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence079 <1 1572 gene locus_tag LOCUS_06440 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWT7:dihydroxy-acid dehydratase 1582 3315 gene locus_tag LOCUS_06450 gene ilvB 1582 3315 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 protein_id gnl|my_center|LOCUS_06450 3318 3857 gene locus_tag LOCUS_06460 3318 3857 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761035.1 protein_id gnl|my_center|LOCUS_06460 3873 5348 gene locus_tag LOCUS_06470 gene ilvC 3873 5348 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TN4 protein_id gnl|my_center|LOCUS_06470 >Feature sequence080 1101 322 gene locus_tag LOCUS_06480 1101 322 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_06480 1559 1113 gene locus_tag LOCUS_06490 1559 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_06490 2754 1573 gene locus_tag LOCUS_06500 2754 1573 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_06500 3845 2898 gene locus_tag LOCUS_06510 3845 2898 CDS product organic solvent ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962912.1 protein_id gnl|my_center|LOCUS_06510 5018 3906 gene locus_tag LOCUS_06520 5018 3906 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962911.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence081 738 953 gene locus_tag LOCUS_06530 738 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 889 1209 gene locus_tag LOCUS_06540 889 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 1284 2204 gene locus_tag LOCUS_06550 1284 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2206 2538 gene locus_tag LOCUS_06560 2206 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2714 3847 gene locus_tag LOCUS_06570 2714 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3915 4391 gene locus_tag LOCUS_06580 3915 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 4516 5277 gene locus_tag LOCUS_06590 4516 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence082 <1 543 gene locus_tag LOCUS_06600 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964075.1:gliding motility lipoprotein GldK 580 1224 gene locus_tag LOCUS_06610 gene gldL 580 1224 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_06610 1235 2815 gene locus_tag LOCUS_06620 gene gldM 1235 2815 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_06620 2825 3721 gene locus_tag LOCUS_06630 gene gldN 2825 3721 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_06630 3781 4836 gene locus_tag LOCUS_06640 gene fjo30 3781 4836 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence083 802 419 gene locus_tag LOCUS_06650 gene dksA 802 419 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_06650 4205 804 gene locus_tag LOCUS_06660 gene ileS 4205 804 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_06660 <6676 4263 gene locus_tag LOCUS_06670 <6676 4263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962686.1:TonB-dependent receptor >Feature sequence084 110 1507 gene locus_tag LOCUS_06680 110 1507 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_06680 1674 2225 gene locus_tag LOCUS_06690 1674 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2237 3763 gene locus_tag LOCUS_06700 2237 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3764 4663 gene locus_tag LOCUS_06710 3764 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 4656 5552 gene locus_tag LOCUS_06720 4656 5552 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence085 1897 1280 gene locus_tag LOCUS_06730 gene nqrE 1897 1280 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 protein_id gnl|my_center|LOCUS_06730 2593 1901 gene locus_tag LOCUS_06740 gene nqrD 2593 1901 CDS product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR8 protein_id gnl|my_center|LOCUS_06740 3263 2601 gene locus_tag LOCUS_06750 gene nqrC 3263 2601 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K9 protein_id gnl|my_center|LOCUS_06750 4489 3335 gene locus_tag LOCUS_06760 gene nqrB 4489 3335 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_06760 5838 4486 gene locus_tag LOCUS_06770 gene nqrA 5838 4486 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 protein_id gnl|my_center|LOCUS_06770 >Feature sequence086 684 1652 gene locus_tag LOCUS_06780 684 1652 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257878.1 protein_id gnl|my_center|LOCUS_06780 1803 2456 gene locus_tag LOCUS_06790 1803 2456 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_06790 2520 3890 gene locus_tag LOCUS_06800 2520 3890 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_06800 3902 5029 gene locus_tag LOCUS_06810 3902 5029 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066962.1 protein_id gnl|my_center|LOCUS_06810 5220 5657 gene locus_tag LOCUS_06820 5220 5657 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193685.1 protein_id gnl|my_center|LOCUS_06820 5744 6172 gene locus_tag LOCUS_06830 5744 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6165 6506 gene locus_tag LOCUS_06840 6165 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence087 488 126 gene locus_tag LOCUS_06850 488 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963214.1 protein_id gnl|my_center|LOCUS_06850 898 485 gene locus_tag LOCUS_06860 898 485 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_06860 2467 914 gene locus_tag LOCUS_06870 gene porX 2467 914 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_06870 2686 3708 gene locus_tag LOCUS_06880 gene lpxD 2686 3708 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 protein_id gnl|my_center|LOCUS_06880 3705 5102 gene locus_tag LOCUS_06890 gene fabZ 3705 5102 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 protein_id gnl|my_center|LOCUS_06890 5104 5889 gene locus_tag LOCUS_06900 gene lpxA 5104 5889 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_06900 5899 6465 gene locus_tag LOCUS_06910 gene efp 5899 6465 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_06910 >Feature sequence088 >Feature sequence089 223 1194 gene locus_tag LOCUS_06920 223 1194 CDS product putative PabA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57527 protein_id gnl|my_center|LOCUS_06920 1178 1774 gene locus_tag LOCUS_06930 1178 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44118 protein_id gnl|my_center|LOCUS_06930 2484 1771 gene locus_tag LOCUS_06940 2484 1771 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_06940 2656 3624 gene locus_tag LOCUS_06950 gene trpS 2656 3624 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_06950 3769 4740 gene locus_tag LOCUS_06960 3769 4740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 protein_id gnl|my_center|LOCUS_06960 5921 4743 gene locus_tag LOCUS_06970 5921 4743 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence090 <1 798 gene locus_tag LOCUS_06980 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962494.1:class II fructose-bisphosphate aldolase 838 1695 gene locus_tag LOCUS_06990 gene accD 838 1695 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_06990 1782 2051 gene locus_tag LOCUS_07000 gene rpsO 1782 2051 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MT6 protein_id gnl|my_center|LOCUS_07000 2137 4290 gene locus_tag LOCUS_07010 gene pnp 2137 4290 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H185 protein_id gnl|my_center|LOCUS_07010 4359 5222 gene locus_tag LOCUS_07020 gene rpoD 4359 5222 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_07020 5264 5914 gene locus_tag LOCUS_07030 gene rpe 5264 5914 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 protein_id gnl|my_center|LOCUS_07030 >Feature sequence091 <1 1127 gene locus_tag LOCUS_07040 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0U4:adenylosuccinate synthetase 1158 2825 gene locus_tag LOCUS_07050 1158 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_07050 2825 4000 gene locus_tag LOCUS_07060 gene argD 2825 4000 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_07060 4098 5453 gene locus_tag LOCUS_07070 4098 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence092 >Feature sequence093 1446 163 gene locus_tag LOCUS_07080 1446 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1769 2797 gene locus_tag LOCUS_07090 1769 2797 CDS product dihydroflavonol-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_07090 2893 4419 gene locus_tag LOCUS_07100 2893 4419 CDS product ketoglutarate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064271.1 protein_id gnl|my_center|LOCUS_07100 4641 4480 gene locus_tag LOCUS_07110 4641 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence094 351 127 gene locus_tag LOCUS_07120 351 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 1276 500 gene locus_tag LOCUS_07130 1276 500 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_07130 1692 1829 gene locus_tag LOCUS_07140 1692 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 3590 2004 gene locus_tag LOCUS_07150 gene yidK 3590 2004 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087134.1 protein_id gnl|my_center|LOCUS_07150 4605 3610 gene locus_tag LOCUS_07160 4605 3610 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083264.1 protein_id gnl|my_center|LOCUS_07160 5501 4638 gene locus_tag LOCUS_07170 5501 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 6163 5792 gene locus_tag LOCUS_07180 6163 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence095 <1 856 gene locus_tag LOCUS_07190 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H159:tyrosine recombinase XerC 1570 857 gene locus_tag LOCUS_07200 gene rprY 1570 857 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963933.1 protein_id gnl|my_center|LOCUS_07200 3137 1590 gene locus_tag LOCUS_07210 gene rprX 3137 1590 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_07210 3839 3261 gene locus_tag LOCUS_07220 gene coaE 3839 3261 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M1 protein_id gnl|my_center|LOCUS_07220 4801 3836 gene locus_tag LOCUS_07230 4801 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768081.1 protein_id gnl|my_center|LOCUS_07230 5641 4826 gene locus_tag LOCUS_07240 5641 4826 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_07240 6048 5677 gene locus_tag LOCUS_07250 6048 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence096 39 3176 gene locus_tag LOCUS_07260 39 3176 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107780.1 protein_id gnl|my_center|LOCUS_07260 3185 4600 gene locus_tag LOCUS_07270 3185 4600 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762337.1 protein_id gnl|my_center|LOCUS_07270 4650 5399 gene locus_tag LOCUS_07280 4650 5399 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963477.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence097 204 3002 gene locus_tag LOCUS_07290 204 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3007 3705 gene locus_tag LOCUS_07300 3007 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 3725 4564 gene locus_tag LOCUS_07310 3725 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_231174.2 protein_id gnl|my_center|LOCUS_07310 5943 4552 gene locus_tag LOCUS_07320 gene hisS 5943 4552 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H160 protein_id gnl|my_center|LOCUS_07320 >Feature sequence098 <1 1115 gene locus_tag LOCUS_07330 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZF0:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 3018 1117 gene locus_tag LOCUS_07340 gene acsA 3018 1117 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 protein_id gnl|my_center|LOCUS_07340 3191 3412 gene locus_tag LOCUS_07350 3191 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3477 4382 gene locus_tag LOCUS_07360 3477 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 4508 5722 gene locus_tag LOCUS_07370 gene arsA 4508 5722 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence099 2416 1469 gene locus_tag LOCUS_07380 2416 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2583 4073 gene locus_tag LOCUS_07390 2583 4073 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107431.1 protein_id gnl|my_center|LOCUS_07390 4196 5545 gene locus_tag LOCUS_07400 4196 5545 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108896.