COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.18 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..93933 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..1858) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962568.1 transl_table 11 codon_start 1 locus_tag LOCUS_00010 gene sppA CDS 1963..2454 product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582990.1 transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2444..3034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00030 note possible pseudo, frameshifted CDS 3171..4883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108507.1 transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS complement(4930..5397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00050 CDS 5680..7035 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 gene actA CDS 7058..10363 product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962544.1 transl_table 11 codon_start 1 locus_tag LOCUS_00070 gene actB CDS 10378..11787 product molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 transl_table 11 codon_start 1 locus_tag LOCUS_00080 gene actC CDS 11797..12333 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962546.1 transl_table 11 codon_start 1 locus_tag LOCUS_00090 gene actD CDS 12330..13010 product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962547.1 transl_table 11 codon_start 1 locus_tag LOCUS_00100 gene actE CDS 13017..14528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS 14541..15842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS 15871..17631 product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_00130 gene ctaD CDS 17672..18271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS 18264..19289 product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 transl_table 11 codon_start 1 locus_tag LOCUS_00150 gene ruvB CDS 19286..20212 product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 transl_table 11 codon_start 1 locus_tag LOCUS_00160 gene queG CDS 20243..21193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 21260..21748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS complement(21749..23281) product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00190 gene porX CDS 23325..24551 product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS 24595..25635 product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY99 transl_table 11 codon_start 1 locus_tag LOCUS_00210 gene lpxD CDS 25632..27035 product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY98 transl_table 11 codon_start 1 locus_tag LOCUS_00220 gene fabZ CDS 27056..27835 product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY97 transl_table 11 codon_start 1 locus_tag LOCUS_00230 gene lpxA CDS complement(27841..28767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS complement(28769..30445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS complement(30442..30924) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 31062..31763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 31873..34146 product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964222.1 transl_table 11 codon_start 1 locus_tag LOCUS_00280 gene maeB CDS 34152..34733 product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G0 transl_table 11 codon_start 1 locus_tag LOCUS_00290 gene ruvA CDS 34743..42146 product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964220.1 transl_table 11 codon_start 1 locus_tag LOCUS_00300 gene sprA CDS 42180..42557 product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 transl_table 11 codon_start 1 locus_tag LOCUS_00310 gene gcvH CDS 42616..43296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS complement(43293..44555) product sulfate adenylyltransferase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYJ5 transl_table 11 codon_start 1 locus_tag LOCUS_00330 gene cysN CDS complement(44562..45467) product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S508 transl_table 11 codon_start 1 locus_tag LOCUS_00340 gene cysD CDS complement(45471..46061) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VR1 transl_table 11 codon_start 1 locus_tag LOCUS_00350 gene cysC CDS 46157..47053 product 2-deoxyribose-5-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS 47057..48526 product betaine-aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403981.1 transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS 48526..49407 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 49409..49633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS 49572..50375 product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107256.1 transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 50372..51421 product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RXT7 transl_table 11 codon_start 1 locus_tag LOCUS_00410 gene gmd CDS 51427..52362 product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FI1 transl_table 11 codon_start 1 locus_tag LOCUS_00420 gene fcl CDS 52371..53888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS 53898..54995 product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS 54988..56496 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS 56567..57439 product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1E4 transl_table 11 codon_start 1 locus_tag LOCUS_00460 gene ctaB CDS 57450..58691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS 58733..59545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS 59556..59960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS 59966..61162 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 61223..61771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 transl_table 11 codon_start 1 locus_tag LOCUS_00510 gene yozB CDS 61768..62010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS 62125..63207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00530 note possible pseudo, internal stop codon, frameshifted CDS 63210..65924 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00540 note possible pseudo, internal stop codon, frameshifted CDS complement(65908..66351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS complement(66355..68334) product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963739.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 gene dsbD CDS complement(68532..69839) product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H020 transl_table 11 codon_start 1 locus_tag LOCUS_00570 gene tilS CDS complement(69827..70933) product para-aminobenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963737.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 gene pabB CDS complement(70942..71970) product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZYE7 transl_table 11 codon_start 1 locus_tag LOCUS_00590 gene hemH CDS complement(71973..73373) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0C9 transl_table 11 codon_start 1 locus_tag LOCUS_00600 gene lpdA1 CDS complement(73413..74600) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764530.1 transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS complement(74602..75369) product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 75424..76542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(76531..81663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(81737..82804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963372.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 82898..83596 product phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963371.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 gene pssA CDS 83596..83847 product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB02 transl_table 11 codon_start 1 locus_tag LOCUS_00670 gene purS CDS complement(83844..84785) product heptosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051000.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(84826..85428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964557.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 CDS complement(85425..85949) product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(85949..86806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(86803..88140) product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P4 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene kmo CDS complement(88125..88289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(88286..89560) product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P7 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene kynU CDS 89623..90918 product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW4 transl_table 11 codon_start 1 locus_tag LOCUS_00750 gene hemL CDS 90969..91949 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 note possible pseudo, frameshifted CDS 92000..92482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00770 note possible pseudo, frameshifted misc_feature complement(92479..>93933) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H76:peptidylprolyl isomerase locus_tag LOCUS_00780 sequence002 source 1..84607 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(382..1062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963850.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(1066..1980) product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H099 transl_table 11 codon_start 1 locus_tag LOCUS_00800 gene rnz CDS complement(1998..2747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS complement(2744..3082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS complement(3126..4058) product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I8 transl_table 11 codon_start 1 locus_tag LOCUS_00830 gene pyrB CDS complement(4061..4600) product bifunctional pyrimidine operon regulatory protein/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 transl_table 11 codon_start 1 locus_tag LOCUS_00840 gene pyrR1 CDS 4697..6184 product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5M0 transl_table 11 codon_start 1 locus_tag LOCUS_00850 gene glpK CDS 6186..6929 product glycerol uptake facilitator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189870.1 transl_table 11 codon_start 1 locus_tag LOCUS_00860 gene glpF CDS complement(6918..7745) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(7750..8184) product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(8194..9882) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963874.1 transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS complement(9909..11024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS complement(11040..13667) product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H092 transl_table 11 codon_start 1 locus_tag LOCUS_00910 gene valS CDS complement(13733..14293) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 transl_table 11 codon_start 1 locus_tag LOCUS_00920 gene pabA CDS 14359..15219 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108156.1 transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS 15372..15704 product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:R7RV76 transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(15751..16863) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(16856..17812) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS 17938..18660 product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 gene gldF CDS 18660..20579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS 20569..21561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS 21651..22769 product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYK6 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene dnaN CDS complement(22766..23992) product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01010 gene rocD CDS 24089..24892 product tRNA 2-thiocytidine biosynthesis protein TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I4E6 transl_table 11 codon_start 1 locus_tag LOCUS_01020 gene ttcA CDS complement(24876..25892) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 transl_table 11 codon_start 1 locus_tag LOCUS_01030 gene porQ CDS complement(25932..27029) product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A339 transl_table 11 codon_start 1 locus_tag LOCUS_01040 gene ychF CDS complement(27047..29548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(29548..29880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS 29960..30841 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962842.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene tktA CDS 30867..32246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01080 CDS 32243..33193 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 transl_table 11 codon_start 1 locus_tag LOCUS_01090 gene tktC CDS 33254..33742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01100 CDS 33755..34654 product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW2 transl_table 11 codon_start 1 locus_tag LOCUS_01110 gene menA CDS complement(34647..35645) product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766068.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS complement(35687..37519) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107334.1 transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS complement(37510..39036) product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0T6 transl_table 11 codon_start 1 locus_tag LOCUS_01140 gene guaA CDS 39121..40038 product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V8 transl_table 11 codon_start 1 locus_tag LOCUS_01150 gene miaA CDS 40060..41169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS 41166..43232 product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963261.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 gene mutB CDS 43225..43665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(43672..44211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(44276..45061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(45102..46400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS complement(46412..48937) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXM8 transl_table 11 codon_start 1 locus_tag LOCUS_01220 gene gyrA CDS 49134..51680 product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 transl_table 11 codon_start 1 locus_tag LOCUS_01230 gene clpA CDS complement(51681..52340) product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS complement(52341..53108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(53110..54993) product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZQ9 transl_table 11 codon_start 1 locus_tag LOCUS_01260 gene htpG CDS 55199..55480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(55462..55896) product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E5 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 56274..57086 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 gene dapD CDS 57114..58241 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 CDS 58219..58800 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS 58781..60211 product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 60201..60731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01330 CDS complement(60733..62805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS complement(62816..63562) product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963112.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 CDS 63729..66158 product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS 66162..68762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS 68847..69629 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962792.1 transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 69650..71686 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963232.1 transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 71686..72966 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66990 transl_table 11 codon_start 1 locus_tag LOCUS_01400 gene pyrC CDS 73106..73585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 73671..74327 product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG9 transl_table 11 codon_start 1 locus_tag LOCUS_01420 gene tal CDS 74334..74942 product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS complement(74939..75988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(76345..76686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01450 CDS 76932..77303 product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51339 transl_table 11 codon_start 1 locus_tag LOCUS_01460 gene mgsA CDS complement(77300..78013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810266.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 CDS complement(78131..78736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 78849..79421 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 79499..80374 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 80491..80661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS 80658..80846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(80857..81060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(81073..81642) product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS 81813..83174 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963231.1 transl_table 11 codon_start 1 locus_tag LOCUS_01550 gene rhlE CDS complement(83197..83967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 sequence003 source 1..81077 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 584..1381 product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847027.1 transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(1385..2071) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005678712.1 transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS complement(2071..3501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(3518..5053) product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404972.1 transl_table 11 codon_start 1 locus_tag LOCUS_01600 gene pccB CDS complement(5055..6344) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 transl_table 11 codon_start 1 locus_tag LOCUS_01610 gene pepP CDS 6522..7748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS 7752..9299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 9296..9874 product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS 9892..10422 product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1R7 transl_table 11 codon_start 1 locus_tag LOCUS_01650 gene haaO CDS complement(10434..14363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 14448..16355 product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 gene purF CDS complement(16352..16855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964474.1 transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS complement(16852..18234) product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775288.1 transl_table 11 codon_start 1 locus_tag LOCUS_01690 gene mvaS CDS complement(18244..18579) product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS complement(18581..19003) product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 transl_table 11 codon_start 1 locus_tag LOCUS_01710 gene sufE CDS complement(19063..20406) product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVU9 transl_table 11 codon_start 1 locus_tag LOCUS_01720 gene radA CDS complement(20426..21883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(21880..22860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS complement(22924..24384) product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS complement(24384..26744) product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963209.1 transl_table 11 codon_start 1 locus_tag LOCUS_01760 gene mur/alr CDS 26865..27470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS 27467..28705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS complement(28710..29603) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 transl_table 11 codon_start 1 locus_tag LOCUS_01790 gene fjo11 CDS complement(29604..30233) product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962679.1 transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS 30309..32069 product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 gene recJ CDS complement(32070..33221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01820 CDS complement(33226..35160) product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P92 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene dnaG CDS 35296..36474 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 transl_table 11 codon_start 1 locus_tag LOCUS_01840 gene gcdH CDS complement(36467..37036) product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 transl_table 11 codon_start 1 locus_tag LOCUS_01850 gene gldD CDS complement(37029..38348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(38365..38817) product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9YA30 transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(38851..39888) product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963777.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 gene mutY CDS 39985..40275 product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 gene hupA CDS 40461..42005 product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762276.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(42011..43102) product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H207 transl_table 11 codon_start 1 locus_tag LOCUS_01910 gene thiL CDS 43199..43522 product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 gene sufA CDS 43532..44977 product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964482.1 transl_table 11 codon_start 1 locus_tag LOCUS_01930 gene sufB CDS 44988..45752 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 transl_table 11 codon_start 1 locus_tag LOCUS_01940 gene sufC CDS 45766..46980 product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene sufD CDS 47027..48475 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01960 CDS complement(48468..49484) product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 transl_table 11 codon_start 1 locus_tag LOCUS_01970 gene murB CDS 49859..50686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS complement(50687..51445) product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257343.1 transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS complement(51438..52325) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963966.1 transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS complement(52337..53005) product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962683.1 transl_table 11 codon_start 1 locus_tag LOCUS_02010 gene ftsE CDS 53169..56363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 transl_table 11 codon_start 1 locus_tag LOCUS_02020 CDS 56356..58170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02030 CDS 58257..60206 product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX10 transl_table 11 codon_start 1 locus_tag LOCUS_02040 gene gyrB CDS 60240..61169 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX11 transl_table 11 codon_start 1 locus_tag LOCUS_02050 gene mdh CDS complement(61172..61576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190402.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS complement(61567..63822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 64013..67138 product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 67138..67389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS complement(67422..68432) product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UNZ8 transl_table 11 codon_start 1 locus_tag LOCUS_02100 gene glnII CDS 68650..70701 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 70741..71913 product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962845.1 transl_table 11 codon_start 1 locus_tag LOCUS_02120 gene purM CDS 71906..72997 product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW5 transl_table 11 codon_start 1 locus_tag LOCUS_02130 gene prfA CDS 72994..73797 product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962701.1 transl_table 11 codon_start 1 locus_tag LOCUS_02140 gene pyrF CDS 74067..74984 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 74974..76575 product alanine glycine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122885.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 gene dagA CDS 76594..77658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02170 CDS 77667..78194 product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6E1 transl_table 11 codon_start 1 locus_tag LOCUS_02180 gene apt CDS 78247..79389 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110496.1 transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 79446..79634 product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NI7 transl_table 11 codon_start 1 locus_tag LOCUS_02200 gene rpsU CDS 79710..80594 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A461 transl_table 11 codon_start 1 locus_tag LOCUS_02210 gene xerC CDS 80606..80908 product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467451.1 transl_table 11 codon_start 1 locus_tag LOCUS_02220 tRNA 80987..81060 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 sequence004 source 1..80457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..4561 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS 4641..7064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 7133..8236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS 8239..9579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS 9579..11102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 11099..12379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 12389..13042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 13026..13817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 13850..14749 product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815329.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 CDS complement(14746..15450) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(15471..15869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(15866..16783) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H148 transl_table 11 codon_start 1 locus_tag LOCUS_02340 gene fmt CDS complement(16800..17984) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS 18044..18940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729187.1 transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(18943..19557) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS 19771..23127 product Fused isobutyryl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Y2 transl_table 11 codon_start 1 locus_tag LOCUS_02380 gene icmF CDS complement(23128..24531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 24637..24891 product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYP9 transl_table 11 codon_start 1 locus_tag LOCUS_02400 gene rpmE CDS 24962..26146 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 26279..28696 product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A8 transl_table 11 codon_start 1 locus_tag LOCUS_02420 gene lon CDS 28794..30653 product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC8 transl_table 11 codon_start 1 locus_tag LOCUS_02430 gene parE CDS 30653..33400 product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962810.