>Feature sequence001 429 2078 gene locus_tag LOCUS_00010 429 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2688 2131 gene locus_tag LOCUS_00020 2688 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4573 2816 gene locus_tag LOCUS_00030 4573 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4871 6388 gene locus_tag LOCUS_00040 4871 6388 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933114.1 protein_id gnl|my_center|LOCUS_00040 8220 6541 gene locus_tag LOCUS_00050 8220 6541 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764544.1 protein_id gnl|my_center|LOCUS_00050 9654 8257 gene locus_tag LOCUS_00060 9654 8257 CDS product dipeptide/tripeptide permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 protein_id gnl|my_center|LOCUS_00060 11741 9807 gene locus_tag LOCUS_00070 11741 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 15285 11743 gene locus_tag LOCUS_00080 15285 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16095 15406 gene locus_tag LOCUS_00090 16095 15406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00090 16611 16108 gene locus_tag LOCUS_00100 16611 16108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00100 19810 16619 gene locus_tag LOCUS_00110 19810 16619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_00110 20238 19807 gene locus_tag LOCUS_00120 gene paaI 20238 19807 CDS product phenylacetic acid degradation protein PaaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813284.1 protein_id gnl|my_center|LOCUS_00120 20432 21097 gene locus_tag LOCUS_00130 20432 21097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 >Feature sequence002 378 809 gene locus_tag LOCUS_00140 gene mscL 378 809 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89ZV7 protein_id gnl|my_center|LOCUS_00140 929 2263 gene locus_tag LOCUS_00150 929 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 3140 2532 gene locus_tag LOCUS_00160 3140 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 3502 3131 gene locus_tag LOCUS_00170 gene nuoA1 3502 3131 CDS product NADH-quinone oxidoreductase subunit A 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA8 protein_id gnl|my_center|LOCUS_00170 3732 5228 gene locus_tag LOCUS_00180 3732 5228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5200 5526 gene locus_tag LOCUS_00190 5200 5526 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953389.1 protein_id gnl|my_center|LOCUS_00190 6575 5535 gene locus_tag LOCUS_00200 gene fjo30 6575 5535 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_00200 6629 7942 gene locus_tag LOCUS_00210 6629 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 8166 8768 gene locus_tag LOCUS_00220 8166 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 8771 9640 gene locus_tag LOCUS_00230 8771 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 9930 10193 gene locus_tag LOCUS_00240 9930 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 10518 11114 gene locus_tag LOCUS_00250 10518 11114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 11471 13510 gene locus_tag LOCUS_00260 gene paaN 11471 13510 CDS product bifunctional aldehyde dehydrogenase/enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709127.1 protein_id gnl|my_center|LOCUS_00260 13650 14018 gene locus_tag LOCUS_00270 13650 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 >Feature sequence003 1149 646 gene locus_tag LOCUS_00280 1149 646 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881417.1 protein_id gnl|my_center|LOCUS_00280 2113 1259 gene locus_tag LOCUS_00290 2113 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 6191 2127 gene locus_tag LOCUS_00300 6191 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 7495 6254 gene locus_tag LOCUS_00310 7495 6254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 8085 7513 gene locus_tag LOCUS_00320 8085 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 >Feature sequence004 781 8628 gene locus_tag LOCUS_00330 781 8628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 8741 10294 gene locus_tag LOCUS_00340 8741 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 10337 11149 gene locus_tag LOCUS_00350 gene zupT 10337 11149 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AU0 protein_id gnl|my_center|LOCUS_00350 >Feature sequence005 1163 1621 gene locus_tag LOCUS_00360 1163 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 1618 1794 gene locus_tag LOCUS_00370 1618 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 1813 3225 gene locus_tag LOCUS_00380 1813 3225 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972453.1 protein_id gnl|my_center|LOCUS_00380 3236 4462 gene locus_tag LOCUS_00390 3236 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 4459 6234 gene locus_tag LOCUS_00400 4459 6234 CDS product DNA primase/helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107640.1 protein_id gnl|my_center|LOCUS_00400 6231 6497 gene locus_tag LOCUS_00410 6231 6497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 7442 6519 gene locus_tag LOCUS_00420 7442 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 7615 8067 gene locus_tag LOCUS_00430 7615 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 8064 8798 gene