>Feature sequence001 <1 560 gene locus_tag LOCUS_00010 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962384.1:coproporphyrinogen III oxidase 1442 576 gene locus_tag LOCUS_00020 1442 576 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 protein_id gnl|my_center|LOCUS_00020 4802 1443 gene locus_tag LOCUS_00030 4802 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4993 8268 gene locus_tag LOCUS_00040 4993 8268 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_00040 8265 8690 gene locus_tag LOCUS_00050 8265 8690 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257545.1 protein_id gnl|my_center|LOCUS_00050 8697 9185 gene locus_tag LOCUS_00060 gene ybeY 8697 9185 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M2 protein_id gnl|my_center|LOCUS_00060 9178 11040 gene locus_tag LOCUS_00070 gene mnmG 9178 11040 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 protein_id gnl|my_center|LOCUS_00070 11272 12804 gene locus_tag LOCUS_00080 gene pcd 11272 12804 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_00080 12804 14018 gene locus_tag LOCUS_00090 12804 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15996 14005 gene locus_tag LOCUS_00100 15996 14005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 16534 18003 gene locus_tag LOCUS_00110 16534 18003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 18017 20188 gene locus_tag LOCUS_00120 18017 20188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 20273 21022 gene locus_tag LOCUS_00130 20273 21022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 21160 21086 gene locus_tag LOCUS_t00010 21160 21086 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 21297 22259 gene locus_tag LOCUS_00140 21297 22259 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 protein_id gnl|my_center|LOCUS_00140 23137 22256 gene locus_tag LOCUS_00150 23137 22256 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_00150 23282 25912 gene locus_tag LOCUS_00160 gene sprE 23282 25912 CDS product gliding motility protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964554.1 protein_id gnl|my_center|LOCUS_00160 25952 26395 gene locus_tag LOCUS_00170 25952 26395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 26395 26601 gene locus_tag LOCUS_00180 26395 26601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 26733 26987 gene locus_tag LOCUS_00190 26733 26987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27068 28228 gene locus_tag LOCUS_00200 gene atpB 27068 28228 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 protein_id gnl|my_center|LOCUS_00200 28257 28502 gene locus_tag LOCUS_00210 28257 28502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 28522 29019 gene locus_tag LOCUS_00220 gene atpF 28522 29019 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGE9 protein_id gnl|my_center|LOCUS_00220 29021 29575 gene locus_tag LOCUS_00230 gene atpH 29021 29575 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8H5I3 protein_id gnl|my_center|LOCUS_00230 29606 31189 gene locus_tag LOCUS_00240 gene atpA 29606 31189 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 protein_id gnl|my_center|LOCUS_00240 31196 32077 gene locus_tag LOCUS_00250 gene atpG 31196 32077 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 protein_id gnl|my_center|LOCUS_00250 32128 33540 gene locus_tag LOCUS_00260 32128 33540 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 protein_id gnl|my_center|LOCUS_00260 34321 33563 gene locus_tag LOCUS_00270 34321 33563 CDS product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_00270 35266 34418 gene locus_tag LOCUS_00280 35266 34418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35438 36160 gene locus_tag LOCUS_00290 35438 36160 CDS product DUF2807 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_00290 38032 36164 gene locus_tag LOCUS_00300 gene glmS 38032 36164 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV6 protein_id gnl|my_center|LOCUS_00300 39391 38042 gene locus_tag LOCUS_00310 39391 38042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 40230 39403 gene locus_tag LOCUS_00320 40230 39403 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_00320 40447 41214 gene locus_tag LOCUS_00330 gene panC 40447 41214 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XM3 protein_id gnl|my_center|LOCUS_00330 41253 41480 gene locus_tag LOCUS_00340 41253 41480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 41612 42802 gene locus_tag LOCUS_00350 41612 42802 CDS product lytic transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764235.1 protein_id gnl|my_center|LOCUS_00350 42943 43917 gene locus_tag LOCUS_00360 42943 43917 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785463.1 protein_id gnl|my_center|LOCUS_00360 43919 44344 gene locus_tag LOCUS_00370 43919 44344 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVM6 protein_id gnl|my_center|LOCUS_00370 44341 45192 gene locus_tag LOCUS_00380 44341 45192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 45218 45493 gene locus_tag LOCUS_00390 gene fjo13 45218 45493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_00390 45497 46327 gene locus_tag LOCUS_00400 gene uppP 45497 46327 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 protein_id gnl|my_center|LOCUS_00400 46339 47037 gene locus_tag LOCUS_00410 46339 47037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47683 46952 gene locus_tag LOCUS_00420 gene sodA 47683 46952 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RUV2 protein_id gnl|my_center|LOCUS_00420 47782 50307 gene locus_tag LOCUS_00430 47782 50307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 50610 52106 gene locus_tag LOCUS_00440 50610 52106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 52134 52216 gene locus_tag LOCUS_t00020 52134 52216 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 52712 53599 gene locus_tag LOCUS_00450 gene lpxD 52712 53599 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHH3 protein_id gnl|my_center|LOCUS_00450 54670 53600 gene locus_tag LOCUS_00460 54670 53600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 55758 54667 gene locus_tag LOCUS_00470 55758 54667 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104557.1 protein_id gnl|my_center|LOCUS_00470 55789 56829 gene locus_tag LOCUS_00480 55789 56829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 56853 57287 gene locus_tag LOCUS_00490 56853 57287 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383325.1 protein_id gnl|my_center|LOCUS_00490 59207 57303 gene locus_tag LOCUS_00500 gene purF 59207 57303 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_00500 62687 59250 gene locus_tag LOCUS_00510 62687 59250 CDS product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_00510 63852 62689 gene locus_tag LOCUS_00520 63852 62689 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403687.1 protein_id gnl|my_center|LOCUS_00520 65264 63849 gene locus_tag LOCUS_00530 65264 63849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 65860 65261 gene locus_tag LOCUS_00540 65860 65261 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_00540 68156 65943 gene locus_tag LOCUS_00550 gene hutU 68156 65943 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 protein_id gnl|my_center|LOCUS_00550 69331 68144 gene locus_tag LOCUS_00560 69331 68144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 69953 69348 gene locus_tag LOCUS_00570 gene tdk 69953 69348 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YL9 protein_id gnl|my_center|LOCUS_00570 70097 70546 gene locus_tag LOCUS_00580 gene rplM 70097 70546 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 protein_id gnl|my_center|LOCUS_00580 70561 70947 gene locus_tag LOCUS_00590 gene rpsI 70561 70947 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU3 protein_id gnl|my_center|LOCUS_00590 71056 71961 gene locus_tag LOCUS_00600 gene rpsB 71056 71961 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P29 protein_id gnl|my_center|LOCUS_00600 71987 72817 gene locus_tag LOCUS_00610 gene tsf 71987 72817 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 protein_id gnl|my_center|LOCUS_00610 72989 73696 gene locus_tag LOCUS_00620 gene pyrH 72989 73696 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_00620 73722 74285 gene locus_tag LOCUS_00630 gene frr 73722 74285 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 protein_id gnl|my_center|LOCUS_00630 >Feature sequence002 2189 987 gene locus_tag LOCUS_00640 gene kbl 2189 987 CDS product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 protein_id gnl|my_center|LOCUS_00640 2259 4331 gene locus_tag LOCUS_00650 gene metG 2259 4331 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVQ2 protein_id gnl|my_center|LOCUS_00650 5719 4688 gene locus_tag LOCUS_00660 gene asd 5719 4688 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 protein_id gnl|my_center|LOCUS_00660 5852 8275 gene locus_tag LOCUS_00670 5852 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 8316 8987 gene locus_tag LOCUS_00680 8316 8987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 8988 9755 gene locus_tag LOCUS_00690 8988 9755 CDS product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_00690 9839 10171 gene locus_tag LOCUS_00700 9839 10171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 10120 11844 gene locus_tag LOCUS_00710 10120 11844 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_00710 12069 13367 gene locus_tag LOCUS_00720 12069 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 15156 13345 gene locus_tag LOCUS_00730 15156 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15252 16553 gene locus_tag LOCUS_00740 gene purD 15252 16553 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650J1 protein_id gnl|my_center|LOCUS_00740 16754 16587 gene locus_tag LOCUS_00750 16754 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 16995 17708 gene locus_tag LOCUS_00760 16995 17708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 17734 20301 gene locus_tag LOCUS_00770 17734 20301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 20339 21046 gene locus_tag LOCUS_00780 gene purQ 20339 21046 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGU4 protein_id gnl|my_center|LOCUS_00780 21054 23018 gene locus_tag LOCUS_00790 gene dxs 21054 23018 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0C2 protein_id gnl|my_center|LOCUS_00790 23022 23537 gene locus_tag LOCUS_00800 23022 23537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 protein_id gnl|my_center|LOCUS_00800 23540 26443 gene locus_tag LOCUS_00810 23540 26443 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_00810 26540 27472 gene locus_tag LOCUS_00820 26540 27472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 27490 27927 gene locus_tag LOCUS_00830 27490 27927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 28739 27933 gene locus_tag LOCUS_00840 28739 27933 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_00840 29521 28736 gene locus_tag LOCUS_00850 gene pdxJ 29521 28736 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V3 protein_id gnl|my_center|LOCUS_00850 29636 30289 gene locus_tag LOCUS_00860 29636 30289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 30289 31230 gene locus_tag LOCUS_00870 gene nadK 30289 31230 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 protein_id gnl|my_center|LOCUS_00870 31247 32107 gene locus_tag LOCUS_00880 31247 32107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 32238 32921 gene locus_tag LOCUS_00890 gene uppS 32238 32921 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63T16 protein_id gnl|my_center|LOCUS_00890 32918 35467 gene locus_tag LOCUS_00900 gene bamA 32918 35467 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 protein_id gnl|my_center|LOCUS_00900 35536 36231 gene locus_tag LOCUS_00910 35536 36231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 36245 36742 gene locus_tag LOCUS_00920 36245 36742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 36739 37572 gene locus_tag LOCUS_00930 gene murI 36739 37572 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFN8 protein_id gnl|my_center|LOCUS_00930 38107 37586 gene locus_tag LOCUS_00940 38107 37586 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791506.1 protein_id gnl|my_center|LOCUS_00940 39617 38100 gene locus_tag LOCUS_00950 39617 38100 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888291.1 protein_id gnl|my_center|LOCUS_00950 40238 39630 gene locus_tag LOCUS_00960 gene gmhA 40238 39630 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JP02 protein_id gnl|my_center|LOCUS_00960 <42261 40348 gene locus_tag LOCUS_00970 <42261 40348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963739.1:thiol:disulfide interchange protein DsbD >Feature sequence003 <1 874 gene locus_tag LOCUS_00980 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962829.1:ABC transporter ATP-binding protein 867 2171 gene locus_tag LOCUS_00990 gene natB 867 2171 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_00990 2164 3174 gene locus_tag LOCUS_01000 2164 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405299.1 protein_id gnl|my_center|LOCUS_01000 3159 4319 gene locus_tag LOCUS_01010 gene dctD 3159 4319 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_01010 4422 4802 gene locus_tag LOCUS_01020 4422 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 5421 4822 gene locus_tag LOCUS_01030 gene folE 5421 4822 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEA8 protein_id gnl|my_center|LOCUS_01030 5873 5451 gene locus_tag LOCUS_01040 5873 5451 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_01040 5950 6927 gene locus_tag LOCUS_01050 gene hldD 5950 6927 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIA5 protein_id gnl|my_center|LOCUS_01050 7229 6945 gene locus_tag LOCUS_01060 7229 6945 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_01060 8286 7315 gene locus_tag LOCUS_01070 8286 7315 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_01070 8338 10968 gene locus_tag LOCUS_01080 gene alaS 8338 10968 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y3 protein_id gnl|my_center|LOCUS_01080 12855 11002 gene locus_tag LOCUS_01090 12855 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 13463 12981 gene locus_tag LOCUS_01100 13463 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 14119 13460 gene locus_tag LOCUS_01110 14119 13460 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_01110 14796 14119 gene locus_tag LOCUS_01120 14796 14119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 17098 14771 gene locus_tag LOCUS_01130 gene uvrD 17098 14771 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 protein_id gnl|my_center|LOCUS_01130 17362 17742 gene locus_tag LOCUS_01140 gene rpsL 17362 17742 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 protein_id gnl|my_center|LOCUS_01140 17780 18217 gene locus_tag LOCUS_01150 gene rpsG 17780 18217 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 protein_id gnl|my_center|LOCUS_01150 18278 20338 gene locus_tag LOCUS_01160 gene fusA 18278 20338 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK6 protein_id gnl|my_center|LOCUS_01160 20345 20650 gene locus_tag LOCUS_01170 gene rpsJ 20345 20650 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA0 protein_id gnl|my_center|LOCUS_01170 20654 21283 gene locus_tag LOCUS_01180 gene rplC 20654 21283 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_01180 21288 21914 gene locus_tag LOCUS_01190 gene rplD 21288 21914 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK9 protein_id gnl|my_center|LOCUS_01190 21923 22216 gene locus_tag LOCUS_01200 gene rplW 21923 22216 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL0 protein_id gnl|my_center|LOCUS_01200 22229 23053 gene locus_tag LOCUS_01210 gene rplB 22229 23053 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ96 protein_id gnl|my_center|LOCUS_01210 23053 23334 gene locus_tag LOCUS_01220 gene rpsS 23053 23334 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ95 protein_id gnl|my_center|LOCUS_01220 23355 23753 gene locus_tag LOCUS_01230 gene rplV 23355 23753 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 protein_id gnl|my_center|LOCUS_01230 23753 24535 gene locus_tag LOCUS_01240 gene rpsC 23753 24535 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 protein_id gnl|my_center|LOCUS_01240 24548 24967 gene locus_tag LOCUS_01250 gene rplP 24548 24967 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ92 protein_id gnl|my_center|LOCUS_01250 24978 25196 gene locus_tag LOCUS_01260 24978 25196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 25196 25483 gene locus_tag LOCUS_01270 gene rpsQ 25196 25483 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL7 protein_id gnl|my_center|LOCUS_01270 25526 25894 gene locus_tag LOCUS_01280 gene rplN 25526 25894 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 protein_id gnl|my_center|LOCUS_01280 25908 26228 gene locus_tag LOCUS_01290 gene rplX 25908 26228 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CG6 protein_id gnl|my_center|LOCUS_01290 26228 26782 gene locus_tag LOCUS_01300 gene rplE 26228 26782 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 protein_id gnl|my_center|LOCUS_01300 26789 27058 gene locus_tag LOCUS_01310 gene rpsN 26789 27058 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ86 protein_id gnl|my_center|LOCUS_01310 27062 27460 gene locus_tag LOCUS_01320 gene rpsH 27062 27460 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ85 protein_id gnl|my_center|LOCUS_01320 27484 28035 gene locus_tag LOCUS_01330 gene rplF 27484 28035 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM3 protein_id gnl|my_center|LOCUS_01330 28047 28406 gene locus_tag LOCUS_01340 gene rplR 28047 28406 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A492 protein_id gnl|my_center|LOCUS_01340 28414 28941 gene locus_tag LOCUS_01350 gene rpsE 28414 28941 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A493 protein_id gnl|my_center|LOCUS_01350 28946 29125 gene locus_tag LOCUS_01360 gene rpmD 28946 29125 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CDY1 protein_id gnl|my_center|LOCUS_01360 29307 29591 gene locus_tag LOCUS_01370 29307 29591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 29603 30952 gene locus_tag LOCUS_01380 gene secY 29603 30952 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 protein_id gnl|my_center|LOCUS_01380 31047 31760 gene locus_tag LOCUS_01390 gene map 31047 31760 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 protein_id gnl|my_center|LOCUS_01390 31804 32025 gene locus_tag LOCUS_01400 gene infA 31804 32025 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_01400 32176 32541 gene locus_tag LOCUS_01410 gene rpsM 32176 32541 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_01410 32602 32988 gene locus_tag LOCUS_01420 gene rpsK 32602 32988 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 protein_id gnl|my_center|LOCUS_01420 >Feature sequence004 968 1762 gene locus_tag LOCUS_01430 gene cysQ 968 1762 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880167.1 protein_id gnl|my_center|LOCUS_01430 2719 1781 gene locus_tag LOCUS_01440 gene rsgA 2719 1781 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YJ1 protein_id gnl|my_center|LOCUS_01440 2777 3481 gene locus_tag LOCUS_01450 2777 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 5187 3547 gene locus_tag LOCUS_01460 gene groL 5187 3547 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H125 protein_id gnl|my_center|LOCUS_01460 5500 5225 gene locus_tag LOCUS_01470 gene groS 5500 5225 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 protein_id gnl|my_center|LOCUS_01470 6038 5700 gene locus_tag LOCUS_01480 6038 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 6984 6049 gene locus_tag LOCUS_01490 6984 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964084.1 protein_id gnl|my_center|LOCUS_01490 7534 7007 gene locus_tag LOCUS_01500 7534 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 8775 7531 gene locus_tag LOCUS_01510 8775 7531 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760045.1 protein_id gnl|my_center|LOCUS_01510 10273 8804 gene locus_tag LOCUS_01520 gene miaB 10273 8804 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 protein_id gnl|my_center|LOCUS_01520 10368 12845 gene locus_tag LOCUS_01530 gene topA 10368 12845 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_01530 12854 14029 gene locus_tag LOCUS_01540 gene fjo29 12854 14029 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_01540 14126 15076 gene locus_tag LOCUS_01550 14126 15076 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_01550 15173 16540 gene locus_tag LOCUS_01560 gene gldK 15173 16540 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_01560 16623 17399 gene locus_tag LOCUS_01570 16623 17399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 17411 19126 gene locus_tag LOCUS_01580 gene gldM 17411 19126 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_01580 19129 19986 gene locus_tag LOCUS_01590 gene gldN 19129 19986 CDS product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_01590 20051 22006 gene locus_tag LOCUS_01600 20051 22006 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 protein_id gnl|my_center|LOCUS_01600 23106 22024 gene locus_tag LOCUS_01610 23106 22024 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 protein_id gnl|my_center|LOCUS_01610 25085 23103 gene locus_tag LOCUS_01620 25085 23103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 25884 25096 gene locus_tag LOCUS_01630 25884 25096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 28170 25933 gene locus_tag LOCUS_01640 gene purL 28170 25933 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD17 protein_id gnl|my_center|LOCUS_01640 28399 30093 gene locus_tag LOCUS_01650 28399 30093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 30099 30551 gene locus_tag LOCUS_01660 gene dtd 30099 30551 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2P0 protein_id gnl|my_center|LOCUS_01660 >Feature sequence005 646 969 gene locus_tag LOCUS_01670 646 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1738 1022 gene locus_tag LOCUS_01680 1738 1022 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706629.1 protein_id gnl|my_center|LOCUS_01680 1827 2441 gene locus_tag LOCUS_01690 1827 2441 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_01690 4609 2471 gene locus_tag LOCUS_01700 4609 2471 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_01700 4885 16500 gene locus_tag LOCUS_01710 4885 16500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 17608 16586 gene locus_tag LOCUS_01720 17608 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 21252 17605 gene locus_tag LOCUS_01730 21252 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 21733 21263 gene locus_tag LOCUS_01740 21733 21263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 22689 21733 gene locus_tag LOCUS_01750 22689 21733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 24023 22689 gene locus_tag LOCUS_01760 24023 22689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 24556 24044 gene locus_tag LOCUS_01770 24556 24044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 25403 24537 gene locus_tag LOCUS_01780 25403 24537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 25517 26743 gene locus_tag LOCUS_01790 25517 26743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 26841 29261 gene locus_tag LOCUS_01800 26841 29261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence006 2083 512 gene locus_tag LOCUS_01810 2083 512 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_01810 2481 2080 gene locus_tag LOCUS_01820 2481 2080 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_01820 2591 3142 gene locus_tag LOCUS_01830 2591 3142 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_01830 3302 3523 gene locus_tag LOCUS_01840 3302 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_01840 4544 3504 gene locus_tag LOCUS_01850 4544 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4664 5161 gene locus_tag LOCUS_01860 4664 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7801 5225 gene locus_tag LOCUS_01870 7801 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9053 7815 gene locus_tag LOCUS_01880 9053 7815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_01880 9130 10647 gene locus_tag LOCUS_01890 gene purH 9130 10647 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NT9 protein_id gnl|my_center|LOCUS_01890 10690 11715 gene locus_tag LOCUS_01900 10690 11715 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792050.1 protein_id gnl|my_center|LOCUS_01900 11729 12577 gene locus_tag LOCUS_01910 11729 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 12574 13083 gene locus_tag LOCUS_01920 12574 13083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 13080 14924 gene locus_tag LOCUS_01930 13080 14924 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762750.1 protein_id gnl|my_center|LOCUS_01930 14921 16243 gene locus_tag LOCUS_01940 gene rodA 14921 16243 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 protein_id gnl|my_center|LOCUS_01940 17508 16255 gene locus_tag LOCUS_01950 gene sucB 17508 16255 CDS product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 protein_id gnl|my_center|LOCUS_01950 20266 17513 gene locus_tag LOCUS_01960 gene sucA 20266 17513 CDS product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_01960 21335 20322 gene locus_tag LOCUS_01970 21335 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 22201 21332 gene locus_tag LOCUS_01980 gene rmlA 22201 21332 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 protein_id gnl|my_center|LOCUS_01980 24680 22227 gene locus_tag LOCUS_01990 24680 22227 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_01990 24679 26166 gene locus_tag LOCUS_02000 gene lpdA1 24679 26166 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 protein_id gnl|my_center|LOCUS_02000 26180 27475 gene locus_tag LOCUS_02010 gene pabB 26180 27475 CDS product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 protein_id gnl|my_center|LOCUS_02010 27493 28917 gene locus_tag LOCUS_02020 27493 28917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence007 <1 1052 gene locus_tag LOCUS_02030 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791861.1:ATP-dependent DNA helicase RecQ 2258 1062 gene locus_tag LOCUS_02040 2258 1062 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_02040 2659 2249 gene locus_tag LOCUS_02050 2659 2249 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97MF2 protein_id gnl|my_center|LOCUS_02050 5862 2674 gene locus_tag LOCUS_02060 5862 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 6005 6664 gene locus_tag LOCUS_02070 6005 6664 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889182.1 protein_id gnl|my_center|LOCUS_02070 7740 6697 gene locus_tag LOCUS_02080 gene phoR 7740 6697 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 