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene parC CDS 33400..34164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS complement(34168..35535) product phosphoenolpyruvate carboxykinase [ATP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CS25 transl_table 11 codon_start 1 locus_tag LOCUS_02460 gene pckA note possible pseudo, internal stop codon CDS complement(35542..35781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02470 note possible pseudo, internal stop codon CDS 35917..36897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS complement(37089..40013) product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933213.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS complement(40051..40704) product 2-deoxyglucose-6-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070789.1 transl_table 11 codon_start 1 locus_tag LOCUS_02500 gene yniC CDS complement(40701..42332) product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 transl_table 11 codon_start 1 locus_tag LOCUS_02510 gene pruA CDS 42430..43599 product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 transl_table 11 codon_start 1 locus_tag LOCUS_02520 gene argD CDS complement(43600..44739) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS 44913..46061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS 46204..47313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(47389..47808) product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG2 transl_table 11 codon_start 1 locus_tag LOCUS_02560 gene ndk CDS complement(47865..48311) product periplasmic L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(48304..50919) product chaperone protein ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0F9 transl_table 11 codon_start 1 locus_tag LOCUS_02580 gene clpB CDS complement(51019..51792) product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(51792..52712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 tRNA 52820..52894 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 52911..53252 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 transl_table 11 codon_start 1 locus_tag LOCUS_02610 gene ytxJ CDS complement(53264..54550) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F801 transl_table 11 codon_start 1 locus_tag LOCUS_02620 gene gltA CDS complement(54620..56302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 CDS complement(56347..56859) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964424.1 transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS complement(56883..57446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS complement(57443..59632) product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene pepX1 CDS complement(59629..60132) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS complement(60117..61130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS complement(61149..61616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS complement(61637..67945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(67969..68481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS 68590..70038 product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760476.1 transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(70027..71106) product choline monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947927.1 transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS 71262..72605 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 72608..75394 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962323.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 75422..79861 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02760 sequence005 source 1..69543 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..824 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64YD8:3-phosphoshikimate 1-carboxyvinyltransferase locus_tag LOCUS_02770 CDS 1081..1680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 1753..1923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 1996..2457 product putative 5'(3')-deoxyribonucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTG7 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS complement(2522..2989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS complement(3098..3514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS complement(3531..4271) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS complement(4268..5503) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(5518..6039) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02850 CDS 6069..7043 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962301.1 transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(7036..8283) product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW04 transl_table 11 codon_start 1 locus_tag LOCUS_02870 gene tyrS CDS 8397..9398 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(9384..10394) product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 transl_table 11 codon_start 1 locus_tag LOCUS_02890 gene ltaE CDS complement(10406..11410) product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 CDS 11429..11875 product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS 11970..15767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02920 CDS 15795..16331 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02930 CDS 16358..17032 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 transl_table 11 codon_start 1 locus_tag LOCUS_02940 CDS 17034..17702 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3H8 transl_table 11 codon_start 1 locus_tag LOCUS_02950 CDS complement(17695..18750) product mechanosensitive ion channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 CDS complement(18804..20846) product oxoisovalerate dehydrogenase subunits alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871691.1 transl_table 11 codon_start 1 locus_tag LOCUS_02970 gene pdhA/B CDS 21139..22536 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02980 CDS 22643..23188 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02990 CDS 23195..23734 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 23727..24194 product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD6 transl_table 11 codon_start 1 locus_tag LOCUS_03010 gene coaD CDS 24194..25657 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(25654..26235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS 26236..26880 product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXE4 transl_table 11 codon_start 1 locus_tag LOCUS_03040 gene pyrE CDS 26837..27280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS complement(27264..28013) product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769390.1 transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 28117..28458 product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX84 transl_table 11 codon_start 1 locus_tag LOCUS_03070 gene rsfS CDS 28468..30519 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX85 transl_table 11 codon_start 1 locus_tag LOCUS_03080 gene ftsH CDS 30559..31212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS 31199..31852 product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 transl_table 11 codon_start 1 locus_tag LOCUS_03100 gene psd CDS 31920..32129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS complement(32126..33280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS complement(33296..34513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 34564..36060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS complement(36061..37254) product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ0 transl_table 11 codon_start 1 locus_tag LOCUS_03150 gene aspC1 CDS 37378..37896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03160 CDS complement(37893..41684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03170 CDS complement(41784..43826) product peptidase S46 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963485.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 CDS complement(43976..44617) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 CDS complement(44619..45074) product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783995.1 transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS complement(45076..46704) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(46722..47984) product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H192 transl_table 11 codon_start 1 locus_tag LOCUS_03220 gene ftsA CDS complement(47986..48768) product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(48765..50117) product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H194 transl_table 11 codon_start 1 locus_tag LOCUS_03240 gene murC CDS complement(50107..51225) product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H195 transl_table 11 codon_start 1 locus_tag LOCUS_03250 gene murG CDS complement(51218..52345) product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 gene ftsW CDS complement(52345..52839) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS complement(52849..54198) product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H197 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene murD CDS complement(54195..55433) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H198 transl_table 11 codon_start 1 locus_tag LOCUS_03290 gene mraY CDS complement(55433..56896) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H199 transl_table 11 codon_start 1 locus_tag LOCUS_03300 gene murE CDS complement(56893..58986) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 gene ftsI CDS complement(58976..59299) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(59301..60212) product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A251 transl_table 11 codon_start 1 locus_tag LOCUS_03330 gene rsmH CDS complement(60202..60606) product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A3 transl_table 11 codon_start 1 locus_tag LOCUS_03340 gene mraZ CDS 60880..61731 product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS 61728..62654 product hemolysin A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 CDS 62655..63257 product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A5 transl_table 11 codon_start 1 locus_tag LOCUS_03370 gene engB CDS 63299..64297 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS complement(64298..65095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(65169..66011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03400 CDS complement(66061..67104) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962530.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene phoR CDS 67198..67572 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS complement(67569..67877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03430 CDS complement(68259..68714) product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 gene crtZ CDS complement(68705..69541) product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 transl_table 11 codon_start 1 locus_tag LOCUS_03450 gene crtB sequence006 source 1..67165 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 297..830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS 889..1548 product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9H7 transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 1575..1886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 1886..3637 product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene mutL CDS 3637..4368 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 4369..5268 product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 CDS 5588..6376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03520 note possible pseudo, frameshifted CDS 6827..8503 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 transl_table 11 codon_start 1 locus_tag LOCUS_03530 CDS complement(8509..9012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 CDS complement(9022..9795) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 transl_table 11 codon_start 1 locus_tag LOCUS_03550 gene dapF CDS 9890..11365 product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 gene degP/Q CDS 11648..12796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 12807..13190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 13230..15659 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 15662..16567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 CDS 16693..17556 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779810.1 transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS 17575..18018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962914.1 transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 18060..18941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS 18952..19545 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS complement(19546..21567) product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA95 transl_table 11 codon_start 1 locus_tag LOCUS_03650 gene uvrB CDS complement(21577..22341) product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS complement(22338..23258) product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS complement(23255..23566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(23569..24351) product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(24348..25766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963880.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 CDS 25953..27338 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS 27357..28496 product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962867.1 transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 28499..29269 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene phnP CDS 29272..29964 product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R6 transl_table 11 codon_start 1 locus_tag LOCUS_03740 gene trmD CDS 30027..30386 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0R5 transl_table 11 codon_start 1 locus_tag LOCUS_03750 gene rplS CDS complement(30392..32179) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MX8 transl_table 11 codon_start 1 locus_tag LOCUS_03760 gene argS CDS complement(32219..32860) product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB5 transl_table 11 codon_start 1 locus_tag LOCUS_03770 gene mrsA CDS 32911..33420 product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203414.1 transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS complement(33412..33873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962875.1 transl_table 11 codon_start 1 locus_tag LOCUS_03790 CDS 34068..35585 product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXJ7 transl_table 11 codon_start 1 locus_tag LOCUS_03800 gene rho CDS 35595..36140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(36132..37493) product peptidoglycan synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS 37603..38880 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963479.1 transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS 38922..40487 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS 40484..41644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS 41660..42859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(42846..44096) product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS 44139..44939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941866.1 transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS 44967..45857 product phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963177.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 gene udp CDS 45905..46780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 46836..47396 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS complement(47399..48796) product glycosyl hydrolase family 109 protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XS1 transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS complement(48796..51060) product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963302.1 transl_table 11 codon_start 1 locus_tag LOCUS_03930 gene acnA CDS complement(51122..51817) product noncanonical pyrimidine nucleotidase, YjjG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963481.1 transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS complement(51818..52276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03950 CDS complement(52273..52929) product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS complement(52957..54240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03970 CDS complement(54237..55379) product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS complement(55455..56021) product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 CDS complement(56130..56381) product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF2 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene rpsT tRNA complement(56397..56469) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 CDS complement(56550..57266) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS complement(57250..58725) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF3 transl_table 11 codon_start 1 locus_tag LOCUS_04020 gene proS CDS complement(58792..59583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(59586..60674) product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TP1 transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS 60704..61729 product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6K1 transl_table 11 codon_start 1 locus_tag LOCUS_04050 gene lpxK CDS 61713..62525 product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QN5 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS 62529..63986 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 transl_table 11 codon_start 1 locus_tag LOCUS_04070 gene gatB CDS 63996..65126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04080 sequence007 source 1..64021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 94..555 product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS complement(543..2303) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 gene acdA CDS 2302..3249 product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H162 transl_table 11 codon_start 1 locus_tag LOCUS_04110 gene prmC CDS 3242..5305 product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N9 transl_table 11 codon_start 1 locus_tag LOCUS_04120 gene ligA CDS 5346..5903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 5905..6402 product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I323 transl_table 11 codon_start 1 locus_tag LOCUS_04140 gene aroK CDS complement(6392..8443) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 gene ptrB CDS complement(8501..9400) product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS complement(9381..10328) product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 transl_table 11 codon_start 1 locus_tag LOCUS_04170 gene mvaK CDS complement(10312..11391) product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962481.1 transl_table 11 codon_start 1 locus_tag LOCUS_04180 gene mvaD CDS complement(11388..12296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(12293..13645) product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H222 transl_table 11 codon_start 1 locus_tag LOCUS_04200 gene mvaA CDS 13787..15214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS 15236..18130 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(18135..18800) product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E3C5 transl_table 11 codon_start 1 locus_tag LOCUS_04230 gene cutC CDS complement(18797..21028) product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107598.1 transl_table 11 codon_start 1 locus_tag LOCUS_04240 CDS complement(21012..22010) product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_638262.2 transl_table 11 codon_start 1 locus_tag LOCUS_04250 gene aspG CDS complement(22078..22428) product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV2 transl_table 11 codon_start 1 locus_tag LOCUS_04260 gene panD CDS complement(22471..23331) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04270 CDS complement(23321..24106) product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993299.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 24203..25399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 25599..25997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04300 CDS 25994..27247 product SOS mutagenesis and repair protein UmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202620.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 27384..27551 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 27624..27863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04330 CDS 28005..28466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04340 CDS complement(28743..30104) product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 transl_table 11 codon_start 1 locus_tag LOCUS_04350 gene mnmE CDS 30164..31228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS 31248..31832 product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1N2 transl_table 11 codon_start 1 locus_tag LOCUS_04370 gene queE CDS 31870..33831 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962492.1 transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 33840..34556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS complement(34546..35889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582828.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 CDS complement(36028..36594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS complement(36598..37203) product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(37205..37957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(37981..39654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(39696..41063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS 41164..42507 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J8 transl_table 11 codon_start 1 locus_tag LOCUS_04460 gene purB CDS complement(42586..43260) product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZP8 transl_table 11 codon_start 1 locus_tag LOCUS_04470 CDS 43355..43921 product chalcone isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(43932..44768) product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS complement(44778..46070) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 46498..47343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 47340..49580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 49586..50620 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXD3 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS 50690..55135 product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI1 transl_table 11 codon_start 1 locus_tag LOCUS_04540 gene dnaE CDS 55207..55524 product thioredoxin-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE49 transl_table 11 codon_start 1 locus_tag LOCUS_04550 gene trx2 CDS complement(55525..57048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 57290..57997 product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 gene dapB CDS 57999..59849 product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2I6 transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS 59849..60463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108764.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS complement(60429..62255) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 62380..62760 product chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 transl_table 11 codon_start 1 locus_tag LOCUS_04610 gene groES-2 misc_feature complement(62757..>64021) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963911.1:8-amino-7-oxononanoate synthase locus_tag LOCUS_04620 sequence008 source 1..62620 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4695 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q1WU99:chromosome partition protein Smc locus_tag LOCUS_04630 CDS complement(4692..6551) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04640 CDS complement(6551..7810) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262233.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 CDS 7914..9476 product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZG1 transl_table 11 codon_start 1 locus_tag LOCUS_04660 gene bshC CDS complement(9465..9803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(9796..10515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(10583..11230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS complement(11230..11628) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(11730..14156) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 transl_table 11 codon_start 1 locus_tag LOCUS_04710 gene fecA CDS complement(14146..14781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS complement(15518..16657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS complement(16760..17923) product DUF4856 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963604.1 transl_table 11 codon_start 1 locus_tag LOCUS_04740 CDS complement(18013..18405) product UPF0382 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CTQ5 transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 18475..19824 product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 19910..20995 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 21197..22135 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS complement(22137..23501) product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816556.1 transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS complement(23498..24295) product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036760.1 transl_table 11 codon_start 1 locus_tag LOCUS_04800 gene hutG CDS 24394..25353 product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(25355..26074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(26058..28745) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766170.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS complement(28836..30149) product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 30304..30780 product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH0 transl_table 11 codon_start 1 locus_tag LOCUS_04850 gene bsaA CDS 30842..31546 product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002027497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04860 gene fabG CDS complement(31530..32447) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MR6 transl_table 11 codon_start 1 locus_tag LOCUS_04870 gene xerC tRNA 32533..32618 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 CDS 32690..33226 product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HL81 transl_table 11 codon_start 1 locus_tag LOCUS_04880 gene resA CDS 33295..34626 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6N7 transl_table 11 codon_start 1 locus_tag LOCUS_04890 gene hisS CDS 34667..36121 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW5 transl_table 11 codon_start 1 locus_tag LOCUS_04900 gene hutH1 CDS complement(36118..36951) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 CDS complement(37143..38576) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04920 CDS 38752..39312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(39309..40274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04940 CDS complement(40280..40768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS complement(40792..41385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS complement(41428..42009) product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW63 transl_table 11 codon_start 1 locus_tag LOCUS_04970 gene ygfA CDS complement(41984..42625) product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 42583..43974 product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 43979..44692 product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962816.1 transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS 44695..45570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 CDS complement(45572..46348) product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZQ5 transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(46345..46938) product sigma factor regulator FecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762908.1 transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS complement(46955..47728) product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9S0 transl_table 11 codon_start 1 locus_tag LOCUS_05040 gene kdsB CDS 47900..48481 product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_05050 gene pdxH CDS 48454..49707 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05060 CDS complement(49736..50080) product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY19 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rplT CDS complement(50380..50784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05080 CDS complement(50946..52889) product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY22 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene thrS CDS 52973..53401 product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671267.