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence100 178 567 gene locus_tag LOCUS_07410 178 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 662 1855 gene locus_tag LOCUS_07420 gene aspC2 662 1855 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 protein_id gnl|my_center|LOCUS_07420 1875 2885 gene locus_tag LOCUS_07430 gene murB 1875 2885 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_07430 3339 2887 gene locus_tag LOCUS_07440 gene dtd 3339 2887 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_07440 4265 3342 gene locus_tag LOCUS_07450 gene rsgA 4265 3342 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 protein_id gnl|my_center|LOCUS_07450 4351 5868 gene locus_tag LOCUS_07460 gene gpmI 4351 5868 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1H2 protein_id gnl|my_center|LOCUS_07460 >Feature sequence101 782 60 gene locus_tag LOCUS_07470 782 60 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962342.1 protein_id gnl|my_center|LOCUS_07470 1536 2279 gene locus_tag LOCUS_07480 1536 2279 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_07480 2664 2287 gene locus_tag LOCUS_07490 2664 2287 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964463.1 protein_id gnl|my_center|LOCUS_07490 2760 3230 gene locus_tag LOCUS_07500 2760 3230 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_07500 3514 3248 gene locus_tag LOCUS_07510 3514 3248 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580382.1 protein_id gnl|my_center|LOCUS_07510 <5957 3511 gene locus_tag LOCUS_07520 <5957 3511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H244:leucine--tRNA ligase >Feature sequence102 <1 872 gene locus_tag LOCUS_07530 <1 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963777.1:A/G-specific adenine glycosylase 916 1338 gene locus_tag LOCUS_07540 gene ssb 916 1338 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H058 protein_id gnl|my_center|LOCUS_07540 1712 1416 gene locus_tag LOCUS_07550 1712 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1867 2670 gene locus_tag LOCUS_07560 1867 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2667 3233 gene locus_tag LOCUS_07570 gene gldD 2667 3233 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_07570 3598 3230 gene locus_tag LOCUS_07580 3598 3230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 5722 3647 gene locus_tag LOCUS_07590 5722 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence103 1633 314 gene locus_tag LOCUS_07600 gene yeiM 1633 314 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_07600 2921 1641 gene locus_tag LOCUS_07610 2921 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 3082 2948 gene locus_tag LOCUS_07620 3082 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3810 3097 gene locus_tag LOCUS_07630 3810 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 protein_id gnl|my_center|LOCUS_07630 4107 3856 gene locus_tag LOCUS_07640 4107 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence104 998 87 gene locus_tag LOCUS_07650 998 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2268 1849 gene locus_tag LOCUS_07660 gene osmC 2268 1849 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089002.1 protein_id gnl|my_center|LOCUS_07660 2674 2330 gene locus_tag LOCUS_07670 2674 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 3353 2973 gene locus_tag LOCUS_07680 3353 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 3769 3470 gene locus_tag LOCUS_07690 3769 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3985 4602 gene locus_tag LOCUS_07700 3985 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 5430 4807 gene locus_tag LOCUS_07710 5430 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence105 65 1951 gene locus_tag LOCUS_07720 gene susA 65 1951 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_07720 2033 3883 gene locus_tag LOCUS_07730 gene susA 2033 3883 CDS product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 protein_id gnl|my_center|LOCUS_07730 3886 5262 gene locus_tag LOCUS_07740 3886 5262 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962476.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence106 <1 883 gene locus_tag LOCUS_07750 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108281.1:threonine synthase 2482 872 gene locus_tag LOCUS_07760 2482 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2567 3655 gene locus_tag LOCUS_07770 gene gcvT 2567 3655 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_07770 3667 4491 gene locus_tag LOCUS_07780 3667 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4513 5229 gene locus_tag LOCUS_07790 4513 5229 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_07790 >Feature sequence107 4795 986 gene locus_tag LOCUS_07800 gene rpoB 4795 986 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_07800 5296 4916 gene locus_tag LOCUS_07810 gene rplL 5296 4916 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU1 protein_id gnl|my_center|LOCUS_07810 5691 5359 gene locus_tag LOCUS_07820 5691 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 >Feature sequence108 1172 5677 gene locus_tag LOCUS_07830 gene gltA 1172 5677 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964980.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence109 363 683 gene locus_tag LOCUS_07840 363 683 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_07840 1275 2348 gene locus_tag LOCUS_07850 gene mvaD 1275 2348 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 protein_id gnl|my_center|LOCUS_07850 2409 3338 gene locus_tag LOCUS_07860 gene mvaK 2409 3338 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_07860 3347 4225 gene locus_tag LOCUS_07870 3347 4225 CDS product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 protein_id gnl|my_center|LOCUS_07870 4235 5002 gene locus_tag LOCUS_07880 4235 5002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 <5658 5078 gene locus_tag LOCUS_07890 <5658 5078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWZ0:tryptophan synthase alpha chain >Feature sequence110 1718 1386 gene locus_tag LOCUS_07900 1718 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3959 2754 gene locus_tag LOCUS_07910 3959 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 5392 4076 gene locus_tag LOCUS_07920 5392 4076 CDS product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence111 99 2234 gene locus_tag LOCUS_07930 99 2234 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_07930 2286 3080 gene locus_tag LOCUS_07940 2286 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000615243.1 protein_id gnl|my_center|LOCUS_07940 3097 3630 gene locus_tag LOCUS_07950 3097 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3878 4258 gene locus_tag LOCUS_07960 3878 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4479 4342 gene locus_tag LOCUS_07970 4479 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 <5557 4956 gene locus_tag LOCUS_07980 <5557 4956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201970.1:lipase >Feature sequence112 1938 1123 gene locus_tag LOCUS_07990 1938 1123 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766741.1 protein_id gnl|my_center|LOCUS_07990 3153 1945 gene locus_tag LOCUS_08000 3153 1945 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_08000 4498 3167 gene locus_tag LOCUS_08010 gene xylE 4498 3167 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence113 <1 905 gene locus_tag LOCUS_08020 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q834W6:hydrophobic dipeptide epimerase 898 1932 gene locus_tag LOCUS_08030 898 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_08030 2383 1934 gene locus_tag LOCUS_08040 2383 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2442 2873 gene locus_tag LOCUS_08050 2442 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_08050 2876 3076 gene locus_tag LOCUS_08060 2876 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 3289 3068 gene locus_tag LOCUS_08070 3289 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4120 3491 gene locus_tag LOCUS_08080 4120 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence114 312 1559 gene locus_tag LOCUS_08090 312 1559 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_08090 1634 1867 gene locus_tag LOCUS_08100 gene rpmB 1634 1867 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_08100 1876 2058 gene locus_tag LOCUS_08110 gene rpmG 1876 2058 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI5 protein_id gnl|my_center|LOCUS_08110 2337 2086 gene locus_tag LOCUS_08120 2337 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2273 3226 gene locus_tag LOCUS_08130 gene ftsY 2273 3226 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI3 protein_id gnl|my_center|LOCUS_08130 3236 4249 gene locus_tag LOCUS_08140 3236 4249 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531457.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence115 770 1561 gene locus_tag LOCUS_08150 770 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_08150 2295 1558 gene locus_tag LOCUS_08160 2295 1558 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 protein_id gnl|my_center|LOCUS_08160 3001 2300 gene locus_tag LOCUS_08170 3001 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 4510 3002 gene locus_tag LOCUS_08180 gene sppA 4510 3002 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 protein_id gnl|my_center|LOCUS_08180 4593 4829 gene locus_tag LOCUS_08190 4593 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence116 442 996 gene locus_tag LOCUS_08200 442 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2861 1065 gene locus_tag LOCUS_08210 2861 1065 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_08210 3311 2874 gene locus_tag LOCUS_08220 3311 2874 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_08220 5140 3371 gene locus_tag LOCUS_08230 gene fadD 5140 3371 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence117 >Feature sequence118 <1 1375 gene locus_tag LOCUS_08240 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964459.1:TonB-dependent receptor 1496 4486 gene locus_tag LOCUS_08250 1496 4486 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203621.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence119 1948 980 gene locus_tag LOCUS_08260 gene hemB 1948 980 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN2 protein_id gnl|my_center|LOCUS_08260 2880 1978 gene locus_tag LOCUS_08270 gene hemF 2880 1978 CDS product coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN4 protein_id gnl|my_center|LOCUS_08270 3916 2894 gene locus_tag LOCUS_08280 gene hemE 3916 2894 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 protein_id gnl|my_center|LOCUS_08280 4584 3919 gene locus_tag LOCUS_08290 gene hemD 4584 3919 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962223.1 protein_id gnl|my_center|LOCUS_08290 <5355 4581 gene locus_tag LOCUS_08300 <5355 4581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVP0:hydroxymethylbilane synthase >Feature sequence120 457 1311 gene locus_tag LOCUS_08310 457 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1518 1706 gene locus_tag LOCUS_08320 1518 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 1778 2155 gene locus_tag LOCUS_08330 1778 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 3512 2166 gene locus_tag LOCUS_08340 3512 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123475.