protein_id gnl|my_center|LOCUS_02080 8414 7737 gene locus_tag LOCUS_02090 gene phoP 8414 7737 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_02090 9793 8411 gene locus_tag LOCUS_02100 9793 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 12370 9860 gene locus_tag LOCUS_02110 gene pheT 12370 9860 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T65 protein_id gnl|my_center|LOCUS_02110 12436 13509 gene locus_tag LOCUS_02120 12436 13509 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143552.1 protein_id gnl|my_center|LOCUS_02120 13612 13685 gene locus_tag LOCUS_t00030 13612 13685 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 14147 13737 gene locus_tag LOCUS_02130 14147 13737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 14224 14931 gene locus_tag LOCUS_02140 14224 14931 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NS7 protein_id gnl|my_center|LOCUS_02140 14931 15965 gene locus_tag LOCUS_02150 gene pheS 14931 15965 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 protein_id gnl|my_center|LOCUS_02150 17769 16048 gene locus_tag LOCUS_02160 17769 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 18903 17866 gene locus_tag LOCUS_02170 18903 17866 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_02170 20425 18878 gene locus_tag LOCUS_02180 gene cysS 20425 18878 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 protein_id gnl|my_center|LOCUS_02180 21224 20628 gene locus_tag LOCUS_02190 21224 20628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 22196 21243 gene locus_tag LOCUS_02200 gene ltd 22196 21243 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_02200 22312 23610 gene locus_tag LOCUS_02210 gene queA 22312 23610 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P8 protein_id gnl|my_center|LOCUS_02210 25670 23664 gene locus_tag LOCUS_02220 25670 23664 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658876.1 protein_id gnl|my_center|LOCUS_02220 27041 25782 gene locus_tag LOCUS_02230 27041 25782 CDS product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_02230 27235 27038 gene locus_tag LOCUS_02240 27235 27038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 27768 27232 gene locus_tag LOCUS_02250 27768 27232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 >Feature sequence008 1559 1987 gene locus_tag LOCUS_02260 1559 1987 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_02260 2153 2068 gene locus_tag LOCUS_t00040 2153 2068 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2793 2266 gene locus_tag LOCUS_02270 2793 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 2877 4046 gene locus_tag LOCUS_02280 gene porR 2877 4046 CDS product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_02280 4061 5380 gene locus_tag LOCUS_02290 4061 5380 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_02290 5384 6406 gene locus_tag LOCUS_02300 5384 6406 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 protein_id gnl|my_center|LOCUS_02300 6403 7005 gene locus_tag LOCUS_02310 6403 7005 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_02310 6998 8332 gene locus_tag LOCUS_02320 gene capL 6998 8332 CDS product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_02320 8343 9431 gene locus_tag LOCUS_02330 gene rfbB 8343 9431 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFL8 protein_id gnl|my_center|LOCUS_02330 9431 10198 gene locus_tag LOCUS_02340 9431 10198 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 protein_id gnl|my_center|LOCUS_02340 10568 10242 gene locus_tag LOCUS_02350 10568 10242 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 protein_id gnl|my_center|LOCUS_02350 11584 10571 gene locus_tag LOCUS_02360 11584 10571 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 protein_id gnl|my_center|LOCUS_02360 11835 11581 gene locus_tag LOCUS_02370 11835 11581 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963781.1 protein_id gnl|my_center|LOCUS_02370 12930 11848 gene locus_tag LOCUS_02380 gene mrp 12930 11848 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 protein_id gnl|my_center|LOCUS_02380 13311 12937 gene locus_tag LOCUS_02390 gene ogt2 13311 12937 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_02390 13987 13304 gene locus_tag LOCUS_02400 gene trmB 13987 13304 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 protein_id gnl|my_center|LOCUS_02400 14768 15223 gene locus_tag LOCUS_02410 14768 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15243 15704 gene locus_tag LOCUS_02420 gene tadA 15243 15704 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YH1 protein_id gnl|my_center|LOCUS_02420 15779 17131 gene locus_tag LOCUS_02430 15779 17131 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H9 protein_id gnl|my_center|LOCUS_02430 17469 17221 gene locus_tag LOCUS_02440 17469 17221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17380 18096 gene locus_tag LOCUS_02450 17380 18096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 18588 18121 gene locus_tag LOCUS_02460 18588 18121 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_02460 19342 18590 gene locus_tag LOCUS_02470 19342 18590 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 protein_id gnl|my_center|LOCUS_02470 19813 19346 gene locus_tag LOCUS_02480 19813 19346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 20680 19826 gene locus_tag LOCUS_02490 20680 19826 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766463.1 protein_id gnl|my_center|LOCUS_02490 20990 20901 gene locus_tag LOCUS_t00050 20990 20901 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 22087 21035 gene locus_tag LOCUS_02500 22087 21035 CDS product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_02500 22870 22094 gene locus_tag LOCUS_02510 gene tatD 22870 22094 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_02510 23024 23539 gene locus_tag LOCUS_02520 23024 23539 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_02520 24582 23563 gene locus_tag LOCUS_02530 24582 23563 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_02530 <28304 24681 gene locus_tag LOCUS_02540 <28304 24681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118116.1:cellulosome anchoring protein >Feature sequence009 950 2509 gene locus_tag LOCUS_02550 950 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 2530 3696 gene locus_tag LOCUS_02560 2530 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3693 4574 gene locus_tag LOCUS_02570 3693 4574 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XK7 protein_id gnl|my_center|LOCUS_02570 4571 6298 gene locus_tag LOCUS_02580 4571 6298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 6763 6837 gene locus_tag LOCUS_t00060 6763 6837 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 6879 6951 gene locus_tag LOCUS_t00070 6879 6951 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7791 6985 gene locus_tag LOCUS_02590 7791 6985 CDS product fatty acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530156.1 protein_id gnl|my_center|LOCUS_02590 8049 8438 gene locus_tag LOCUS_02600 8049 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 10769 8424 gene locus_tag LOCUS_02610 gene pepN 10769 8424 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_02610 10982 11272 gene locus_tag LOCUS_02620 10982 11272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 11277 12437 gene locus_tag LOCUS_02630 11277 12437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 14292 12445 gene locus_tag LOCUS_02640 14292 12445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 16863 14383 gene locus_tag LOCUS_02650 16863 14383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 18842 16863 gene locus_tag LOCUS_02660 18842 16863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 19900 18839 gene locus_tag LOCUS_02670 19900 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_02670 20885 19935 gene locus_tag LOCUS_02680 20885 19935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_02680 21798 20905 gene locus_tag LOCUS_02690 21798 20905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_02690 22857 21808 gene locus_tag LOCUS_02700 22857 21808 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence010 214 1377 gene locus_tag LOCUS_02710 214 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1533 1460 gene locus_tag LOCUS_t00080 1533 1460 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1648 3060 gene locus_tag LOCUS_02720 1648 3060 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731185.1 protein_id gnl|my_center|LOCUS_02720 3101 4087 gene locus_tag LOCUS_02730 3101 4087 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_02730 5126 4155 gene locus_tag LOCUS_02740 5126 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5248 6900 gene locus_tag LOCUS_02750 5248 6900 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_02750 8970 6922 gene locus_tag LOCUS_02760 8970 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 9710 9015 gene locus_tag LOCUS_02770 9710 9015 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 protein_id gnl|my_center|LOCUS_02770 11033 9726 gene locus_tag LOCUS_02780 11033 9726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 11113 12060 gene locus_tag LOCUS_02790 gene prsA 11113 12060 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_02790 12073 12714 gene locus_tag LOCUS_02800 gene rplY 12073 12714 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 protein_id gnl|my_center|LOCUS_02800 12749 13312 gene locus_tag LOCUS_02810 gene pth 12749 13312 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X30 protein_id gnl|my_center|LOCUS_02810 13925 13323 gene locus_tag LOCUS_02820 gene nadD 13925 13323 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 protein_id gnl|my_center|LOCUS_02820 14542 13922 gene locus_tag LOCUS_02830 gene gmk 14542 13922 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PY1 protein_id gnl|my_center|LOCUS_02830 15404 14532 gene locus_tag LOCUS_02840 15404 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_02840 15535 16467 gene locus_tag LOCUS_02850 15535 16467 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_02850 16561 17643 gene locus_tag LOCUS_02860 16561 17643 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_02860 17705 18073 gene locus_tag LOCUS_02870 17705 18073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 18141 19307 gene locus_tag LOCUS_02880 gene hmgA 18141 19307 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_02880 19338 20474 gene locus_tag LOCUS_02890 gene hppD 19338 20474 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_02890 20471 22030 gene locus_tag LOCUS_02900 20471 22030 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088346.1 protein_id gnl|my_center|LOCUS_02900 22043 22825 gene locus_tag LOCUS_02910 gene crt 22043 22825 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence011 267 743 gene locus_tag LOCUS_02920 267 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 746 1735 gene locus_tag LOCUS_02930 746 1735 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_02930 1732 3141 gene locus_tag LOCUS_02940 1732 3141 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2K1 protein_id gnl|my_center|LOCUS_02940 3166 4221 gene locus_tag LOCUS_02950 3166 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4240 5007 gene locus_tag LOCUS_02960 4240 5007 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767618.1 protein_id gnl|my_center|LOCUS_02960 6972 5017 gene locus_tag LOCUS_02970 6972 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 9947 7068 gene locus_tag LOCUS_02980 9947 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 10058 11398 gene locus_tag LOCUS_02990 10058 11398 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203485.1 protein_id gnl|my_center|LOCUS_02990 11445 12665 gene locus_tag LOCUS_03000 11445 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 12724 13287 gene locus_tag LOCUS_03010 12724 13287 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785402.1 protein_id gnl|my_center|LOCUS_03010 13359 13808 gene locus_tag LOCUS_03020 13359 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 13870 14352 gene locus_tag LOCUS_03030 13870 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962782.1 protein_id gnl|my_center|LOCUS_03030 15863 14343 gene locus_tag LOCUS_03040 15863 14343 CDS product RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787725.1 protein_id gnl|my_center|LOCUS_03040 16002 18608 gene locus_tag LOCUS_03050 16002 18608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 18703 19017 gene locus_tag LOCUS_03060 18703 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 19054 19779 gene locus_tag LOCUS_03070 19054 19779 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877498.1 protein_id gnl|my_center|LOCUS_03070 19796 20626 gene locus_tag LOCUS_03080 gene parA 19796 20626 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_03080 20637 21635 gene locus_tag LOCUS_03090 gene spo0J 20637 21635 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403291.1 protein_id gnl|my_center|LOCUS_03090 21640 22200 gene locus_tag LOCUS_03100 21640 22200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 22352 22206 gene locus_tag LOCUS_03110 22352 22206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 22404 22886 gene locus_tag LOCUS_03120 22404 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence012 2 907 gene locus_tag LOCUS_03130 2 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 1559 1059 gene locus_tag LOCUS_03140 1559 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2799 1648 gene locus_tag LOCUS_03150 2799 1648 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 protein_id gnl|my_center|LOCUS_03150 4257 2851 gene locus_tag LOCUS_03160 4257 2851 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_03160 4487 5905 gene locus_tag LOCUS_03170 4487 5905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5902 6696 gene locus_tag LOCUS_03180 5902 6696 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_03180 6722 7039 gene locus_tag LOCUS_03190 6722 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 7036 7947 gene locus_tag LOCUS_03200 7036 7947 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071604.1 protein_id gnl|my_center|LOCUS_03200 7872 8717 gene locus_tag LOCUS_03210 7872 8717 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_03210 8768 9586 gene locus_tag LOCUS_03220 gene murQ 8768 9586 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABH7 protein_id gnl|my_center|LOCUS_03220 9597 10178 gene locus_tag LOCUS_03230 9597 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10199 10966 gene locus_tag LOCUS_03240 gene arsC 10199 10966 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123107.1 protein_id gnl|my_center|LOCUS_03240 10976 13072 gene locus_tag LOCUS_03250 10976 13072 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 protein_id gnl|my_center|LOCUS_03250 13072 14364 gene locus_tag LOCUS_03260 gene pyrC 13072 14364 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_03260 14743 14387 gene locus_tag LOCUS_03270 14743 14387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 protein_id gnl|my_center|LOCUS_03270 15449 14754 gene locus_tag LOCUS_03280 15449 14754 CDS product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784670.1 protein_id gnl|my_center|LOCUS_03280 15945 15484 gene locus_tag LOCUS_03290 15945 15484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 17249 15933 gene locus_tag LOCUS_03300 17249 15933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001255207.1 protein_id gnl|my_center|LOCUS_03300 18361 17246 gene locus_tag LOCUS_03310 gene bplD 18361 17246 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929613.1 protein_id gnl|my_center|LOCUS_03310 19078 18428 gene locus_tag LOCUS_03320 gene radC 19078 18428 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_03320 19518 19261 gene locus_tag LOCUS_03330 gene rpsT 19518 19261 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A276 protein_id gnl|my_center|LOCUS_03330 20060 19596 gene locus_tag LOCUS_03340 20060 19596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 20638 20186 gene locus_tag LOCUS_03350 20638 20186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 <21401 20660 gene locus_tag LOCUS_03360 <21401 20660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYY2:pseudouridine synthase >Feature sequence013 531 1730 gene locus_tag LOCUS_03370 531 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 1853 2641 gene locus_tag LOCUS_03380 1853 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 2672 3640 gene locus_tag LOCUS_03390 gene fcl 2672 3640 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 protein_id gnl|my_center|LOCUS_03390 3637 4983 gene locus_tag LOCUS_03400 3637 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5139 6209 gene locus_tag LOCUS_03410 5139 6209 CDS product undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258150.1 protein_id gnl|my_center|LOCUS_03410 6206 7612 gene locus_tag LOCUS_03420 6206 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 7676 8527 gene locus_tag LOCUS_03430 gene ctaB 7676 8527 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 protein_id gnl|my_center|LOCUS_03430 8539 9339 gene locus_tag LOCUS_03440 8539 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 9386 10366 gene locus_tag LOCUS_03450 9386 10366 CDS product cytochrome oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_03450 10373 10750 gene locus_tag LOCUS_03460 10373 10750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 10760 11416 gene locus_tag LOCUS_03470 10760 11416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 11413 12102 gene locus_tag LOCUS_03480 11413 12102 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123491.1 protein_id gnl|my_center|LOCUS_03480 12133 12681 gene locus_tag LOCUS_03490 gene yozB 12133 12681 CDS product putative membrane protein YozB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31845 protein_id gnl|my_center|LOCUS_03490 12700 12939 gene locus_tag LOCUS_03500 12700 12939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 13001 14470 gene locus_tag LOCUS_03510 13001 14470 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_03510 14505 15821 gene locus_tag LOCUS_03520 14505 15821 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_03520 15799 16500 gene locus_tag LOCUS_03530 15799 16500 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 protein_id gnl|my_center|LOCUS_03530 16493 16945 gene locus_tag LOCUS_03540 16493 16945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 18284 16965 gene locus_tag LOCUS_03550 gene ahcY 18284 16965 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 protein_id gnl|my_center|LOCUS_03550 18315 18986 gene locus_tag LOCUS_03560 18315 18986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 >Feature sequence014 443 1963 gene locus_tag LOCUS_03570 443 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 3119 2034 gene locus_tag LOCUS_03580 3119 2034 CDS product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 protein_id gnl|my_center|LOCUS_03580 4405 3116 gene locus_tag LOCUS_03590 4405 3116 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_03590 5738 4380 gene locus_tag LOCUS_03600 5738 4380 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_03600 5834 6271 gene locus_tag LOCUS_03610 5834 6271 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794261.1 protein_id gnl|my_center|LOCUS_03610 7471 6275 gene locus_tag LOCUS_03620 gene pgk 7471 6275 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 protein_id gnl|my_center|LOCUS_03620 9051 7501 gene locus_tag LOCUS_03630 gene glyQS 9051 7501 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 protein_id gnl|my_center|LOCUS_03630 9171 13214 gene locus_tag LOCUS_03640 9171 13214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 13692 13237 gene locus_tag LOCUS_03650 13692 13237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14635 13724 gene locus_tag LOCUS_03660 14635 13724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 15312 15109 gene locus_tag LOCUS_03670 15312 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 15287 16111 gene locus_tag LOCUS_03680 15287 16111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 17022 16147 gene locus_tag LOCUS_03690 17022 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001974887.1 protein_id gnl|my_center|LOCUS_03690 17164 17526 gene locus_tag LOCUS_03700 17164 17526 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DU6 protein_id gnl|my_center|LOCUS_03700 17669 18007 gene locus_tag LOCUS_03710 17669 18007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 18025 18732 gene locus_tag LOCUS_03720 18025 18732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 18729 19481 gene locus_tag LOCUS_03730 18729 19481 CDS product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 protein_id gnl|my_center|LOCUS_03730 19478 20851 gene locus_tag LOCUS_03740 gene pyrC1 19478 20851 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 protein_id gnl|my_center|LOCUS_03740 >Feature sequence015 167 95 gene locus_tag LOCUS_t00090 167 95 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 238 1110 gene locus_tag LOCUS_03750 238 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 1135 1395 gene locus_tag LOCUS_03760 gene purS 1135 1395 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Y6 protein_id gnl|my_center|LOCUS_03760 2975 1671 gene locus_tag LOCUS_03770 2975 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4857 3142 gene locus_tag LOCUS_03780 4857 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7163 4962 gene locus_tag LOCUS_03790 gene ptrB 7163 4962 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_03790 8058 7405 gene locus_tag LOCUS_03800 gene ybbC 8058 7405 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_03800 9104 8040 gene locus_tag LOCUS_03810 9104 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9875 9117 gene locus_tag LOCUS_03820 gene kdsB 9875 9117 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 protein_id gnl|my_center|LOCUS_03820 12286 9872 gene locus_tag LOCUS_03830 12286 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 12388 13482 gene locus_tag LOCUS_03840 gene dprA 12388 13482 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03840 13879 13520 gene locus_tag LOCUS_03850 13879 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 15137 13881 gene locus_tag LOCUS_03860 15137 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 16568 15159 gene locus_tag LOCUS_03870 16568 15159 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ0 protein_id gnl|my_center|LOCUS_03870 16714 16565 gene locus_tag LOCUS_03880 16714 16565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 16738 19101 gene locus_tag LOCUS_03890 gene mrcA 16738 19101 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_03890 19120 19839 gene locus_tag LOCUS_03900 gene atoD 19120 19839 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_03900 19843 20496 gene locus_tag LOCUS_03910 gene atoA 19843 20496 CDS product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence016 470 1312 gene locus_tag LOCUS_03920 470 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 1402 2607 gene locus_tag LOCUS_03930 1402 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_03930 2607 3062 gene locus_tag LOCUS_03940 2607 3062 CDS product iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224598.1 protein_id gnl|my_center|LOCUS_03940 3034 4287 gene locus_tag LOCUS_03950 3034 4287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_03950 4432 5265 gene locus_tag LOCUS_03960 gene glpQ 4432 5265 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_03960 5812 5243 gene locus_tag LOCUS_03970 5812 5243 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0Q0 protein_id gnl|my_center|LOCUS_03970 8243 6096 gene locus_tag LOCUS_03980 8243 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8686 8402 gene locus_tag LOCUS_03990 8686 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 10609 8852 gene locus_tag LOCUS_04000 10609 8852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 13201 10838 gene locus_tag LOCUS_04010 13201 10838 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_04010 14603 13815 gene locus_tag LOCUS_04020 14603 13815 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939228.1 protein_id gnl|my_center|LOCUS_04020 14814 15677 gene locus_tag LOCUS_04030 14814 15677 CDS product 4,5-9,10-diseco-3-hydroxy-5,9,17-trioxoandrosta-1(10),2-diene-4-oate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 protein_id gnl|my_center|LOCUS_04030 16238 15693 gene locus_tag LOCUS_04040 16238 15693 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_04040 20066 16248 gene locus_tag LOCUS_04050 20066 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 20013 20324 gene locus_tag LOCUS_04060 20013 20324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence017 <1 4404 gene locus_tag LOCUS_04070 <1 4404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989777.1:cell wall surface anchor protein 4524 5720 gene locus_tag LOCUS_04080 4524 5720 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776370.1 protein_id gnl|my_center|LOCUS_04080 5756 9376 gene locus_tag LOCUS_04090 5756 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 9420 11609 gene locus_tag LOCUS_04100 gene glnA 9420 11609 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962708.1 protein_id gnl|my_center|LOCUS_04100 11686 13701 gene locus_tag LOCUS_04110 11686 13701 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 protein_id gnl|my_center|LOCUS_04110 13698 14963 gene locus_tag LOCUS_04120 13698 14963 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813169.1 protein_id gnl|my_center|LOCUS_04120 14963 16042 gene locus_tag LOCUS_04130 gene prfA 14963 16042 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888C1 protein_id gnl|my_center|LOCUS_04130 16008 16865 gene locus_tag LOCUS_04140 gene pyrF 16008 16865 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A012 protein_id gnl|my_center|LOCUS_04140 16949 17329 gene locus_tag LOCUS_04150 16949 17329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 17253 17450 gene locus_tag LOCUS_04160 17253 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 17544 19097 gene locus_tag LOCUS_04170 gene dagA 17544 19097 CDS product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 protein_id gnl|my_center|LOCUS_04170 19110 20045 gene locus_tag LOCUS_04180 19110 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence018 1638 199 gene locus_tag LOCUS_04190 1638 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 1999 4308 gene locus_tag LOCUS_04200 1999 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 7079 4410 gene locus_tag LOCUS_04210 7079 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 7915 7082 gene locus_tag LOCUS_04220 7915 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 9363 7942 gene locus_tag LOCUS_04230 9363 