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS 53413..56688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS complement(56706..57380) product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(57417..58571) product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0G9 transl_table 11 codon_start 1 locus_tag LOCUS_05130 gene mnmA CDS 58655..60679 product 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113937.1 transl_table 11 codon_start 1 locus_tag LOCUS_05140 gene fadH1 CDS complement(60669..61388) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 CDS complement(61397..61891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 transl_table 11 codon_start 1 locus_tag LOCUS_05160 sequence009 source 1..57935 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1230..3278) product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709127.1 transl_table 11 codon_start 1 locus_tag LOCUS_05170 gene paaN CDS complement(3375..3707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(3697..4713) product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760933.1 transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 4752..5186 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000267395.1 transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS 5196..5912 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 CDS 5935..6558 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS complement(6560..7165) product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963558.1 transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(7162..7935) product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(7967..10561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS complement(10605..11915) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 transl_table 11 codon_start 1 locus_tag LOCUS_05260 gene bfmBB CDS complement(12003..13946) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(13955..14566) product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ60 transl_table 11 codon_start 1 locus_tag LOCUS_05280 gene recR CDS 14833..16203 product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(16193..16513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS complement(16526..17344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361984.1 transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS complement(17341..18375) product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L5 transl_table 11 codon_start 1 locus_tag LOCUS_05320 gene pyrD CDS complement(18427..20109) product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS 20200..20940 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS complement(21398..21556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS complement(22041..22175) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS 22282..23295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS 23292..24734 product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964033.1 transl_table 11 codon_start 1 locus_tag LOCUS_05380 gene pepD CDS complement(24731..27334) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 27354..28169 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY12 transl_table 11 codon_start 1 locus_tag LOCUS_05400 gene panB CDS 28171..28851 product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS complement(28857..29255) product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05420 gene yjgF CDS complement(29236..31740) product organic solvent tolerance protein OstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 CDS 31866..32981 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790917.1 transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS 32991..34019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS 34038..35366 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 35371..36162 product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS 36159..36635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS complement(36584..38101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS complement(38140..39402) product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U4 transl_table 11 codon_start 1 locus_tag LOCUS_05500 gene purA CDS complement(39404..39751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS complement(39752..40189) product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 transl_table 11 codon_start 1 locus_tag LOCUS_05520 gene fur CDS complement(40231..42423) product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 transl_table 11 codon_start 1 locus_tag LOCUS_05530 gene relA CDS complement(42431..43711) product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962840.1 transl_table 11 codon_start 1 locus_tag LOCUS_05540 gene fahA CDS complement(43705..44979) product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXG2 transl_table 11 codon_start 1 locus_tag LOCUS_05550 gene glyA CDS 45072..46664 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989531.1 transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 46674..47366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963400.1 transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 47377..48309 product putative glycosyltransferase YkcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34319 transl_table 11 codon_start 1 locus_tag LOCUS_05580 gene ykcC CDS 48306..48920 product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71785 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 48924..49583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407619.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 49583..50479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WLW7 transl_table 11 codon_start 1 locus_tag LOCUS_05610 CDS 50484..51608 product dTDP-4-amino-4,6-dideoxy-D-glucose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963398.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS complement(52103..52567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 52673..52879 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 52937..55309 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 gene wzc CDS 55315..56400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS 56397..56963 product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545779.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 sequence010 source 1..45875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 553..1329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS 1326..3362 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203283.1 transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 3696..4202 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS 4213..4515 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 4532..4987 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS complement(5008..7713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(7766..9340) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(9351..12533) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405543.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 CDS 12787..13152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(13180..14442) product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWE2 transl_table 11 codon_start 1 locus_tag LOCUS_05770 gene lysC CDS complement(14497..15792) product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81GN5 transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS complement(15796..16005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 16157..17167 product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KP35 transl_table 11 codon_start 1 locus_tag LOCUS_05800 gene fbp CDS 17157..20489 product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW35 transl_table 11 codon_start 1 locus_tag LOCUS_05810 gene mfd CDS complement(20486..21826) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 transl_table 11 codon_start 1 locus_tag LOCUS_05820 gene accC CDS complement(21845..22360) product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 gene accB CDS complement(22424..23410) product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NV1 transl_table 11 codon_start 1 locus_tag LOCUS_05840 gene fabH CDS complement(23407..24345) product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 transl_table 11 codon_start 1 locus_tag LOCUS_05850 gene plsX CDS complement(24355..24546) product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H261 transl_table 11 codon_start 1 locus_tag LOCUS_05860 gene rpmF CDS complement(24567..25082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770281.1 transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS complement(25133..26032) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS 26159..28813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS 28854..29291 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS 29372..30199 product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 transl_table 11 codon_start 1 locus_tag LOCUS_05910 gene uspA CDS 30215..31915 product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PM9 transl_table 11 codon_start 1 locus_tag LOCUS_05920 gene lysS CDS 31988..33268 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 33331..34734 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 34781..35956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964009.1 transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(36140..36337) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 36462..37679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05970 CDS 37685..38704 product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107967.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS 38697..40616 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene yyaL CDS 40613..41506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 41511..41750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 41754..43199 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 transl_table 11 codon_start 1 locus_tag LOCUS_06020 CDS 43224..43652 product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 transl_table 11 codon_start 1 locus_tag LOCUS_06030 CDS 43673..44656 product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66954 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 44653..45357 product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 gene lipB sequence011 source 1..44783 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(477..1361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403756.1 transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS complement(1368..3239) product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVK0 transl_table 11 codon_start 1 locus_tag LOCUS_06070 gene mnmG CDS complement(3261..3689) product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2M2 transl_table 11 codon_start 1 locus_tag LOCUS_06080 gene ybeY CDS complement(3693..4109) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06090 CDS complement(4102..7131) product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS 7527..7967 product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS 7980..8795 product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZC86 transl_table 11 codon_start 1 locus_tag LOCUS_06120 gene hemF CDS 8799..9284 product phenylacetate-CoA oxygenase subunit PaaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189197.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 9363..9749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS complement(9916..10773) product endo-1,4-beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS complement(11659..12153) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS 12349..15942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS 16007..18499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 18628..19326 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 19432..20052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS 20369..20662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 CDS 21428..21835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS 22087..22521 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 22505..22930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS complement(23449..26973) product copper transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(26983..28032) product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000484214.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 CDS complement(28029..29354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS complement(29351..29890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 30069..31454 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T2 transl_table 11 codon_start 1 locus_tag LOCUS_06290 gene asnS CDS 31580..32938 product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964339.1 transl_table 11 codon_start 1 locus_tag LOCUS_06300 gene rpoN CDS 32938..33597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962552.1 transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS complement(33587..34594) product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962575.1 transl_table 11 codon_start 1 locus_tag LOCUS_06320 gene galE CDS complement(34760..35125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS 35139..35819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(35816..38236) product prevent-host-death protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107799.1 transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(38375..39055) product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 transl_table 11 codon_start 1 locus_tag LOCUS_06360 gene purQ CDS 40142..40327 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(40328..41608) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2F2 transl_table 11 codon_start 1 locus_tag LOCUS_06380 gene purD CDS 41740..42078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 42078..44357 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 transl_table 11 codon_start 1 locus_tag LOCUS_06400 sequence012 source 1..44753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 12..85 product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 CDS complement(110..1129) product arabinogalactan endo-beta-1,4-galactanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PB67 transl_table 11 codon_start 1 locus_tag LOCUS_06410 gene galA CDS 1306..2211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 2213..3718 product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A287 transl_table 11 codon_start 1 locus_tag LOCUS_06430 gene gpmI CDS complement(3722..5440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS 5555..6940 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS 6942..7382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 7447..7773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 7774..8115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS complement(8116..9327) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(9320..10087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(10128..11873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(11845..12288) product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2C9 transl_table 11 codon_start 1 locus_tag LOCUS_06520 gene dut CDS complement(12293..13807) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769160.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(13812..14585) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962230.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 gene crt CDS complement(14860..15195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS 15299..16186 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A165 transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 16179..17195 product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVW9 transl_table 11 codon_start 1 locus_tag LOCUS_06570 gene pheS CDS complement(17204..18247) product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249732.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS complement(18249..19673) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW47 transl_table 11 codon_start 1 locus_tag LOCUS_06590 gene pykA CDS complement(19675..20094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS complement(20134..21552) product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ4 transl_table 11 codon_start 1 locus_tag LOCUS_06610 gene gatA CDS complement(21558..21734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS complement(21776..22192) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(22450..25194) product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962462.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 gene polA CDS complement(25194..26210) product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 transl_table 11 codon_start 1 locus_tag LOCUS_06650 CDS 26325..27842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06660 CDS 27903..29438 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 transl_table 11 codon_start 1 locus_tag LOCUS_06670 gene pcd CDS complement(29448..30422) product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 transl_table 11 codon_start 1 locus_tag LOCUS_06680 gene trpS CDS complement(30770..31612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(31698..31997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS complement(31990..32283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS complement(32295..32534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS 32606..33343 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS 33333..33620 product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(33623..34036) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962234.1 transl_table 11 codon_start 1 locus_tag LOCUS_06750 gene yqiW CDS complement(34108..34548) product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB8 transl_table 11 codon_start 1 locus_tag LOCUS_06760 gene tadA CDS 34625..35227 product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 transl_table 11 codon_start 1 locus_tag LOCUS_06770 gene sodA CDS 35280..35744 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(35714..36283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS complement(36317..37102) product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962773.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 37406..39046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 CDS 39124..40866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(40868..42802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS 42996..43631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS 43636..43866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS 43962..44459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS 44466..44732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 sequence013 source 1..42701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 326..1150 product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene rplB CDS 1154..1420 product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 transl_table 11 codon_start 1 locus_tag LOCUS_06890 gene rpsS CDS 1441..1833 product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ94 transl_table 11 codon_start 1 locus_tag LOCUS_06900 gene rplV CDS 1843..2535 product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ93 transl_table 11 codon_start 1 locus_tag LOCUS_06910 gene rpsC CDS 2545..2964 product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A483 transl_table 11 codon_start 1 locus_tag LOCUS_06920 gene rplP CDS 2979..3194 product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ91 transl_table 11 codon_start 1 locus_tag LOCUS_06930 gene rpmC CDS 3200..3451 product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ90 transl_table 11 codon_start 1 locus_tag LOCUS_06940 gene rpsQ CDS 3457..3825 product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ89 transl_table 11 codon_start 1 locus_tag LOCUS_06950 gene rplN CDS 3838..4167 product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CRH1 transl_table 11 codon_start 1 locus_tag LOCUS_06960 gene rplX CDS 4164..4712 product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ87 transl_table 11 codon_start 1 locus_tag LOCUS_06970 gene rplE CDS 4724..5011 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIG9 transl_table 11 codon_start 1 locus_tag LOCUS_06980 gene rpsN CDS 5031..5429 product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A490 transl_table 11 codon_start 1 locus_tag LOCUS_06990 gene rpsH CDS 5440..5994 product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ84 transl_table 11 codon_start 1 locus_tag LOCUS_07000 gene rplF CDS 6004..6357 product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MSX0 transl_table 11 codon_start 1 locus_tag LOCUS_07010 gene rplR CDS 6367..6882 product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ82 transl_table 11 codon_start 1 locus_tag LOCUS_07020 gene rpsE CDS 6893..7069 product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NM6 transl_table 11 codon_start 1 locus_tag LOCUS_07030 gene rpmD CDS 7091..7561 product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A495 transl_table 11 codon_start 1 locus_tag LOCUS_07040 gene rplO CDS 7558..8889 product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A496 transl_table 11 codon_start 1 locus_tag LOCUS_07050 gene secY CDS 8900..9697 product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ7 transl_table 11 codon_start 1 locus_tag LOCUS_07060 gene map CDS 9690..9908 product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 transl_table 11 codon_start 1 locus_tag LOCUS_07070 gene infA CDS 10037..10414 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NN2 transl_table 11 codon_start 1 locus_tag LOCUS_07080 gene rpsM CDS 10433..10816 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ75 transl_table 11 codon_start 1 locus_tag LOCUS_07090 gene rpsK CDS 10892..11497 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ74 transl_table 11 codon_start 1 locus_tag LOCUS_07100 gene rpsD CDS 11522..12514 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ73 transl_table 11 codon_start 1 locus_tag LOCUS_07110 gene rpoA CDS 12544..13128 product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ72 transl_table 11 codon_start 1 locus_tag LOCUS_07120 gene rplQ CDS 13226..14320 product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ71 transl_table 11 codon_start 1 locus_tag LOCUS_07130 gene carA CDS 14343..15632 product enolase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG25 transl_table 11 codon_start 1 locus_tag LOCUS_07140 gene eno2 CDS 15625..16401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 16451..18676 product isocitrate dehydrogenase, NADP-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS complement(18673..20721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404282.1 transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS complement(20845..21657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS complement(21690..22370) product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0X7 transl_table 11 codon_start 1 locus_tag LOCUS_07190 gene trmB CDS complement(22351..22728) product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 gene gldC CDS complement(22715..23740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS 23803..24681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 24734..25516 product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1A8 transl_table 11 codon_start 1 locus_tag LOCUS_07230 gene nadE CDS complement(25517..25834) product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964488.1 transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(25836..26846) product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H064 transl_table 11 codon_start 1 locus_tag LOCUS_07250 CDS complement(26877..27356) product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC3 transl_table 11 codon_start 1 locus_tag LOCUS_07260 gene purE CDS complement(27356..28519) product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZC2 transl_table 11 codon_start 1 locus_tag LOCUS_07270 gene purK CDS 28617..29159 product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963490.1 transl_table 11 codon_start 1 locus_tag LOCUS_07280 gene hpt CDS 29161..29730 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZB9 transl_table 11 codon_start 1 locus_tag LOCUS_07290 gene adk CDS 29732..30733 product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XA5 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene obg CDS 30720..31292 product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 31289..31657 product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83LX0 transl_table 11 codon_start 1 locus_tag LOCUS_07320 gene crcB CDS complement(31650..31895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(31892..32389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(32386..33723) product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW07 transl_table 11 codon_start 1 locus_tag LOCUS_07350 gene pyrC1 CDS complement(33713..34426) product dolichol-phosphate mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760550.1 transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 34617..35864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 35866..36192 product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 transl_table 11 codon_start 1 locus_tag LOCUS_07380 gene ogt2 CDS 36225..37340 product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H062 transl_table 11 codon_start 1 locus_tag LOCUS_07390 gene mrp CDS 37315..37578 product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933446.1 transl_table 11 codon_start 1 locus_tag LOCUS_07400 CDS complement(37580..40015) product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 40167..41045 product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 41042..42520 product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 transl_table 11 codon_start 1 locus_tag LOCUS_07430 gene crtI sequence014 source 1..39382 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 380..703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS 700..3351 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS 3361..3867 product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963563.1 