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence121 124 645 gene locus_tag LOCUS_08350 124 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 803 3094 gene locus_tag LOCUS_08360 gene xloA 803 3094 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_08360 3261 3602 gene locus_tag LOCUS_08370 3261 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4276 3599 gene locus_tag LOCUS_08380 gene ung2 4276 3599 CDS product uracil-DNA glycosylase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM3 protein_id gnl|my_center|LOCUS_08380 >Feature sequence122 <1 535 gene locus_tag LOCUS_08390 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVT6:ferrous iron transport protein B 1970 726 gene locus_tag LOCUS_08400 gene pepP 1970 726 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_08400 2836 4839 gene locus_tag LOCUS_08410 gene sdhA 2836 4839 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence123 1436 39 gene locus_tag LOCUS_08420 1436 39 CDS product acetylglucosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767323.1 protein_id gnl|my_center|LOCUS_08420 1599 3032 gene locus_tag LOCUS_08430 1599 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_08430 3139 4593 gene locus_tag LOCUS_08440 3139 4593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence124 <1 914 gene locus_tag LOCUS_08450 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201961.1:acetylornithine deacetylase 945 2243 gene locus_tag LOCUS_08460 gene argH 945 2243 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z15 protein_id gnl|my_center|LOCUS_08460 3632 2232 gene locus_tag LOCUS_08470 gene lpdA1 3632 2232 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_08470 3737 5170 gene locus_tag LOCUS_08480 3737 5170 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence125 1224 361 gene locus_tag LOCUS_08490 1224 361 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_08490 2770 1214 gene locus_tag LOCUS_08500 2770 1214 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2X1 protein_id gnl|my_center|LOCUS_08500 3768 2773 gene locus_tag LOCUS_08510 gene nadA 3768 2773 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG0 protein_id gnl|my_center|LOCUS_08510 4525 3830 gene locus_tag LOCUS_08520 gene truB 4525 3830 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H238 protein_id gnl|my_center|LOCUS_08520 4958 4527 gene locus_tag LOCUS_08530 4958 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence126 <1 1011 gene locus_tag LOCUS_08540 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083627.1:1,4-butanediol diacrylate esterase 1286 2146 gene locus_tag LOCUS_08550 1286 2146 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963827.1 protein_id gnl|my_center|LOCUS_08550 2491 2195 gene locus_tag LOCUS_08560 2491 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 2986 2501 gene locus_tag LOCUS_08570 2986 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 3721 3035 gene locus_tag LOCUS_08580 3721 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 4085 3765 gene locus_tag LOCUS_08590 4085 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence127 98 1780 gene locus_tag LOCUS_08600 98 1780 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_08600 2930 1791 gene locus_tag LOCUS_08610 2930 1791 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_08610 4206 2956 gene locus_tag LOCUS_08620 gene rocD 4206 2956 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence128 2731 665 gene locus_tag LOCUS_08630 gene dnaG 2731 665 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B0 protein_id gnl|my_center|LOCUS_08630 3686 2709 gene locus_tag LOCUS_08640 3686 2709 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_08640 4783 3728 gene locus_tag LOCUS_08650 gene rlmN 4783 3728 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_08650 >Feature sequence129 847 101 gene locus_tag LOCUS_08660 847 101 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_08660 1485 961 gene locus_tag LOCUS_08670 1485 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123243.1 protein_id gnl|my_center|LOCUS_08670 2902 1541 gene locus_tag LOCUS_08680 2902 1541 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_08680 3043 4695 gene locus_tag LOCUS_08690 3043 4695 CDS product solute:sodium symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence130 1164 139 gene locus_tag LOCUS_08700 1164 139 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_08700 1357 2178 gene locus_tag LOCUS_08710 1357 2178 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_08710 2175 2828 gene locus_tag LOCUS_08720 gene tal 2175 2828 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_08720 4222 2825 gene locus_tag LOCUS_08730 4222 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963192.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence131 909 283 gene locus_tag LOCUS_08740 gene rplD 909 283 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ98 protein_id gnl|my_center|LOCUS_08740 1526 909 gene locus_tag LOCUS_08750 gene rplC 1526 909 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ99 protein_id gnl|my_center|LOCUS_08750 1850 1545 gene locus_tag LOCUS_08760 gene rpsJ 1850 1545 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_08760 3990 1864 gene locus_tag LOCUS_08770 gene fusA 3990 1864 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA1 protein_id gnl|my_center|LOCUS_08770 4473 3997 gene locus_tag LOCUS_08780 gene rpsG 4473 3997 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_08780 4857 4483 gene locus_tag LOCUS_08790 gene rpsL 4857 4483 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_08790 >Feature sequence132 <1 1389 gene locus_tag LOCUS_08800 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0T6:GMP synthase [glutamine-hydrolyzing] 1430 3142 gene locus_tag LOCUS_08810 1430 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_08810 3215 4831 gene locus_tag LOCUS_08820 gene pyrG 3215 4831 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence133 409 1488 gene locus_tag LOCUS_08830 409 1488 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947999.1 protein_id gnl|my_center|LOCUS_08830 1493 2242 gene locus_tag LOCUS_08840 gene tpiA 1493 2242 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 protein_id gnl|my_center|LOCUS_08840 2243 3076 gene locus_tag LOCUS_08850 gene prmA 2243 3076 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_08850 3073 3357 gene locus_tag LOCUS_08860 gene clpS 3073 3357 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_08860 3417 3989 gene locus_tag LOCUS_08870 gene bsaA 3417 3989 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 protein_id gnl|my_center|LOCUS_08870 3994 4713 gene locus_tag LOCUS_08880 3994 4713 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_08880 4751 4825 gene locus_tag LOCUS_t00140 4751 4825 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence134 1345 1770 gene locus_tag LOCUS_08890 1345 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3041 1776 gene locus_tag LOCUS_08900 gene gltA 3041 1776 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ68 protein_id gnl|my_center|LOCUS_08900 4415 3129 gene locus_tag LOCUS_08910 gene eno 4415 3129 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ69 protein_id gnl|my_center|LOCUS_08910 >Feature sequence135 <1 2447 gene locus_tag LOCUS_08920 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962693.1:protein translocase subunit SecDF 3020 2493 gene locus_tag LOCUS_08930 3020 2493 CDS product putative metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HI24 protein_id gnl|my_center|LOCUS_08930 3759 3031 gene locus_tag LOCUS_08940 gene lgt 3759 3031 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG9 protein_id gnl|my_center|LOCUS_08940 <4889 4181 gene locus_tag LOCUS_08950 <4889 4181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX80:cysteine--tRNA ligase >Feature sequence136 322 1491 gene locus_tag LOCUS_08960 322 1491 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence137 106 936 gene locus_tag LOCUS_08970 106 936 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249686.1 protein_id gnl|my_center|LOCUS_08970 1183 1641 gene locus_tag LOCUS_08980 1183 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1785 2318 gene locus_tag LOCUS_08990 1785 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2427 2564 gene locus_tag LOCUS_09000 2427 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2883 3851 gene locus_tag LOCUS_09010 2883 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117866.1 protein_id gnl|my_center|LOCUS_09010 <4779 4217 gene locus_tag LOCUS_09020 <4779 4217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403438.1:pyridine nucleotide-disulfide oxidoreductase >Feature sequence138 1559 2167 gene locus_tag LOCUS_09030 gene sodA 1559 2167 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_09030 4293 2395 gene locus_tag LOCUS_09040 gene purF 4293 2395 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence139 2167 743 gene locus_tag LOCUS_09050 2167 743 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_09050 2256 2900 gene locus_tag LOCUS_09060 2256 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2887 3660 gene locus_tag LOCUS_09070 2887 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3660 4196 gene locus_tag LOCUS_09080 3660 4196 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence140 535 1110 gene locus_tag LOCUS_09090 535 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1120 2211 gene locus_tag LOCUS_09100 1120 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2826 2671 gene locus_tag LOCUS_09110 2826 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2934 3269 gene locus_tag LOCUS_09120 2934 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3291 4199 gene locus_tag LOCUS_09130 3291 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963614.1 protein_id gnl|my_center|LOCUS_09130 <4750 4248 gene locus_tag LOCUS_09140 <4750 4248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767783.1:fructokinase >Feature sequence141 <1 855 gene locus_tag LOCUS_09150 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXD5:D-alanine--D-alanine ligase 865 1329 gene locus_tag LOCUS_09160 gene coaD 865 1329 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 protein_id gnl|my_center|LOCUS_09160 1923 1324 gene locus_tag LOCUS_09170 1923 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1930 2577 gene locus_tag LOCUS_09180 gene pyrE 1930 2577 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_09180 3308 2571 gene locus_tag LOCUS_09190 gene birA 3308 2571 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361998.1 protein_id gnl|my_center|LOCUS_09190 3367 3738 gene locus_tag LOCUS_09200 gene rsfS 3367 3738 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 protein_id gnl|my_center|LOCUS_09200 >Feature sequence142 1947 904 gene locus_tag LOCUS_09210 gene alkB2 1947 904 CDS product alkane 1-monooxygenase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6H941 protein_id gnl|my_center|LOCUS_09210 2733 1975 gene locus_tag LOCUS_09220 2733 1975 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_09220 3002 4243 gene locus_tag LOCUS_09230 3002 4243 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHW6 protein_id gnl|my_center|LOCUS_09230 4258 4596 gene locus_tag LOCUS_09240 4258 4596 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932186.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence143 1032 631 gene locus_tag LOCUS_09250 1032 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09250 1135 1217 gene locus_tag LOCUS_t00150 1135 1217 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1740 1345 gene locus_tag LOCUS_09260 1740 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 2810 2064 gene locus_tag LOCUS_09270 2810 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2828 3871 gene locus_tag LOCUS_09280 2828 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 <4682 3883 gene locus_tag LOCUS_09290 <4682 3883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203604.1:3-deoxy-D-manno-octulosonic acid transferase >Feature sequence144 632 940 gene locus_tag LOCUS_09300 632 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1073 1258 gene locus_tag LOCUS_09310 1073 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2151 1396 gene locus_tag LOCUS_09320 2151 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2639 2190 gene locus_tag LOCUS_09330 2639 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2761 4404 gene locus_tag LOCUS_09340 2761 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence145 225 1262 gene locus_tag LOCUS_09350 gene paaE 225 1262 CDS product flavodoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964555.1 protein_id gnl|my_center|LOCUS_09350 2296 1265 gene locus_tag LOCUS_09360 2296 1265 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964556.1 protein_id gnl|my_center|LOCUS_09360 2920 2303 gene locus_tag LOCUS_09370 2920 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 protein_id gnl|my_center|LOCUS_09370 3925 2999 gene locus_tag LOCUS_09380 3925 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence146 314 1018 gene locus_tag LOCUS_09390 gene lipB 314 1018 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_09390 1874 1011 gene locus_tag LOCUS_09400 1874 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3456 1864 gene locus_tag LOCUS_09410 3456 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 4167 3535 gene locus_tag LOCUS_09420 gene rnhB 4167 3535 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 protein_id gnl|my_center|LOCUS_09420 >Feature sequence147 120 1736 gene locus_tag LOCUS_09430 120 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118540.1 protein_id gnl|my_center|LOCUS_09430 1741 3210 gene locus_tag LOCUS_09440 1741 3210 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121006.1 protein_id gnl|my_center|LOCUS_09440 3223 4188 gene locus_tag LOCUS_09450 3223 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123438.