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 9497 9360 gene locus_tag LOCUS_04240 9497 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 10820 9510 gene locus_tag LOCUS_04250 10820 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 12952 10853 gene locus_tag LOCUS_04260 12952 10853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 13698 12952 gene locus_tag LOCUS_04270 13698 12952 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 protein_id gnl|my_center|LOCUS_04270 14505 13708 gene locus_tag LOCUS_04280 14505 13708 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_04280 15867 14509 gene locus_tag LOCUS_04290 15867 14509 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_04290 16938 15901 gene locus_tag LOCUS_04300 16938 15901 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_04300 17953 16943 gene locus_tag LOCUS_04310 17953 16943 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence019 1717 233 gene locus_tag LOCUS_04320 1717 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2493 1714 gene locus_tag LOCUS_04330 2493 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3068 2490 gene locus_tag LOCUS_04340 3068 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4393 3074 gene locus_tag LOCUS_04350 4393 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 4821 4393 gene locus_tag LOCUS_04360 4821 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5868 4831 gene locus_tag LOCUS_04370 5868 4831 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107826.1 protein_id gnl|my_center|LOCUS_04370 5985 6293 gene locus_tag LOCUS_04380 gene hupA 5985 6293 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_04380 6310 6930 gene locus_tag LOCUS_04390 6310 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7050 8642 gene locus_tag LOCUS_04400 7050 8642 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 protein_id gnl|my_center|LOCUS_04400 9967 8729 gene locus_tag LOCUS_04410 9967 8729 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_04410 10033 11595 gene locus_tag LOCUS_04420 gene porX 10033 11595 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_04420 11592 12080 gene locus_tag LOCUS_04430 11592 12080 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759702.1 protein_id gnl|my_center|LOCUS_04430 12130 13368 gene locus_tag LOCUS_04440 gene ald 12130 13368 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_04440 15982 13346 gene locus_tag LOCUS_04450 gene mutS 15982 13346 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MG7 protein_id gnl|my_center|LOCUS_04450 17237 15996 gene locus_tag LOCUS_04460 gene clpX 17237 15996 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A128 protein_id gnl|my_center|LOCUS_04460 17915 17238 gene locus_tag LOCUS_04470 gene clpP 17915 17238 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 protein_id gnl|my_center|LOCUS_04470 19322 17970 gene locus_tag LOCUS_04480 gene tig 19322 17970 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964185.1 protein_id gnl|my_center|LOCUS_04480 19472 19388 gene locus_tag LOCUS_t00100 19472 19388 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 1066 1674 gene locus_tag LOCUS_04490 1066 1674 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_04490 1710 2156 gene locus_tag LOCUS_04500 1710 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3865 2117 gene locus_tag LOCUS_04510 3865 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202130.1 protein_id gnl|my_center|LOCUS_04510 4063 4389 gene locus_tag LOCUS_04520 4063 4389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4383 5483 gene locus_tag LOCUS_04530 gene prfB 4383 5483 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 protein_id gnl|my_center|LOCUS_04530 5489 6883 gene locus_tag LOCUS_04540 gene fumC 5489 6883 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 protein_id gnl|my_center|LOCUS_04540 8001 6880 gene locus_tag LOCUS_04550 8001 6880 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108476.1 protein_id gnl|my_center|LOCUS_04550 7894 8250 gene locus_tag LOCUS_04560 7894 8250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 8264 9004 gene locus_tag LOCUS_04570 8264 9004 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963506.1 protein_id gnl|my_center|LOCUS_04570 9001 9777 gene locus_tag LOCUS_04580 9001 9777 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_04580 9770 10495 gene locus_tag LOCUS_04590 9770 10495 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_04590 10617 10850 gene locus_tag LOCUS_04600 gene acpP 10617 10850 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2E6 protein_id gnl|my_center|LOCUS_04600 10866 12113 gene locus_tag LOCUS_04610 10866 12113 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 protein_id gnl|my_center|LOCUS_04610 12110 12829 gene locus_tag LOCUS_04620 12110 12829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 12835 13245 gene locus_tag LOCUS_04630 12835 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 13301 14716 gene locus_tag LOCUS_04640 gene pykA 13301 14716 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 protein_id gnl|my_center|LOCUS_04640 14756 18139 gene locus_tag LOCUS_04650 gene ileS 14756 18139 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW60 protein_id gnl|my_center|LOCUS_04650 18141 18512 gene locus_tag LOCUS_04660 gene dksA 18141 18512 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962394.1 protein_id gnl|my_center|LOCUS_04660 18520 19167 gene locus_tag LOCUS_04670 gene lspA 18520 19167 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW62 protein_id gnl|my_center|LOCUS_04670 >Feature sequence021 317 1099 gene locus_tag LOCUS_04680 317 1099 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118862.1 protein_id gnl|my_center|LOCUS_04680 2597 1110 gene locus_tag LOCUS_04690 gene guaB 2597 1110 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 protein_id gnl|my_center|LOCUS_04690 4786 2663 gene locus_tag LOCUS_04700 4786 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5850 4849 gene locus_tag LOCUS_04710 5850 4849 CDS product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_04710 6123 6974 gene locus_tag LOCUS_04720 6123 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 7068 9059 gene locus_tag LOCUS_04730 7068 9059 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_04730 9140 9919 gene locus_tag LOCUS_04740 9140 9919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 9916 11340 gene locus_tag LOCUS_04750 9916 11340 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A123 protein_id gnl|my_center|LOCUS_04750 11295 12299 gene locus_tag LOCUS_04760 11295 12299 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_04760 12296 13543 gene locus_tag LOCUS_04770 gene fahA 12296 13543 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 protein_id gnl|my_center|LOCUS_04770 13606 15852 gene locus_tag LOCUS_04780 gene relA 13606 15852 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_04780 15889 17160 gene locus_tag LOCUS_04790 gene purA 15889 17160 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 protein_id gnl|my_center|LOCUS_04790 17166 18926 gene locus_tag LOCUS_04800 17166 18926 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074915.1 protein_id gnl|my_center|LOCUS_04800 19344 18904 gene locus_tag LOCUS_04810 19344 18904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence022 349 1107 gene locus_tag LOCUS_04820 349 1107 CDS product putative response regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KL96 protein_id gnl|my_center|LOCUS_04820 1142 2191 gene locus_tag LOCUS_04830 gene rlmN 1142 2191 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 protein_id gnl|my_center|LOCUS_04830 3975 2188 gene locus_tag LOCUS_04840 gene lepA 3975 2188 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA33 protein_id gnl|my_center|LOCUS_04840 4086 7664 gene locus_tag LOCUS_04850 4086 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 7667 9052 gene locus_tag LOCUS_04860 gene radA 7667 9052 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 protein_id gnl|my_center|LOCUS_04860 9734 9000 gene locus_tag LOCUS_04870 gene rsmI 9734 9000 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5G6 protein_id gnl|my_center|LOCUS_04870 10462 9731 gene locus_tag LOCUS_04880 10462 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 11354 10428 gene locus_tag LOCUS_04890 11354 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 16531 11351 gene locus_tag LOCUS_04900 16531 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 17661 16702 gene locus_tag LOCUS_04910 17661 16702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 18566 17667 gene locus_tag LOCUS_04920 18566 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 18480 18761 gene locus_tag LOCUS_04930 18480 18761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 18982 18806 gene locus_tag LOCUS_04940 18982 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 >Feature sequence023 326 1345 gene locus_tag LOCUS_04950 326 1345 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 protein_id gnl|my_center|LOCUS_04950 2567 1332 gene locus_tag LOCUS_04960 2567 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2999 2649 gene locus_tag LOCUS_04970 gene rbfA 2999 2649 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFT0 protein_id gnl|my_center|LOCUS_04970 3901 3038 gene locus_tag LOCUS_04980 3901 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5191 3968 gene locus_tag LOCUS_04990 gene hflX 5191 3968 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 protein_id gnl|my_center|LOCUS_04990 5525 5172 gene locus_tag LOCUS_05000 5525 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 5941 5525 gene locus_tag LOCUS_05010 5941 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7322 5976 gene locus_tag LOCUS_05020 gene gdhA 7322 5976 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 protein_id gnl|my_center|LOCUS_05020 8200 7403 gene locus_tag LOCUS_05030 8200 7403 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339313.1 protein_id gnl|my_center|LOCUS_05030 8310 9383 gene locus_tag LOCUS_05040 8310 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_05040 9380 10606 gene locus_tag LOCUS_05050 9380 10606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 10644 11039 gene locus_tag LOCUS_05060 10644 11039 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_05060 12638 11250 gene locus_tag LOCUS_05070 gene kmo 12638 11250 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 protein_id gnl|my_center|LOCUS_05070 13795 12635 gene locus_tag LOCUS_05080 13795 12635 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_05080 14946 13912 gene locus_tag LOCUS_05090 14946 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203278.1 protein_id gnl|my_center|LOCUS_05090 15751 14939 gene locus_tag LOCUS_05100 15751 14939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 16040 16642 gene locus_tag LOCUS_05110 16040 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_05110 16639 18162 gene locus_tag LOCUS_05120 16639 18162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 18172 18525 gene locus_tag LOCUS_05130 gene panD 18172 18525 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 protein_id gnl|my_center|LOCUS_05130 >Feature sequence024 <1 5821 gene locus_tag LOCUS_05140 <1 5821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964220.1:cell surface protein SprA 5886 6263 gene locus_tag LOCUS_05150 gene gcvH 5886 6263 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64N36 protein_id gnl|my_center|LOCUS_05150 6327 6701 gene locus_tag LOCUS_05160 6327 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 6717 7421 gene locus_tag LOCUS_05170 6717 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 7946 7428 gene locus_tag LOCUS_05180 7946 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9555 7954 gene locus_tag LOCUS_05190 9555 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 9768 11273 gene locus_tag LOCUS_05200 gene atpD 9768 11273 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 protein_id gnl|my_center|LOCUS_05200 11273 11506 gene locus_tag LOCUS_05210 11273 11506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 12135 11647 gene locus_tag LOCUS_05220 gene rlmH 12135 11647 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WA8 protein_id gnl|my_center|LOCUS_05220 12212 13090 gene locus_tag LOCUS_05230 12212 13090 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_05230 13087 15837 gene locus_tag LOCUS_05240 13087 15837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 15897 16346 gene locus_tag LOCUS_05250 15897 16346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 17885 16395 gene locus_tag LOCUS_05260 17885 16395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence025 5 376 gene locus_tag LOCUS_05270 5 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1146 568 gene locus_tag LOCUS_05280 1146 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2660 1221 gene locus_tag LOCUS_05290 gene rpoN 2660 1221 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 protein_id gnl|my_center|LOCUS_05290 4051 2660 gene locus_tag LOCUS_05300 gene asnS 4051 2660 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 protein_id gnl|my_center|LOCUS_05300 4744 4067 gene locus_tag LOCUS_05310 4744 4067 CDS product macrolide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_05310 4805 7018 gene locus_tag LOCUS_05320 4805 7018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 8534 7026 gene locus_tag LOCUS_05330 gene gpmI 8534 7026 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747Q8 protein_id gnl|my_center|LOCUS_05330 9210 8527 gene locus_tag LOCUS_05340 9210 8527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 9378 9453 gene locus_tag LOCUS_t00110 9378 9453 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9561 11708 gene locus_tag LOCUS_05350 9561 11708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 12969 11737 gene locus_tag LOCUS_05360 gene folC 12969 11737 CDS product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_05360 13760 12966 gene locus_tag LOCUS_05370 13760 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 14149 13757 gene locus_tag LOCUS_05380 14149 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 14880 14146 gene locus_tag LOCUS_05390 14880 14146 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791129.1 protein_id gnl|my_center|LOCUS_05390 16357 14960 gene locus_tag LOCUS_05400 16357 14960 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086520.1 protein_id gnl|my_center|LOCUS_05400 17600 16359 gene locus_tag LOCUS_05410 17600 16359 CDS product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 protein_id gnl|my_center|LOCUS_05410 <18484 17622 gene locus_tag LOCUS_05420 <18484 17622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZV7:anhydro-N-acetylmuramic acid kinase >Feature sequence026 <1 658 gene locus_tag LOCUS_05430 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203293.1:signal peptide peptidase SppA 1264 674 gene locus_tag LOCUS_05440 1264 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1352 2320 gene locus_tag LOCUS_05450 1352 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_05450 2358 3242 gene locus_tag LOCUS_05460 gene fabD 2358 3242 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 protein_id gnl|my_center|LOCUS_05460 3579 3262 gene locus_tag LOCUS_05470 3579 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 4842 3607 gene locus_tag LOCUS_05480 4842 3607 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190318.1 protein_id gnl|my_center|LOCUS_05480 5030 5257 gene locus_tag LOCUS_05490 5030 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 5261 6889 gene locus_tag LOCUS_05500 5261 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_05500 6932 7555 gene locus_tag LOCUS_05510 6932 7555 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_05510 8423 7593 gene locus_tag LOCUS_05520 8423 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 10734 8476 gene locus_tag LOCUS_05530 10734 8476 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 protein_id gnl|my_center|LOCUS_05530 11765 10785 gene locus_tag LOCUS_05540 gene pdhB 11765 10785 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 protein_id gnl|my_center|LOCUS_05540 11865 12605 gene locus_tag LOCUS_05550 gene etfB 11865 12605 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_05550 12613 13539 gene locus_tag LOCUS_05560 gene etfA 12613 13539 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_05560 13542 14135 gene locus_tag LOCUS_05570 13542 14135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_05570 14155 15450 gene locus_tag LOCUS_05580 14155 15450 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_05580 15494 16003 gene locus_tag LOCUS_05590 gene purE 15494 16003 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 protein_id gnl|my_center|LOCUS_05590 16011 16916 gene locus_tag LOCUS_05600 16011 16916 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 protein_id gnl|my_center|LOCUS_05600 16971 17378 gene locus_tag LOCUS_05610 16971 17378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence027 1087 623 gene locus_tag LOCUS_05620 1087 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2122 1412 gene locus_tag LOCUS_05630 2122 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 3408 2128 gene locus_tag LOCUS_05640 gene glyA 3408 2128 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 protein_id gnl|my_center|LOCUS_05640 3501 5273 gene locus_tag LOCUS_05650 gene typA 3501 5273 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_05650 5318 6418 gene locus_tag LOCUS_05660 5318 6418 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_05660 6466 7818 gene locus_tag LOCUS_05670 gene nagA 6466 7818 CDS product alpha-N-acetylgalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ECL7 protein_id gnl|my_center|LOCUS_05670 7895 8302 gene locus_tag LOCUS_05680 7895 8302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8312 9418 gene locus_tag LOCUS_05690 8312 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813194.1 protein_id gnl|my_center|LOCUS_05690 9428 11815 gene locus_tag LOCUS_05700 9428 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11888 12631 gene locus_tag LOCUS_05710 11888 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403968.1 protein_id gnl|my_center|LOCUS_05710 12666 14411 gene locus_tag LOCUS_05720 12666 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 14430 15449 gene locus_tag LOCUS_05730 14430 15449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 protein_id gnl|my_center|LOCUS_05730 15556 16542 gene locus_tag LOCUS_05740 15556 16542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16583 16756 gene locus_tag LOCUS_05750 16583 16756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 <17718 16794 gene locus_tag LOCUS_05760 <17718 16794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UJ08:thymidine phosphorylase >Feature sequence028 1271 621 gene locus_tag LOCUS_05770 1271 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1895 1823 gene locus_tag LOCUS_t00120 1895 1823 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3488 2004 gene locus_tag LOCUS_05780 gene proS 3488 2004 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TJ6 protein_id gnl|my_center|LOCUS_05780 3611 4651 gene locus_tag LOCUS_05790 3611 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4663 6129 gene locus_tag LOCUS_05800 4663 6129 CDS product hemin receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795092.1 protein_id gnl|my_center|LOCUS_05800 6965 6168 gene locus_tag LOCUS_05810 6965 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_05810 8071 6965 gene locus_tag LOCUS_05820 8071 6965 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9D3 protein_id gnl|my_center|LOCUS_05820 8120 9283 gene locus_tag LOCUS_05830 gene lpxK 8120 9283 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 protein_id gnl|my_center|LOCUS_05830 9280 10386 gene locus_tag LOCUS_05840 9280 10386 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_05840 10383 11183 gene locus_tag LOCUS_05850 gene lpxH 10383 11183 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_05850 14258 11196 gene locus_tag LOCUS_05860 14258 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 15237 14371 gene locus_tag LOCUS_05870 gene lipA 15237 14371 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 protein_id gnl|my_center|LOCUS_05870 15999 15277 gene locus_tag LOCUS_05880 15999 15277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 16054 16518 gene locus_tag LOCUS_05890 16054 16518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119515.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence029 3274 902 gene locus_tag LOCUS_05900 3274 902 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_05900 3705 3271 gene locus_tag LOCUS_05910 3705 3271 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_05910 4020 6737 gene locus_tag LOCUS_05920 4020 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6753 7064 gene locus_tag LOCUS_05930 6753 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7061 7519 gene locus_tag LOCUS_05940 7061 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 8241 7588 gene locus_tag LOCUS_05950 gene lolD 8241 7588 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z80 protein_id gnl|my_center|LOCUS_05950 8272 9483 gene locus_tag LOCUS_05960 gene sucC 8272 9483 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 protein_id gnl|my_center|LOCUS_05960 10164 9487 gene locus_tag LOCUS_05970 10164 9487 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_05970 10893 10216 gene locus_tag LOCUS_05980 10893 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10977 11345 gene locus_tag LOCUS_05990 10977 11345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 11342 12619 gene locus_tag LOCUS_06000 11342 12619 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108720.1 protein_id gnl|my_center|LOCUS_06000 12985 12674 gene locus_tag LOCUS_06010 12985 12674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 13579 13031 gene locus_tag LOCUS_06020 13579 13031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 13804 13601 gene locus_tag LOCUS_06030 13804 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 13718 15424 gene locus_tag LOCUS_06040 13718 15424 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_06040 15448 16107 gene locus_tag LOCUS_06050 15448 16107 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence030 2782 1034 gene locus_tag LOCUS_06060 2782 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3872 2856 gene locus_tag LOCUS_06070 3872 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4031 7576 gene locus_tag LOCUS_06080 gene porU 4031 7576 CDS product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_06080 7640 8902 gene locus_tag LOCUS_06090 gene porV 7640 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_06090 8919 9401 gene locus_tag LOCUS_06100 gene ispF 8919 9401 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S211 protein_id gnl|my_center|LOCUS_06100 9508 10551 gene locus_tag LOCUS_06110 gene pdhA 9508 10551 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 protein_id gnl|my_center|LOCUS_06110 10564 11820 gene locus_tag LOCUS_06120 gene pdhC 10564 11820 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 protein_id gnl|my_center|LOCUS_06120 11833 13950 gene locus_tag LOCUS_06130 gene recG 11833 13950 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 protein_id gnl|my_center|LOCUS_06130 13925 14947 gene locus_tag LOCUS_06140 13925 14947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 16112 14970 gene locus_tag LOCUS_06150 16112 14970 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence031 535 2811 gene locus_tag LOCUS_06160 gene acnA 535 2811 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 protein_id gnl|my_center|LOCUS_06160 3048 3710 gene locus_tag LOCUS_06170 3048 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 4202 3714 gene locus_tag LOCUS_06180 4202 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 4508 4281 gene locus_tag LOCUS_06190 4508 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 5031 4828 gene locus_tag LOCUS_06200 5031 4828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5961 5083 gene locus_tag LOCUS_06210 5961 5083 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_06210 6076 6708 gene locus_tag LOCUS_06220 6076 6708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 6711 7277 gene locus_tag LOCUS_06230 6711 7277 CDS product SOUL heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139961.1 protein_id gnl|my_center|LOCUS_06230 7451 7642 gene locus_tag LOCUS_06240 7451 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 7976 8377 gene locus_tag LOCUS_06250 7976 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 12455 8898 gene locus_tag LOCUS_06260 12455 8898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence032 1485 703 gene locus_tag LOCUS_06270 1485 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3118 1490 gene locus_tag LOCUS_06280 3118 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3198 3638 gene locus_tag LOCUS_06290 gene smpB 3198 3638 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 protein_id gnl|my_center|LOCUS_06290 4181 3618 gene locus_tag LOCUS_06300 4181 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4369 5409 gene locus_tag LOCUS_06310 gene pyrD 4369 5409 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 protein_id gnl|my_center|LOCUS_06310 6344 5457 gene locus_tag LOCUS_06320 6344 5457 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_06320 6422 7774 gene locus_tag LOCUS_06330 gene purB 6422 7774 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 protein_id gnl|my_center|LOCUS_06330 7771 9600 gene locus_tag LOCUS_06340 7771 9600 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_06340 9659 10018 gene locus_tag LOCUS_06350 9659 10018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 10257 10721 gene locus_tag LOCUS_06360 gene cysC1 10257 10721 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK5 protein_id gnl|my_center|LOCUS_06360 10718 10984 gene locus_tag LOCUS_06370 10718 10984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 10981 11889 gene locus_tag LOCUS_06380 gene cysD 10981 11889 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 protein_id gnl|my_center|LOCUS_06380 11890 13176 gene locus_tag LOCUS_06390 11890 13176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 13678 13226 gene locus_tag LOCUS_06400 13678 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 14108 15493 gene locus_tag LOCUS_06410 14108 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 >Feature sequence033 2978 2274 gene locus_tag LOCUS_06420 gene fklB 2978 2274 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KIQ2 protein_id gnl|my_center|LOCUS_06420 3778 2975 gene locus_tag LOCUS_06430 3778 2975 CDS