transl_table 11 codon_start 1 locus_tag LOCUS_07460 gene pyrR2 CDS complement(3871..4428) product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D77 transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(4433..5485) product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 5527..5880 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 transl_table 11 codon_start 1 locus_tag LOCUS_07490 gene fdx1 CDS 5908..6756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS 6867..7940 product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXC2 transl_table 11 codon_start 1 locus_tag LOCUS_07510 gene serC CDS 7943..8899 product 3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 transl_table 11 codon_start 1 locus_tag LOCUS_07520 gene serA CDS 8919..10133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS complement(10130..11341) product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY30 transl_table 11 codon_start 1 locus_tag LOCUS_07540 gene sucC CDS 11466..12119 product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 transl_table 11 codon_start 1 locus_tag LOCUS_07550 gene lolD CDS complement(12111..13109) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 13306..14958 product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225041.1 transl_table 11 codon_start 1 locus_tag LOCUS_07570 gene fadD-2 CDS complement(14974..16617) product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 16713..17849 product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(17834..19933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 20094..22046 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 transl_table 11 codon_start 1 locus_tag LOCUS_07610 gene bfmBA CDS 22049..22855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 22864..23778 product DUF2279 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963344.1 transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 23839..24594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123952.1 transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 24666..25391 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(25397..26515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 26664..27422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 27513..28991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS 29065..29580 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(29638..30510) product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY93 transl_table 11 codon_start 1 locus_tag LOCUS_07700 gene sucD CDS complement(30586..32793) product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109211.1 transl_table 11 codon_start 1 locus_tag LOCUS_07710 gene rpsA CDS 32960..34003 product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H164 transl_table 11 codon_start 1 locus_tag LOCUS_07720 gene ribD CDS 33996..34865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(34869..35759) product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0M8 transl_table 11 codon_start 1 locus_tag LOCUS_07740 gene dapA CDS complement(35768..36676) product DUF4835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS complement(36667..37857) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 transl_table 11 codon_start 1 locus_tag LOCUS_07760 CDS complement(37863..38201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS complement(38191..39018) product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788200.1 transl_table 11 codon_start 1 locus_tag LOCUS_07780 sequence015 source 1..38550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS complement(1027..1236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS complement(1299..1568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(1968..2348) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(2432..3076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS complement(3494..4210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404631.1 transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 4457..5035 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS complement(5133..5555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS complement(5749..6117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(6104..6400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07880 CDS 6519..6725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS complement(7131..7298) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(7295..7465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(7580..9118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(9153..9659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 CDS 9824..10363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS complement(10369..11121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 11233..13674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 13811..14896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS 15169..16272 product sodium/hydrogen exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121670.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 gene ncx CDS 16458..20567 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07990 CDS 20577..24704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 24818..25261 product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 CDS complement(25276..26280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 26356..26835 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340546.1 transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(27014..29893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 29913..30053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08050 CDS 30260..30868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS 31470..33665 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 transl_table 11 codon_start 1 locus_tag LOCUS_08070 gene phuR CDS 33755..34024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS 34097..34510 product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095260.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 34765..34956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 35412..35873 product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 35883..36380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS 36381..37601 product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757677.1 transl_table 11 codon_start 1 locus_tag LOCUS_08130 sequence016 source 1..36708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(865..2007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS complement(2017..2928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(2939..4432) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS complement(4437..7547) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108629.1 transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS 7722..8969 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(8989..9567) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X24 transl_table 11 codon_start 1 locus_tag LOCUS_08190 gene coaE CDS complement(9571..9897) product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(9914..10339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(10342..11280) product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YY9 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(11273..12301) product leucine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962697.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene vdh CDS 12525..14219 product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS 14288..14611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 14831..15646 product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 transl_table 11 codon_start 1 locus_tag LOCUS_08260 gene parA CDS 15636..16514 product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963268.1 transl_table 11 codon_start 1 locus_tag LOCUS_08270 gene parB CDS 16511..17062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08280 CDS 17118..18611 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZ75 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS 18639..19790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS complement(19787..20818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(20890..21885) product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45791 transl_table 11 codon_start 1 locus_tag LOCUS_08320 gene recA CDS complement(21938..22390) product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963239.1 transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS 22492..23301 product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXK5 transl_table 11 codon_start 1 locus_tag LOCUS_08340 gene murQ CDS complement(23292..24827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(24828..26018) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVL5 transl_table 11 codon_start 1 locus_tag LOCUS_08360 gene pgk CDS 26099..26854 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462044.1 transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(26859..27323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(27386..28198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS complement(28195..29028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS 29116..29928 product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A033 transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS 29928..31214 product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1L7 transl_table 11 codon_start 1 locus_tag LOCUS_08420 gene murF CDS 31216..31359 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS 31360..31680 product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY02 transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS complement(31681..32466) product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 transl_table 11 codon_start 1 locus_tag LOCUS_08450 gene zupT CDS complement(32466..33152) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962874.1 transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS complement(33301..34617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS 34721..36175 product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97J51 transl_table 11 codon_start 1 locus_tag LOCUS_08480 misc_feature complement(36155..>36708) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878820.1:aspartate aminotransferase family protein locus_tag LOCUS_08490 sequence017 source 1..36240 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 393..1004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS 1014..1802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS 1799..2821 product L-asparaginase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964381.1 transl_table 11 codon_start 1 locus_tag LOCUS_08520 gene ansA CDS 2926..3768 product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 3789..4385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 4385..5080 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 5090..5551 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(5535..6440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 6490..7479 product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1T4 transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 7476..8036 product cobalamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 CDS 8111..8332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 8426..11818 product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX63 transl_table 11 codon_start 1 locus_tag LOCUS_08610 gene secA CDS 11954..13780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(13782..15215) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 CDS complement(15216..16154) product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 transl_table 11 codon_start 1 locus_tag LOCUS_08640 CDS complement(16158..17513) product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0H9 transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(17565..18329) product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVR5 transl_table 11 codon_start 1 locus_tag LOCUS_08660 gene rsmA CDS complement(18329..20185) product antibiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963277.1 transl_table 11 codon_start 1 locus_tag LOCUS_08670 gene msbA CDS 20269..20601 product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 20598..21365 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962587.1 transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 21365..21784 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 21781..23001 product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 transl_table 11 codon_start 1 locus_tag LOCUS_08710 gene ald CDS complement(23010..23990) product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962508.1 transl_table 11 codon_start 1 locus_tag LOCUS_08720 gene pdhB CDS 24171..24911 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 gene etfB CDS 24914..25858 product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 transl_table 11 codon_start 1 locus_tag LOCUS_08740 gene etfA CDS 25923..26516 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 26455..26979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 26984..28297 product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 transl_table 11 codon_start 1 locus_tag LOCUS_08770 gene yeiM CDS 28375..29199 product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWH3 transl_table 11 codon_start 1 locus_tag LOCUS_08780 gene thyA CDS 29196..29705 product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS complement(29702..30940) product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C2 transl_table 11 codon_start 1 locus_tag LOCUS_08800 gene clpX CDS complement(30944..31627) product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C3 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene clpP CDS complement(31658..33016) product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764110.1 transl_table 11 codon_start 1 locus_tag LOCUS_08820 tRNA complement(33079..33163) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 CDS 33273..34166 product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964439.1 transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 34176..34523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS 34537..35925 product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071598.1 transl_table 11 codon_start 1 locus_tag LOCUS_08850 gene atoE tRNA 36000..36075 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 sequence018 source 1..31502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 743..1327 product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101673.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS 1402..1761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS 2006..2674 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962272.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 gene sdhC CDS 2680..4683 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962273.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 gene sdhA CDS 4691..5437 product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 transl_table 11 codon_start 1 locus_tag LOCUS_08900 gene sdhB CDS complement(5469..5960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 CDS complement(6050..7000) product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NU8 transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS 7160..8950 product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1S4 transl_table 11 codon_start 1 locus_tag LOCUS_08930 gene lepA CDS complement(8947..12381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962474.1 transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS 12583..13569 product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(13571..14179) product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY8 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene nadD CDS complement(14176..14760) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWI8 transl_table 11 codon_start 1 locus_tag LOCUS_08970 gene gmk CDS complement(14757..15629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(15655..16545) product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962522.1 transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS 16612..17754 product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 17757..19913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS 19918..21027 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(21024..21956) product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW76 transl_table 11 codon_start 1 locus_tag LOCUS_09030 gene ribF CDS 22113..23618 product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV9 transl_table 11 codon_start 1 locus_tag LOCUS_09040 gene atpD CDS 23630..23863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS complement(23860..24411) product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A293 transl_table 11 codon_start 1 locus_tag LOCUS_09060 gene rnhB CDS complement(24438..25964) product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1P8 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene glyQS CDS 26058..26642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 CDS 27051..28091 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962627.1 transl_table 11 codon_start 1 locus_tag LOCUS_09090 gene nrdB CDS 28109..30412 product ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU5 transl_table 11 codon_start 1 locus_tag LOCUS_09100 gene nrdA CDS 30444..31292 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531695.1 transl_table 11 codon_start 1 locus_tag LOCUS_09110 sequence019 source 1..29391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(497..1222) product xanthorhodopsin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140202.1 transl_table 11 codon_start 1 locus_tag LOCUS_09120 CDS complement(1374..1556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS complement(1623..2276) product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C7B1 transl_table 11 codon_start 1 locus_tag LOCUS_09140 gene cysH CDS complement(2367..3449) product beta-xylanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E346 transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(3813..4256) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 tRNA complement(4849..4923) product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS 5053..5964 product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS 5970..7202 product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 CDS complement(7192..8058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09190 CDS complement(8074..9636) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09200 tRNA complement(9696..9767) product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(9813..10163) product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 gene folB CDS complement(10166..11710) product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2H7 transl_table 11 codon_start 1 locus_tag LOCUS_09220 gene gltX CDS complement(11792..14584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS complement(14594..15538) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 CDS complement(15543..17804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 CDS 18185..19084 product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2U5 transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 19086..19316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 transl_table 11 codon_start 1 locus_tag LOCUS_09270 gene fjo13 CDS 19323..20114 product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L9 transl_table 11 codon_start 1 locus_tag LOCUS_09280 gene uppP CDS 20111..20803 product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650L8 transl_table 11 codon_start 1 locus_tag LOCUS_09290 gene truB CDS 20841..21890 product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW82 transl_table 11 codon_start 1 locus_tag LOCUS_09300 gene queA CDS 21925..22974 product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1B8 transl_table 11 codon_start 1 locus_tag LOCUS_09310 gene rlmN CDS complement(22963..24336) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020392.1 transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(24344..25333) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX07 transl_table 11 codon_start 1 locus_tag LOCUS_09330 gene asd CDS 25383..27170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 27243..28214 product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 sequence020 source 1..28678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..1663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS complement(1667..2785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 CDS complement(2791..3798) product N,N'-diacetyllegionaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8T1 transl_table 11 codon_start 1 locus_tag LOCUS_09380 gene legI CDS complement(3791..4492) product spore coat polysaccharide biosynthesis protein SpsF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39626 transl_table 11 codon_start 1 locus_tag LOCUS_09390 gene spsF CDS complement(4489..4968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(5034..5903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS complement(6035..6931) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878124.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS 7133..8302 product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 transl_table 11 codon_start 1 locus_tag LOCUS_09430 gene putA CDS complement(8294..9118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(9096..9644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962699.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 CDS complement(9656..11893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(12100..12747) product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWQ2 transl_table 11 codon_start 1 locus_tag LOCUS_09470 gene rsmG CDS complement(12734..13351) product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene sigW CDS complement(13352..14440) product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 CDS 14528..15658 product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX92 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene tgt CDS 15668..16759 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761518.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS complement(16760..17422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS complement(17444..18748) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW32 transl_table 11 codon_start 1 locus_tag LOCUS_09530 gene ahcY CDS complement(18822..20489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09540 CDS complement(20483..21163) product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51082 transl_table 11 codon_start 1 locus_tag LOCUS_09550 gene ung CDS 21577..22242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 22242..23105 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZL9 transl_table 11 codon_start 1 locus_tag LOCUS_09570 gene lipA CDS 23305..26337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS 26417..27418 product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H007 transl_table 11 codon_start 1 locus_tag LOCUS_09590 gene gapA3 CDS complement(27413..28036) product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 transl_table 11 codon_start 1 locus_tag LOCUS_09600 gene lpxH sequence021 source 1..28610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1619 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384833.1:GlcNAc-PI de-N-acetylase locus_tag LOCUS_09610 CDS 1725..3449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09620 CDS complement(3436..4362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS 4348..4713 product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5K3 transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 4706..5422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS complement(5415..6116) product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9CHD0 transl_table 11 codon_start 1 locus_tag LOCUS_09660 gene rnc CDS complement(6109..7362) product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZV8 transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS complement(7395..7628) product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW43 transl_table 11 codon_start 1 locus_tag LOCUS_09680 gene acpP CDS 7764..8327 product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962376.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 gene purN CDS 8320..9132 product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 CDS 9132..9605 product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW41 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene rnhA CDS 9605..10636 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 gene fadB5 CDS 10636..11316 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962268.1 transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(11322..12071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405037.1 transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 12148..12927 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766194.1 transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS complement(12911..14440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS complement(14437..14895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107997.1 transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 14972..15730 product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYT7 transl_table 11 codon_start 1 locus_tag LOCUS_09780 CDS complement(15882..16733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 CDS complement(16806..17402) product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963562.1 transl_table 11 codon_start 1 locus_tag LOCUS_09800 gene tpm CDS complement(17383..18426) product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947748.1 transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(18530..21670) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 tRNA complement(22055..22131) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 CDS 22196..24514 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS 24590..25117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS 25138..26259 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 26268..26753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 CDS 26768..27916 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204968.1 transl_table 11 codon_start 1 locus_tag LOCUS_09870 sequence022 source 1..28451 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1021..1809) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 CDS complement(1871..3871) product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0Z9 transl_table 11 codon_start 1 locus_tag LOCUS_09890 gene hutU CDS complement(3892..4053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS 4185..5537 product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB2 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene gdhA CDS 5547..6737 product 2-amino-3-ketobutyrate coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW00 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene kbl CDS 6823..7269 product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU4 transl_table 11 codon_start 1 locus_tag LOCUS_09930 gene rplM CDS 7277..7663 product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P28 transl_table 11 codon_start 1 locus_tag LOCUS_09940 gene rpsI CDS 7770..8543 product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64P29 transl_table 11 codon_start 1 locus_tag LOCUS_09950 gene rpsB CDS 8556..9377 product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 gene tsf CDS 9438..10145 product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 transl_table 11 codon_start 1 locus_tag LOCUS_09970 gene pyrH CDS 10156..10716 product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS4 transl_table 11 codon_start 1 locus_tag LOCUS_09980 gene frr CDS 10819..11064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(11104..11991) product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS 12208..14844 product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 14847..15707 product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEU4 transl_table 11 codon_start 1 locus_tag LOCUS_10020 gene rmlA CDS 15714..16679 product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(16676..17575) product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962832.