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence148 600 2534 gene locus_tag LOCUS_09460 gene ftsK 600 2534 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_09460 2544 3188 gene locus_tag LOCUS_09470 gene lolA 2544 3188 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963703.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence149 97 1947 gene locus_tag LOCUS_09480 97 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 1964 2677 gene locus_tag LOCUS_09490 1964 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 protein_id gnl|my_center|LOCUS_09490 2702 3337 gene locus_tag LOCUS_09500 2702 3337 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZTG8 protein_id gnl|my_center|LOCUS_09500 3460 3388 gene locus_tag LOCUS_t00160 3460 3388 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3634 4452 gene locus_tag LOCUS_09510 3634 4452 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334178.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence150 <1 1622 gene locus_tag LOCUS_09520 <1 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963539.1:cytochrome c biogenesis protein 1653 2087 gene locus_tag LOCUS_09530 1653 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 3326 2091 gene locus_tag LOCUS_09540 gene mscS2 3326 2091 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963097.1 protein_id gnl|my_center|LOCUS_09540 3972 3442 gene locus_tag LOCUS_09550 3972 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence151 1506 1045 gene locus_tag LOCUS_09560 1506 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2903 1542 gene locus_tag LOCUS_09570 2903 1542 CDS product glycan metabolism protein RagB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108738.1 protein_id gnl|my_center|LOCUS_09570 <4533 2908 gene locus_tag LOCUS_09580 <4533 2908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792393.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence152 137 1291 gene locus_tag LOCUS_09590 137 1291 CDS product alkanesulfonate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314866.1 protein_id gnl|my_center|LOCUS_09590 1275 2837 gene locus_tag LOCUS_09600 gene sglT 1275 2837 CDS product sodium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036949.1 protein_id gnl|my_center|LOCUS_09600 3005 2931 gene locus_tag LOCUS_t00170 3005 2931 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3516 3139 gene locus_tag LOCUS_09610 3516 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4178 3510 gene locus_tag LOCUS_09620 4178 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125622.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence153 <1 1642 gene locus_tag LOCUS_09630 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYW2:lysine--tRNA ligase 3139 1853 gene locus_tag LOCUS_09640 gene hemL 3139 1853 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 protein_id gnl|my_center|LOCUS_09640 3974 3141 gene locus_tag LOCUS_09650 3974 3141 CDS product hemagglutinin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963337.1 protein_id gnl|my_center|LOCUS_09650 <4490 3953 gene locus_tag LOCUS_09660 <4490 3953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963338.1:1-aminocyclopropane-1-carboxylate deaminase >Feature sequence154 300 16 gene locus_tag LOCUS_09670 300 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1014 618 gene locus_tag LOCUS_tm00010 1014 618 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1934 1101 gene locus_tag LOCUS_09680 gene kdsA 1934 1101 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWY4 protein_id gnl|my_center|LOCUS_09680 2647 1967 gene locus_tag LOCUS_09690 gene ftsE 2647 1967 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence155 <1 2107 gene locus_tag LOCUS_09700 <1 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964222.1:malic enzyme 2104 2685 gene locus_tag LOCUS_09710 gene ruvA 2104 2685 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 protein_id gnl|my_center|LOCUS_09710 >Feature sequence156 <1 754 gene locus_tag LOCUS_09720 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108748.1:alpha-glucosidase 1071 751 gene locus_tag LOCUS_09730 1071 751 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072992.1 protein_id gnl|my_center|LOCUS_09730 1168 3498 gene locus_tag LOCUS_09740 1168 3498 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105802.1 protein_id gnl|my_center|LOCUS_09740 3522 4292 gene locus_tag LOCUS_09750 3522 4292 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence157 143 829 gene locus_tag LOCUS_09760 143 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 4189 821 gene locus_tag LOCUS_09770 gene mfd 4189 821 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_09770 >Feature sequence158 <1 2679 gene locus_tag LOCUS_09780 <1 2679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964399.1:T9SS C-terminal target domain-containing protein 2723 3547 gene locus_tag LOCUS_09790 2723 3547 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence159 1298 465 gene locus_tag LOCUS_09800 1298 465 CDS product GLPGLI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962440.1 protein_id gnl|my_center|LOCUS_09800 1436 2911 gene locus_tag LOCUS_09810 1436 2911 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767658.1 protein_id gnl|my_center|LOCUS_09810 2911 3771 gene locus_tag LOCUS_09820 2911 3771 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence160 280 1866 gene locus_tag LOCUS_09830 280 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2725 1889 gene locus_tag LOCUS_09840 2725 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 <4291 2725 gene locus_tag LOCUS_09850 <4291 2725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790478.1:caspase >Feature sequence161 1118 348 gene locus_tag LOCUS_09860 1118 348 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_09860 2519 1191 gene locus_tag LOCUS_09870 2519 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3221 2601 gene locus_tag LOCUS_09880 gene recR 3221 2601 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_09880 >Feature sequence162 <1 515 gene locus_tag LOCUS_09890 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865031.1:laminarinase 1483 527 gene locus_tag LOCUS_09900 gene etfA 1483 527 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_09900 2242 1496 gene locus_tag LOCUS_09910 gene etfB 2242 1496 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_09910 3061 2765 gene locus_tag LOCUS_09920 3061 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence163 <1 1074 gene locus_tag LOCUS_09930 <1 1074 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461370.1:membrane protein 1086 2264 gene locus_tag LOCUS_09940 1086 2264 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_09940 2274 3314 gene locus_tag LOCUS_09950 2274 3314 CDS product 2-dehydro-3-deoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763049.1 protein_id gnl|my_center|LOCUS_09950 3289 3990 gene locus_tag LOCUS_09960 3289 3990 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence164 385 38 gene locus_tag LOCUS_09970 385 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 765 2537 gene locus_tag LOCUS_09980 gene atsA 765 2537 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122139.1 protein_id gnl|my_center|LOCUS_09980 <4183 2809 gene locus_tag LOCUS_09990 <4183 2809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767373.1:arylsulfatase >Feature sequence165 561 232 gene locus_tag LOCUS_10000 561 232 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_10000 1538 561 gene locus_tag LOCUS_10010 1538 561 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence166 1866 298 gene locus_tag LOCUS_10020 1866 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2869 1925 gene locus_tag LOCUS_10030 2869 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 <4159 2881 gene locus_tag LOCUS_10040 <4159 2881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109369.1:starch-binding protein >Feature sequence167 <1 1077 gene locus_tag LOCUS_10050 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW92:aminotransferase 1074 1940 gene locus_tag LOCUS_10060 gene tyrA 1074 1940 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864662.1 protein_id gnl|my_center|LOCUS_10060 1946 3028 gene locus_tag LOCUS_10070 1946 3028 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_10070 <4158 3055 gene locus_tag LOCUS_10080 <4158 3055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWQ0:aminotransferase >Feature sequence168 >Feature sequence169 835 353 gene locus_tag LOCUS_10090 gene gldH 835 353 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962205.1 protein_id gnl|my_center|LOCUS_10090 1994 828 gene locus_tag LOCUS_10100 gene fjo17 1994 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962204.1 protein_id gnl|my_center|LOCUS_10100 3085 2054 gene locus_tag LOCUS_10110 gene yceA 3085 2054 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL9 protein_id gnl|my_center|LOCUS_10110 >Feature sequence170 <1 770 gene locus_tag LOCUS_10120 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q650L4:S-adenosylmethionine synthase 767 2038 gene locus_tag LOCUS_10130 gene metY 767 2038 CDS product O-acetylhomoserine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962432.1 protein_id gnl|my_center|LOCUS_10130 2049 3014 gene locus_tag LOCUS_10140 gene metX 2049 3014 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW98 protein_id gnl|my_center|LOCUS_10140 4014 3166 gene locus_tag LOCUS_10150 gene gldA 4014 3166 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence171 >Feature sequence172 1470 313 gene locus_tag LOCUS_10160 1470 313 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_10160 1602 1958 gene locus_tag LOCUS_10170 1602 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1948 2838 gene locus_tag LOCUS_10180 1948 2838 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_10180 2888 3397 gene locus_tag LOCUS_10190 2888 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4048 3401 gene locus_tag LOCUS_10200 4048 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence173 1433 315 gene locus_tag LOCUS_10210 gene dnaN 1433 315 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_10210 3161 1506 gene locus_tag LOCUS_10220 gene gldG 3161 1506 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_10220 3898 3158 gene locus_tag LOCUS_10230 gene gldF 3898 3158 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence174 149 640 gene locus_tag LOCUS_10240 gene recX 149 640 CDS product recombinase RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964333.1 protein_id gnl|my_center|LOCUS_10240 2463 628 gene locus_tag LOCUS_10250 2463 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2772 2494 gene locus_tag LOCUS_10260 2772 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 <4064 2772 gene locus_tag LOCUS_10270 <4064 2772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GVV9:ATP synthase subunit beta >Feature sequence175 2951 354 gene locus_tag LOCUS_10280 2951 354 CDS product heparinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109359.1 protein_id gnl|my_center|LOCUS_10280 <4044 2948 gene locus_tag LOCUS_10290 <4044 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123572.1:N-acetylgalactosamine-6-sulfatase >Feature sequence176 <1 689 gene locus_tag LOCUS_10300 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962704.1:tetrahydrofolate synthase 726 1274 gene locus_tag LOCUS_10310 726 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1285 2829 gene locus_tag LOCUS_10320 1285 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 3713 2838 gene locus_tag LOCUS_10330 3713 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence177 800 42 gene locus_tag LOCUS_10340 800 42 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 protein_id gnl|my_center|LOCUS_10340 1468 797 gene locus_tag LOCUS_10350 gene lolD 1468 797 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_10350 1579 2115 gene locus_tag LOCUS_10360 gene msrA 1579 2115 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_10360 2507 2178 gene locus_tag LOCUS_10370 2507 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962797.1 protein_id gnl|my_center|LOCUS_10370 3465 2515 gene locus_tag LOCUS_10380 gene serA 3465 2515 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_10380 <3996 3476 gene locus_tag LOCUS_10390 <3996 3476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXC2:phosphoserine aminotransferase >Feature sequence178 >Feature sequence179 2341 920 gene locus_tag LOCUS_10400 gene atsG 2341 920 CDS product sulfatase atsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122623.