product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ21 protein_id gnl|my_center|LOCUS_06430 3826 5715 gene locus_tag LOCUS_06440 3826 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 6712 5741 gene locus_tag LOCUS_06450 6712 5741 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_06450 6862 9075 gene locus_tag LOCUS_06460 gene dpp11 6862 9075 CDS product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 protein_id gnl|my_center|LOCUS_06460 9397 11823 gene locus_tag LOCUS_06470 9397 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 12343 11924 gene locus_tag LOCUS_06480 12343 11924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121852.1 protein_id gnl|my_center|LOCUS_06480 <15670 12381 gene locus_tag LOCUS_06490 <15670 12381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence034 419 1522 gene locus_tag LOCUS_06500 419 1522 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 protein_id gnl|my_center|LOCUS_06500 1898 1509 gene locus_tag LOCUS_06510 1898 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2518 1895 gene locus_tag LOCUS_06520 2518 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4752 2518 gene locus_tag LOCUS_06530 4752 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5495 4749 gene locus_tag LOCUS_06540 5495 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 6543 5464 gene locus_tag LOCUS_06550 6543 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 6723 7130 gene locus_tag LOCUS_06560 6723 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7683 7141 gene locus_tag LOCUS_06570 7683 7141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 7990 10602 gene locus_tag LOCUS_06580 7990 10602 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405046.1 protein_id gnl|my_center|LOCUS_06580 11879 10599 gene locus_tag LOCUS_06590 11879 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_06590 14910 12433 gene locus_tag LOCUS_06600 14910 12433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_06600 15255 15037 gene locus_tag LOCUS_06610 15255 15037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence035 1475 339 gene locus_tag LOCUS_06620 1475 339 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_06620 1687 4773 gene locus_tag LOCUS_06630 1687 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4778 6103 gene locus_tag LOCUS_06640 gene fucP 4778 6103 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036694.1 protein_id gnl|my_center|LOCUS_06640 6018 6359 gene locus_tag LOCUS_06650 6018 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6727 6452 gene locus_tag LOCUS_06660 6727 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7294 6890 gene locus_tag LOCUS_06670 7294 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 8070 7369 gene locus_tag LOCUS_06680 gene aat 8070 7369 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CL02 protein_id gnl|my_center|LOCUS_06680 8140 8754 gene locus_tag LOCUS_06690 8140 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 10410 8764 gene locus_tag LOCUS_06700 10410 8764 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_06700 10620 11750 gene locus_tag LOCUS_06710 10620 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 11747 12775 gene locus_tag LOCUS_06720 11747 12775 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787518.1 protein_id gnl|my_center|LOCUS_06720 12772 13449 gene locus_tag LOCUS_06730 12772 13449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 13446 14735 gene locus_tag LOCUS_06740 13446 14735 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_06740 >Feature sequence036 2168 4201 gene locus_tag LOCUS_06750 2168 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 4221 5747 gene locus_tag LOCUS_06760 4221 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_06760 5740 6378 gene locus_tag LOCUS_06770 gene udk 5740 6378 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_06770 6400 7317 gene locus_tag LOCUS_06780 6400 7317 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 protein_id gnl|my_center|LOCUS_06780 7327 7884 gene locus_tag LOCUS_06790 gene haaO 7327 7884 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 protein_id gnl|my_center|LOCUS_06790 7929 10511 gene locus_tag LOCUS_06800 7929 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 10589 14479 gene locus_tag LOCUS_06810 10589 14479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence037 1649 219 gene locus_tag LOCUS_06820 1649 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 3603 1879 gene locus_tag LOCUS_06830 3603 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_06830 3632 4225 gene locus_tag LOCUS_06840 3632 4225 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 protein_id gnl|my_center|LOCUS_06840 4530 5264 gene locus_tag LOCUS_06850 4530 5264 CDS product NAD-dependent nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225382.1 protein_id gnl|my_center|LOCUS_06850 5257 5412 gene locus_tag LOCUS_06860 5257 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5520 6764 gene locus_tag LOCUS_06870 gene phrB1 5520 6764 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 protein_id gnl|my_center|LOCUS_06870 7848 6940 gene locus_tag LOCUS_06880 7848 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016600.1 protein_id gnl|my_center|LOCUS_06880 7903 8817 gene locus_tag LOCUS_06890 7903 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 8929 10869 gene locus_tag LOCUS_06900 8929 10869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 11744 10893 gene locus_tag LOCUS_06910 11744 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 11786 13303 gene locus_tag LOCUS_06920 11786 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 13338 13874 gene locus_tag LOCUS_06930 13338 13874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence038 3118 2546 gene locus_tag LOCUS_06940 3118 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 3305 5533 gene locus_tag LOCUS_06950 3305 5533 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_06950 5530 6009 gene locus_tag LOCUS_06960 gene aroQ 5530 6009 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR7 protein_id gnl|my_center|LOCUS_06960 6572 5949 gene locus_tag LOCUS_06970 6572 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 7699 6569 gene locus_tag LOCUS_06980 7699 6569 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_06980 10741 7709 gene locus_tag LOCUS_06990 10741 7709 CDS product beta-N-acetylglucosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_06990 11482 10742 gene locus_tag LOCUS_07000 gene cmk 11482 10742 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PU2 protein_id gnl|my_center|LOCUS_07000 12556 11507 gene locus_tag LOCUS_07010 12556 11507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 <14692 12553 gene locus_tag LOCUS_07020 <14692 12553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0A8:Lon protease >Feature sequence039 98 1135 gene locus_tag LOCUS_07030 98 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1135 5352 gene locus_tag LOCUS_07040 1135 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5371 5847 gene locus_tag LOCUS_07050 gene greA 5371 5847 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 protein_id gnl|my_center|LOCUS_07050 5847 6236 gene locus_tag LOCUS_07060 5847 6236 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 protein_id gnl|my_center|LOCUS_07060 7262 6192 gene locus_tag LOCUS_07070 gene ddl 7262 6192 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD5 protein_id gnl|my_center|LOCUS_07070 8595 7297 gene locus_tag LOCUS_07080 8595 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9035 8592 gene locus_tag LOCUS_07090 gene fur 9035 8592 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_07090 9634 9032 gene locus_tag LOCUS_07100 9634 9032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 10465 9644 gene locus_tag LOCUS_07110 10465 9644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11280 10486 gene locus_tag LOCUS_07120 gene thyA 11280 10486 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JY72 protein_id gnl|my_center|LOCUS_07120 12556 11294 gene locus_tag LOCUS_07130 gene purK 12556 11294 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 protein_id gnl|my_center|LOCUS_07130 12569 13096 gene locus_tag LOCUS_07140 12569 13096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 13113 14177 gene locus_tag LOCUS_07150 13113 14177 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109381.1 protein_id gnl|my_center|LOCUS_07150 14350 14174 gene locus_tag LOCUS_07160 14350 14174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence040 <1 2085 gene locus_tag LOCUS_07170 <1 2085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117787.1:acriflavine resistance protein B 2075 3196 gene locus_tag LOCUS_07180 2075 3196 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140877.1 protein_id gnl|my_center|LOCUS_07180 3196 4461 gene locus_tag LOCUS_07190 3196 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6288 4495 gene locus_tag LOCUS_07200 gene fadD 6288 4495 CDS product AMP-dependent synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_07200 7231 6335 gene locus_tag LOCUS_07210 7231 6335 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_07210 7704 7228 gene locus_tag LOCUS_07220 7704 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07220 7789 9114 gene locus_tag LOCUS_07230 7789 9114 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_07230 9545 9111 gene locus_tag LOCUS_07240 9545 9111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 9641 10663 gene locus_tag LOCUS_07250 gene holA 9641 10663 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_07250 10698 11867 gene locus_tag LOCUS_07260 10698 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 11877 13097 gene locus_tag LOCUS_07270 11877 13097 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_07270 13618 13226 gene locus_tag LOCUS_07280 13618 13226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 13708 14466 gene locus_tag LOCUS_07290 13708 14466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence041 <1 1071 gene locus_tag LOCUS_07300 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDQ7:glucose-6-phosphate isomerase 1168 2883 gene locus_tag LOCUS_07310 1168 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 3156 5387 gene locus_tag LOCUS_07320 3156 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5452 6807 gene locus_tag LOCUS_07330 gene suc1 5452 6807 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037603.1 protein_id gnl|my_center|LOCUS_07330 6873 9884 gene locus_tag LOCUS_07340 6873 9884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 9920 10501 gene locus_tag LOCUS_07350 9920 10501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 10578 10865 gene locus_tag LOCUS_07360 10578 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 12136 10862 gene locus_tag LOCUS_07370 12136 10862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 protein_id gnl|my_center|LOCUS_07370 12177 13244 gene locus_tag LOCUS_07380 12177 13244 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202022.1 protein_id gnl|my_center|LOCUS_07380 13241 14215 gene locus_tag LOCUS_07390 13241 14215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence042 3 1907 gene locus_tag LOCUS_07400 3 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2265 1882 gene locus_tag LOCUS_07410 2265 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_07410 2815 2276 gene locus_tag LOCUS_07420 2815 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 2906 3709 gene locus_tag LOCUS_07430 2906 3709 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 protein_id gnl|my_center|LOCUS_07430 3706 4446 gene locus_tag LOCUS_07440 3706 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962886.1 protein_id gnl|my_center|LOCUS_07440 5445 4609 gene locus_tag LOCUS_07450 gene mvaB 5445 4609 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_07450 5582 5836 gene locus_tag LOCUS_07460 5582 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 6739 5762 gene locus_tag LOCUS_07470 6739 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 8460 7393 gene locus_tag LOCUS_07480 8460 7393 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_07480 10007 8457 gene locus_tag LOCUS_07490 10007 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 10058 12295 gene locus_tag LOCUS_07500 10058 12295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 <14299 12372 gene locus_tag LOCUS_07510 <14299 12372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861071.1:spore coat protein >Feature sequence043 2092 335 gene locus_tag LOCUS_07520 gene aspS 2092 335 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 protein_id gnl|my_center|LOCUS_07520 2310 3851 gene locus_tag LOCUS_07530 gene pccB 2310 3851 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 protein_id gnl|my_center|LOCUS_07530 4915 3866 gene locus_tag LOCUS_07540 gene queA 4915 3866 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 protein_id gnl|my_center|LOCUS_07540 5778 4990 gene locus_tag LOCUS_07550 gene truB 5778 4990 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U2 protein_id gnl|my_center|LOCUS_07550 5815 6447 gene locus_tag LOCUS_07560 5815 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 9781 6431 gene locus_tag LOCUS_07570 gene mfd 9781 6431 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 protein_id gnl|my_center|LOCUS_07570 11052 10027 gene locus_tag LOCUS_07580 gene fbp 11052 10027 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87SW0 protein_id gnl|my_center|LOCUS_07580 11804 11097 gene locus_tag LOCUS_07590 gene rsmA 11804 11097 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 protein_id gnl|my_center|LOCUS_07590 12215 11895 gene locus_tag LOCUS_07600 12215 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 protein_id gnl|my_center|LOCUS_07600 >Feature sequence044 422 497 gene locus_tag LOCUS_r00010 422 497 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 63 percent of the 5S ribosomal RNA 608 1915 gene locus_tag LOCUS_07610 gene der 608 1915 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A135 protein_id gnl|my_center|LOCUS_07610 3983 1902 gene locus_tag LOCUS_07620 3983 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 4116 5405 gene locus_tag LOCUS_07630 gene metK 4116 5405 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 protein_id gnl|my_center|LOCUS_07630 5418 6941 gene locus_tag LOCUS_07640 gene dnaB 5418 6941 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 protein_id gnl|my_center|LOCUS_07640 6941 8233 gene locus_tag LOCUS_07650 6941 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_07650 8850 8275 gene locus_tag LOCUS_07660 8850 8275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9240 8989 gene locus_tag LOCUS_07670 9240 8989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9671 9237 gene locus_tag LOCUS_07680 9671 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 10900 9785 gene locus_tag LOCUS_07690 10900 9785 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 protein_id gnl|my_center|LOCUS_07690 11184 10993 gene locus_tag LOCUS_07700 11184 10993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 11210 12133 gene locus_tag LOCUS_07710 gene tgt 11210 12133 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9I0 protein_id gnl|my_center|LOCUS_07710 12159 13262 gene locus_tag LOCUS_07720 12159 13262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence045 56 526 gene locus_tag LOCUS_07730 56 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 596 2809 gene locus_tag LOCUS_07740 596 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107185.1 protein_id gnl|my_center|LOCUS_07740 2809 3519 gene locus_tag LOCUS_07750 gene trmD 2809 3519 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TM8 protein_id gnl|my_center|LOCUS_07750 3587 3940 gene locus_tag LOCUS_07760 gene rplS 3587 3940 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 protein_id gnl|my_center|LOCUS_07760 3992 4756 gene locus_tag LOCUS_07770 gene cutC 3992 4756 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEV5 protein_id gnl|my_center|LOCUS_07770 6474 4777 gene locus_tag LOCUS_07780 6474 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 7767 6538 gene locus_tag LOCUS_07790 gene hutI 7767 6538 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 protein_id gnl|my_center|LOCUS_07790 7869 8984 gene locus_tag LOCUS_07800 gene aroC 7869 8984 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_07800 9017 10435 gene locus_tag LOCUS_07810 gene gltP 9017 10435 CDS product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_07810 10432 12468 gene locus_tag LOCUS_07820 10432 12468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 12486 13067 gene locus_tag LOCUS_07830 12486 13067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence046 1262 18 gene locus_tag LOCUS_07840 1262 18 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_07840 1968 1264 gene locus_tag LOCUS_07850 1968 1264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_07850 3528 1993 gene locus_tag LOCUS_07860 gene hutH1 3528 1993 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 protein_id gnl|my_center|LOCUS_07860 3619 4935 gene locus_tag LOCUS_07870 3619 4935 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143675.1 protein_id gnl|my_center|LOCUS_07870 4932 7016 gene locus_tag LOCUS_07880 gene ymxG 4932 7016 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403997.1 protein_id gnl|my_center|LOCUS_07880 6994 7719 gene locus_tag LOCUS_07890 6994 7719 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_07890 7716 8468 gene locus_tag LOCUS_07900 gene wcaE 7716 8468 CDS product colanic acid biosynthesis glycosyltransferase WcaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097876.1 protein_id gnl|my_center|LOCUS_07900 9606 8446 gene locus_tag LOCUS_07910 9606 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 10451 9603 gene locus_tag LOCUS_07920 10451 9603 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_07920 12437 10473 gene locus_tag LOCUS_07930 12437 10473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 <13186 12456 gene locus_tag LOCUS_07940 <13186 12456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX72:dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex >Feature sequence047 <1 3217 gene locus_tag LOCUS_07950 <1 3217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070535.1:peptidase M6 3738 3283 gene locus_tag LOCUS_07960 3738 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035532.1 protein_id gnl|my_center|LOCUS_07960 5096 3735 gene locus_tag LOCUS_07970 gene rhlE 5096 3735 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 protein_id gnl|my_center|LOCUS_07970 5246 6886 gene locus_tag LOCUS_07980 gene betA 5246 6886 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_07980 8131 6890 gene locus_tag LOCUS_07990 8131 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8741 8825 gene locus_tag LOCUS_t00130 8741 8825 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 9070 9145 gene locus_tag LOCUS_t00140 9070 9145 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9291 9686 gene locus_tag LOCUS_08000 9291 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 9837 10928 gene locus_tag LOCUS_08010 9837 10928 CDS product tRNA 2-selenouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72EL0 protein_id gnl|my_center|LOCUS_08010 10939 11997 gene locus_tag LOCUS_08020 gene selD 10939 11997 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ZEK1 protein_id gnl|my_center|LOCUS_08020 12857 12225 gene locus_tag LOCUS_08030 12857 12225 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A749 protein_id gnl|my_center|LOCUS_08030 >Feature sequence048 1199 525 gene locus_tag LOCUS_08040 1199 525 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257887.1 protein_id gnl|my_center|LOCUS_08040 2067 1192 gene locus_tag LOCUS_08050 2067 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963724.1 protein_id gnl|my_center|LOCUS_08050 3067 2078 gene locus_tag LOCUS_08060 gene gapA 3067 2078 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D4Z2 protein_id gnl|my_center|LOCUS_08060 4114 3125 gene locus_tag LOCUS_08070 gene pfkA 4114 3125 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H008 protein_id gnl|my_center|LOCUS_08070 4211 4915 gene locus_tag LOCUS_08080 4211 4915 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107446.1 protein_id gnl|my_center|LOCUS_08080 4912 7752 gene locus_tag LOCUS_08090 4912 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 7749 10874 gene locus_tag LOCUS_08100 7749 10874 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202162.1 protein_id gnl|my_center|LOCUS_08100 10874 12325 gene locus_tag LOCUS_08110 10874 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 12316 12852 gene locus_tag LOCUS_08120 12316 12852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence049 6233 1302 gene locus_tag LOCUS_08130 6233 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 7423 6305 gene locus_tag LOCUS_08140 gene mauG 7423 6305 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_08140 8175 7420 gene locus_tag LOCUS_08150 8175 7420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8266 11583 gene locus_tag LOCUS_08160 8266 11583 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8W3 protein_id gnl|my_center|LOCUS_08160 12704 11592 gene locus_tag LOCUS_08170 gene gmd 12704 11592 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C5Y5 protein_id gnl|my_center|LOCUS_08170 12916 12713 gene locus_tag LOCUS_08180 12916 12713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence050 <1 932 gene locus_tag LOCUS_08190 <1 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KC68:putative cysteine ligase BshC 898 1338 gene locus_tag LOCUS_08200 898 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 protein_id gnl|my_center|LOCUS_08200 1837 1427 gene locus_tag LOCUS_08210 1837 1427 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP5 protein_id gnl|my_center|LOCUS_08210 1865 2698 gene locus_tag LOCUS_08220 gene dapD 1865 2698 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_08220 2698 3702 gene locus_tag LOCUS_08230 gene rfaF 2698 3702 CDS product ADP-heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_08230 4097 3681 gene locus_tag LOCUS_08240 4097 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4247 5362 gene locus_tag LOCUS_08250 gene dnaN 4247 5362 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 protein_id gnl|my_center|LOCUS_08250 6089 5364 gene locus_tag LOCUS_08260 6089 5364 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_08260 6186 7106 gene locus_tag LOCUS_08270 6186 7106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 7707 7099 gene locus_tag LOCUS_08280 7707 7099 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_08280 8921 7704 gene locus_tag LOCUS_08290 8921 7704 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202424.1 protein_id gnl|my_center|LOCUS_08290 8996 9229 gene locus_tag LOCUS_08300 8996 9229 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI69 protein_id gnl|my_center|LOCUS_08300 9957 9355 gene locus_tag LOCUS_08310 9957 9355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 11611 9992 gene locus_tag LOCUS_08320 11611 9992 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence051 3 449 gene locus_tag LOCUS_08330 3 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1362 460 gene locus_tag LOCUS_08340 1362 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1796 1395 gene locus_tag LOCUS_08350 1796 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 2644 1991 gene locus_tag LOCUS_08360 2644 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3268 2756 gene locus_tag LOCUS_08370 3268 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3397 4197 gene locus_tag LOCUS_08380 3397 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 7454 4176 gene locus_tag LOCUS_08390 7454 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 7679 8995 gene locus_tag LOCUS_08400 gene xseA 7679 8995 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P41 protein_id gnl|my_center|LOCUS_08400 8985 9182 gene locus_tag LOCUS_08410 8985 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence052 721 1269 gene locus_tag LOCUS_08420 721 1269 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918364.1 protein_id gnl|my_center|LOCUS_08420 5300 1350 gene locus_tag LOCUS_08430 5300 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 9030 5812 gene locus_tag LOCUS_08440 9030 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 9504 9220 gene locus_tag LOCUS_08450 9504 9220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 9939 11477 gene locus_tag LOCUS_08460 9939 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence053 1143 1772 gene locus_tag LOCUS_08470 1143 1772 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 protein_id gnl|my_center|LOCUS_08470 1785 2156 gene locus_tag LOCUS_08480 gene crcB 1785 2156 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXV4 protein_id gnl|my_center|LOCUS_08480 2168 3844 gene locus_tag LOCUS_08490 gene pafA 2168 3844 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_08490 3856 5604 gene locus_tag LOCUS_08500 3856 5604 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_08500 5630 6232 gene locus_tag LOCUS_08510 5630 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 6225 6680 gene locus_tag LOCUS_08520 6225 6680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7574 6903 gene locus_tag LOCUS_08530 7574 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_08530 7643 10576 gene locus_tag LOCUS_08540 gene secDF 7643 10576 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962693.1 protein_id gnl|my_center|LOCUS_08540 10748 12148 gene locus_tag LOCUS_08550 10748 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence054 164 1540 gene locus_tag LOCUS_08560 164 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 1955 1500 gene locus_tag LOCUS_08570 1955 1500 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962822.1 protein_id gnl|my_center|LOCUS_08570 1954 2616 gene locus_tag LOCUS_08580 gene pyrE 1954 2616 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 protein_id gnl|my_center|LOCUS_08580 2613 3023 gene locus_tag LOCUS_08590 2613 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 3080 3910 gene locus_tag LOCUS_08600 3080 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_08600 4698 3841 gene locus_tag LOCUS_08610 gene birA 4698 3841 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899999.1 protein_id gnl|my_center|LOCUS_08610 4746 5156 gene locus_tag LOCUS_08620 gene rsfS 4746 5156 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0L3 protein_id gnl|my_center|LOCUS_08620 5158 7137 gene locus_tag LOCUS_08630 gene ftsH 5158 7137 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YA1 protein_id gnl|my_center|LOCUS_08630 7134 7799 gene locus_tag LOCUS_08640 7134 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 