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS 17752..18219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS 18333..21059 product 2-oxoglutarate dehydrogenase subunit E1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 transl_table 11 codon_start 1 locus_tag LOCUS_10060 gene sucA CDS 21064..22281 product dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H289 transl_table 11 codon_start 1 locus_tag LOCUS_10070 gene sucB CDS complement(22287..23546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(23548..26130) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS 26202..27257 product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 sequence023 source 1..28201 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..636 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PZ0:zinc metalloprotease locus_tag LOCUS_10110 CDS 724..1638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(1642..4158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 CDS complement(4165..5727) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene pafA CDS complement(5837..7630) product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 gene typA CDS 7758..8210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS complement(8207..9700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS 9867..10652 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123022.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 gene dltE CDS 10792..11943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 11947..13008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(13013..13492) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS complement(13592..13963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS complement(13960..14526) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10230 CDS complement(14598..15311) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS complement(15315..16127) product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(16124..16867) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS 16992..17876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS 17869..19221 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10280 CDS complement(19366..21273) product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 transl_table 11 codon_start 1 locus_tag LOCUS_10290 gene wbtH CDS complement(21368..21775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(21826..22626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 CDS 22779..25316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS 25322..26047 product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYY2 transl_table 11 codon_start 1 locus_tag LOCUS_10330 sequence024 source 1..27665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 438..1022 product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 transl_table 11 codon_start 1 locus_tag LOCUS_10340 gene ribE CDS complement(1025..1657) product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738964.1 transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(1654..2139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10360 CDS 2220..3344 product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 CDS 3341..4108 product arylformamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 CDS 4162..4650 product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004791887.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 gene lrp CDS complement(4639..7068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(7065..7775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(7759..9216) product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962229.1 transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(9266..10063) product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D6 transl_table 11 codon_start 1 locus_tag LOCUS_10430 gene atpG CDS complement(10144..11724) product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D7 transl_table 11 codon_start 1 locus_tag LOCUS_10440 gene atpA CDS complement(11735..12292) product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA5 transl_table 11 codon_start 1 locus_tag LOCUS_10450 gene atpH CDS complement(12296..12796) product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D9 transl_table 11 codon_start 1 locus_tag LOCUS_10460 gene atpF CDS complement(12865..13077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(13107..14195) product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2E1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 gene atpB CDS complement(14628..14828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS 14980..17394 product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202791.1 transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS 17398..18093 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 gene atoD CDS 18100..18762 product succinyl-CoA--3-ketoacid-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 transl_table 11 codon_start 1 locus_tag LOCUS_10520 gene atoA CDS complement(19377..19595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10530 CDS 19864..20181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10540 CDS complement(20184..20882) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 CDS complement(20879..23422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS complement(23515..24027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS complement(24032..24901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS complement(24902..25171) product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(25175..26020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(26045..26380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS 26484..27002 product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107875.1 transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(26995..27663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 sequence025 source 1..26678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 41..976 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118537.1 transl_table 11 codon_start 1 locus_tag LOCUS_10640 gene galE CDS 976..2859 product asparagine synthetase [glutamine-hydrolyzing] 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54420 transl_table 11 codon_start 1 locus_tag LOCUS_10650 gene asnB CDS 2856..3986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS 3979..4530 product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331372.1 transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 4527..5267 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10680 gene wbyL CDS complement(5264..6247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS 6432..7409 product 2-nitropropane dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS 7461..9560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(9562..10833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS complement(10869..12404) product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX96 transl_table 11 codon_start 1 locus_tag LOCUS_10730 gene dnaB CDS 12473..13753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(13754..14704) product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX95 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene accA CDS complement(14775..16253) product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962990.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(16896..18269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(18863..19534) product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX2 transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(19555..22356) product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 transl_table 11 codon_start 1 locus_tag LOCUS_10790 gene uvrA2 CDS complement(22376..23479) product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286457.1 transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(23482..24021) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 CDS complement(24012..26534) product tyrosine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202999.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 sequence026 source 1..25939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..591) product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI4 transl_table 11 codon_start 1 locus_tag LOCUS_10830 gene tdk CDS complement(613..2652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(2639..3943) product glutamate:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 gene gltP CDS complement(3940..5022) product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXP5 transl_table 11 codon_start 1 locus_tag LOCUS_10860 gene aroC CDS complement(5032..5733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS complement(5736..10643) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10880 CDS 10714..11769 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945949.1 transl_table 11 codon_start 1 locus_tag LOCUS_10890 CDS complement(11758..12318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 12426..13214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS 13229..13900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(13901..14365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS 14475..16217 product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948922.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 tRNA complement(16471..16545) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(16599..17510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(17511..18845) product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(18916..20601) product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 20724..21017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 21021..21299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 21304..22293 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS 22461..23504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS 23498..24592 product glycosyltransferase WbpH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115615.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 gene wbpH CDS complement(25063..25233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 25487..25834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 sequence027 source 1..25714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 426..578 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 CDS complement(713..2611) product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X01 transl_table 11 codon_start 1 locus_tag LOCUS_11060 gene dnaK CDS complement(2734..4206) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 gene accC CDS complement(4190..5068) product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM5 transl_table 11 codon_start 1 locus_tag LOCUS_11080 gene folD CDS complement(5074..6420) product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZM6 transl_table 11 codon_start 1 locus_tag LOCUS_11090 gene ffh CDS 6579..7466 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 7497..8204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 8197..8805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 8889..11354 product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963704.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 gene ftsK CDS 11351..12013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS complement(12010..13656) product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0N3 transl_table 11 codon_start 1 locus_tag LOCUS_11150 gene recN CDS complement(13659..15824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(15821..16228) product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS 16247..17035 product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784454.1 transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS 17010..17960 product metallophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963938.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 CDS 18129..19559 product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYW8 transl_table 11 codon_start 1 locus_tag LOCUS_11200 gene dnaA CDS 19570..20043 product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963341.1 transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 20033..20731 product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(20746..21624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS complement(21614..22051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS complement(22138..23124) product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 transl_table 11 codon_start 1 locus_tag LOCUS_11250 gene fjo19 CDS complement(23157..23747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS complement(23765..24676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS complement(24740..25030) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 transl_table 11 codon_start 1 locus_tag LOCUS_11280 sequence028 source 1..25341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..882 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797236.1:membrane protein locus_tag LOCUS_11290 CDS complement(879..2144) product hemolysin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS complement(2145..2345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11310 CDS complement(2346..2903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11320 CDS complement(2900..4198) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(4210..5517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(5555..6283) product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZL1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 gene coaX CDS complement(6360..8891) product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945413.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 9038..10417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11370 CDS complement(10411..13008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11380 CDS complement(13024..14289) product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404047.1 transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS complement(14372..15160) product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962746.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 15231..16049 product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYZ5 transl_table 11 codon_start 1 locus_tag LOCUS_11410 gene tatC CDS 16073..16813 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 gene lptB CDS 16815..17495 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 17560..17952 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS 18040..18597 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS 18651..19364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 19429..21165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS 21186..23627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(23624..24088) product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1D6 transl_table 11 codon_start 1 locus_tag LOCUS_11490 gene recX CDS complement(24088..25074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964525.1 transl_table 11 codon_start 1 locus_tag LOCUS_11500 sequence029 source 1..23552 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(327..995) product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000209109.1 transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(999..1430) product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 CDS complement(1443..2012) product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS 2128..4257 product catalase-peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KRS6 transl_table 11 codon_start 1 locus_tag LOCUS_11540 gene katG tRNA complement(4306..4390) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS 4500..5678 product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962929.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 CDS complement(5711..6778) product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 transl_table 11 codon_start 1 locus_tag LOCUS_11560 gene ilvK CDS 6840..8741 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS complement(8803..13257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS 13270..14298 product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 transl_table 11 codon_start 1 locus_tag LOCUS_11590 gene tsaD CDS complement(14295..17420) product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene ccsBA CDS 17588..18529 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001102581.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS 18519..19169 product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 19241..19768 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 19765..20541 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963540.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 20531..21049 product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963541.1 transl_table 11 codon_start 1 locus_tag LOCUS_11650 gene kdsC CDS 21043..21894 product ubiquinone biosynthesis protein UbiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962485.1 transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS 21891..22487 product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH5 transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(22480..22896) product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H157 transl_table 11 codon_start 1 locus_tag LOCUS_11680 gene aroQ CDS complement(22930..23304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962264.1 transl_table 11 codon_start 1 locus_tag LOCUS_11690 sequence030 source 1..22806 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(262..1122) product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG2 transl_table 11 codon_start 1 locus_tag LOCUS_11700 gene accD CDS complement(1130..2188) product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 gene fbaA CDS complement(2281..4725) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS 4750..5472 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 transl_table 11 codon_start 1 locus_tag LOCUS_11730 CDS complement(5469..6206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11740 CDS complement(6242..6973) product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWG7 transl_table 11 codon_start 1 locus_tag LOCUS_11750 gene menG CDS 7127..7909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS 7913..9007 product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS 9056..9976 product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 transl_table 11 codon_start 1 locus_tag LOCUS_11780 gene hemB CDS complement(9973..10734) product UPF0246 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43908 transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(10739..11461) product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E82 transl_table 11 codon_start 1 locus_tag LOCUS_11800 gene comB CDS complement(11458..12543) product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW3 transl_table 11 codon_start 1 locus_tag LOCUS_11810 gene gcvT CDS complement(12518..13627) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056101.1 transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS 13768..15648 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS 15691..16740 product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YM8 transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS 16727..17776 product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109390.1 transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS 17878..18276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 CDS 18263..20569 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 transl_table 11 codon_start 1 locus_tag LOCUS_11870 gene pepN misc_feature complement(20625..>22806) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108276.1:TonB-dependent receptor locus_tag LOCUS_11880 sequence031 source 1..21643 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(484..1359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766240.1 transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS complement(1404..2441) product luciferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528461.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 CDS complement(2626..3708) product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 transl_table 11 codon_start 1 locus_tag LOCUS_11910 gene pfkA CDS complement(3772..4116) product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123088.1 transl_table 11 codon_start 1 locus_tag LOCUS_11920 gene csaA CDS 4243..5628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088591.1 transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS 5675..6631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337458.1 transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS 6641..7798 product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYF0 transl_table 11 codon_start 1 locus_tag LOCUS_11950 gene purT CDS complement(7804..8367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 8519..10885 product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 10885..11790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS 11848..12798 product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962776.1 transl_table 11 codon_start 1 locus_tag LOCUS_11990 gene trxB1 CDS complement(12782..14035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 14169..14969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS 14984..15589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS 15602..16345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 16358..17701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 17805..18251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS 18264..18719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 CDS 18726..19070 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS 19205..19426 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS 19545..19742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS 19790..20527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 sequence032 source 1..21428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 563..3430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 3513..5093 product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene ggt CDS 5154..6596 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000160471.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 CDS 6586..7209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS 7209..8321 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(8323..9666) product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS 9766..11118 product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K7 transl_table 11 codon_start 1 locus_tag LOCUS_12170 gene nqrA CDS 11135..12373 product Na(+)-translocating NADH-quinone reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8K8 transl_table 11 codon_start 1 locus_tag LOCUS_12180 gene nqrB CDS 12375..13133 product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR9 transl_table 11 codon_start 1 locus_tag LOCUS_12190 gene nqrC CDS 13144..13845 product Na(+)-translocating NADH-quinone reductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8L0 transl_table 11 codon_start 1 locus_tag LOCUS_12200 gene nqrD CDS 13854..14468 product Na(+)-translocating NADH-quinone reductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UR7 transl_table 11 codon_start 1 locus_tag LOCUS_12210 gene nqrE CDS 14487..15782 product Na(+)-translocating NADH-quinone reductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWS0 transl_table 11 codon_start 1 locus_tag LOCUS_12220 gene nqrF CDS 15766..16797 product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64X44 transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(16794..16973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(16991..17197) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS 17275..18045 product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 18096..19307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 19406..20458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12280 sequence033 source 1..21294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..854 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787927.1:magnesium chelatase subunit I locus_tag LOCUS_12290 CDS 868..1731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 1728..2690 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS 2914..3708 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12320 CDS 3705..4865 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 transl_table 11 codon_start 1 locus_tag LOCUS_12330 CDS 4862..5695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS 5696..7474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS 7464..8219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 8219..8863 product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYL6 transl_table 11 codon_start 1 locus_tag LOCUS_12370 gene nth CDS 8866..9414 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS complement(9401..10207) product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889560.