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence180 <1 2088 gene locus_tag LOCUS_10410 <1 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence181 1764 877 gene locus_tag LOCUS_10420 1764 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1955 2155 gene locus_tag LOCUS_10430 1955 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10430 2362 2781 gene locus_tag LOCUS_10440 2362 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10440 >Feature sequence182 1168 125 gene locus_tag LOCUS_10450 gene thiL 1168 125 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_10450 1300 1671 gene locus_tag LOCUS_10460 gene sufA 1300 1671 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_10460 1685 3130 gene locus_tag LOCUS_10470 gene sufB 1685 3130 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_10470 3141 3887 gene locus_tag LOCUS_10480 gene sufC 3141 3887 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence183 <1 1151 gene locus_tag LOCUS_10490 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RT38:glycerol kinase 1155 2705 gene locus_tag LOCUS_10500 gene glpA 1155 2705 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943389.1 protein_id gnl|my_center|LOCUS_10500 2702 3448 gene locus_tag LOCUS_10510 gene glpF 2702 3448 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence184 <1 1253 gene locus_tag LOCUS_10520 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW65:UvrABC system protein C 1375 2139 gene locus_tag LOCUS_10530 1375 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_10530 2249 3544 gene locus_tag LOCUS_10540 2249 3544 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962405.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence185 2720 348 gene locus_tag LOCUS_10550 2720 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3789 2722 gene locus_tag LOCUS_10560 3789 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence186 >Feature sequence187 1821 163 gene locus_tag LOCUS_10570 1821 163 CDS product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118263.1 protein_id gnl|my_center|LOCUS_10570 3171 1834 gene locus_tag LOCUS_10580 gene arsA 3171 1834 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_10580 <3844 3175 gene locus_tag LOCUS_10590 <3844 3175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120800.1:oxidoreductase >Feature sequence188 710 2923 gene locus_tag LOCUS_10600 710 2923 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765025.1 protein_id gnl|my_center|LOCUS_10600 2956 3399 gene locus_tag LOCUS_10610 2956 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence189 <3838 2149 gene locus_tag LOCUS_10620 <3838 2149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962336.1:ATP-dependent helicase >Feature sequence190 1409 192 gene locus_tag LOCUS_10630 gene GALNS 1409 192 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121616.1 protein_id gnl|my_center|LOCUS_10630 2876 1521 gene locus_tag LOCUS_10640 2876 1521 CDS product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 protein_id gnl|my_center|LOCUS_10640 <3781 3116 gene locus_tag LOCUS_10650 <3781 3116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583958.1:diacylglycerol kinase >Feature sequence191 <1 737 gene locus_tag LOCUS_10660 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962701.1:orotidine 5'-phosphate decarboxylase 737 1525 gene locus_tag LOCUS_10670 737 1525 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 protein_id gnl|my_center|LOCUS_10670 2355 1522 gene locus_tag LOCUS_10680 gene purU 2355 1522 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7Z3 protein_id gnl|my_center|LOCUS_10680 <3740 2502 gene locus_tag LOCUS_10690 <3740 2502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMD2:ammonium transporter >Feature sequence192 1342 731 gene locus_tag LOCUS_10700 1342 731 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_10700 1461 2438 gene locus_tag LOCUS_10710 1461 2438 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_10710 3589 2435 gene locus_tag LOCUS_10720 gene crtY 3589 2435 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963565.1 protein_id gnl|my_center|LOCUS_10720 >Feature sequence193 286 210 gene locus_tag LOCUS_t00180 286 210 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1161 511 gene locus_tag LOCUS_10730 1161 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1319 2320 gene locus_tag LOCUS_10740 1319 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2789 2412 gene locus_tag LOCUS_10750 2789 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence194 220 1779 gene locus_tag LOCUS_10760 gene cafA 220 1779 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963779.1 protein_id gnl|my_center|LOCUS_10760 <3690 1828 gene locus_tag LOCUS_10770 <3690 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259232.1:acetoacetyl-CoA synthetase >Feature sequence195 <1 823 gene locus_tag LOCUS_10780 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122010.1:oxidoreductase 1182 820 gene locus_tag LOCUS_10790 1182 820 CDS product quinol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403203.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence196 186 410 gene locus_tag LOCUS_10800 186 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 528 1514 gene locus_tag LOCUS_10810 gene pfkA 528 1514 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_10810 1543 2541 gene locus_tag LOCUS_10820 gene gapA3 1543 2541 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 protein_id gnl|my_center|LOCUS_10820 2551 3417 gene locus_tag LOCUS_10830 2551 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence197 720 1436 gene locus_tag LOCUS_10840 720 1436 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_10840 2078 1440 gene locus_tag LOCUS_10850 gene porT 2078 1440 CDS product PorT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_10850 2901 2164 gene locus_tag LOCUS_10860 gene menG 2901 2164 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 protein_id gnl|my_center|LOCUS_10860 >Feature sequence198 1775 1542 gene locus_tag LOCUS_10870 gene feoA 1775 1542 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962269.1 protein_id gnl|my_center|LOCUS_10870 2520 1846 gene locus_tag LOCUS_10880 2520 1846 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence199 >Feature sequence200 494 1555 gene locus_tag LOCUS_10890 gene fabH1 494 1555 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963502.1 protein_id gnl|my_center|LOCUS_10890 1693 2355 gene locus_tag LOCUS_10900 1693 2355 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_10900 2352 3122 gene locus_tag LOCUS_10910 2352 3122 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence201 260 637 gene locus_tag LOCUS_10920 gene crcB 260 637 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_10920 808 2088 gene locus_tag LOCUS_10930 808 2088 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYN3 protein_id gnl|my_center|LOCUS_10930 2119 3150 gene locus_tag LOCUS_10940 2119 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence202 3007 545 gene locus_tag LOCUS_10950 gene topA 3007 545 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 protein_id gnl|my_center|LOCUS_10950 >Feature sequence203 <1 554 gene locus_tag LOCUS_10960 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962842.1:transketolase 573 1526 gene locus_tag LOCUS_10970 gene tktC 573 1526 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_10970 1568 2140 gene locus_tag LOCUS_10980 1568 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2985 2137 gene locus_tag LOCUS_10990 2985 2137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963560.1 protein_id gnl|my_center|LOCUS_10990 3095 3472 gene locus_tag LOCUS_11000 3095 3472 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence204 <1 1868 gene locus_tag LOCUS_11010 <1 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX10:DNA gyrase subunit B 1947 2882 gene locus_tag LOCUS_11020 gene mdh 1947 2882 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 protein_id gnl|my_center|LOCUS_11020 >Feature sequence205 157 1173 gene locus_tag LOCUS_11030 157 1173 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_11030 1151 1903 gene locus_tag LOCUS_11040 gene aroE 1151 1903 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence206 1738 350 gene locus_tag LOCUS_11050 1738 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2533 1751 gene locus_tag LOCUS_11060 2533 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11060 3011 2538 gene locus_tag LOCUS_11070 3011 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11070 >Feature sequence207 <1 1032 gene locus_tag LOCUS_11080 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120376.1:heparan N-sulfatase 1042 2565 gene locus_tag LOCUS_11090 1042 2565 CDS product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789275.1 protein_id gnl|my_center|LOCUS_11090 <3450 2569 gene locus_tag LOCUS_11100 <3450 2569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118973.1:heparan N-sulfatase >Feature sequence208 745 3192 gene locus_tag LOCUS_11110 gene priA 745 3192 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 protein_id gnl|my_center|LOCUS_11110 >Feature sequence209 109 987 gene locus_tag LOCUS_11120 gene dapA 109 987 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 protein_id gnl|my_center|LOCUS_11120 1069 1881 gene locus_tag LOCUS_11130 gene bamD 1069 1881 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_11130 1884 2213 gene locus_tag LOCUS_11140 1884 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963943.1 protein_id gnl|my_center|LOCUS_11140 2217 3419 gene locus_tag LOCUS_11150 gene coaBC 2217 3419 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963944.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence210 939 70 gene locus_tag LOCUS_11160 gene lipA 939 70 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_11160 2176 965 gene locus_tag LOCUS_11170 2176 965 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 protein_id gnl|my_center|LOCUS_11170 2726 2169 gene locus_tag LOCUS_11180 2726 2169 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963584.1 protein_id gnl|my_center|LOCUS_11180 2948 2742 gene locus_tag LOCUS_11190 2948 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence211 310 1440 gene locus_tag LOCUS_11200 gene tgt 310 1440 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 protein_id gnl|my_center|LOCUS_11200 1442 2515 gene locus_tag LOCUS_11210 1442 2515 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962772.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence212 <1 2225 gene locus_tag LOCUS_11220 <1 2225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962441.1:TonB-dependent receptor 3074 2226 gene locus_tag LOCUS_11230 3074 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence213 1392 346 gene locus_tag LOCUS_11240 1392 346 CDS product branched-chain-amino-acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0D5 protein_id gnl|my_center|LOCUS_11240 1557 2231 gene locus_tag LOCUS_11250 1557 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 protein_id gnl|my_center|LOCUS_11250 2255 3172 gene locus_tag LOCUS_11260 2255 3172 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence214 <1 692 gene locus_tag LOCUS_11270 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010993299.1:nitroreductase 2778 811 gene locus_tag LOCUS_11280 gene dsbD 2778 811 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 protein_id gnl|my_center|LOCUS_11280 <3386 2771 gene locus_tag LOCUS_11290 <3386 2771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H020:tRNA(Ile)-lysidine synthase >Feature sequence215 1973 1470 gene locus_tag LOCUS_11300 1973 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964227.1 protein_id gnl|my_center|LOCUS_11300 2663 1980 gene locus_tag LOCUS_11310 2663 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2800 3243 gene locus_tag LOCUS_11320 gene yitI 2800 3243 CDS product putative N-acetyltransferase YitI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06744 protein_id gnl|my_center|LOCUS_11320 >Feature sequence216 392 1210 gene locus_tag LOCUS_11330 gene map 392 1210 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_11330 1207 1965 gene locus_tag LOCUS_11340 1207 1965 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_11340 2915 1962 gene locus_tag LOCUS_11350 2915 1962 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 protein_id gnl|my_center|LOCUS_11350 3306 2935 gene locus_tag LOCUS_11360 3306 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence217 1363 356 gene locus_tag LOCUS_11370 gene ribD 1363 356 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 protein_id gnl|my_center|LOCUS_11370 1439 2293 gene locus_tag LOCUS_11380 gene prmC 1439 2293 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 protein_id gnl|my_center|LOCUS_11380 >Feature sequence218 155 925 gene locus_tag LOCUS_11390 gene phnP 155 925 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_11390 928 1422 gene locus_tag LOCUS_11400 928 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963236.1 protein_id gnl|my_center|LOCUS_11400 2050 1412 gene locus_tag LOCUS_11410 2050 1412 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963235.1 protein_id gnl|my_center|LOCUS_11410 3311 2055 gene locus_tag LOCUS_11420 gene pyrC2 3311 2055 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963233.