7796 8440 gene locus_tag LOCUS_08650 gene psd 7796 8440 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_08650 10566 8602 gene locus_tag LOCUS_08660 10566 8602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence055 6735 2245 gene locus_tag LOCUS_08670 6735 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 6950 7023 gene locus_tag LOCUS_t00150 6950 7023 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9127 7139 gene locus_tag LOCUS_08680 9127 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 10502 9258 gene locus_tag LOCUS_08690 gene kdtA 10502 9258 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_08690 11303 10521 gene locus_tag LOCUS_08700 11303 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence056 4420 6231 gene locus_tag LOCUS_08710 4420 6231 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786603.1 protein_id gnl|my_center|LOCUS_08710 6228 6857 gene locus_tag LOCUS_08720 6228 6857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_08720 7662 6892 gene locus_tag LOCUS_08730 7662 6892 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 protein_id gnl|my_center|LOCUS_08730 7997 7698 gene locus_tag LOCUS_08740 7997 7698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 9093 7978 gene locus_tag LOCUS_08750 gene recF 9093 7978 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 protein_id gnl|my_center|LOCUS_08750 9244 9927 gene locus_tag LOCUS_08760 9244 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785232.1 protein_id gnl|my_center|LOCUS_08760 9927 10415 gene locus_tag LOCUS_08770 gene ribH 9927 10415 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 protein_id gnl|my_center|LOCUS_08770 >Feature sequence057 1807 2070 gene locus_tag LOCUS_08780 1807 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2484 2101 gene locus_tag LOCUS_08790 2484 2101 CDS product RNA-binding protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963561.1 protein_id gnl|my_center|LOCUS_08790 2919 2491 gene locus_tag LOCUS_08800 2919 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4198 3107 gene locus_tag LOCUS_08810 4198 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08810 4325 4714 gene locus_tag LOCUS_08820 gene rpsF 4325 4714 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 protein_id gnl|my_center|LOCUS_08820 4735 5001 gene locus_tag LOCUS_08830 gene rpsR 4735 5001 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P2 protein_id gnl|my_center|LOCUS_08830 5023 5469 gene locus_tag LOCUS_08840 gene rplI 5023 5469 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S7 protein_id gnl|my_center|LOCUS_08840 5599 7653 gene locus_tag LOCUS_08850 gene uvrB 5599 7653 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY25 protein_id gnl|my_center|LOCUS_08850 7710 10013 gene locus_tag LOCUS_08860 7710 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 10013 10405 gene locus_tag LOCUS_08870 10013 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 10528 11160 gene locus_tag LOCUS_08880 gene sigW 10528 11160 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_08880 >Feature sequence058 <1 775 gene locus_tag LOCUS_08890 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963194.1:short-chain dehydrogenase/reductase 786 2342 gene locus_tag LOCUS_08900 gene accC 786 2342 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_08900 2374 2988 gene locus_tag LOCUS_08910 2374 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3095 3664 gene locus_tag LOCUS_08920 3095 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_08920 3661 4320 gene locus_tag LOCUS_08930 3661 4320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4317 5369 gene locus_tag LOCUS_08940 4317 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5388 5588 gene locus_tag LOCUS_08950 5388 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 5598 6002 gene locus_tag LOCUS_08960 5598 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 5981 8821 gene locus_tag LOCUS_08970 5981 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 8814 9542 gene locus_tag LOCUS_08980 8814 9542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 9840 9559 gene locus_tag LOCUS_08990 9840 9559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9742 10050 gene locus_tag LOCUS_09000 9742 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 10896 10180 gene locus_tag LOCUS_09010 10896 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence059 2338 1400 gene locus_tag LOCUS_09020 2338 1400 CDS product prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_09020 3307 2357 gene locus_tag LOCUS_09030 gene aspG 3307 2357 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 protein_id gnl|my_center|LOCUS_09030 5595 3367 gene locus_tag LOCUS_09040 5595 3367 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_09040 6571 5765 gene locus_tag LOCUS_09050 6571 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053466.1 protein_id gnl|my_center|LOCUS_09050 7039 6803 gene locus_tag LOCUS_09060 7039 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 7469 8479 gene locus_tag LOCUS_09070 7469 8479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9840 9364 gene locus_tag LOCUS_09080 gene tspO 9840 9364 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_09080 10086 9871 gene locus_tag LOCUS_09090 10086 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 10906 10319 gene locus_tag LOCUS_09100 10906 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence060 61 993 gene locus_tag LOCUS_09110 61 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1047 1421 gene locus_tag LOCUS_09120 gene rplL 1047 1421 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A468 protein_id gnl|my_center|LOCUS_09120 1565 5389 gene locus_tag LOCUS_09130 gene rpoB 1565 5389 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU0 protein_id gnl|my_center|LOCUS_09130 5424 9788 gene locus_tag LOCUS_09140 gene rpoC 5424 9788 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NJ8 protein_id gnl|my_center|LOCUS_09140 >Feature sequence061 <1 1379 gene locus_tag LOCUS_09150 <1 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405126.1:glycosyl hydrolase 1874 1428 gene locus_tag LOCUS_09160 1874 1428 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_09160 1888 2100 gene locus_tag LOCUS_09170 1888 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2097 2369 gene locus_tag LOCUS_09180 gene hupB 2097 2369 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964108.1 protein_id gnl|my_center|LOCUS_09180 2480 3169 gene locus_tag LOCUS_09190 gene trmH 2480 3169 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_09190 3156 4490 gene locus_tag LOCUS_09200 3156 4490 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107339.1 protein_id gnl|my_center|LOCUS_09200 4570 5532 gene locus_tag LOCUS_09210 gene fmt 4570 5532 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PD6 protein_id gnl|my_center|LOCUS_09210 8905 5546 gene locus_tag LOCUS_09220 8905 5546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 8988 9491 gene locus_tag LOCUS_09230 8988 9491 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KQ94 protein_id gnl|my_center|LOCUS_09230 9472 10419 gene locus_tag LOCUS_09240 9472 10419 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence062 287 601 gene locus_tag LOCUS_09250 287 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 612 1541 gene locus_tag LOCUS_09260 612 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1598 3058 gene locus_tag LOCUS_09270 1598 3058 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786127.1 protein_id gnl|my_center|LOCUS_09270 3058 5919 gene locus_tag LOCUS_09280 gene uvrA2 3058 5919 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_09280 5958 6653 gene locus_tag LOCUS_09290 5958 6653 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 protein_id gnl|my_center|LOCUS_09290 6672 7082 gene locus_tag LOCUS_09300 6672 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 7112 8080 gene locus_tag LOCUS_09310 7112 8080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 8196 10202 gene locus_tag LOCUS_09320 gene htpG 8196 10202 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 protein_id gnl|my_center|LOCUS_09320 >Feature sequence063 803 27 gene locus_tag LOCUS_09330 gene surE 803 27 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 protein_id gnl|my_center|LOCUS_09330 2281 800 gene locus_tag LOCUS_09340 gene pepD 2281 800 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 protein_id gnl|my_center|LOCUS_09340 6430 2318 gene locus_tag LOCUS_09350 6430 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 8958 6505 gene locus_tag LOCUS_09360 8958 6505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence064 <1 583 gene locus_tag LOCUS_09370 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538117.1:di-heme enzyme 593 2251 gene locus_tag LOCUS_09380 593 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 2248 4845 gene locus_tag LOCUS_09390 2248 4845 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_09390 4868 5407 gene locus_tag LOCUS_09400 4868 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5415 5945 gene locus_tag LOCUS_09410 5415 5945 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_09410 6017 6595 gene locus_tag LOCUS_09420 6017 6595 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896521.1 protein_id gnl|my_center|LOCUS_09420 6624 7019 gene locus_tag LOCUS_09430 6624 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 7152 7226 gene locus_tag LOCUS_t00160 7152 7226 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence065 124 1083 gene locus_tag LOCUS_09440 124 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 1599 1114 gene locus_tag LOCUS_09450 1599 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1919 1599 gene locus_tag LOCUS_09460 1919 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4593 1966 gene locus_tag LOCUS_09470 4593 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 5017 4619 gene locus_tag LOCUS_09480 5017 4619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 5362 5436 gene locus_tag LOCUS_t00170 5362 5436 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5513 6082 gene locus_tag LOCUS_09490 5513 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 protein_id gnl|my_center|LOCUS_09490 6905 6123 gene locus_tag LOCUS_09500 6905 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 7826 6936 gene locus_tag LOCUS_09510 7826 6936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 8170 7823 gene locus_tag LOCUS_09520 gene fdx1 8170 7823 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_09520 8250 9287 gene locus_tag LOCUS_09530 8250 9287 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence066 21 443 gene locus_tag LOCUS_09540 21 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 453 1118 gene locus_tag LOCUS_09550 gene tal 453 1118 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 protein_id gnl|my_center|LOCUS_09550 1162 1536 gene locus_tag LOCUS_09560 1162 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1582 2544 gene locus_tag LOCUS_09570 1582 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2541 3971 gene locus_tag LOCUS_09580 2541 3971 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_09580 4159 5220 gene locus_tag LOCUS_09590 4159 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5240 5857 gene locus_tag LOCUS_09600 5240 5857 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 protein_id gnl|my_center|LOCUS_09600 5969 6505 gene locus_tag LOCUS_09610 gene aroK 5969 6505 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2B2 protein_id gnl|my_center|LOCUS_09610 7059 6538 gene locus_tag LOCUS_09620 gene pyrR2 7059 6538 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 protein_id gnl|my_center|LOCUS_09620 8558 7056 gene locus_tag LOCUS_09630 8558 7056 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J51 protein_id gnl|my_center|LOCUS_09630 8622 9512 gene locus_tag LOCUS_09640 8622 9512 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122002.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence067 160 2379 gene locus_tag LOCUS_09650 160 2379 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_09650 2399 3727 gene locus_tag LOCUS_09660 2399 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4099 3728 gene locus_tag LOCUS_09670 4099 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 6313 4127 gene locus_tag LOCUS_09680 6313 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6502 8049 gene locus_tag LOCUS_09690 gene asnB 6502 8049 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000337015.1 protein_id gnl|my_center|LOCUS_09690 8539 8051 gene locus_tag LOCUS_09700 gene cdd 8539 8051 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_09700 8696 10138 gene locus_tag LOCUS_09710 8696 10138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence068 1855 3099 gene locus_tag LOCUS_09720 1855 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 3361 3152 gene locus_tag LOCUS_09730 3361 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 3486 3809 gene locus_tag LOCUS_09740 3486 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 4584 3832 gene locus_tag LOCUS_09750 4584 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 4706 5683 gene locus_tag LOCUS_09760 4706 5683 CDS product putative GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63578 protein_id gnl|my_center|LOCUS_09760 5686 6510 gene locus_tag LOCUS_09770 5686 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 7897 6533 gene locus_tag LOCUS_09780 gene hisS 7897 6533 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QS2 protein_id gnl|my_center|LOCUS_09780 8635 7937 gene locus_tag LOCUS_09790 gene ung 8635 7937 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XXA1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence069 1158 1739 gene locus_tag LOCUS_09800 gene adk 1158 1739 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 protein_id gnl|my_center|LOCUS_09800 1744 2754 gene locus_tag LOCUS_09810 gene obg 1744 2754 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZI9 protein_id gnl|my_center|LOCUS_09810 3158 5560 gene locus_tag LOCUS_09820 3158 5560 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_09820 5557 5847 gene locus_tag LOCUS_09830 5557 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 5966 8815 gene locus_tag LOCUS_09840 5966 8815 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence070 2528 1563 gene locus_tag LOCUS_09850 2528 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2551 2745 gene locus_tag LOCUS_09860 2551 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2765 3709 gene locus_tag LOCUS_09870 gene mdh 2765 3709 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_09870 6086 3714 gene locus_tag LOCUS_09880 6086 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6474 6088 gene locus_tag LOCUS_09890 6474 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7140 8624 gene locus_tag LOCUS_09900 gene pckA1 7140 8624 CDS product phosphoenolpyruvate carboxykinase [ATP] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKS7 protein_id gnl|my_center|LOCUS_09900 8676 9410 gene locus_tag LOCUS_09910 8676 9410 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_09910 9460 9777 gene locus_tag LOCUS_09920 9460 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 10045 9770 gene locus_tag LOCUS_09930 10045 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence071 1494 1700 gene locus_tag LOCUS_09940 1494 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1852 2610 gene locus_tag LOCUS_09950 1852 2610 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880595.1 protein_id gnl|my_center|LOCUS_09950 2607 3893 gene locus_tag LOCUS_09960 2607 3893 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706241.1 protein_id gnl|my_center|LOCUS_09960 4363 3926 gene locus_tag LOCUS_09970 4363 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 4473 5672 gene locus_tag LOCUS_09980 4473 5672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 6420 5662 gene locus_tag LOCUS_09990 6420 5662 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_09990 7611 6433 gene locus_tag LOCUS_10000 7611 6433 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 protein_id gnl|my_center|LOCUS_10000 8720 7806 gene locus_tag LOCUS_10010 8720 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 8949 9410 gene locus_tag LOCUS_10020 8949 9410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence072 383 829 gene locus_tag LOCUS_10030 383 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_10030 826 1656 gene locus_tag LOCUS_10040 826 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1538 2410 gene locus_tag LOCUS_10050 1538 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3561 2374 gene locus_tag LOCUS_10060 3561 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 8090 3558 gene locus_tag LOCUS_10070 8090 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 8865 8116 gene locus_tag LOCUS_10080 8865 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 <9881 9024 gene locus_tag LOCUS_10090 <9881 9024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B6P0:histidine kinase >Feature sequence073 1541 330 gene locus_tag LOCUS_10100 gene purT 1541 330 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDJ0 protein_id gnl|my_center|LOCUS_10100 1764 3020 gene locus_tag LOCUS_10110 1764 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 3038 5125 gene locus_tag LOCUS_10120 3038 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5122 6120 gene locus_tag LOCUS_10130 5122 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 7528 6137 gene locus_tag LOCUS_10140 gene mauG 7528 6137 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084368.1 protein_id gnl|my_center|LOCUS_10140 9539 7716 gene locus_tag LOCUS_10150 9539 7716 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence074 516 589 gene locus_tag LOCUS_t00180 516 589 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 667 1788 gene locus_tag LOCUS_10160 667 1788 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0P6 protein_id gnl|my_center|LOCUS_10160 1816 2805 gene locus_tag LOCUS_10170 gene lpxD 1816 2805 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCQ3 protein_id gnl|my_center|LOCUS_10170 2811 4241 gene locus_tag LOCUS_10180 gene lpxC/fabZ 2811 4241 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A015 protein_id gnl|my_center|LOCUS_10180 4241 5038 gene locus_tag LOCUS_10190 gene lpxA 4241 5038 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 protein_id gnl|my_center|LOCUS_10190 5094 5711 gene locus_tag LOCUS_10200 5094 5711 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887051.1 protein_id gnl|my_center|LOCUS_10200 5882 7162 gene locus_tag LOCUS_10210 5882 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8550 7267 gene locus_tag LOCUS_10220 8550 7267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107406.1 protein_id gnl|my_center|LOCUS_10220 8956 8615 gene locus_tag LOCUS_10230 8956 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence075 1697 651 gene locus_tag LOCUS_10240 1697 651 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_10240 1945 1694 gene locus_tag LOCUS_10250 1945 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 1838 2062 gene locus_tag LOCUS_10260 1838 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 2111 3058 gene locus_tag LOCUS_10270 gene fjo11 2111 3058 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_10270 3127 3642 gene locus_tag LOCUS_10280 3127 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 3646 3909 gene locus_tag LOCUS_10290 gene rpmA 3646 3909 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XL7 protein_id gnl|my_center|LOCUS_10290 4047 5315 gene locus_tag LOCUS_10300 gene serS 4047 5315 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 protein_id gnl|my_center|LOCUS_10300 5312 5899 gene locus_tag LOCUS_10310 5312 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 5970 7745 gene locus_tag LOCUS_10320 5970 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 8529 7747 gene locus_tag LOCUS_10330 8529 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9116 8673 gene locus_tag LOCUS_10340 9116 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence076 466 3219 gene locus_tag LOCUS_10350 gene leuS 466 3219 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A329 protein_id gnl|my_center|LOCUS_10350 >Feature sequence077 1280 2038 gene locus_tag LOCUS_10360 1280 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 2675 2052 gene locus_tag LOCUS_10370 2675 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2731 5850 gene locus_tag LOCUS_10380 2731 5850 CDS product periplasmic amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073037.1 protein_id gnl|my_center|LOCUS_10380 5850 7169 gene locus_tag LOCUS_10390 5850 7169 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118166.1 protein_id gnl|my_center|LOCUS_10390 8309 7197 gene locus_tag LOCUS_10400 8309 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9322 8336 gene locus_tag LOCUS_10410 gene trpS 9322 8336 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence078 487 1479 gene locus_tag LOCUS_10420 gene rpoA 487 1479 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 protein_id gnl|my_center|LOCUS_10420 1499 2101 gene locus_tag LOCUS_10430 1499 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2204 3340 gene locus_tag LOCUS_10440 gene carA 2204 3340 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 protein_id gnl|my_center|LOCUS_10440 3327 4610 gene locus_tag LOCUS_10450 gene eno 3327 4610 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0DM31 protein_id gnl|my_center|LOCUS_10450 6558 4630 gene locus_tag LOCUS_10460 6558 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7469 6570 gene locus_tag LOCUS_10470 7469 6570 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_10470 9649 7478 gene locus_tag LOCUS_10480 9649 7478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence079 862 407 gene locus_tag LOCUS_10490 862 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1077 2408 gene locus_tag LOCUS_10500 1077 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 4017 2665 gene locus_tag LOCUS_10510 4017 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 5387 4623 gene locus_tag LOCUS_10520 5387 4623 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_10520 6928 5780 gene locus_tag LOCUS_10530 6928 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 8251 7097 gene locus_tag LOCUS_10540 8251 7097 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078027.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence080 <1 1805 gene locus_tag LOCUS_10550 <1 1805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964486.1:peptidase M1 1839 2402 gene locus_tag LOCUS_10560 1839 2402 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087070.1 protein_id gnl|my_center|LOCUS_10560 2417 4321 gene locus_tag LOCUS_10570 gene pepN 2417 4321 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_10570 8095 4325 gene locus_tag LOCUS_10580 8095 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence081 <1 955 gene locus_tag LOCUS_10590 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962548.1:quinol:cytochrome C oxidoreductase 975 2453 gene locus_tag LOCUS_10600 975 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 2477 4228 gene locus_tag LOCUS_10610 gene ctaD 2477 4228 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_10610 4303 5349 gene locus_tag LOCUS_10620 gene ruvB 4303 5349 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 protein_id gnl|my_center|LOCUS_10620 5351 6322 gene locus_tag LOCUS_10630 gene queG 5351 6322 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_10630 6641 6354 gene locus_tag LOCUS_10640 6641 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6744 7784 gene locus_tag LOCUS_10650 6744 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 8424 7792 gene locus_tag LOCUS_10660 8424 7792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence082 41 1147 gene locus_tag LOCUS_10670 41 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1317 1601 gene locus_tag LOCUS_10680 1317 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 1601 2569 gene locus_tag LOCUS_10690 gene yrbG 1601 2569 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_10690 2582 3397 gene locus_tag LOCUS_10700 gene panB 2582 3397 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 protein_id gnl|my_center|LOCUS_10700 3397 4149 gene locus_tag LOCUS_10710 3397 4149 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_10710 4283 5236 gene locus_tag LOCUS_10720 gene trxB1 4283 5236 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 protein_id gnl|my_center|LOCUS_10720 5236 6003 gene locus_tag LOCUS_10730 5236 6003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 7141 6029 gene locus_tag LOCUS_10740 7141 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7195 7269 gene locus_tag LOCUS_t00190 7195 7269 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7534 8298 gene locus_tag LOCUS_10750 7534 8298 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 protein_id gnl|my_center|LOCUS_10750 <8983 8300 gene locus_tag LOCUS_10760 <8983 8300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791183.1:endonuclease >Feature sequence083 837 2921 gene locus_tag LOCUS_10770 837 2921 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201930.1 protein_id gnl|my_center|LOCUS_10770 2936 3727 gene locus_tag LOCUS_10780 2936 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4565 3873 gene locus_tag LOCUS_10790 4565 3873 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 protein_id gnl|my_center|LOCUS_10790 4762 4562 gene locus_tag LOCUS_10800 4762 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 5833 4865 gene locus_tag LOCUS_10810 5833 4865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 6022 8070 gene locus_tag LOCUS_10820 6022 8070 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186481.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence084 298 882 gene locus_tag LOCUS_10830 298 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1926 844 gene locus_tag LOCUS_10840 1926 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 6072 1936 gene locus_tag LOCUS_10850 6072 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 6208 7266 gene locus_tag LOCUS_10860 gene tsaD 6208 7266 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_10860 7729 7298 gene locus_tag LOCUS_10870 7729 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 8573 7830 gene locus_tag LOCUS_10880 8573 7830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 >Feature sequence085 626 120 gene locus_tag LOCUS_10890 626 120 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_10890 1663 629 gene locus_tag LOCUS_10900 gene pdxA 1663 629 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 protein_id gnl|my_center|LOCUS_10900 1699 4428 gene locus_tag LOCUS_10910 1699 4428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 4439 5062 gene locus_tag LOCUS_10920 gene ribE 4439 5062 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_10920 5820 5068 gene locus_tag LOCUS_10930 gene lptB 5820 5068 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_10930 6656 5817 gene locus_tag LOCUS_10940 gene tatC 6656 5817 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 protein_id gnl|my_center|LOCUS_10940 7619 6669 gene locus_tag LOCUS_10950 gene kdsD 7619 6669 CDS product D-arabinose 5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963366.