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS 10185..10436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS complement(10371..11345) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(11368..12333) product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34653 transl_table 11 codon_start 1 locus_tag LOCUS_12420 gene des CDS complement(12382..12960) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 13762..14757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS complement(14750..15592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS complement(15870..16862) product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833199.1 transl_table 11 codon_start 1 locus_tag LOCUS_12460 gene fabH CDS complement(16849..18123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001038124.1 transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(18113..18961) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181763.1 transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(18954..19940) product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783220.1 transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS 20133..21224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12500 sequence034 source 1..21039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(304..1737) product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118737.1 transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 1923..3284 product nucleoside-diphosphate sugar epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403679.1 transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 3287..3568 product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS 3540..4016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS 4013..4174 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 4272..5387 product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS 5384..5761 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 5862..6266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 CDS 6320..7465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS 7486..8514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(8519..9922) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203533.1 transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 10069..11052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(11049..11441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(11520..11789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS 11912..12211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 12295..13449 product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64QP0 transl_table 11 codon_start 1 locus_tag LOCUS_12660 gene leuA CDS 13442..14830 product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6L7 transl_table 11 codon_start 1 locus_tag LOCUS_12670 gene leuC CDS 14836..15441 product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789845.1 transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 15452..16513 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54354 transl_table 11 codon_start 1 locus_tag LOCUS_12690 gene leuB CDS complement(16527..17306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12700 CDS complement(17323..20736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 sequence035 source 1..20807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(305..1027) product metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883304.1 transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS complement(1148..1705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS 1866..2441 product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459816.1 transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 2643..3509 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962779.1 transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(3501..3701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(3702..4403) product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(4453..4926) product NADH:ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933738.1 transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS complement(5029..5460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(5491..5652) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS complement(5659..6126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS complement(6567..7172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(7187..7834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(7865..8116) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(8134..8880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(8966..9373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 CDS complement(9427..13740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12870 CDS complement(13768..15270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS complement(15267..16817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(16827..17321) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(17266..17937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12910 sequence036 source 1..20452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 362..1078 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS 1075..1845 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931754.1 transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS 1881..2780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS 2787..3152 product heat-shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(3215..3367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(3484..4956) product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8E9D5 transl_table 11 codon_start 1 locus_tag LOCUS_12970 gene ilvC CDS complement(4953..5483) product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene ilvH CDS complement(5485..7170) product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT6 transl_table 11 codon_start 1 locus_tag LOCUS_12990 gene ilvB CDS complement(7174..8841) product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWT7 transl_table 11 codon_start 1 locus_tag LOCUS_13000 gene ilvD CDS complement(8838..10505) product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706472.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 gene asnB CDS 10785..11387 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13020 CDS 11396..13594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS 13742..15016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS 15018..15752 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS 15755..16582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS 16726..17298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS complement(17358..18275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(18287..19969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13090 CDS complement(20045..20263) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13100 sequence037 source 1..20093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1054 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962645.1:alanine dehydrogenase locus_tag LOCUS_13110 CDS complement(1051..1701) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H188 transl_table 11 codon_start 1 locus_tag LOCUS_13120 gene rpe CDS complement(1760..2626) product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 gene rpoD CDS complement(2744..4891) product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A4N6 transl_table 11 codon_start 1 locus_tag LOCUS_13140 gene pnp CDS complement(4968..5237) product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A418 transl_table 11 codon_start 1 locus_tag LOCUS_13150 gene rpsO CDS complement(5317..6012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 CDS complement(6057..6701) product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0V1 transl_table 11 codon_start 1 locus_tag LOCUS_13170 gene pcm CDS 6834..7805 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 CDS 7853..8728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS 8725..10122 product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 10144..11049 product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS complement(11244..11840) product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS 11982..14762 product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6Y6 transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS complement(14764..16542) product xenobiotic ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963545.1 transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS complement(16532..17281) product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH6 transl_table 11 codon_start 1 locus_tag LOCUS_13250 gene truA CDS complement(17283..17972) product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A6 transl_table 11 codon_start 1 locus_tag LOCUS_13260 gene cmk CDS complement(18029..18403) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 transl_table 11 codon_start 1 locus_tag LOCUS_13270 CDS complement(18409..18969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 transl_table 11 codon_start 1 locus_tag LOCUS_13280 CDS 19075..19812 product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962887.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 19816..20028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 sequence038 source 1..19926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3199..4056) product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(4138..6369) product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD17 transl_table 11 codon_start 1 locus_tag LOCUS_13320 gene purL CDS complement(6897..7094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS 7303..7782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 7751..9406 product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 9503..10975 product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NW5 transl_table 11 codon_start 1 locus_tag LOCUS_13360 gene guaB CDS 10983..12929 product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 transl_table 11 codon_start 1 locus_tag LOCUS_13370 CDS 12933..13790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 13787..15124 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L5 transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 15334..17886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 sequence039 source 1..19874 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1000..1542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 1640..3136 product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H296 transl_table 11 codon_start 1 locus_tag LOCUS_13420 gene purH CDS 3146..4171 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964505.1 transl_table 11 codon_start 1 locus_tag LOCUS_13430 gene mreB CDS 4239..5018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS 5015..5530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13450 CDS 5530..7365 product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964508.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene pbpA CDS 7366..8697 product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964509.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene rodA CDS 8721..8918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13480 CDS complement(8919..9341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS 9610..10356 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 10353..11099 product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS complement(11151..12869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS complement(12997..14949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS complement(15056..16915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(16912..19800) product glycine dehydrogenase (aminomethyl-transferring) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZD2 transl_table 11 codon_start 1 locus_tag LOCUS_13550 gene gcvP sequence040 source 1..19188 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..4098 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_13560 CDS 4133..4975 product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 transl_table 11 codon_start 1 locus_tag LOCUS_13570 gene glpQ CDS complement(4965..7991) product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8W3 transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(7992..9221) product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 9331..10200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS 10207..11262 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 transl_table 11 codon_start 1 locus_tag LOCUS_13610 CDS 11267..11704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS 11729..14413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS complement(14410..15096) product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416112.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 15202..17193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS 17193..17615 product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455359.1 transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS 17615..18604 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 sequence041 source 1..18905 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1322..1600) product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H124 transl_table 11 codon_start 1 locus_tag LOCUS_13680 gene groS CDS complement(1729..2052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS complement(2055..2804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS complement(2798..3316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764536.1 transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(3317..4570) product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964082.1 transl_table 11 codon_start 1 locus_tag LOCUS_13720 CDS complement(4571..6040) product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H119 transl_table 11 codon_start 1 locus_tag LOCUS_13730 gene miaB CDS 6665..9094 product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H115 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene topA CDS 9095..10243 product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 transl_table 11 codon_start 1 locus_tag LOCUS_13750 gene fjo29 CDS 10430..11275 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_13760 gene porP CDS 11361..12854 product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 transl_table 11 codon_start 1 locus_tag LOCUS_13770 gene gldK CDS 12942..13811 product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 transl_table 11 codon_start 1 locus_tag LOCUS_13780 gene gldL CDS 13844..15853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 15856..16794 product gliding motility protein GldO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene gldN CDS 16843..18690 product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964069.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 sequence042 source 1..18708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1233 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403138.1:outer membrane protein locus_tag LOCUS_13820 CDS 1462..3531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS 3550..5697 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108749.1 transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS 6059..6208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13850 CDS 6205..7056 product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(7061..7738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964078.1 transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(7741..8988) product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0H4 transl_table 11 codon_start 1 locus_tag LOCUS_13880 gene hutI CDS complement(9273..10073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 transl_table 11 codon_start 1 locus_tag LOCUS_13890 gene fjo14 CDS 10157..11089 product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 transl_table 11 codon_start 1 locus_tag LOCUS_13900 gene phoH CDS 11096..12037 product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A004 transl_table 11 codon_start 1 locus_tag LOCUS_13910 gene purC CDS complement(12040..13248) product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64YT3 transl_table 11 codon_start 1 locus_tag LOCUS_13920 gene ribBA CDS complement(13285..14460) product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(14457..15653) product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021090.1 transl_table 11 codon_start 1 locus_tag LOCUS_13940 CDS complement(15628..17034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS complement(17136..17519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13960 tRNA 17671..17745 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS 17845..18471 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 sequence043 source 1..18164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 146..2344 product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963365.1 transl_table 11 codon_start 1 locus_tag LOCUS_13980 gene recQ1 CDS complement(2337..3248) product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963338.1 transl_table 11 codon_start 1 locus_tag LOCUS_13990 gene acdS CDS complement(3254..3568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962251.1 transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(3568..5406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(5429..5956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS complement(5964..7235) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962253.1 transl_table 11 codon_start 1 locus_tag LOCUS_14030 gene serS CDS complement(7342..7602) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1P8 transl_table 11 codon_start 1 locus_tag LOCUS_14040 gene rpmA CDS complement(7622..8071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS 8248..9498 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS complement(9495..10718) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H270 transl_table 11 codon_start 1 locus_tag LOCUS_14070 gene sufS CDS complement(10753..13092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(13312..13851) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS 14026..14625 product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 transl_table 11 codon_start 1 locus_tag LOCUS_14100 CDS complement(14622..15707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 transl_table 11 codon_start 1 locus_tag LOCUS_14110 CDS 15829..16785 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS 16789..17364 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 misc_feature complement(17417..>18164) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920406.1:heme-binding protein locus_tag LOCUS_14140 sequence044 source 1..18086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..678 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0KK77:fatty acid oxidation complex subunit alpha locus_tag LOCUS_14150 CDS 760..2622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 2615..3730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 CDS 4070..5053 product LPS biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108791.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS 5055..5591 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220466.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene tag CDS 5749..6381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS 6395..7585 product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H090 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene aspC2 CDS complement(7600..8169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963034.1 transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS complement(8169..9485) product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZF6 transl_table 11 codon_start 1 locus_tag LOCUS_14230 gene rimO CDS complement(9489..10457) product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9A1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 gene ftsY CDS complement(10530..10676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(10684..10866) product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TK2 transl_table 11 codon_start 1 locus_tag LOCUS_14260 gene rpmG CDS 10878..11456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 11453..11881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(11868..13289) product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945838.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene pepP CDS complement(13328..13564) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VWY1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene rpmB CDS complement(13619..15523) product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64T26 transl_table 11 codon_start 1 locus_tag LOCUS_14310 gene yidC CDS 15705..16250 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 CDS complement(16251..17468) product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 transl_table 11 codon_start 1 locus_tag LOCUS_14330 misc_feature complement(17461..>18086) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963825.1:MFS transporter locus_tag LOCUS_14340 sequence045 source 1..17786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(13..86) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 234..2648 product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYG2 transl_table 11 codon_start 1 locus_tag LOCUS_14350 gene pheT CDS 2650..3972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS complement(3961..4908) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 gene ltd CDS complement(4935..6056) product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H294 transl_table 11 codon_start 1 locus_tag LOCUS_14380 gene hflX CDS complement(6074..6430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS 6774..10034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS 10413..10628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 10700..11347 product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 11348..12427 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 transl_table 11 codon_start 1 locus_tag LOCUS_14430 gene fjo30 CDS 12500..12913 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 CDS complement(12906..13472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14450 CDS 13634..14602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS 14661..15485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 15476..16486 product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(16488..17102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14490 sequence046 source 1..16430 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3545..5947) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963716.1 transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS complement(6038..6817) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962703.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS complement(6863..8635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14520 CDS complement(8676..10739) product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918909.1 transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 10931..11212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS complement(11345..11767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 CDS complement(11902..12624) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964101.1 transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS complement(12625..12903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 12803..13354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 13477..16293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14590 sequence047 source 1..15573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(936..2513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS complement(2598..5435) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 5602..6108 product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KEB9 transl_table 11 codon_start 1 locus_tag LOCUS_14620 CDS 6117..6512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS 6614..7111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 7108..8037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 8047..9807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 CDS 9810..11354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS 11407..11715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS complement(12443..12649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14690 CDS complement(12976..13734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS 13850..14698 product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287963.1 transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS 14735..14884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14720 CDS 14978..15550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14730 sequence048 source 1..15525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1842..3209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14740 CDS complement(3202..4026) product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 CDS 4127..4951 product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVV3 transl_table 11 codon_start 1 locus_tag LOCUS_14760 gene panC CDS 4958..6199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 CDS complement(6196..7950) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWB6 transl_table 11 codon_start 1 locus_tag LOCUS_14780 gene aspS CDS complement(7964..9499) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS complement(9486..9881) product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 transl_table 11 codon_start 1 locus_tag LOCUS_14800 tRNA complement(9936..10018) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 10104..11042 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 transl_table 11 codon_start 1 locus_tag LOCUS_14810 gene prsA CDS 11067..11717 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVZ1 transl_table 11 codon_start 1 locus_tag LOCUS_14820 gene rplY CDS 11733..12296 product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW73 transl_table 11 codon_start 1 locus_tag LOCUS_14830 gene pth CDS complement(12326..12940) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS complement(13017..13790) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(13804..15336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 transl_table 11 codon_start 1 locus_tag LOCUS_14860 sequence049 source 1..15444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..885) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 note possible pseudo, internal stop codon CDS complement(996..1967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 CDS complement(1968..3662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14890 CDS complement(3662..5395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14900 CDS 5658..7151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS complement(7152..9464) product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109396.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS complement(9464..11290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS complement(11305..12579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS complement(12576..13805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS complement(13806..14843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 sequence050 source 1..15288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 240..713 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H247 transl_table 11 codon_start 1 locus_tag LOCUS_14970 gene greA CDS 713..1108 product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791382.1 transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS complement(1101..1652) product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW52 transl_table 11 codon_start 1 locus_tag LOCUS_14990 gene ruvC CDS 2254..2631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 2619..3725 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS complement(3728..4027) product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K5 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS complement(4030..5424) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 CDS 5504..6568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS 6555..7184 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261130.1 transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 7174..8412 product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883908.1 transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS 8409..8846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(8847..10064) product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 gene kdtA CDS complement(10065..10724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 10897..12042 product cell surface polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 transl_table 11 codon_start 1 locus_tag LOCUS_15100 gene porR CDS 12042..13361 product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 13361..14347 product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964564.1 transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 14347..14919 product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 transl_table 11 codon_start 1 locus_tag LOCUS_15130 sequence051 source 1..15147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1259 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000677374.1:NTPase locus_tag LOCUS_15140 CDS 1274..2143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(2355..3080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS 3248..3862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS 3916..4110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS complement(4112..4501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS complement(4522..5142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 5181..5690 product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS complement(5687..6508) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z26 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene murI CDS complement(6543..7049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS complement(7053..7562) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS complement(7567..10122) product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964195.