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence219 529 1953 gene locus_tag LOCUS_11430 529 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204001.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence220 2101 269 gene locus_tag LOCUS_11440 2101 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 <3318 2112 gene locus_tag LOCUS_11450 <3318 2112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123096.1:N-acetylgalactosamine-6-sulfatase >Feature sequence221 <1 3186 gene locus_tag LOCUS_11460 <1 3186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWI1:DNA-directed DNA polymerase >Feature sequence222 46 1305 gene locus_tag LOCUS_11470 gene umuC 46 1305 CDS product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962560.1 protein_id gnl|my_center|LOCUS_11470 1302 1736 gene locus_tag LOCUS_11480 1302 1736 CDS product SOS-response transcriptional regulator UmuD-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202621.1 protein_id gnl|my_center|LOCUS_11480 2910 1741 gene locus_tag LOCUS_11490 2910 1741 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_11490 3308 2916 gene locus_tag LOCUS_11500 3308 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence223 1120 1194 gene locus_tag LOCUS_t00190 1120 1194 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2182 1379 gene locus_tag LOCUS_11510 2182 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2249 2398 gene locus_tag LOCUS_11520 2249 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 2494 3231 gene locus_tag LOCUS_11530 2494 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence224 281 1036 gene locus_tag LOCUS_11540 281 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962314.1 protein_id gnl|my_center|LOCUS_11540 1138 2670 gene locus_tag LOCUS_11550 1138 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962312.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence225 869 126 gene locus_tag LOCUS_11560 gene fabG 869 126 CDS product acetoacetyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250412.1 protein_id gnl|my_center|LOCUS_11560 <3288 971 gene locus_tag LOCUS_11570 <3288 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403170.1:TonB-dependent receptor >Feature sequence226 >Feature sequence227 2832 1042 gene locus_tag LOCUS_11580 2832 1042 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence228 <1 800 gene locus_tag LOCUS_11590 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964195.1:outer membrane protein assembly factor BamA 868 1434 gene locus_tag LOCUS_11600 868 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 1465 1974 gene locus_tag LOCUS_11610 1465 1974 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964197.1 protein_id gnl|my_center|LOCUS_11610 2531 2022 gene locus_tag LOCUS_11620 2531 2022 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence229 >Feature sequence230 3016 875 gene locus_tag LOCUS_11630 3016 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence231 221 9 gene locus_tag LOCUS_11640 221 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 681 214 gene locus_tag LOCUS_11650 681 214 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000577041.1 protein_id gnl|my_center|LOCUS_11650 1538 684 gene locus_tag LOCUS_11660 1538 684 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005449968.1 protein_id gnl|my_center|LOCUS_11660 3070 1661 gene locus_tag LOCUS_11670 gene uxaC 3070 1661 CDS product uronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9J2 protein_id gnl|my_center|LOCUS_11670 >Feature sequence232 <1 1420 gene locus_tag LOCUS_11680 <1 1420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108185.1:peptidase S41 3126 1417 gene locus_tag LOCUS_11690 gene btuB 3126 1417 CDS product vitamin B12 transporter BtuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KVI9 protein_id gnl|my_center|LOCUS_11690 >Feature sequence233 261 734 gene locus_tag LOCUS_11700 gene rlmH 261 734 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Q2 protein_id gnl|my_center|LOCUS_11700 734 1312 gene locus_tag LOCUS_11710 734 1312 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 protein_id gnl|my_center|LOCUS_11710 1363 2124 gene locus_tag LOCUS_11720 1363 2124 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963924.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence234 257 724 gene locus_tag LOCUS_11730 257 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 708 1748 gene locus_tag LOCUS_11740 708 1748 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_11740 1825 2586 gene locus_tag LOCUS_11750 1825 2586 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ8 protein_id gnl|my_center|LOCUS_11750 >Feature sequence235 574 834 gene locus_tag LOCUS_11760 574 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 818 1450 gene locus_tag LOCUS_11770 gene pnuC 818 1450 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 protein_id gnl|my_center|LOCUS_11770 1411 1977 gene locus_tag LOCUS_11780 1411 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence236 1059 403 gene locus_tag LOCUS_11790 gene nth 1059 403 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_11790 1104 1562 gene locus_tag LOCUS_11800 1104 1562 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence237 1238 114 gene locus_tag LOCUS_11810 1238 114 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970668.1 protein_id gnl|my_center|LOCUS_11810 2715 1246 gene locus_tag LOCUS_11820 2715 1246 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence238 1749 1051 gene locus_tag LOCUS_11830 1749 1051 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_11830 2221 1751 gene locus_tag LOCUS_11840 2221 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence239 <1 1201 gene locus_tag LOCUS_11850 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706833.1:carbohydrate kinase >Feature sequence240 2837 216 gene locus_tag LOCUS_11860 gene valS 2837 216 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 protein_id gnl|my_center|LOCUS_11860 >Feature sequence241 1218 556 gene locus_tag LOCUS_11870 gene clpP 1218 556 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_11870 2584 1262 gene locus_tag LOCUS_11880 gene tig 2584 1262 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence242 1388 843 gene locus_tag LOCUS_11890 1388 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence243 267 1619 gene locus_tag LOCUS_11900 267 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence244 931 353 gene locus_tag LOCUS_11910 gene yceI 931 353 CDS product lipid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962678.1 protein_id gnl|my_center|LOCUS_11910 1385 951 gene locus_tag LOCUS_11920 1385 951 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_11920 1486 1791 gene locus_tag LOCUS_11930 1486 1791 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence245 >Feature sequence246 1747 374 gene locus_tag LOCUS_11940 1747 374 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975577.1 protein_id gnl|my_center|LOCUS_11940 1971 2711 gene locus_tag LOCUS_11950 1971 2711 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence247 <1 868 gene locus_tag LOCUS_11960 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962586.1:DUF5103 domain-containing protein 1430 1011 gene locus_tag LOCUS_11970 1430 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1703 2812 gene locus_tag LOCUS_11980 1703 2812 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence248 <1 545 gene locus_tag LOCUS_11990 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108919.1:membrane protein 2308 542 gene locus_tag LOCUS_12000 2308 542 CDS product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 protein_id gnl|my_center|LOCUS_12000 <2896 2308 gene locus_tag LOCUS_12010 <2896 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GZH6:tRNA pseudouridine synthase A >Feature sequence249 23 1006 gene locus_tag LOCUS_12020 23 1006 CDS product NAD dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807052.1 protein_id gnl|my_center|LOCUS_12020 1008 2207 gene locus_tag LOCUS_12030 gene lhgO 1008 2207 CDS product L-2-hydroxyglutarate oxidase LhgO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FPE5 protein_id gnl|my_center|LOCUS_12030 >Feature sequence250 1545 1219 gene locus_tag LOCUS_12040 1545 1219 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962417.1 protein_id gnl|my_center|LOCUS_12040 2309 1617 gene locus_tag LOCUS_12050 2309 1617 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence251 >Feature sequence252 <1 2649 gene locus_tag LOCUS_12060 <1 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA >Feature sequence253 <1 1251 gene locus_tag LOCUS_12070 <1 1251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121854.1:sulfatase 1374 2756 gene locus_tag LOCUS_12080 1374 2756 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122113.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence254 2576 165 gene locus_tag LOCUS_12090 2576 165 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence255 179 1129 gene locus_tag LOCUS_12100 179 1129 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_12100 2367 1126 gene locus_tag LOCUS_12110 2367 1126 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence256 480 869 gene locus_tag LOCUS_12120 480 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704230.1 protein_id gnl|my_center|LOCUS_12120 1849 989 gene locus_tag LOCUS_12130 1849 989 CDS product PAP2 superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546183.1 protein_id gnl|my_center|LOCUS_12130 2790 2140 gene locus_tag LOCUS_12140 2790 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence257 <1 705 gene locus_tag LOCUS_12150 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764324.1:Trk system potassium transport protein TrkA 713 2209 gene locus_tag LOCUS_12160 713 2209 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545413.1 protein_id gnl|my_center|LOCUS_12160 <2772 2206 gene locus_tag LOCUS_12170 <2772 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963479.1:ATPase AAA >Feature sequence258 <1 900 gene locus_tag LOCUS_12180 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036051.1:glucose-fructose oxidoreductase 903 2093 gene locus_tag LOCUS_12190 903 2093 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265923.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence259 165 1151 gene locus_tag LOCUS_12200 165 1151 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_12200 1522 1175 gene locus_tag LOCUS_12210 1522 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 2746 1523 gene locus_tag LOCUS_12220 gene pyrC1 2746 1523 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_12220 >Feature sequence260 287 1597 gene locus_tag LOCUS_12230 287 1597 CDS product NADH-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121135.1 protein_id gnl|my_center|LOCUS_12230 1613 2686 gene locus_tag LOCUS_12240 1613 2686 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SKP8 protein_id gnl|my_center|LOCUS_12240 >Feature sequence261 >Feature sequence262 1392 499 gene locus_tag LOCUS_12250 gene prfB 1392 499 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_12250 >Feature sequence263 >Feature sequence264 121 705 gene locus_tag LOCUS_12260 121 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 875 1207 gene locus_tag LOCUS_12270 875 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence265 456 989 gene locus_tag LOCUS_12280 456 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 986 1840 gene locus_tag LOCUS_12290 986 1840 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963505.