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence086 1611 3317 gene locus_tag LOCUS_10960 1611 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3461 5428 gene locus_tag LOCUS_10970 gene gyrB 3461 5428 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 protein_id gnl|my_center|LOCUS_10970 6211 5441 gene locus_tag LOCUS_10980 gene ste14 6211 5441 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_10980 7346 6243 gene locus_tag LOCUS_10990 7346 6243 CDS product RND transporter MFP subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763619.1 protein_id gnl|my_center|LOCUS_10990 8613 7348 gene locus_tag LOCUS_11000 8613 7348 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_11000 8882 8643 gene locus_tag LOCUS_11010 8882 8643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence087 574 206 gene locus_tag LOCUS_11020 gene folB 574 206 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 protein_id gnl|my_center|LOCUS_11020 2025 574 gene locus_tag LOCUS_11030 gene gltX 2025 574 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI3 protein_id gnl|my_center|LOCUS_11030 2903 2175 gene locus_tag LOCUS_11040 2903 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4178 2982 gene locus_tag LOCUS_11050 4178 2982 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_11050 4840 4175 gene locus_tag LOCUS_11060 4840 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4956 5303 gene locus_tag LOCUS_11070 4956 5303 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 protein_id gnl|my_center|LOCUS_11070 5388 6089 gene locus_tag LOCUS_11080 gene sdhC 5388 6089 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 protein_id gnl|my_center|LOCUS_11080 6094 8091 gene locus_tag LOCUS_11090 gene sdhA 6094 8091 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 protein_id gnl|my_center|LOCUS_11090 8097 8849 gene locus_tag LOCUS_11100 gene sdhB 8097 8849 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence088 1656 1135 gene locus_tag LOCUS_11110 1656 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3273 1804 gene locus_tag LOCUS_11120 3273 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3493 4188 gene locus_tag LOCUS_11130 3493 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4199 6469 gene locus_tag LOCUS_11140 gene maeB 4199 6469 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 protein_id gnl|my_center|LOCUS_11140 6466 7074 gene locus_tag LOCUS_11150 gene ruvA 6466 7074 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PZ9 protein_id gnl|my_center|LOCUS_11150 >Feature sequence089 4030 2120 gene locus_tag LOCUS_11160 gene dnaK 4030 2120 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X01 protein_id gnl|my_center|LOCUS_11160 4344 5420 gene locus_tag LOCUS_11170 gene wlbA 4344 5420 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_11170 6339 5410 gene locus_tag LOCUS_11180 6339 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 7153 6449 gene locus_tag LOCUS_11190 7153 6449 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768051.1 protein_id gnl|my_center|LOCUS_11190 7451 7167 gene locus_tag LOCUS_11200 7451 7167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 8680 7532 gene locus_tag LOCUS_11210 8680 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence090 296 18 gene locus_tag LOCUS_11220 296 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence091 683 2278 gene locus_tag LOCUS_11230 683 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2964 2275 gene locus_tag LOCUS_11240 gene ktrA 2964 2275 CDS product potassium transporter Trk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289151.1 protein_id gnl|my_center|LOCUS_11240 4286 2994 gene locus_tag LOCUS_11250 gene kynU 4286 2994 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 protein_id gnl|my_center|LOCUS_11250 4926 4297 gene locus_tag LOCUS_11260 4926 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 5159 8005 gene locus_tag LOCUS_11270 gene gcvP 5159 8005 CDS product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 protein_id gnl|my_center|LOCUS_11270 >Feature sequence092 1577 2509 gene locus_tag LOCUS_11280 1577 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2527 5547 gene locus_tag LOCUS_11290 2527 5547 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787151.1 protein_id gnl|my_center|LOCUS_11290 5553 7745 gene locus_tag LOCUS_11300 5553 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7916 7752 gene locus_tag LOCUS_11310 7916 7752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence093 466 1416 gene locus_tag LOCUS_11320 gene serA 466 1416 CDS product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_11320 1425 2681 gene locus_tag LOCUS_11330 1425 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990082.1 protein_id gnl|my_center|LOCUS_11330 2685 3344 gene locus_tag LOCUS_11340 2685 3344 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_11340 4599 3436 gene locus_tag LOCUS_11350 gene solA 4599 3436 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_11350 5585 4596 gene locus_tag LOCUS_11360 5585 4596 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_11360 8267 5814 gene locus_tag LOCUS_11370 gene priA 8267 5814 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 protein_id gnl|my_center|LOCUS_11370 >Feature sequence094 210 136 gene locus_tag LOCUS_t00200 210 136 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2432 264 gene locus_tag LOCUS_11380 gene rnr 2432 264 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A378 protein_id gnl|my_center|LOCUS_11380 2553 2792 gene locus_tag LOCUS_11390 2553 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2808 3704 gene locus_tag LOCUS_11400 2808 3704 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_11400 3772 5085 gene locus_tag LOCUS_11410 gene pepP 3772 5085 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_11410 5082 5669 gene locus_tag LOCUS_11420 gene miaE 5082 5669 CDS product tRNA 2-methylthio-N6-isopentenyl adenosine(37) hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_11420 5662 6921 gene locus_tag LOCUS_11430 5662 6921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 6923 7354 gene locus_tag LOCUS_11440 6923 7354 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence095 348 1622 gene locus_tag LOCUS_11450 gene tyrS 348 1622 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2S5 protein_id gnl|my_center|LOCUS_11450 2718 1648 gene locus_tag LOCUS_11460 2718 1648 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 protein_id gnl|my_center|LOCUS_11460 2839 3243 gene locus_tag LOCUS_11470 2839 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 7870 3272 gene locus_tag LOCUS_11480 7870 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence096 689 901 gene locus_tag LOCUS_11490 689 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1036 2301 gene locus_tag LOCUS_11500 1036 2301 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_11500 4953 2302 gene locus_tag LOCUS_11510 4953 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 <8114 5102 gene locus_tag LOCUS_11520 <8114 5102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence097 499 1515 gene locus_tag LOCUS_11530 499 1515 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_11530 1548 2084 gene locus_tag LOCUS_11540 1548 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4052 2205 gene locus_tag LOCUS_11550 4052 2205 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654981.1 protein_id gnl|my_center|LOCUS_11550 6484 4112 gene locus_tag LOCUS_11560 6484 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 6888 6481 gene locus_tag LOCUS_11570 6888 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence098 1936 2673 gene locus_tag LOCUS_11580 gene recO 1936 2673 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB0 protein_id gnl|my_center|LOCUS_11580 2687 5050 gene locus_tag LOCUS_11590 2687 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 protein_id gnl|my_center|LOCUS_11590 5137 6189 gene locus_tag LOCUS_11600 5137 6189 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799206.1 protein_id gnl|my_center|LOCUS_11600 6189 6677 gene locus_tag LOCUS_11610 6189 6677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 7080 6664 gene locus_tag LOCUS_11620 7080 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 7329 7102 gene locus_tag LOCUS_11630 7329 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence099 <1 2007 gene locus_tag LOCUS_11640 <1 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031412.1:NADPH-dependent 2,4-dienoyl-CoA reductase 3147 2011 gene locus_tag LOCUS_11650 3147 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3341 4567 gene locus_tag LOCUS_11660 3341 4567 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405434.1 protein_id gnl|my_center|LOCUS_11660 5079 6020 gene locus_tag LOCUS_11670 5079 6020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 7790 6105 gene locus_tag LOCUS_11680 gene pruA 7790 6105 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence100 322 1914 gene locus_tag LOCUS_11690 322 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1919 3820 gene locus_tag LOCUS_11700 1919 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 3958 6372 gene locus_tag LOCUS_11710 3958 6372 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_11710 7125 6388 gene locus_tag LOCUS_11720 7125 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence101 959 306 gene locus_tag LOCUS_11730 gene actE 959 306 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 protein_id gnl|my_center|LOCUS_11730 1498 959 gene locus_tag LOCUS_11740 gene actD 1498 959 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 protein_id gnl|my_center|LOCUS_11740 2886 1501 gene locus_tag LOCUS_11750 gene actC 2886 1501 CDS product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_11750 6036 2890 gene locus_tag LOCUS_11760 gene actB 6036 2890 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 protein_id gnl|my_center|LOCUS_11760 7514 6084 gene locus_tag LOCUS_11770 gene actA 7514 6084 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence102 1828 4362 gene locus_tag LOCUS_11780 gene gyrA 1828 4362 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 protein_id gnl|my_center|LOCUS_11780 4386 5618 gene locus_tag LOCUS_11790 4386 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6511 6071 gene locus_tag LOCUS_11800 6511 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6983 7636 gene locus_tag LOCUS_11810 6983 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence103 1889 1275 gene locus_tag LOCUS_11820 1889 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2054 2473 gene locus_tag LOCUS_11830 gene ndk 2054 2473 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 protein_id gnl|my_center|LOCUS_11830 2470 3699 gene locus_tag LOCUS_11840 gene icd 2470 3699 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R4 protein_id gnl|my_center|LOCUS_11840 5190 3703 gene locus_tag LOCUS_11850 5190 3703 CDS product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 protein_id gnl|my_center|LOCUS_11850 5265 6149 gene locus_tag LOCUS_11860 5265 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 6244 6993 gene locus_tag LOCUS_11870 6244 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 7024 7563 gene locus_tag LOCUS_11880 7024 7563 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence104 960 253 gene locus_tag LOCUS_11890 gene rprY 960 253 CDS product transcriptional regulatory protein RprY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9AE24 protein_id gnl|my_center|LOCUS_11890 2225 957 gene locus_tag LOCUS_11900 2225 957 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963526.1 protein_id gnl|my_center|LOCUS_11900 2315 3145 gene locus_tag LOCUS_11910 2315 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 3225 3932 gene locus_tag LOCUS_11920 3225 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_11920 3945 5252 gene locus_tag LOCUS_11930 gene murA 3945 5252 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 protein_id gnl|my_center|LOCUS_11930 5292 5882 gene locus_tag LOCUS_11940 5292 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 5937 6509 gene locus_tag LOCUS_11950 gene grpE 5937 6509 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 protein_id gnl|my_center|LOCUS_11950 6516 7631 gene locus_tag LOCUS_11960 gene dnaJ 6516 7631 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence105 1105 1569 gene locus_tag LOCUS_11970 1105 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1577 2134 gene locus_tag LOCUS_11980 1577 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2121 2615 gene locus_tag LOCUS_11990 2121 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2774 7219 gene locus_tag LOCUS_12000 2774 7219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence106 399 1223 gene locus_tag LOCUS_12010 399 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 1247 2530 gene locus_tag LOCUS_12020 gene ftsA 1247 2530 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 protein_id gnl|my_center|LOCUS_12020 2650 4470 gene locus_tag LOCUS_12030 gene ftsZ 2650 4470 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H191 protein_id gnl|my_center|LOCUS_12030 4472 4930 gene locus_tag LOCUS_12040 4472 4930 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 protein_id gnl|my_center|LOCUS_12040 4966 5421 gene locus_tag LOCUS_12050 4966 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 6225 5449 gene locus_tag LOCUS_12060 6225 5449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 6539 6222 gene locus_tag LOCUS_12070 6539 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 7151 6567 gene locus_tag LOCUS_12080 7151 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 <7699 7151 gene locus_tag LOCUS_12090 <7699 7151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 >Feature sequence107 1231 524 gene locus_tag LOCUS_12100 1231 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 1412 3373 gene locus_tag LOCUS_12110 gene thrS 1412 3373 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VP2 protein_id gnl|my_center|LOCUS_12110 3419 3940 gene locus_tag LOCUS_12120 gene infC 3419 3940 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAP1 protein_id gnl|my_center|LOCUS_12120 3977 4171 gene locus_tag LOCUS_12130 gene rpmI 3977 4171 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY20 protein_id gnl|my_center|LOCUS_12130 4310 4597 gene locus_tag LOCUS_12140 gene rplT 4310 4597 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 protein_id gnl|my_center|LOCUS_12140 5764 4709 gene locus_tag LOCUS_12150 5764 4709 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_12150 6885 5782 gene locus_tag LOCUS_12160 gene recA 6885 5782 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S7 protein_id gnl|my_center|LOCUS_12160 7460 6996 gene locus_tag LOCUS_12170 gene bcp 7460 6996 CDS product putative peroxiredoxin bcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0AE55 protein_id gnl|my_center|LOCUS_12170 >Feature sequence108 3505 2135 gene locus_tag LOCUS_12180 gene aroA 3505 2135 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q187E3 protein_id gnl|my_center|LOCUS_12180 4296 3502 gene locus_tag LOCUS_12190 gene menG 4296 3502 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XV8 protein_id gnl|my_center|LOCUS_12190 6128 4308 gene locus_tag LOCUS_12200 gene ktrB 6128 4308 CDS product ktr system potassium uptake protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32081 protein_id gnl|my_center|LOCUS_12200 7117 6125 gene locus_tag LOCUS_12210 7117 6125 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence109 <1 1285 gene locus_tag LOCUS_12220 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein 1290 2291 gene locus_tag LOCUS_12230 1290 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2330 2953 gene locus_tag LOCUS_12240 2330 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 5729 2961 gene locus_tag LOCUS_12250 gene uvrA1 5729 2961 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYM2 protein_id gnl|my_center|LOCUS_12250 6024 6626 gene locus_tag LOCUS_12260 6024 6626 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_12260 6715 6876 gene locus_tag LOCUS_12270 6715 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence110 834 1724 gene locus_tag LOCUS_12280 834 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1724 2590 gene locus_tag LOCUS_12290 gene nadE 1724 2590 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 protein_id gnl|my_center|LOCUS_12290 2657 4300 gene locus_tag LOCUS_12300 2657 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 7205 4290 gene locus_tag LOCUS_12310 7205 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence111 452 832 gene locus_tag LOCUS_12320 452 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1937 843 gene locus_tag LOCUS_12330 gene putA 1937 843 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_12330 2044 3432 gene locus_tag LOCUS_12340 2044 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_12340 3422 3934 gene locus_tag LOCUS_12350 3422 3934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 3955 7161 gene locus_tag LOCUS_12360 3955 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence112 1650 2975 gene locus_tag LOCUS_12370 gene crtI 1650 2975 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_12370 3006 3869 gene locus_tag LOCUS_12380 gene crtB 3006 3869 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_12380 3851 4375 gene locus_tag LOCUS_12390 3851 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 4642 4917 gene locus_tag LOCUS_12400 4642 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 5020 5532 gene locus_tag LOCUS_12410 gene crtZ 5020 5532 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_12410 5529 6266 gene locus_tag LOCUS_12420 5529 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 6443 6294 gene locus_tag LOCUS_12430 6443 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence113 <1 1398 gene locus_tag LOCUS_12440 <1 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0T6:GMP synthase [glutamine-hydrolyzing] 1389 2690 gene locus_tag LOCUS_12450 1389 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3393 2698 gene locus_tag LOCUS_12460 3393 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6065 3390 gene locus_tag LOCUS_12470 gene ftsK 6065 3390 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 protein_id gnl|my_center|LOCUS_12470 6394 6549 gene locus_tag LOCUS_12480 6394 6549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence114 <1 2494 gene locus_tag LOCUS_12490 <1 2494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098386.1:type I secretion C-terminal target domain-containing protein 2592 2894 gene locus_tag LOCUS_12500 2592 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 2932 3306 gene locus_tag LOCUS_12510 2932 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3499 3648 gene locus_tag LOCUS_12520 3499 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 5567 3780 gene locus_tag LOCUS_12530 gene argS 5567 3780 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3X5 protein_id gnl|my_center|LOCUS_12530 6520 5564 gene locus_tag LOCUS_12540 6520 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence115 283 1602 gene locus_tag LOCUS_12550 283 1602 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 protein_id gnl|my_center|LOCUS_12550 2325 1609 gene locus_tag LOCUS_12560 2325 1609 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727426.1 protein_id gnl|my_center|LOCUS_12560 3977 2475 gene locus_tag LOCUS_12570 gene lysS 3977 2475 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW2 protein_id gnl|my_center|LOCUS_12570 4042 5052 gene locus_tag LOCUS_12580 4042 5052 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 protein_id gnl|my_center|LOCUS_12580 4985 5803 gene locus_tag LOCUS_12590 gene lipB 4985 5803 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 protein_id gnl|my_center|LOCUS_12590 5800 6960 gene locus_tag LOCUS_12600 5800 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence116 >Feature sequence117 1157 363 gene locus_tag LOCUS_12610 1157 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 1812 1207 gene locus_tag LOCUS_12620 1812 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3175 2273 gene locus_tag LOCUS_12630 3175 2273 CDS product flavonol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963174.1 protein_id gnl|my_center|LOCUS_12630 4389 3196 gene locus_tag LOCUS_12640 4389 3196 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966338.1 protein_id gnl|my_center|LOCUS_12640 5644 4451 gene locus_tag LOCUS_12650 5644 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence118 2768 603 gene locus_tag LOCUS_12660 2768 603 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108840.1 protein_id gnl|my_center|LOCUS_12660 3181 2765 gene locus_tag LOCUS_12670 3181 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 4116 3178 gene locus_tag LOCUS_12680 gene rsmH 4116 3178 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 protein_id gnl|my_center|LOCUS_12680 4604 4116 gene locus_tag LOCUS_12690 gene mraZ 4604 4116 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 protein_id gnl|my_center|LOCUS_12690 4885 5655 gene locus_tag LOCUS_12700 gene pcbD 4885 5655 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_12700 5630 6280 gene locus_tag LOCUS_12710 gene engB 5630 6280 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 protein_id gnl|my_center|LOCUS_12710 6604 6281 gene locus_tag LOCUS_12720 6604 6281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence119 1319 405 gene locus_tag LOCUS_12730 gene prmA 1319 405 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_12730 2098 1316 gene locus_tag LOCUS_12740 gene tpiA 2098 1316 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P83 protein_id gnl|my_center|LOCUS_12740 2228 4129 gene locus_tag LOCUS_12750 gene recQ2 2228 4129 CDS product ATP-dependent DNA helicase RecQ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362014.1 protein_id gnl|my_center|LOCUS_12750 4143 5387 gene locus_tag LOCUS_12760 4143 5387 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_12760 6095 5409 gene locus_tag LOCUS_12770 gene pdxH 6095 5409 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ5 protein_id gnl|my_center|LOCUS_12770 <6885 6121 gene locus_tag LOCUS_12780 <6885 6121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022309.1:2-heptaprenyl-1,4-naphthoquinone methyltransferase >Feature sequence120 3960 4628 gene locus_tag LOCUS_12790 3960 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence121 1075 602 gene locus_tag LOCUS_12800 1075 602 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775709.1 protein_id gnl|my_center|LOCUS_12800 1114 3021 gene locus_tag LOCUS_12810 1114 3021 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962749.1 protein_id gnl|my_center|LOCUS_12810 4109 3027 gene locus_tag LOCUS_12820 gene paaK 4109 3027 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709129.1 protein_id gnl|my_center|LOCUS_12820 4193 5134 gene locus_tag LOCUS_12830 gene paaA 4193 5134 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 protein_id gnl|my_center|LOCUS_12830 5156 5443 gene locus_tag LOCUS_12840 gene paaB 5156 5443 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813296.1 protein_id gnl|my_center|LOCUS_12840 5440 6198 gene locus_tag LOCUS_12850 gene paaC 5440 6198 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813293.1 protein_id gnl|my_center|LOCUS_12850 6198 6692 gene locus_tag LOCUS_12860 gene paaD 6198 6692 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence122 1806 1495 gene locus_tag LOCUS_12870 1806 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1951 2973 gene locus_tag LOCUS_12880 1951 2973 CDS product cytochrome c4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962424.1 protein_id gnl|my_center|LOCUS_12880 2999 4099 gene locus_tag LOCUS_12890 2999 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4180 6195 gene locus_tag LOCUS_12900 4180 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 6810 6211 gene locus_tag LOCUS_12910 6810 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence123 1491 277 gene locus_tag LOCUS_12920 gene ispH 1491 277 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404617.1 protein_id gnl|my_center|LOCUS_12920 2333 1785 gene locus_tag LOCUS_12930 2333 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 3760 2375 gene locus_tag LOCUS_12940 3760 2375 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_12940 3908 5302 gene locus_tag LOCUS_12950 3908 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 5347 6666 gene locus_tag LOCUS_12960 5347 6666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence124 812 5146 gene locus_tag LOCUS_12970 gene dnaE 812 5146 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 protein_id gnl|my_center|LOCUS_12970 5249 5569 gene locus_tag LOCUS_12980 5249 5569 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA1 protein_id gnl|my_center|LOCUS_12980 5657 6586 gene locus_tag LOCUS_12990 5657 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence125 1036 2808 gene locus_tag LOCUS_13000 gene sglT 1036 2808 CDS product sodium/glucose cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_13000 2805 3860 gene locus_tag LOCUS_13010 2805 3860 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_13010 3965 4711 gene locus_tag LOCUS_13020 3965 4711 CDS product dTDP-glucose pyrophosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776793.1 protein_id gnl|my_center|LOCUS_13020 5252 4746 gene locus_tag LOCUS_13030 5252 4746 CDS product exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287061.1 protein_id gnl|my_center|LOCUS_13030 <6690 5230 gene locus_tag LOCUS_13040 <6690 5230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0N9:DNA ligase >Feature sequence126 2099 45 gene locus_tag LOCUS_13050 gene ppk 2099 45 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY90 protein_id gnl|my_center|LOCUS_13050 2170 2802 gene locus_tag LOCUS_13060 2170 2802 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_13060 3825 2896 gene locus_tag LOCUS_13070 3825 2896 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932922.1 protein_id gnl|my_center|LOCUS_13070 4428 3967 gene locus_tag LOCUS_13080 4428 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence127 2749 1307 gene locus_tag LOCUS_13090 2749 1307 CDS product L-2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404010.1 protein_id gnl|my_center|LOCUS_13090 2748 3503 gene locus_tag LOCUS_13100 2748 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3487 4128 gene locus_tag LOCUS_13110 3487 4128 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404718.