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene bamA CDS complement(10115..10864) product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D3 transl_table 11 codon_start 1 locus_tag LOCUS_15260 gene uppS CDS complement(10887..11711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(11771..12652) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1D1 transl_table 11 codon_start 1 locus_tag LOCUS_15280 gene nadK CDS complement(12654..13316) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS 13363..14100 product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1C9 transl_table 11 codon_start 1 locus_tag LOCUS_15300 gene pdxJ CDS 14097..14855 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15310 sequence052 source 1..14904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 108..338 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15320 CDS 357..710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15330 CDS complement(757..1491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15340 CDS complement(1495..2244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS complement(2234..2455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(2440..3495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS 3563..4954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 CDS 4980..6299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15390 CDS 6412..6819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 7173..7337 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS complement(7426..9552) product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106277.1 transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(9627..12164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15430 CDS complement(12230..12616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(12701..12892) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(12861..14486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15460 sequence053 source 1..14779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..1566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(1698..3491) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS 3896..5434 product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767373.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 CDS complement(5497..7149) product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 transl_table 11 codon_start 1 locus_tag LOCUS_15500 gene yidK CDS complement(7191..9575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 CDS 9709..10572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS complement(10607..11980) product aryl-sulfate sulfohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120414.1 transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS complement(12013..14727) product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109377.1 transl_table 11 codon_start 1 locus_tag LOCUS_15540 sequence054 source 1..14632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 334..2061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853121.1 transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 2244..3257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS 3248..3418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS complement(3466..4746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS 4989..5324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS 5413..5670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS 5719..6888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS 6980..8227 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 CDS 8230..8754 product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167085.1 transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 8823..9860 product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948681.1 transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS complement(9912..10364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS complement(10557..12170) product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786690.1 transl_table 11 codon_start 1 locus_tag LOCUS_15660 sequence055 source 1..14533 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2078 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_15670 CDS 2075..3022 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 CDS complement(3318..3779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS complement(3776..4891) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS complement(4888..6288) product ATP-dependent exodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362006.1 transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(6313..7809) product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS complement(7778..8899) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(9535..9717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15740 CDS complement(9714..9887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(10051..10248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(10284..12344) product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MP7 transl_table 11 codon_start 1 locus_tag LOCUS_15770 gene metG CDS 12410..13306 product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962239.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS 13315..13932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 sequence056 source 1..14489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(836..2155) product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108187.1 transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(2156..3013) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 CDS complement(3010..3870) product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZH8 transl_table 11 codon_start 1 locus_tag LOCUS_15820 gene folP CDS 3894..4427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 4436..5422 product protein tlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963548.1 transl_table 11 codon_start 1 locus_tag LOCUS_15840 gene tlpB CDS 5427..6167 product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI2 transl_table 11 codon_start 1 locus_tag LOCUS_15850 gene tpiA CDS 6169..6996 product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 gene prmA CDS 6999..11468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS 11470..12123 product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000972779.1 transl_table 11 codon_start 1 locus_tag LOCUS_15880 gene plsY sequence057 source 1..13824 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..820 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120545.1:aminopeptidase locus_tag LOCUS_15890 CDS complement(858..3116) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108276.1 transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(3799..4377) product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962363.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 gene pnuC CDS 4500..4910 product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0I4 transl_table 11 codon_start 1 locus_tag LOCUS_15920 gene ygcM CDS 4873..5565 product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_15930 gene folE2 CDS 5562..6044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 6037..6711 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 6715..8010 product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963159.1 transl_table 11 codon_start 1 locus_tag LOCUS_15960 gene phrB1 CDS 8085..8885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 8882..9679 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS complement(9689..11395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS complement(11444..13291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS complement(13408..13560) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16010 sequence058 source 1..13819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 83..565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 578..2341 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16030 CDS 2473..4566 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 4638..5303 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J9 transl_table 11 codon_start 1 locus_tag LOCUS_16050 gene npdA CDS 5718..5930 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS complement(6094..6297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16070 CDS complement(6381..6599) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(6754..7092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 7259..8242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16100 CDS complement(8294..9436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS complement(9498..9917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(9984..10565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(10702..11307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16140 CDS complement(11411..11848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS complement(11974..12705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS complement(12780..12944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 sequence059 source 1..13764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(410..1093) product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS complement(1149..2216) product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813290.1 transl_table 11 codon_start 1 locus_tag LOCUS_16190 gene paaE CDS 2298..3083 product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206400.1 transl_table 11 codon_start 1 locus_tag LOCUS_16200 gene paaG CDS complement(3084..5516) product Asp/Glu-specific dipeptidyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWM2 transl_table 11 codon_start 1 locus_tag LOCUS_16210 gene dpp11 CDS 5567..6334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16220 CDS 6342..7493 product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 transl_table 11 codon_start 1 locus_tag LOCUS_16230 CDS 7490..7810 product dksA/traR C4-type zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 7957..9633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16250 CDS 9664..10968 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073592.1 transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 10975..11529 product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS complement(11526..13514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 sequence060 source 1..13475 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..515 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002117778.1:rhomboid family intramembrane serine protease locus_tag LOCUS_16290 CDS 516..1382 product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262287.1 transl_table 11 codon_start 1 locus_tag LOCUS_16300 gene pabC CDS complement(1351..1938) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964107.1 transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(1978..2550) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(2551..4041) product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 transl_table 11 codon_start 1 locus_tag LOCUS_16330 CDS complement(4022..5362) product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 5448..6863 product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404928.1 transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(6860..8455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16360 CDS 8521..9285 product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H213 transl_table 11 codon_start 1 locus_tag LOCUS_16370 gene surE CDS 9273..9629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS 9629..10756 product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 transl_table 11 codon_start 1 locus_tag LOCUS_16390 gene lpxB CDS 10805..11968 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583956.1 transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS complement(12114..13124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16410 sequence061 source 1..13405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 595..2535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(2586..3728) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 CDS 3797..4852 product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 transl_table 11 codon_start 1 locus_tag LOCUS_16440 CDS 4926..6155 product amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964029.1 transl_table 11 codon_start 1 locus_tag LOCUS_16450 CDS 6165..7541 product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725372.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 CDS 7585..8325 product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS 8328..8717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS 8714..9100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS 9200..9832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 9822..11048 product tetrahydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 transl_table 11 codon_start 1 locus_tag LOCUS_16510 gene folC tRNA 11073..11150 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS complement(11218..11871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 tRNA 12231..12307 product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS complement(12386..12565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS complement(12558..12962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 sequence062 source 1..13345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(528..1508) product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVY6 transl_table 11 codon_start 1 locus_tag LOCUS_16550 gene gpsA CDS complement(1505..2059) product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 transl_table 11 codon_start 1 locus_tag LOCUS_16560 gene idi CDS complement(2020..3483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 CDS complement(3476..3901) product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964575.1 transl_table 11 codon_start 1 locus_tag LOCUS_16580 gene rpiB CDS 4200..5732 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS 5729..6490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS 6483..7181 product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYI2 transl_table 11 codon_start 1 locus_tag LOCUS_16610 gene rsmI CDS 7168..9990 product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H244 transl_table 11 codon_start 1 locus_tag LOCUS_16620 gene leuS CDS complement(9987..10595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS complement(10647..11027) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 misc_feature complement(11033..>13345) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GW60:isoleucine--tRNA ligase locus_tag LOCUS_16650 sequence063 source 1..12349 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(846..1796) product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0A1 transl_table 11 codon_start 1 locus_tag LOCUS_16660 gene aroB CDS complement(1880..2647) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962360.1 transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS 2779..5031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 5095..6072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(6076..6666) product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705605.1 transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(6673..7881) product 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C7L2 transl_table 11 codon_start 1 locus_tag LOCUS_16710 gene paaJ CDS complement(7934..8335) product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423284.1 transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(8349..9962) product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0U1 transl_table 11 codon_start 1 locus_tag LOCUS_16730 gene pyrG misc_feature complement(10031..>12349) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404901.1:TonB-dependent receptor locus_tag LOCUS_16740 sequence064 source 1..11996 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 644..1048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963852.1 transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS complement(1045..1560) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H143 transl_table 11 codon_start 1 locus_tag LOCUS_16760 gene ribH CDS complement(1560..2363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS 2464..3555 product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H141 transl_table 11 codon_start 1 locus_tag LOCUS_16780 gene recF CDS 3559..3855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 CDS complement(3863..4726) product zinc transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 transl_table 11 codon_start 1 locus_tag LOCUS_16800 CDS complement(4719..5375) product iron-dependent repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 transl_table 11 codon_start 1 locus_tag LOCUS_16810 gene sirR CDS 5446..7686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(7688..9490) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 CDS complement(9498..10679) product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 transl_table 11 codon_start 1 locus_tag LOCUS_16840 misc_feature complement(10683..>11996) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963833.1:3-hydroxyacyl-CoA dehydrogenase locus_tag LOCUS_16850 sequence065 source 1..11778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 213..1154 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813298.1 transl_table 11 codon_start 1 locus_tag LOCUS_16860 gene paaA CDS 1156..1446 product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931076.1 transl_table 11 codon_start 1 locus_tag LOCUS_16870 gene paaB CDS 1446..2198 product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072831.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 CDS 2210..2971 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 CDS 2958..4064 product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 4054..4638 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS 4646..4999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 5002..5730 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 CDS complement(5734..8277) product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR4 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene infB CDS complement(8303..9541) product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZR5 transl_table 11 codon_start 1 locus_tag LOCUS_16950 gene nusA CDS complement(9551..10024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16960 CDS 10167..11300 product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964524.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 gene smf sequence066 source 1..11588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1161..2723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 CDS complement(2720..4198) product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX80 transl_table 11 codon_start 1 locus_tag LOCUS_16990 gene cysS CDS complement(4195..4773) product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX79 transl_table 11 codon_start 1 locus_tag LOCUS_17000 gene folE2 CDS 4938..5543 product siderophore biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 CDS 5551..6279 product geranylgeranylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW30 transl_table 11 codon_start 1 locus_tag LOCUS_17020 gene pcrB CDS 6281..7156 product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS 7409..8281 product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY00 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene prfB CDS 8265..8624 product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963715.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(8621..8776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS 8829..10214 product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H000 transl_table 11 codon_start 1 locus_tag LOCUS_17070 gene fumC CDS 10214..10393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 10390..11250 product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 sequence067 source 1..11029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4394..6868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(6922..7770) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 gene porP misc_feature complement(7856..>11029) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001060462.1:MSCRAMM family adhesin SdrC locus_tag LOCUS_17120 sequence068 source 1..11013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1060..1395) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17130 tRNA complement(1474..1549) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 tRNA 1633..1721 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 1777..5031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS complement(5066..7240) product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS 7286..9061 product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038196.1 transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 9204..9629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 sequence069 source 1..10853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1192..1668) product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS complement(1691..3007) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(2997..6179) product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 CDS complement(6184..7335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS complement(7516..8526) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 transl_table 11 codon_start 1 locus_tag LOCUS_17220 CDS complement(8588..9370) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 transl_table 11 codon_start 1 locus_tag LOCUS_17230 CDS complement(9456..10031) product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWU8 transl_table 11 codon_start 1 locus_tag LOCUS_17240 misc_feature complement(10088..>10853) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962241.1:aldo/keto reductase locus_tag LOCUS_17250 sequence070 source 1..10563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(518..3454) product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS 3591..4313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS 4373..7129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(7135..8997) product neopullulanase SusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A1G0 transl_table 11 codon_start 1 locus_tag LOCUS_17290 gene susA CDS 9119..9859 product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787639.1 transl_table 11 codon_start 1 locus_tag LOCUS_17300 sequence071 source 1..10209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1882..2556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 tRNA complement(3526..3609) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS 3679..4098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 tRNA complement(4125..4198) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 4330..5742 product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17330 gene glcD CDS complement(5744..7231) product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035686.1 transl_table 11 codon_start 1 locus_tag LOCUS_17340 gene yhiP CDS 7319..9205 product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 transl_table 11 codon_start 1 locus_tag LOCUS_17350 gene pepN CDS complement(9209..9661) product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8ABD1 transl_table 11 codon_start 1 locus_tag LOCUS_17360 gene smpB sequence072 source 1..9978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(528..2087) product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362015.1 transl_table 11 codon_start 1 locus_tag LOCUS_17370 gene sulP CDS complement(2156..2425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS complement(2609..3238) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS complement(3235..5664) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17400 gene helX CDS complement(5657..7261) product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 transl_table 11 codon_start 1 locus_tag LOCUS_17410 gene lig2 CDS complement(7254..8258) product DNA ligase-associated DEXH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS 8570..9451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 sequence073 source 1..9826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(65..139) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 345..2588 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 CDS complement(2578..5811) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS 5942..8440 product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NH9 transl_table 11 codon_start 1 locus_tag LOCUS_17460 gene priA sequence074 source 1..9788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(4328..8062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(8163..8555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 8560..9003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 9003..9635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17500 sequence075 source 1..9642 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 709..2772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS complement(2765..4864) product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2G8 transl_table 11 codon_start 1 locus_tag LOCUS_17520 gene rnr CDS complement(4889..5071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 5241..5645 product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 transl_table 11 codon_start 1 locus_tag LOCUS_17540 CDS complement(5599..6240) product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964126.1 transl_table 11 codon_start 1 locus_tag LOCUS_17550 CDS 6320..8266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17560 tRNA 9075..9149 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS 9271..9519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17570 sequence076 source 1..9555 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(944..1621) product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HCR8 transl_table 11 codon_start 1 locus_tag LOCUS_17580 CDS complement(1709..2290) product dimethyladenosine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398109.1 transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS complement(2316..3182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(3201..4574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(4607..5065) product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81I71 transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS complement(5093..6154) product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS complement(6200..6619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS complement(6725..7129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(7145..7663) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS complement(7871..9046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 sequence077 source 1..9448 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1245..