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence266 <2669 1370 gene locus_tag LOCUS_12300 <2669 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 >Feature sequence267 92 574 gene locus_tag LOCUS_12310 92 574 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_12310 664 1329 gene locus_tag LOCUS_12320 664 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_12320 <2658 1330 gene locus_tag LOCUS_12330 <2658 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964339.1:RNA polymerase sigma-54 factor >Feature sequence268 198 1529 gene locus_tag LOCUS_12340 198 1529 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962333.1 protein_id gnl|my_center|LOCUS_12340 <2658 1611 gene locus_tag LOCUS_12350 <2658 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64VS5:galactokinase >Feature sequence269 >Feature sequence270 1462 455 gene locus_tag LOCUS_12360 gene fabH2 1462 455 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ1 protein_id gnl|my_center|LOCUS_12360 <2644 1784 gene locus_tag LOCUS_12370 <2644 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963623.1:ABC transporter >Feature sequence271 1639 206 gene locus_tag LOCUS_12380 gene asnS 1639 206 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_12380 <2637 1686 gene locus_tag LOCUS_12390 <2637 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964341.1:transporter >Feature sequence272 <1 2233 gene locus_tag LOCUS_12400 <1 2233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963716.1:TonB-dependent receptor >Feature sequence273 >Feature sequence274 1263 211 gene locus_tag LOCUS_12410 1263 211 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940450.1 protein_id gnl|my_center|LOCUS_12410 1429 2484 gene locus_tag LOCUS_12420 1429 2484 CDS product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016813.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence275 1628 219 gene locus_tag LOCUS_12430 1628 219 CDS product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 protein_id gnl|my_center|LOCUS_12430 <2561 1721 gene locus_tag LOCUS_12440 <2561 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992183.1:membrane protein >Feature sequence276 <1 1808 gene locus_tag LOCUS_12450 <1 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763077.1:bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase >Feature sequence277 403 858 gene locus_tag LOCUS_12460 403 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 965 1897 gene locus_tag LOCUS_12470 965 1897 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence278 541 807 gene locus_tag LOCUS_12480 541 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 858 1067 gene locus_tag LOCUS_12490 858 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1078 1707 gene locus_tag LOCUS_12500 1078 1707 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_12500 1732 2376 gene locus_tag LOCUS_12510 1732 2376 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence279 1104 124 gene locus_tag LOCUS_12520 1104 124 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962811.1 protein_id gnl|my_center|LOCUS_12520 1778 1101 gene locus_tag LOCUS_12530 1778 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence280 <1 895 gene locus_tag LOCUS_12540 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016890.1:sigma factor sigB regulation protein rsbU <2505 892 gene locus_tag LOCUS_12550 <2505 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545101.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence281 2017 1463 gene locus_tag LOCUS_12560 gene frr 2017 1463 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_12560 >Feature sequence282 1282 113 gene locus_tag LOCUS_12570 1282 113 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_12570 2121 1279 gene locus_tag LOCUS_12580 2121 1279 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence283 <1 644 gene locus_tag LOCUS_12590 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963113.1:DNA polymerase III, subunit gamma and tau 602 1294 gene locus_tag LOCUS_12600 602 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1304 1888 gene locus_tag LOCUS_12610 gene miaE 1304 1888 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_12610 <2495 1885 gene locus_tag LOCUS_12620 <2495 1885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963116.1:exopolyphosphatase >Feature sequence284 567 286 gene locus_tag LOCUS_12630 567 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 1361 645 gene locus_tag LOCUS_12640 1361 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_12640 1873 1355 gene locus_tag LOCUS_12650 1873 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964083.1 protein_id gnl|my_center|LOCUS_12650 <2493 1866 gene locus_tag LOCUS_12660 <2493 1866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964082.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence285 >Feature sequence286 857 390 gene locus_tag LOCUS_12670 gene rimP 857 390 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWV6 protein_id gnl|my_center|LOCUS_12670 1089 2306 gene locus_tag LOCUS_12680 1089 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence287 651 1052 gene locus_tag LOCUS_12690 651 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1067 1366 gene locus_tag LOCUS_12700 1067 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1442 2230 gene locus_tag LOCUS_12710 gene parA 1442 2230 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence288 <1 1746 gene locus_tag LOCUS_12720 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963971.1:RelA/SpoT family protein 1769 2224 gene locus_tag LOCUS_12730 gene fur 1769 2224 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence289 720 1568 gene locus_tag LOCUS_12740 720 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <2392 1565 gene locus_tag LOCUS_12750 <2392 1565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963567.1:phytoene dehydrogenase >Feature sequence290 >Feature sequence291 <1 977 gene locus_tag LOCUS_12760 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000405145.1:sterol desaturase 967 2115 gene locus_tag LOCUS_12770 967 2115 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence292 <2336 1233 gene locus_tag LOCUS_12780 <2336 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962640.1:GTP-binding protein >Feature sequence293 >Feature sequence294 178 1692 gene locus_tag LOCUS_12790 178 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1840 2106 gene locus_tag LOCUS_12800 1840 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence295 102 1373 gene locus_tag LOCUS_12810 gene serS 102 1373 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence296 2017 647 gene locus_tag LOCUS_12820 2017 647 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121176.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence297 820 317 gene locus_tag LOCUS_12830 gene accB 820 317 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_12830 1843 839 gene locus_tag LOCUS_12840 gene fabH3 1843 839 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H260 protein_id gnl|my_center|LOCUS_12840 >Feature sequence298 <2199 804 gene locus_tag LOCUS_12850 <2199 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118737.1:iduronate-2-sulfatase >Feature sequence299 2178 547 gene locus_tag LOCUS_12860 2178 547 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918544.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence300 1284 793 gene locus_tag LOCUS_12870 1284 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12870 <2175 1454 gene locus_tag LOCUS_12880 <2175 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A1JSI6:glucose-1-phosphate adenylyltransferase >Feature sequence301 252 584 gene locus_tag LOCUS_12890 252 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12890 614 1045 gene locus_tag LOCUS_12900 614 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12900 >Feature sequence302 260 454 gene locus_tag LOCUS_12910 gene rpsU 260 454 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_12910 493 1419 gene locus_tag LOCUS_12920 gene xerC 493 1419 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963321.1 protein_id gnl|my_center|LOCUS_12920 1433 1729 gene locus_tag LOCUS_12930 1433 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence303 398 583 gene locus_tag LOCUS_12940 398 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 945 860 gene locus_tag LOCUS_t00200 945 860 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2116 986 gene locus_tag LOCUS_12950 gene ribBA 2116 986 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence304 <1 1894 gene locus_tag LOCUS_12960 <1 1894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY90:polyphosphate kinase >Feature sequence305 1095 175 gene locus_tag LOCUS_12970 1095 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 >Feature sequence306 <1 1389 gene locus_tag LOCUS_12980 <1 1389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964496.1:2-oxoglutarate dehydrogenase subunit E1 >Feature sequence307 431 817 gene locus_tag LOCUS_12990 431 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 823 1347 gene locus_tag LOCUS_13000 823 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence308 <1 1016 gene locus_tag LOCUS_13010 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963494.1:peptidase M3 note possible pseudo, frameshifted 1058 1510 gene locus_tag LOCUS_13020 1058 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13020 2022 1690 gene locus_tag LOCUS_13030 2022 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence309 <2078 1155 gene locus_tag LOCUS_13040 <2078 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122885.1:alanine glycine permease >Feature sequence310 172 951 gene locus_tag LOCUS_13050 172 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_13050 983 1759 gene locus_tag LOCUS_13060 983 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 1935 1860 gene locus_tag LOCUS_t00210 1935 1860 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence311 1245 631 gene locus_tag LOCUS_13070 1245 631 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence312 1884 544 gene locus_tag LOCUS_13080 gene gdhA 1884 544 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_13080 >Feature sequence313 <2039 1434 gene locus_tag LOCUS_13090 <2039 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118973.1:heparan N-sulfatase >Feature sequence314 1040 360 gene locus_tag LOCUS_13100 1040 360 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_13100 <2034 1064 gene locus_tag LOCUS_13110 <2034 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964214.1:transporter >Feature sequence315 >Feature sequence316 >Feature sequence317 <1 1034 gene locus_tag LOCUS_13120 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086520.1:sodium:proton antiporter 1093 1761 gene locus_tag LOCUS_13130 1093 1761 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence318 79 1074 gene locus_tag LOCUS_13140 gene trpD 79 1074 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ4 protein_id gnl|my_center|LOCUS_13140 1071 1856 gene locus_tag LOCUS_13150 gene trpC 1071 1856 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ3 protein_id gnl|my_center|LOCUS_13150 >Feature sequence319 >Feature sequence320 382 798 gene locus_tag LOCUS_13160 382 798 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020192.1 protein_id gnl|my_center|LOCUS_13160 <2006 852 gene locus_tag LOCUS_13170 <2006 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GY25:UvrABC system protein B >Feature sequence321 1101 262 gene locus_tag LOCUS_13180 gene crtB 1101 262 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_13180 <2000 1159 gene locus_tag LOCUS_13190 <2000 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963566.1:MerR family transcriptional regulator >Feature sequence322 >Feature sequence323 <1 1645 gene locus_tag LOCUS_13200 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108168.