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence128 1005 850 gene locus_tag LOCUS_13120 1005 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1191 1036 gene locus_tag LOCUS_13130 1191 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1429 1608 gene locus_tag LOCUS_13140 1429 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1631 3076 gene locus_tag LOCUS_13150 1631 3076 CDS product O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_13150 3076 3978 gene locus_tag LOCUS_13160 3076 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3975 6113 gene locus_tag LOCUS_13170 gene yyaL 3975 6113 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence129 1451 987 gene locus_tag LOCUS_13180 1451 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 protein_id gnl|my_center|LOCUS_13180 1670 2263 gene locus_tag LOCUS_13190 1670 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2274 3152 gene locus_tag LOCUS_13200 2274 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 <6514 3191 gene locus_tag LOCUS_13210 <6514 3191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GX63:protein translocase subunit SecA >Feature sequence130 790 2838 gene locus_tag LOCUS_13220 790 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 4678 2810 gene locus_tag LOCUS_13230 4678 2810 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404891.1 protein_id gnl|my_center|LOCUS_13230 <6505 4682 gene locus_tag LOCUS_13240 <6505 4682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962850.1:collagen-binding protein >Feature sequence131 <1 870 gene locus_tag LOCUS_13250 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962842.1:transketolase 857 2371 gene locus_tag LOCUS_13260 857 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2368 3357 gene locus_tag LOCUS_13270 gene tktC 2368 3357 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_13270 4253 3354 gene locus_tag LOCUS_13280 gene dapA 4253 3354 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C0 protein_id gnl|my_center|LOCUS_13280 4830 4276 gene locus_tag LOCUS_13290 4830 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5698 4853 gene locus_tag LOCUS_13300 5698 4853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964178.1 protein_id gnl|my_center|LOCUS_13300 6258 5695 gene locus_tag LOCUS_13310 gene mrsA 6258 5695 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 protein_id gnl|my_center|LOCUS_13310 >Feature sequence132 2612 1173 gene locus_tag LOCUS_13320 2612 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_13320 3820 2951 gene locus_tag LOCUS_13330 gene rpoD 3820 2951 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_13330 4805 3936 gene locus_tag LOCUS_13340 gene rpoD 4805 3936 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_13340 <6284 4925 gene locus_tag LOCUS_13350 <6284 4925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64N73:polyribonucleotide nucleotidyltransferase >Feature sequence133 82 3813 gene locus_tag LOCUS_13360 82 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence134 <1 950 gene locus_tag LOCUS_13370 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87RX8:DNA repair protein RecN 3304 956 gene locus_tag LOCUS_13380 3304 956 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_13380 3350 4843 gene locus_tag LOCUS_13390 gene glpK 3350 4843 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KIT3 protein_id gnl|my_center|LOCUS_13390 >Feature sequence135 2674 3564 gene locus_tag LOCUS_13400 2674 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3545 4282 gene locus_tag LOCUS_13410 gene pcrB 3545 4282 CDS product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 protein_id gnl|my_center|LOCUS_13410 5979 4279 gene locus_tag LOCUS_13420 5979 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence136 3157 263 gene locus_tag LOCUS_13430 3157 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 protein_id gnl|my_center|LOCUS_13430 3304 3438 gene locus_tag LOCUS_13440 3304 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3435 4463 gene locus_tag LOCUS_13450 gene murB 3435 4463 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZVY7 protein_id gnl|my_center|LOCUS_13450 5497 4472 gene locus_tag LOCUS_13460 5497 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence137 <1 1781 gene locus_tag LOCUS_13470 <1 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:sugar transporter 1765 3090 gene locus_tag LOCUS_13480 1765 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3087 4184 gene locus_tag LOCUS_13490 3087 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence138 2 526 gene locus_tag LOCUS_13500 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1420 545 gene locus_tag LOCUS_13510 1420 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2508 1408 gene locus_tag LOCUS_13520 gene ribD 2508 1408 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S076 protein_id gnl|my_center|LOCUS_13520 3402 2515 gene locus_tag LOCUS_13530 gene folD 3402 2515 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB7 protein_id gnl|my_center|LOCUS_13530 4769 3399 gene locus_tag LOCUS_13540 gene ffh 4769 3399 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A7C3 protein_id gnl|my_center|LOCUS_13540 >Feature sequence139 >Feature sequence140 952 2169 gene locus_tag LOCUS_13550 gene dinP 952 2169 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FZ2 protein_id gnl|my_center|LOCUS_13550 2195 3001 gene locus_tag LOCUS_13560 2195 3001 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence141 2586 1342 gene locus_tag LOCUS_13570 2586 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3521 2583 gene locus_tag LOCUS_13580 3521 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3557 4006 gene locus_tag LOCUS_13590 3557 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962689.1 protein_id gnl|my_center|LOCUS_13590 4003 4935 gene locus_tag LOCUS_13600 4003 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 4957 5409 gene locus_tag LOCUS_13610 4957 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 >Feature sequence142 2354 1137 gene locus_tag LOCUS_13620 2354 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 3032 2382 gene locus_tag LOCUS_13630 gene efp 3032 2382 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 protein_id gnl|my_center|LOCUS_13630 4996 3029 gene locus_tag LOCUS_13640 4996 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 5310 4978 gene locus_tag LOCUS_13650 5310 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence143 1428 511 gene locus_tag LOCUS_13660 1428 511 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109282.1 protein_id gnl|my_center|LOCUS_13660 1982 1425 gene locus_tag LOCUS_13670 1982 1425 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462480.1 protein_id gnl|my_center|LOCUS_13670 2796 2014 gene locus_tag LOCUS_13680 2796 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2878 3369 gene locus_tag LOCUS_13690 2878 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3460 4431 gene locus_tag LOCUS_13700 3460 4431 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence144 2093 840 gene locus_tag LOCUS_13710 gene nusA 2093 840 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 protein_id gnl|my_center|LOCUS_13710 2563 2096 gene locus_tag LOCUS_13720 2563 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 2774 5134 gene locus_tag LOCUS_13730 2774 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence145 <1 814 gene locus_tag LOCUS_13740 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339522.1:esterase 2007 811 gene locus_tag LOCUS_13750 gene argD 2007 811 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_13750 5009 2007 gene locus_tag LOCUS_13760 5009 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5710 5006 gene locus_tag LOCUS_13770 5710 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence146 2 826 gene locus_tag LOCUS_13780 2 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence147 2225 3229 gene locus_tag LOCUS_13790 2225 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence148 <1 2226 gene locus_tag LOCUS_13800 <1 2226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9RUB8:alpha-amylase 2273 3586 gene locus_tag LOCUS_13810 2273 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3623 5011 gene locus_tag LOCUS_13820 3623 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 <5676 5061 gene locus_tag LOCUS_13830 <5676 5061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036149.1:membrane protein >Feature sequence149 1042 107 gene locus_tag LOCUS_13840 gene thrB 1042 107 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P9Q0 protein_id gnl|my_center|LOCUS_13840 3515 1047 gene locus_tag LOCUS_13850 gene thrA 3515 1047 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_13850 4361 3528 gene locus_tag LOCUS_13860 4361 3528 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 protein_id gnl|my_center|LOCUS_13860 5041 4415 gene locus_tag LOCUS_13870 5041 4415 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_13870 <5603 5038 gene locus_tag LOCUS_13880 <5603 5038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962735.1:dehydrogenase >Feature sequence150 <1 1746 gene locus_tag LOCUS_13890 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391785.1:glycosyl hydrolase 4594 1757 gene locus_tag LOCUS_13900 4594 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence151 36 1319 gene locus_tag LOCUS_13910 36 1319 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_13910 2143 1304 gene locus_tag LOCUS_13920 2143 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 2814 2140 gene locus_tag LOCUS_13930 gene nth 2814 2140 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 protein_id gnl|my_center|LOCUS_13930 3011 2826 gene locus_tag LOCUS_13940 3011 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2982 3890 gene locus_tag LOCUS_13950 gene fjo19 2982 3890 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_13950 3890 4651 gene locus_tag LOCUS_13960 3890 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5111 4641 gene locus_tag LOCUS_13970 gene ptpA 5111 4641 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106924.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence152 407 1537 gene locus_tag LOCUS_13980 407 1537 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_13980 1600 3246 gene locus_tag LOCUS_13990 gene pyrG 1600 3246 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 protein_id gnl|my_center|LOCUS_13990 3821 3210 gene locus_tag LOCUS_14000 3821 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702814.1 protein_id gnl|my_center|LOCUS_14000 5067 3847 gene locus_tag LOCUS_14010 5067 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence153 2320 824 gene locus_tag LOCUS_14020 2320 824 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202708.1 protein_id gnl|my_center|LOCUS_14020 2396 2983 gene locus_tag LOCUS_14030 gene recR 2396 2983 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 protein_id gnl|my_center|LOCUS_14030 2988 4928 gene locus_tag LOCUS_14040 2988 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence154 927 754 gene locus_tag LOCUS_14050 927 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 1017 1092 gene locus_tag LOCUS_t00210 1017 1092 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1267 1518 gene locus_tag LOCUS_14060 1267 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 3541 1502 gene locus_tag LOCUS_14070 gene feoB 3541 1502 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVT6 protein_id gnl|my_center|LOCUS_14070 4767 3607 gene locus_tag LOCUS_14080 4767 3607 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404349.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence155 820 500 gene locus_tag LOCUS_14090 820 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1399 956 gene locus_tag LOCUS_14100 1399 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 1498 4242 gene locus_tag LOCUS_14110 1498 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 4303 4452 gene locus_tag LOCUS_14120 4303 4452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 4463 4873 gene locus_tag LOCUS_14130 4463 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence156 2189 807 gene locus_tag LOCUS_14140 2189 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2800 2189 gene locus_tag LOCUS_14150 2800 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_14150 2823 3620 gene locus_tag LOCUS_14160 gene folP 2823 3620 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 protein_id gnl|my_center|LOCUS_14160 3617 4408 gene locus_tag LOCUS_14170 3617 4408 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence157 119 643 gene locus_tag LOCUS_14180 119 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 668 1156 gene locus_tag LOCUS_14190 668 1156 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962472.1 protein_id gnl|my_center|LOCUS_14190 1153 1863 gene locus_tag LOCUS_14200 1153 1863 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_14200 1899 2801 gene locus_tag LOCUS_14210 1899 2801 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_14210 3402 2842 gene locus_tag LOCUS_14220 3402 2842 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176066.1 protein_id gnl|my_center|LOCUS_14220 4940 3402 gene locus_tag LOCUS_14230 4940 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 5132 5047 gene locus_tag LOCUS_t00220 5132 5047 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence158 2103 1270 gene locus_tag LOCUS_14240 2103 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_14240 2660 2100 gene locus_tag LOCUS_14250 2660 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3027 2653 gene locus_tag LOCUS_14260 3027 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3112 4131 gene locus_tag LOCUS_14270 3112 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962781.1 protein_id gnl|my_center|LOCUS_14270 <5335 4132 gene locus_tag LOCUS_14280 <5335 4132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404692.1:endonuclease >Feature sequence159 1232 588 gene locus_tag LOCUS_14290 1232 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1851 1321 gene locus_tag LOCUS_14300 1851 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 3613 1844 gene locus_tag LOCUS_14310 3613 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 4300 3800 gene locus_tag LOCUS_14320 4300 3800 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXI9 protein_id gnl|my_center|LOCUS_14320 >Feature sequence160 2441 408 gene locus_tag LOCUS_14330 gene bfmBA 2441 408 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_14330 2514 4064 gene locus_tag LOCUS_14340 2514 4064 CDS product FAD-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963361.1 protein_id gnl|my_center|LOCUS_14340 <5252 4046 gene locus_tag LOCUS_14350 <5252 4046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:membrane protein >Feature sequence161 1472 1981 gene locus_tag LOCUS_14360 1472 1981 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783639.1 protein_id gnl|my_center|LOCUS_14360 2014 2652 gene locus_tag LOCUS_14370 2014 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14370 3538 2657 gene locus_tag LOCUS_14380 gene sucD 3538 2657 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 protein_id gnl|my_center|LOCUS_14380 3537 5048 gene locus_tag LOCUS_14390 gene mnmE 3537 5048 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_14390 >Feature sequence162 112 726 gene locus_tag LOCUS_14400 gene nqrE 112 726 CDS product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS1 protein_id gnl|my_center|LOCUS_14400 736 2031 gene locus_tag LOCUS_14410 gene nqrF 736 2031 CDS product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9K0M8 protein_id gnl|my_center|LOCUS_14410 2031 3119 gene locus_tag LOCUS_14420 2031 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 3325 3122 gene locus_tag LOCUS_14430 3325 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3521 5077 gene locus_tag LOCUS_14440 3521 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence163 772 2478 gene locus_tag LOCUS_14450 772 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2666 5110 gene locus_tag LOCUS_14460 2666 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence164 <1 1369 gene locus_tag LOCUS_14470 <1 1369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein >Feature sequence165 2337 1087 gene locus_tag LOCUS_14480 gene sufD 2337 1087 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_14480 3083 2337 gene locus_tag LOCUS_14490 3083 2337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021049.1 protein_id gnl|my_center|LOCUS_14490 4558 3110 gene locus_tag LOCUS_14500 gene sufB 4558 3110 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 protein_id gnl|my_center|LOCUS_14500 4904 4578 gene locus_tag LOCUS_14510 gene sufA 4904 4578 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence166 323 616 gene locus_tag LOCUS_14520 323 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_14520 740 814 gene locus_tag LOCUS_t00230 740 814 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 842 925 gene locus_tag LOCUS_t00240 842 925 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 964 1039 gene locus_tag LOCUS_t00250 964 1039 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1080 1152 gene locus_tag LOCUS_t00260 1080 1152 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1203 2390 gene locus_tag LOCUS_14530 gene tuf 1203 2390 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU7 protein_id gnl|my_center|LOCUS_14530 2470 2543 gene locus_tag LOCUS_t00270 2470 2543 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2558 2779 gene locus_tag LOCUS_14540 2558 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2788 3339 gene locus_tag LOCUS_14550 gene nusG 2788 3339 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A464 protein_id gnl|my_center|LOCUS_14550 3475 3912 gene locus_tag LOCUS_14560 gene rplK 3475 3912 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYU4 protein_id gnl|my_center|LOCUS_14560 3932 4630 gene locus_tag LOCUS_14570 gene rplA 3932 4630 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A466 protein_id gnl|my_center|LOCUS_14570 >Feature sequence167 3852 397 gene locus_tag LOCUS_14580 3852 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 4921 4196 gene locus_tag LOCUS_14590 4921 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence168 2365 1598 gene locus_tag LOCUS_14600 gene truA 2365 1598 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZY4 protein_id gnl|my_center|LOCUS_14600 3503 2370 gene locus_tag LOCUS_14610 3503 2370 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_14610 3564 4544 gene locus_tag LOCUS_14620 3564 4544 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence169 <1 521 gene locus_tag LOCUS_14630 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GWQ2:ribosomal RNA small subunit methyltransferase G 582 1076 gene locus_tag LOCUS_14640 582 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 1802 2209 gene locus_tag LOCUS_14650 1802 2209 CDS product acyl-CoA esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169420.1 protein_id gnl|my_center|LOCUS_14650 2206 3180 gene locus_tag LOCUS_14660 2206 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence170 2853 1579 gene locus_tag LOCUS_14670 2853 1579 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964285.1 protein_id gnl|my_center|LOCUS_14670 2914 4107 gene locus_tag LOCUS_14680 2914 4107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108150.1 protein_id gnl|my_center|LOCUS_14680 4133 4663 gene locus_tag LOCUS_14690 4133 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence171 60 2156 gene locus_tag LOCUS_14700 60 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 3475 2288 gene locus_tag LOCUS_14710 gene gcdH 3475 2288 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_14710 4000 3542 gene locus_tag LOCUS_14720 gene rnhA 4000 3542 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 protein_id gnl|my_center|LOCUS_14720 4580 4002 gene locus_tag LOCUS_14730 4580 4002 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 protein_id gnl|my_center|LOCUS_14730 >Feature sequence172 3246 640 gene locus_tag LOCUS_14740 3246 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3284 4441 gene locus_tag LOCUS_14750 3284 4441 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence173 560 1981 gene locus_tag LOCUS_14760 560 1981 CDS product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_14760 2742 1996 gene locus_tag LOCUS_14770 2742 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_14770 3676 2858 gene locus_tag LOCUS_14780 3676 2858 CDS product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_14780 4338 3673 gene locus_tag LOCUS_14790 gene sirR 4338 3673 CDS product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence174 2094 73 gene locus_tag LOCUS_14800 2094 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3404 2307 gene locus_tag LOCUS_14810 3404 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 3440 4297 gene locus_tag LOCUS_14820 3440 4297 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence175 120 1961 gene locus_tag LOCUS_14830 120 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3280 1973 gene locus_tag LOCUS_14840 3280 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405182.1 protein_id gnl|my_center|LOCUS_14840 3545 3399 gene locus_tag LOCUS_14850 3545 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence176 <1 1328 gene locus_tag LOCUS_14860 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965973.1:maltose phosphorylase 2052 1306 gene locus_tag LOCUS_14870 2052 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 3584 2160 gene locus_tag LOCUS_14880 3584 2160 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_14880 4217 3702 gene locus_tag LOCUS_14890 gene rimM 4217 3702 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI5 protein_id gnl|my_center|LOCUS_14890 >Feature sequence177 516 181 gene locus_tag LOCUS_14900 516 181 CDS product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 protein_id gnl|my_center|LOCUS_14900 596 1885 gene locus_tag LOCUS_14910 596 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1893 3239 gene locus_tag LOCUS_14920 1893 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence178 <1 720 gene locus_tag LOCUS_14930 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405465.1:isoaspartyl peptidase/L-asparaginase 1442 771 gene locus_tag LOCUS_14940 gene coaE 1442 771 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD46 protein_id gnl|my_center|LOCUS_14940 1455 2105 gene locus_tag LOCUS_14950 1455 2105 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0S5 protein_id gnl|my_center|LOCUS_14950 <4424 2102 gene locus_tag LOCUS_14960 <4424 2102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119335.1:RNA-binding protein >Feature sequence179 >Feature sequence180 1 603 gene locus_tag LOCUS_14970 1 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 600 1091 gene locus_tag LOCUS_14980 600 1091 CDS product cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_14980 2438 1104 gene locus_tag LOCUS_14990 gene accC 2438 1104 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_14990 2978 2460 gene locus_tag LOCUS_15000 gene accB 2978 2460 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_15000 4030 3014 gene locus_tag LOCUS_15010 gene fabH 4030 3014 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I4 protein_id gnl|my_center|LOCUS_15010 4328 4140 gene locus_tag LOCUS_15020 gene rpmF 4328 4140 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 protein_id gnl|my_center|LOCUS_15020 >Feature sequence181 433 358 gene locus_tag LOCUS_t00280 433 358 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1793 516 gene locus_tag LOCUS_15030 1793 516 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202629.1 protein_id gnl|my_center|LOCUS_15030 2715 1786 gene locus_tag LOCUS_15040 2715 1786 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_15040 3239 2712 gene locus_tag LOCUS_15050 3239 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3201 3350 gene locus_tag LOCUS_15060 3201 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence182 1959 187 gene locus_tag LOCUS_15070 1959 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2897 1965 gene locus_tag LOCUS_15080 2897 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 3581 2907 gene locus_tag LOCUS_15090 3581 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 4102 3593 gene locus_tag LOCUS_15100 gene ftnA 4102 3593 CDS product putative bacterial non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43707 protein_id gnl|my_center|LOCUS_15100 >Feature sequence183 52 891 gene locus_tag LOCUS_15110 gene menB 52 891 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WQ8 protein_id gnl|my_center|LOCUS_15110 888 1835 gene locus_tag LOCUS_15120 gene menA 888 1835 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KFP0 protein_id gnl|my_center|LOCUS_15120 1837 2913 gene locus_tag LOCUS_15130 1837 2913 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YM8 protein_id gnl|my_center|LOCUS_15130 2910 3920 gene locus_tag LOCUS_15140 2910 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence184 3264 3803 gene locus_tag LOCUS_15150 3264 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence185 2097 3341 gene locus_tag LOCUS_15160 2097 3341 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence186 1220 600 gene locus_tag LOCUS_15170 1220 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1777 1232 gene locus_tag LOCUS_15180 1777 1232 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_15180 2809 1799 gene locus_tag LOCUS_15190 2809 1799 CDS product 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731314.1 protein_id gnl|my_center|LOCUS_15190 <4116 2819 gene locus_tag LOCUS_15200 <4116 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868766.1:peptide ABC transporter substrate-binding protein >Feature sequence187 517 2262 gene locus_tag LOCUS_15210 517 2262 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_15210 2316 3728 gene locus_tag LOCUS_15220 2316 3728 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_15220 3792 3874 gene locus_tag LOCUS_t00290 3792 3874 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4060 3938 gene locus_tag LOCUS_15230 4060 3938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence188 <1 837 gene locus_tag LOCUS_15240 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H199:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 849 2003 gene locus_tag LOCUS_15250 gene mraY 849 2003 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 protein_id gnl|my_center|LOCUS_15250 2003 3355 gene locus_tag LOCUS_15260 gene murD 2003 3355 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 protein_id gnl|my_center|LOCUS_15260 >Feature sequence189 1060 449 gene locus_tag LOCUS_15270 1060 449 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_15270 1380 1057 gene locus_tag LOCUS_15280 1380 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1300 2298 gene locus_tag LOCUS_15290 gene mnmA 1300 2298 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 protein_id gnl|my_center|LOCUS_15290 3272 2310 gene locus_tag LOCUS_15300 3272 2310 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_15300 3889 3269 gene locus_tag LOCUS_15310 3889 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence190 356 1399 gene locus_tag LOCUS_15320 356 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2351 1422 gene locus_tag LOCUS_15330 2351 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 <3996 2364 gene locus_tag LOCUS_15340 <3996 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763956.1:TonB-dependent receptor >Feature sequence191 3361 704 gene locus_tag LOCUS_15350 gene parC 3361 704 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 protein_id gnl|my_center|LOCUS_15350 <3985 3368 gene locus_tag LOCUS_15360 <3985 3368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64MK5:DNA topoisomerase (ATP-hydrolyzing) >Feature sequence192 <1 1927 gene locus_tag LOCUS_15370 <1 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000482288.1:bacillolysin 1978 2358 gene locus_tag LOCUS_15380 1978 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2422 3114 gene locus_tag LOCUS_15390 2422 3114 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_15390 3248 3736 gene locus_tag LOCUS_15400 3248 3736 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824008.