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17680 CDS complement(3311..5296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS complement(5296..6726) product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120368.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS complement(6726..8285) product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120799.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 misc_feature complement(8316..>9448) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775423.1:surface-anchored protein locus_tag LOCUS_17720 sequence078 source 1..8956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 24..97 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 CDS complement(145..2736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17730 misc_feature complement(2736..>8956) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:protein of unknown function precursor; adhesin locus_tag LOCUS_17740 sequence079 source 1..8738 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1313..2596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS 2877..3542 product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 gene phoP CDS complement(3531..4154) product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 4226..4633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17780 CDS 4686..5615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963439.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 CDS 5615..6532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 transl_table 11 codon_start 1 locus_tag LOCUS_17800 CDS complement(6547..7521) product UDP-GlcNAc--UDP-phosphate GlcNAc-1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786860.1 transl_table 11 codon_start 1 locus_tag LOCUS_17810 misc_feature complement(7514..>8738) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582958.1:glycosyltransferase WbuB locus_tag LOCUS_17820 sequence080 source 1..8635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(628..1794) product D-galactarolactone cycloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9CEQ8 transl_table 11 codon_start 1 locus_tag LOCUS_17830 gene gci CDS complement(1812..2114) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(2121..3290) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(3394..3951) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(4084..5718) product iduronate-2-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123571.1 transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS complement(5702..6199) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS complement(6318..7310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 sequence081 source 1..8510 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(476..1693) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 transl_table 11 codon_start 1 locus_tag LOCUS_17900 CDS complement(1694..2431) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 transl_table 11 codon_start 1 locus_tag LOCUS_17910 CDS complement(2465..2806) product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS complement(2808..4226) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783735.1 transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS complement(4293..4766) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS complement(4763..6421) product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 CDS 6490..7410 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947383.1 transl_table 11 codon_start 1 locus_tag LOCUS_17960 sequence082 source 1..8418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1177..2145 product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 2148..2492 product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 2503..3207 product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001361291.1 transl_table 11 codon_start 1 locus_tag LOCUS_17990 gene ybhL CDS 3217..4098 product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWP6 transl_table 11 codon_start 1 locus_tag LOCUS_18000 gene fabD CDS complement(4095..4847) product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963406.1 transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS complement(4850..5902) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ54 transl_table 11 codon_start 1 locus_tag LOCUS_18020 gene rmlB CDS complement(5902..7197) product UDP-N-acetyl-D-galactosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022298.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 gene wbtE CDS complement(7194..8213) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 sequence083 source 1..8247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3811 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_18050 CDS complement(3815..4456) product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 4522..7662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18070 CDS 7667..8092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18080 sequence084 source 1..7896 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 712..939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 1248..2237 product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 gene iaaA CDS complement(2296..3336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 3524..4438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS 4447..5334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS 5331..6485 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063795.1 transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(6480..7607) product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEY0 transl_table 11 codon_start 1 locus_tag LOCUS_18150 gene galK sequence085 source 1..7690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1286..1816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 2075..3064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107637.1 transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS complement(3114..3560) product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64PH9 transl_table 11 codon_start 1 locus_tag LOCUS_18180 gene rplI CDS complement(3566..3832) product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S6 transl_table 11 codon_start 1 locus_tag LOCUS_18190 gene rpsR CDS complement(3858..4196) product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A5S5 transl_table 11 codon_start 1 locus_tag LOCUS_18200 gene rpsF CDS 4343..6091 product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 6133..6720 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0E7 transl_table 11 codon_start 1 locus_tag LOCUS_18220 gene def CDS 6717..7256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18230 sequence086 source 1..7170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A0M6:alanine--tRNA ligase locus_tag LOCUS_18240 CDS complement(1780..2961) product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(2946..4241) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 transl_table 11 codon_start 1 locus_tag LOCUS_18260 gene natB CDS complement(4234..5160) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene natA CDS complement(5176..6282) product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXF1 transl_table 11 codon_start 1 locus_tag LOCUS_18280 gene dnaJ CDS complement(6292..6816) product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A8C4 transl_table 11 codon_start 1 locus_tag LOCUS_18290 gene grpE sequence087 source 1..6565 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1068 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H070:2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase locus_tag LOCUS_18300 CDS 1075..1908 product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWW1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 gene menB CDS complement(1905..3317) product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403836.1 transl_table 11 codon_start 1 locus_tag LOCUS_18320 gene dacB CDS 3430..4593 product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS 4645..5451 product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108518.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 sequence088 source 1..6473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(213..1985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS complement(2058..3332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS complement(3329..4558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18370 CDS complement(4559..5596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 sequence089 source 1..6440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(413..1051) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(1048..1884) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223259.1 transl_table 11 codon_start 1 locus_tag LOCUS_18400 CDS complement(1881..2780) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476318.1 transl_table 11 codon_start 1 locus_tag LOCUS_18410 CDS complement(2963..3595) product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964140.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS complement(3599..4684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(4730..5533) product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227675.1 transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(5683..6357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 sequence090 source 1..6244 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 505..660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(596..1216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 sequence091 source 1..6101 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..789) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GY96 transl_table 11 codon_start 1 locus_tag LOCUS_18480 gene efp CDS complement(843..2963) product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYD1 transl_table 11 codon_start 1 locus_tag LOCUS_18490 gene recG CDS complement(3004..4269) product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE4 transl_table 11 codon_start 1 locus_tag LOCUS_18500 gene pdhC CDS complement(4279..5316) product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZE5 transl_table 11 codon_start 1 locus_tag LOCUS_18510 gene pdhA CDS complement(5379..5867) product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 gene cdd sequence092 source 1..6052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(171..320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18530 CDS complement(506..886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18540 CDS complement(889..1167) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18550 tRNA complement(1327..1400) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 CDS 1539..5747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18560 sequence093 source 1..5956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(311..1252) product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW90 transl_table 11 codon_start 1 locus_tag LOCUS_18570 gene rsgA CDS 1343..2251 product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 transl_table 11 codon_start 1 locus_tag LOCUS_18580 gene gldA CDS 2378..3625 product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWA9 transl_table 11 codon_start 1 locus_tag LOCUS_18590 gene metK CDS complement(3634..4938) product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H103 transl_table 11 codon_start 1 locus_tag LOCUS_18600 gene der CDS complement(4935..5810) product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A136 transl_table 11 codon_start 1 locus_tag LOCUS_18610 gene era tRNA 5859..5932 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 sequence094 source 1..5944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1229..5041) product peptidase C25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 gene porU sequence095 source 1..5851 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..1085) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(1397..1678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118582.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(1691..2239) product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS complement(2277..2552) product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 transl_table 11 codon_start 1 locus_tag LOCUS_18660 gene clpS sequence096 source 1..5807 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(74..541) product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA2 transl_table 11 codon_start 1 locus_tag LOCUS_18670 gene rpsG CDS complement(550..927) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZA3 transl_table 11 codon_start 1 locus_tag LOCUS_18680 gene rpsL CDS 1110..3380 product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXZ5 transl_table 11 codon_start 1 locus_tag LOCUS_18690 gene uvrD CDS 3439..4092 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964113.1 transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS 4079..5389 product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H153 transl_table 11 codon_start 1 locus_tag LOCUS_18710 gene murA sequence097 source 1..5788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1750) product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(1747..2082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(2116..2862) product uroporphyrinogen III methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS 3663..4655 product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CXS1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 sequence098 source 1..5764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..753 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64QU2:60 kDa chaperonin locus_tag LOCUS_18760 CDS complement(803..2695) product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963090.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 gene acsA CDS complement(2736..4385) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795080.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS complement(4547..4861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963310.1 transl_table 11 codon_start 1 locus_tag LOCUS_18790 misc_feature complement(4865..>5764) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6GYT9:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_18800 sequence099 source 1..5546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(600..1448) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 transl_table 11 codon_start 1 locus_tag LOCUS_18810 gene mvaB CDS complement(1464..3725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 3867..5459 product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE72 transl_table 11 codon_start 1 locus_tag LOCUS_18830 gene prfC sequence100 source 1..5354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 14..481 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acatctaaactagtaagctgattgtta CDS 915..1865 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931739.1 transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS 1874..2404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 2461..2823 product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 2825..3616 product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939228.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 CDS complement(3635..4039) product stress-induced protein OsmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964001.1 transl_table 11 codon_start 1 locus_tag LOCUS_18880 gene osmC CDS 4311..5204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence101 source 1..5228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(864..5042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 sequence102 source 1..5138 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(791..1969) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS complement(1973..2926) product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GVN8 transl_table 11 codon_start 1 locus_tag LOCUS_18920 gene hemE CDS 3006..3938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 misc_feature complement(3941..>5138) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_18940 sequence103 source 1..4928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1442..2914 product N-acetylgalactosamine-6-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123096.1 transl_table 11 codon_start 1 locus_tag LOCUS_18950 gene aslA CDS 2911..4776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 sequence104 source 1..4648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 105..1409 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 CDS complement(1404..2519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18980 sequence105 source 1..4632 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1313 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS 1310..2239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 sequence106 source 1..4619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1963 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082594.1:beta-glucosidase locus_tag LOCUS_19010 CDS 1956..2762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS complement(2763..3401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS complement(3426..4013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19040 sequence107 source 1..4500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence108 source 1..4399 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 413..1252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19050 CDS 1410..1982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS 1986..2684 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS 2684..3829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19080 sequence109 source 1..4283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2036..3766 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 sequence110 source 1..4146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(833..2902) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(2991..3788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 sequence111 source 1..4100 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 490..1704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS 1775..2932 product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 transl_table 11 codon_start 1 locus_tag LOCUS_19130 gene hmgA sequence112 source 1..3726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2597..3589 product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XE6 transl_table 11 codon_start 1 locus_tag LOCUS_19140 gene pdxA sequence113 source 1..3573 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(623..2638) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(2667..3341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 sequence114 source 1..3455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..816 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405417.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_19170 CDS complement(1245..1697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19180 CDS 2194..2544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19190 sequence115 source 1..3434 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2219 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64ZY5:beta-galactosidase locus_tag LOCUS_19200 misc_feature complement(2221..>3434) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_19210 sequence116 source 1..3331 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(304..378) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(636..2057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS 2899..3303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 sequence117 source 1..3161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(860..2752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 sequence118 source 1..3154 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 327..1058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021949.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 CDS 1058..2536 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877378.1 transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS 2543..2956 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 sequence119 source 1..2837 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1260..>2837) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein locus_tag LOCUS_19280 sequence120 source 1..2830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..958 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964141.1:FAD-binding protein locus_tag LOCUS_19290 CDS complement(984..1589) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(1701..2150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 sequence121 source 1..2788 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence122 source 1..2785 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(995..>2785) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963607.1:TonB-dependent receptor locus_tag LOCUS_19320 sequence123 source 1..2764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..727 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731314.1:2-hydroxy-3-carboxy-6-oxo-7-methylocta-2,4-dienoate decarboxylase locus_tag LOCUS_19330 CDS 724..2607 product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964486.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 sequence124 source 1..2760 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 402..2306 product 9-O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 transl_table 11 codon_start 1 locus_tag LOCUS_19350 sequence125 source 1..2739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence126 source 1..2721 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2463 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A334:DNA mismatch repair protein MutS locus_tag LOCUS_19360 tRNA 2516..2589 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA 2614..2698 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 sequence127 source 1..2690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence128 source 1..2680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1004 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527051.1:NAD-dependent succinate-semialdehyde dehydrogenase locus_tag LOCUS_19370 CDS 1014..2045 product sugar:proton symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762702.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 misc_feature complement(2062..>2680) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005775503.1:AraC family transcriptional regulator locus_tag LOCUS_19390 sequence129 source 1..2414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..683 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:serine/threonine protein kinase locus_tag LOCUS_19400 CDS 694..1284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 sequence130 source 1..2377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence131 source 1..2374 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(166..1173) product mucin desulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813305.1 transl_table 11 codon_start 1 locus_tag LOCUS_19420 gene nahK CDS complement(1164..2063) product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762743.1 transl_table 11 codon_start 1 locus_tag LOCUS_19430 sequence132 source 1..2323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence133 source 1..2208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..261) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS 722..1570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(1549..2142) product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A327 transl_table 11 codon_start 1 locus_tag LOCUS_19460 sequence134 source 1..2199 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 263..1684 product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7S5 transl_table 11 codon_start 1 locus_tag LOCUS_19470 gene putA CDS 1678..2100 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19480 sequence135 source 1..2158 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 343..2157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 sequence136 source 1..2148 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1790 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000821884.1:penicillin G acylase precursor locus_tag LOCUS_19500 CDS 1831..2118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 sequence137 source 1..2093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(846..1901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 sequence138 source 1..2091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence139 source 1..2089 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence140 source 1..2085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence141 source 1..2072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence142 source 1..2060 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence143 source 1..1981 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence144 source 1..1953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 490..1698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 sequence145 source 1..1939 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence146 source 1..1884 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence147 source 1..1882 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence148 source 1..1831 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence149 source 1..1758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(463..912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 sequence150 source 1..1689 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1222..1554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 sequence151 source 1..1490 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 95..589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 904..1263 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS 1260..1400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19580 sequence152 source 1..1457 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence153 source 1..1222 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence154 source 1..1181 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence155 source 1..1175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence156 source 1..1085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 196..843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 sequence157 source 1..1084 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence158 source 1..1071 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@