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence324 >Feature sequence325 >Feature sequence326 <1969 419 gene locus_tag LOCUS_13210 <1969 419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533597.1:short chain dehydrogenase >Feature sequence327 343 1020 gene locus_tag LOCUS_13220 343 1020 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence328 295 59 gene locus_tag LOCUS_13230 295 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1476 295 gene locus_tag LOCUS_13240 gene trpB 1476 295 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWZ1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence329 503 60 gene locus_tag LOCUS_13250 gene tadA 503 60 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 protein_id gnl|my_center|LOCUS_13250 >Feature sequence330 489 1880 gene locus_tag LOCUS_13260 489 1880 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118019.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence331 <1 1670 gene locus_tag LOCUS_13270 <1 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122718.1:sulfate transporter >Feature sequence332 >Feature sequence333 >Feature sequence334 527 970 gene locus_tag LOCUS_13280 gene rplK 527 970 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_13280 980 1669 gene locus_tag LOCUS_13290 gene rplA 980 1669 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU3 protein_id gnl|my_center|LOCUS_13290 >Feature sequence335 1193 675 gene locus_tag LOCUS_13300 1193 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963267.1 protein_id gnl|my_center|LOCUS_13300 <1881 1219 gene locus_tag LOCUS_13310 <1881 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963268.1:chromosome partitioning protein ParB >Feature sequence336 1261 1187 gene locus_tag LOCUS_t00220 1261 1187 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence337 261 1052 gene locus_tag LOCUS_13320 261 1052 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence338 >Feature sequence339 <1846 1108 gene locus_tag LOCUS_13330 <1846 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H104:GTPase Era >Feature sequence340 81 1268 gene locus_tag LOCUS_13340 gene tuf 81 1268 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_13340 1334 1407 gene locus_tag LOCUS_t00230 1334 1407 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence341 <1826 151 gene locus_tag LOCUS_13350 <1826 151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202162.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence342 195 770 gene locus_tag LOCUS_13360 195 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1764 772 gene locus_tag LOCUS_13370 1764 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence343 <1810 510 gene locus_tag LOCUS_13380 <1810 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000513713.1:dihydropyrimidine dehydrogenase subunit A >Feature sequence344 <1 771 gene locus_tag LOCUS_13390 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119680.1:acetylxylan esterase <1780 774 gene locus_tag LOCUS_13400 <1780 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791107.1:sulfatase >Feature sequence345 1556 669 gene locus_tag LOCUS_13410 gene prsA 1556 669 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence346 1068 595 gene locus_tag LOCUS_13420 1068 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1389 1120 gene locus_tag LOCUS_13430 1389 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence347 <1753 675 gene locus_tag LOCUS_13440 <1753 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120799.1:choline-sulfatase >Feature sequence348 86 526 gene locus_tag LOCUS_13450 86 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 523 1296 gene locus_tag LOCUS_13460 523 1296 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence349 >Feature sequence350 <1 1250 gene locus_tag LOCUS_13470 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962677.1:anthranilate synthase component I >Feature sequence351 301 678 gene locus_tag LOCUS_13480 301 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 817 1128 gene locus_tag LOCUS_13490 817 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13490 1141 1590 gene locus_tag LOCUS_13500 1141 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence352 202 1503 gene locus_tag LOCUS_13510 202 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 >Feature sequence353 <1 894 gene locus_tag LOCUS_13520 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXP5:chorismate synthase >Feature sequence354 >Feature sequence355 <1644 1010 gene locus_tag LOCUS_13530 <1644 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964076.1:arginase >Feature sequence356 >Feature sequence357 8 1237 gene locus_tag LOCUS_13540 8 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1340 1552 gene locus_tag LOCUS_13550 1340 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13550 >Feature sequence358 <1611 780 gene locus_tag LOCUS_13560 <1611 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H119:tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase >Feature sequence359 <1607 804 gene locus_tag LOCUS_13570 <1607 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108084.1:peptidase M23 >Feature sequence360 <1602 294 gene locus_tag LOCUS_13580 <1602 294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962495.1:membrane protein >Feature sequence361 <1 865 gene locus_tag LOCUS_13590 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705768.1:long-chain acyl-CoA synthetase >Feature sequence362 1222 101 gene locus_tag LOCUS_13600 1222 101 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762695.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence363 <1 1148 gene locus_tag LOCUS_13610 <1 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0U2:membrane protein insertase YidC >Feature sequence364 >Feature sequence365 >Feature sequence366 <1539 462 gene locus_tag LOCUS_13620 <1539 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0L3:inosine-5'-monophosphate dehydrogenase >Feature sequence367 346 783 gene locus_tag LOCUS_13630 346 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 780 1451 gene locus_tag LOCUS_13640 780 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence368 >Feature sequence369 >Feature sequence370 >Feature sequence371 <1 665 gene locus_tag LOCUS_13650 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H2D7:ATP synthase subunit alpha >Feature sequence372 >Feature sequence373 >Feature sequence374 1184 381 gene locus_tag LOCUS_13660 gene cdsA 1184 381 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962766.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence375 <1462 508 gene locus_tag LOCUS_13670 <1462 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0N9:DNA ligase >Feature sequence376 <1 618 gene locus_tag LOCUS_13680 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GXB5:peptide methionine sulfoxide reductase MsrA >Feature sequence377 <1 1374 gene locus_tag LOCUS_13690 <1 1374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYP1:signal peptidase I >Feature sequence378 <1 730 gene locus_tag LOCUS_13700 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1C2:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence379 <1420 65 gene locus_tag LOCUS_13710 <1420 65 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005422351.1:transporter >Feature sequence380 21 887 gene locus_tag LOCUS_13720 21 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence381 >Feature sequence382 925 143 gene locus_tag LOCUS_13730 gene argB 925 143 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B0 protein_id gnl|my_center|LOCUS_13730 >Feature sequence383 309 118 gene locus_tag LOCUS_13740 309 118 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962450.1 protein_id gnl|my_center|LOCUS_13740 612 373 gene locus_tag LOCUS_13750 612 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1369 635 gene locus_tag LOCUS_13760 1369 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence384 <1394 437 gene locus_tag LOCUS_13770 <1394 437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119366.1:dehydrogenase >Feature sequence385 >Feature sequence386 1062 841 gene locus_tag LOCUS_13780 1062 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence387 116 937 gene locus_tag LOCUS_13790 116 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence388 476 294 gene locus_tag LOCUS_13800 476 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 <1354 626 gene locus_tag LOCUS_13810 <1354 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061879.1:2-hydroxyhepta-2,4-diene-1,7-dioate isomerase >Feature sequence389 <1 584 gene locus_tag LOCUS_13820 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX79:GTP cyclohydrolase 1 >Feature sequence390 >Feature sequence391 >Feature sequence392 398 808 gene locus_tag LOCUS_13830 398 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence393 >Feature sequence394 972 73 gene locus_tag LOCUS_13840 972 73 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404794.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence395 <1 995 gene locus_tag LOCUS_13850 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX85:ATP-dependent zinc metalloprotease FtsH >Feature sequence396 <1311 571 gene locus_tag LOCUS_13860 <1311 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963220.1:phosphate starvation protein PhoH >Feature sequence397 >Feature sequence398 >Feature sequence399 >Feature sequence400 <1281 42 gene locus_tag LOCUS_13870 <1281 42 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121702.1:arylsulfatase >Feature sequence401 2 352 gene locus_tag LOCUS_13880 2 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 <1276 349 gene locus_tag LOCUS_13890 <1276 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A1:3-dehydroquinate synthase >Feature sequence402 679 104 gene locus_tag LOCUS_13900 gene ygfA 679 104 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 protein_id gnl|my_center|LOCUS_13900 >Feature sequence403 >Feature sequence404 >Feature sequence405 64 600 gene locus_tag LOCUS_13910 64 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence406 40 444 gene locus_tag LOCUS_13920 40 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 <1246 491 gene locus_tag LOCUS_13930 <1246 491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121570.1:N-acetylgalactosamine-6-sulfatase >Feature sequence407 374 565 gene locus_tag LOCUS_13940 374 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence408 204 73 gene locus_tag LOCUS_13950 204 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 <1243 446 gene locus_tag LOCUS_13960 <1243 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCC4:apolipoprotein N-acyltransferase >Feature sequence409 641 399 gene locus_tag LOCUS_13970 641 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13970 >Feature sequence410 >Feature sequence411 <1 806 gene locus_tag LOCUS_13980 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964379.1:TatD family hydrolase 876 965 gene locus_tag LOCUS_t00240 876 965 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence412 >Feature sequence413 <1202 414 gene locus_tag LOCUS_13990 <1202 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118456.1:arylsulfatase >Feature sequence414 474 271 gene locus_tag LOCUS_14000 474 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 635 471 gene locus_tag LOCUS_14010 635 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence415 >Feature sequence416 >Feature sequence417 >Feature sequence418 >Feature sequence419 >Feature sequence420 320 910 gene locus_tag LOCUS_14020 320 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence421 >Feature sequence422 <1 847 gene locus_tag LOCUS_14030 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767356.1:beta-galactosidase >Feature sequence423 94 282 gene locus_tag LOCUS_14040 94 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 <1098 285 gene locus_tag LOCUS_14050 <1098 285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962776.1:thioredoxin-disulfide reductase >Feature sequence424 <1092 161 gene locus_tag LOCUS_14060 <1092 161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963922.1:MBL fold metallo-hydrolase >Feature sequence425 262 432 gene locus_tag LOCUS_14070 262 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence426 >Feature sequence427 >Feature sequence428 115 423 gene locus_tag LOCUS_14080 gene rhaM 115 423 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A044 protein_id gnl|my_center|LOCUS_14080 >Feature sequence429 >Feature sequence430 >Feature sequence431 3 182 gene locus_tag LOCUS_14090 3 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence432 182 697 gene locus_tag LOCUS_14100 182 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100