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence193 >Feature sequence194 881 525 gene locus_tag LOCUS_15410 881 525 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939478.1 protein_id gnl|my_center|LOCUS_15410 905 1492 gene locus_tag LOCUS_15420 gene pabA 905 1492 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence195 2536 1793 gene locus_tag LOCUS_15430 2536 1793 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence196 822 2408 gene locus_tag LOCUS_15440 822 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 3594 2419 gene locus_tag LOCUS_15450 gene lpxB 3594 2419 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence197 656 84 gene locus_tag LOCUS_15460 gene def 656 84 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 protein_id gnl|my_center|LOCUS_15460 764 1933 gene locus_tag LOCUS_15470 gene ribBA 764 1933 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963701.1 protein_id gnl|my_center|LOCUS_15470 1312 1227 gene locus_tag LOCUS_t00300 1312 1227 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2409 2155 gene locus_tag LOCUS_15480 gene rpmE 2409 2155 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 protein_id gnl|my_center|LOCUS_15480 >Feature sequence198 84 1670 gene locus_tag LOCUS_15490 gene prfC 84 1670 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 protein_id gnl|my_center|LOCUS_15490 1691 2368 gene locus_tag LOCUS_15500 1691 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence199 268 2034 gene locus_tag LOCUS_15510 gene uvrC 268 2034 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW65 protein_id gnl|my_center|LOCUS_15510 2044 3129 gene locus_tag LOCUS_15520 gene thiL 2044 3129 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 protein_id gnl|my_center|LOCUS_15520 3617 3231 gene locus_tag LOCUS_15530 3617 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence200 604 837 gene locus_tag LOCUS_15540 604 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 1153 3447 gene locus_tag LOCUS_15550 1153 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence201 2 547 gene locus_tag LOCUS_15560 2 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2608 623 gene locus_tag LOCUS_15570 2608 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3607 2627 gene locus_tag LOCUS_15580 3607 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence202 2585 798 gene locus_tag LOCUS_15590 2585 798 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence203 <1 1551 gene locus_tag LOCUS_15600 <1 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A2I6:signal peptidase I 1548 2147 gene locus_tag LOCUS_15610 1548 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2478 2179 gene locus_tag LOCUS_15620 2478 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2516 3616 gene locus_tag LOCUS_15630 gene gcvT 2516 3616 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 protein_id gnl|my_center|LOCUS_15630 >Feature sequence204 >Feature sequence205 <1 963 gene locus_tag LOCUS_15640 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962906.1:ATP-dependent Clp protease ClpC 960 1250 gene locus_tag LOCUS_15650 960 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1873 1253 gene locus_tag LOCUS_15660 gene glpG 1873 1253 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_15660 2369 1875 gene locus_tag LOCUS_15670 2369 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143007.1 protein_id gnl|my_center|LOCUS_15670 3459 2362 gene locus_tag LOCUS_15680 gene ychF 3459 2362 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 protein_id gnl|my_center|LOCUS_15680 >Feature sequence206 2089 650 gene locus_tag LOCUS_15690 2089 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2247 3029 gene locus_tag LOCUS_15700 gene dapF 2247 3029 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P2 protein_id gnl|my_center|LOCUS_15700 >Feature sequence207 <1 880 gene locus_tag LOCUS_15710 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107276.1:beta-mannosidase 3233 903 gene locus_tag LOCUS_15720 3233 903 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202543.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence208 >Feature sequence209 2134 620 gene locus_tag LOCUS_15730 2134 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2438 2127 gene locus_tag LOCUS_15740 2438 2127 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYQ9 protein_id gnl|my_center|LOCUS_15740 2701 2435 gene locus_tag LOCUS_15750 2701 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 2987 3310 gene locus_tag LOCUS_15760 2987 3310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence210 331 1302 gene locus_tag LOCUS_15770 gene xerD 331 1302 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H159 protein_id gnl|my_center|LOCUS_15770 2216 1353 gene locus_tag LOCUS_15780 gene gluQ 2216 1353 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P8E9 protein_id gnl|my_center|LOCUS_15780 <3327 2216 gene locus_tag LOCUS_15790 <3327 2216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005776885.1:energy-dependent translational throttle protein EttA >Feature sequence211 1585 752 gene locus_tag LOCUS_15800 gene era 1585 752 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV2 protein_id gnl|my_center|LOCUS_15800 1771 1844 gene locus_tag LOCUS_t00310 1771 1844 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence212 <1 729 gene locus_tag LOCUS_15810 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97E82:putative 2-phosphosulfolactate phosphatase 722 1594 gene locus_tag LOCUS_15820 722 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 2034 1570 gene locus_tag LOCUS_15830 2034 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence213 1488 391 gene locus_tag LOCUS_15840 1488 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 2885 1614 gene locus_tag LOCUS_15850 2885 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 3271 2882 gene locus_tag LOCUS_15860 3271 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence214 35 1639 gene locus_tag LOCUS_15870 35 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 <3236 1668 gene locus_tag LOCUS_15880 <3236 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760864.1:chloride channel protein >Feature sequence215 1303 689 gene locus_tag LOCUS_15890 1303 689 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_15890 2135 1293 gene locus_tag LOCUS_15900 2135 1293 CDS product VTC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259682.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence216 <1 554 gene locus_tag LOCUS_15910 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A8K7:Na(+)-translocating NADH-quinone reductase subunit A 561 1802 gene locus_tag LOCUS_15920 gene nqrB 561 1802 CDS product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 protein_id gnl|my_center|LOCUS_15920 1814 2566 gene locus_tag LOCUS_15930 gene nqrC 1814 2566 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 protein_id gnl|my_center|LOCUS_15930 >Feature sequence217 438 1667 gene locus_tag LOCUS_15940 gene rimO 438 1667 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 protein_id gnl|my_center|LOCUS_15940 1667 2272 gene locus_tag LOCUS_15950 gene queE 1667 2272 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 protein_id gnl|my_center|LOCUS_15950 <3130 2298 gene locus_tag LOCUS_15960 <3130 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882683.1:(pyruvate) oxoisovalerate dehydrogenase subunits alpha/beta >Feature sequence218 704 129 gene locus_tag LOCUS_15970 gene rnhB 704 129 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZN7 protein_id gnl|my_center|LOCUS_15970 1647 691 gene locus_tag LOCUS_15980 1647 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1899 2879 gene locus_tag LOCUS_15990 1899 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence219 1083 2762 gene locus_tag LOCUS_16000 1083 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence220 2666 1716 gene locus_tag LOCUS_16010 gene accA 2666 1716 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 protein_id gnl|my_center|LOCUS_16010 >Feature sequence221 979 842 gene locus_tag LOCUS_16020 979 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 2396 1254 gene locus_tag LOCUS_16030 2396 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 >Feature sequence222 100 1350 gene locus_tag LOCUS_16040 100 1350 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788745.1 protein_id gnl|my_center|LOCUS_16040 1378 2301 gene locus_tag LOCUS_16050 1378 2301 CDS product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence223 >Feature sequence224 157 1332 gene locus_tag LOCUS_16060 157 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1320 1886 gene locus_tag LOCUS_16070 1320 1886 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence225 <1 737 gene locus_tag LOCUS_16080 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HXG4:ribosomal RNA large subunit methyltransferase F 1688 744 gene locus_tag LOCUS_16090 1688 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 1723 2436 gene locus_tag LOCUS_16100 gene ybhL 1723 2436 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000373626.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence226 2304 685 gene locus_tag LOCUS_16110 2304 685 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204697.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence227 1130 1252 gene locus_tag LOCUS_16120 1130 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1461 1330 gene locus_tag LOCUS_16130 1461 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence228 2452 113 gene locus_tag LOCUS_16140 2452 113 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_16140 2796 2449 gene locus_tag LOCUS_16150 2796 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence229 >Feature sequence230 2120 1071 gene locus_tag LOCUS_16160 2120 1071 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 protein_id gnl|my_center|LOCUS_16160 2682 2152 gene locus_tag LOCUS_16170 2682 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence231 277 2346 gene locus_tag LOCUS_16180 277 2346 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 protein_id gnl|my_center|LOCUS_16180 2403 2666 gene locus_tag LOCUS_16190 2403 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence232 471 73 gene locus_tag LOCUS_16200 gene apaG 471 73 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62674 protein_id gnl|my_center|LOCUS_16200 1826 543 gene locus_tag LOCUS_16210 1826 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence233 2208 1051 gene locus_tag LOCUS_16220 gene murG 2208 1051 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 protein_id gnl|my_center|LOCUS_16220 <2707 2205 gene locus_tag LOCUS_16230 <2707 2205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964157.1:cell division protein FtsW >Feature sequence234 135 347 gene locus_tag LOCUS_16240 135 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 414 1700 gene locus_tag LOCUS_16250 gene gltA 414 1700 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UPW5 protein_id gnl|my_center|LOCUS_16250 1697 2467 gene locus_tag LOCUS_16260 1697 2467 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence235 494 87 gene locus_tag LOCUS_16270 494 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16270 1991 798 gene locus_tag LOCUS_16280 1991 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence236 >Feature sequence237 2315 78 gene locus_tag LOCUS_16290 2315 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence238 1600 725 gene locus_tag LOCUS_16300 1600 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 <2659 1610 gene locus_tag LOCUS_16310 <2659 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963532.1:O-acyltransferase >Feature sequence239 >Feature sequence240 1921 1598 gene locus_tag LOCUS_16320 1921 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence241 1842 2480 gene locus_tag LOCUS_16330 1842 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence242 >Feature sequence243 >Feature sequence244 256 2028 gene locus_tag LOCUS_16340 256 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence245 59 925 gene locus_tag LOCUS_16350 gene ppx 59 925 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963116.1 protein_id gnl|my_center|LOCUS_16350 2259 922 gene locus_tag LOCUS_16360 2259 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence246 <1 912 gene locus_tag LOCUS_16370 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KEY5:adenosine deaminase 1738 866 gene locus_tag LOCUS_16380 1738 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1810 2226 gene locus_tag LOCUS_16390 1810 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence247 >Feature sequence248 1879 782 gene locus_tag LOCUS_16400 1879 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence249 <1 1307 gene locus_tag LOCUS_16410 <1 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963281.1:peptidase M23 >Feature sequence250 435 2144 gene locus_tag LOCUS_16420 435 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence251 >Feature sequence252 543 1193 gene locus_tag LOCUS_16430 543 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 1627 1448 gene locus_tag LOCUS_16440 1627 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 >Feature sequence253 >Feature sequence254 1 525 gene locus_tag LOCUS_16450 1 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 525 1427 gene locus_tag LOCUS_16460 525 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1490 2101 gene locus_tag LOCUS_16470 1490 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence255 >Feature sequence256 <2164 1347 gene locus_tag LOCUS_16480 <2164 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:peptidase S9 >Feature sequence257 540 226 gene locus_tag LOCUS_16490 540 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 2137 620 gene locus_tag LOCUS_16500 2137 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence258 762 331 gene locus_tag LOCUS_16510 762 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence259 >Feature sequence260 725 1027 gene locus_tag LOCUS_16520 725 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1168 1551 gene locus_tag LOCUS_16530 1168 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence261 435 1211 gene locus_tag LOCUS_16540 435 1211 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527978.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence262 546 1331 gene locus_tag LOCUS_16550 546 1331 CDS product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109883.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence263 357 608 gene locus_tag LOCUS_16560 357 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence264 >Feature sequence265 >Feature sequence266 >Feature sequence267 <1 671 gene locus_tag LOCUS_16570 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946887.1:amine oxidase 683 1456 gene locus_tag LOCUS_16580 683 1456 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107566.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence268 <1 797 gene locus_tag LOCUS_16590 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A120:DNA mismatch repair protein MutL 838 1515 gene locus_tag LOCUS_16600 838 1515 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765306.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence269 >Feature sequence270 951 700 gene locus_tag LOCUS_16610 951 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence271 581 456 gene locus_tag LOCUS_16620 581 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence272 >Feature sequence273 901 713 gene locus_tag LOCUS_16630 gene rpsU 901 713 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYV0 protein_id gnl|my_center|LOCUS_16630 <1830 958 gene locus_tag LOCUS_16640 <1830 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000545532.1:butyryl-CoA dehydrogenase >Feature sequence274 >Feature sequence275 1023 1229 gene locus_tag LOCUS_16650 1023 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence276 551 742 gene locus_tag LOCUS_16660 551 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 <1770 679 gene locus_tag LOCUS_16670 <1770 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000405145.1:sterol desaturase >Feature sequence277 >Feature sequence278 292 1065 gene locus_tag LOCUS_16680 292 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 <1758 1132 gene locus_tag LOCUS_16690 <1758 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021945.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence279 >Feature sequence280 261 698 gene locus_tag LOCUS_16700 gene sufE 261 698 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_16700 695 1018 gene locus_tag LOCUS_16710 695 1018 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence281 >Feature sequence282 354 611 gene locus_tag LOCUS_16720 354 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence283 >Feature sequence284 1307 657 gene locus_tag LOCUS_16730 1307 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence285 371 613 gene locus_tag LOCUS_16740 gene rpmB 371 613 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence286 <1 863 gene locus_tag LOCUS_16750 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XH6:valine--tRNA ligase >Feature sequence287 >Feature sequence288 >Feature sequence289 7 1404 gene locus_tag LOCUS_16760 7 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence290 >Feature sequence291 939 316 gene locus_tag LOCUS_16770 939 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 1014 1547 gene locus_tag LOCUS_16780 1014 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence292 >Feature sequence293 >Feature sequence294 805 1092 gene locus_tag LOCUS_16790 805 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1089 1466 gene locus_tag LOCUS_16800 1089 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence295 231 94 gene locus_tag LOCUS_16810 231 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 781 236 gene locus_tag LOCUS_16820 781 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence296 288 1232 gene locus_tag LOCUS_16830 288 1232 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 protein_id gnl|my_center|LOCUS_16830 >Feature sequence297 <1 500 gene locus_tag LOCUS_16840 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681373.1:metal-dependent hydrolase 1077 628 gene locus_tag LOCUS_16850 1077 628 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964067.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence298 >Feature sequence299 468 316 gene locus_tag LOCUS_16860 468 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 937 818 gene locus_tag LOCUS_16870 937 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence300 >Feature sequence301 1425 187 gene locus_tag LOCUS_16880 1425 187 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence302 <1 1104 gene locus_tag LOCUS_16890 <1 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229107.1:SGNH hydrolase >Feature sequence303 >Feature sequence304 357 512 gene locus_tag LOCUS_16900 357 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence305 504 322 gene locus_tag LOCUS_16910 504 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 >Feature sequence306 >Feature sequence307 1131 91 gene locus_tag LOCUS_16920 gene nrdB 1131 91 CDS product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence308 >Feature sequence309 >Feature sequence310 >Feature sequence311 594 758 gene locus_tag LOCUS_16930 594 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence312 <1405 706 gene locus_tag LOCUS_16940 <1405 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962476.1:alpha-amylase >Feature sequence313 >Feature sequence314 >Feature sequence315 544 1215 gene locus_tag LOCUS_16950 544 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence316 493 1380 gene locus_tag LOCUS_16960 gene accD 493 1380 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 protein_id gnl|my_center|LOCUS_16960 >Feature sequence317 >Feature sequence318 1099 1260 gene locus_tag LOCUS_16970 1099 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence319 >Feature sequence320 898 1317 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgatgtcatcagtgacgtcatcac >Feature sequence321 >Feature sequence322 >Feature sequence323 >Feature sequence324 >Feature sequence325 >Feature sequence326 995 606 gene locus_tag LOCUS_16980 995 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence327 >Feature sequence328 >Feature sequence329 358 615 gene locus_tag LOCUS_16990 358 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence330 >Feature sequence331 >Feature sequence332 >Feature sequence333 >Feature sequence334 >Feature sequence335 >Feature sequence336 >Feature sequence337 >Feature sequence338 794 15 gene locus_tag LOCUS_17000 794 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 1001 834 gene locus_tag LOCUS_17010 1001 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 >Feature sequence339 >Feature sequence340 >Feature sequence341 1079 582 gene locus_tag LOCUS_17020 1079 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence342 >Feature sequence343 >Feature sequence344 584 234 gene locus_tag LOCUS_17030 584 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 772 581 gene locus_tag LOCUS_17040 772 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence345 >Feature sequence346 378 614 gene locus_tag LOCUS_17050 378 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence347 >Feature sequence348 318 458 gene locus_tag LOCUS_17060 318 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 585 791 gene locus_tag LOCUS_17070 585 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence349 >Feature sequence350 74 199 gene locus_tag LOCUS_17080 74 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence351 889 14 gene locus_tag LOCUS_17090 889 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence352 >Feature sequence353 917 651 gene locus_tag LOCUS_17100 917 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 >Feature sequence354 >Feature sequence355 >Feature sequence356 >Feature sequence357 342 542 gene locus_tag LOCUS_17110 342 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 >Feature sequence358 <1157 315 gene locus_tag LOCUS_17120 <1157 315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS C-terminal target domain-containing protein >Feature sequence359 345 662 gene locus_tag LOCUS_17130 345 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence360 218 562 gene locus_tag LOCUS_17140 218 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence361 >Feature sequence362 >Feature sequence363 >Feature sequence364 547 756 gene locus_tag LOCUS_17150 547 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence365 150 572 gene locus_tag LOCUS_17160 150 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence366 >Feature sequence367 327 154 gene locus_tag LOCUS_17170 327 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence368 >Feature sequence369 >Feature sequence370 >Feature sequence371 511 1032 gene locus_tag LOCUS_17180 511 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence372 >Feature sequence373 161 352 gene locus_tag LOCUS_17190 161 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence374 >Feature sequence375 50 238 gene locus_tag LOCUS_17200 50 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence376 >Feature sequence377 >Feature sequence378 >Feature sequence379 >Feature sequence380 1082 549 gene locus_tag LOCUS_17210 1082 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence381 >Feature sequence382 <1 981 gene locus_tag LOCUS_17220 <1 981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933019.1:ABC transporter >Feature sequence383 658 395 gene locus_tag LOCUS_17230 658 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence384 <1063 413 gene locus_tag LOCUS_17240 <1063 413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XX2:tRNA dimethylallyltransferase 1 >Feature sequence385 >Feature sequence386 >Feature sequence387 >Feature sequence388 >Feature sequence389 >Feature sequence390 462 298 gene locus_tag LOCUS_17250 462 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 461 835 gene locus_tag LOCUS_17260 461 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence391 >Feature sequence392 >Feature sequence393 666 379 gene locus_tag LOCUS_17270 666 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence394 140 301 gene locus_tag LOCUS_17280 140 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence395 >Feature sequence396 >Feature sequence397 564 319 gene locus_tag LOCUS_17290 564 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence398 503 712 gene locus_tag LOCUS_17300 503 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 861 709 gene locus_tag LOCUS_17310 861 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence399 >Feature sequence400 >Feature sequence401 >Feature sequence402 >Feature sequence403 454 630 gene locus_tag LOCUS_17320 454 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 943 791 gene locus_tag LOCUS_17330 943 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence404 >Feature sequence405 >Feature sequence406 >Feature sequence407 >Feature sequence408