locus_tag LOCUS_00440 8064 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 8804 9376 gene locus_tag LOCUS_00450 8804 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 9816 9439 gene locus_tag LOCUS_00460 9816 9439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 9970 10167 gene locus_tag LOCUS_00470 9970 10167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 10161 10628 gene locus_tag LOCUS_00480 10161 10628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence006 3113 4309 gene locus_tag LOCUS_00490 3113 4309 CDS product alanine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250045.1 protein_id gnl|my_center|LOCUS_00490 4412 5167 gene locus_tag LOCUS_00500 gene dapB 4412 5167 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963266.1 protein_id gnl|my_center|LOCUS_00500 5215 5787 gene locus_tag LOCUS_00510 5215 5787 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_00510 5780 7006 gene locus_tag LOCUS_00520 5780 7006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 7300 8085 gene locus_tag LOCUS_00530 7300 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence007 674 324 gene locus_tag LOCUS_00540 674 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 1121 681 gene locus_tag LOCUS_00550 1121 681 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B849 protein_id gnl|my_center|LOCUS_00550 2018 1416 gene locus_tag LOCUS_00560 gene sodA 2018 1416 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW03 protein_id gnl|my_center|LOCUS_00560 3511 2135 gene locus_tag LOCUS_00570 gene tnaA 3511 2135 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V4 protein_id gnl|my_center|LOCUS_00570 4454 3648 gene locus_tag LOCUS_00580 gene murI 4454 3648 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFY7 protein_id gnl|my_center|LOCUS_00580 5145 4444 gene locus_tag LOCUS_00590 5145 4444 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_00590 6083 5208 gene locus_tag LOCUS_00600 6083 5208 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_00600 6694 6086 gene locus_tag LOCUS_00610 6694 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 8265 6691 gene locus_tag LOCUS_00620 8265 6691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 8739 8320 gene locus_tag LOCUS_00630 8739 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence008 2266 368 gene locus_tag LOCUS_00640 2266 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 3026 2313 gene locus_tag LOCUS_00650 3026 2313 CDS product dolichyl-phosphate beta-D-mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_00650 4505 3030 gene locus_tag LOCUS_00660 4505 3030 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_00660 5635 4502 gene locus_tag LOCUS_00670 5635 4502 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_00670 6830 5685 gene locus_tag LOCUS_00680 6830 5685 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_00680 8480 6837 gene locus_tag LOCUS_00690 8480 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 <9749 8480 gene locus_tag LOCUS_00700 <9749 8480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582972.1:polysaccharide biosynthesis protein >Feature sequence009 728 51 gene locus_tag LOCUS_00710 728 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 1311 1042 gene locus_tag LOCUS_00720 1311 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 2710 1292 gene locus_tag LOCUS_00730 2710 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 3222 2707 gene locus_tag LOCUS_00740 3222 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 3561 3818 gene locus_tag LOCUS_00750 3561 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 3838 4044 gene locus_tag LOCUS_00760 3838 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 4066 4326 gene locus_tag LOCUS_00770 4066 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4329 4808 gene locus_tag LOCUS_00780 4329 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 5058 5543 gene locus_tag LOCUS_00790 5058 5543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 5989 6627 gene locus_tag LOCUS_00800 5989 6627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6637 7113 gene locus_tag LOCUS_00810 6637 7113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 7139 8191 gene locus_tag LOCUS_00820 7139 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 8260 9420 gene locus_tag LOCUS_00830 8260 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 >Feature sequence010 985 563 gene locus_tag LOCUS_00840 985 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1397 978 gene locus_tag LOCUS_00850 1397 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1836 1402 gene locus_tag LOCUS_00860 1836 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 1960 2124 gene locus_tag LOCUS_00870 1960 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00870 2161 2754 gene locus_tag LOCUS_00880 2161 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00880 3612 2731 gene locus_tag LOCUS_00890 3612 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4550 3612 gene locus_tag LOCUS_00900 4550 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6794 4569 gene locus_tag LOCUS_00910 6794 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7095 6856 gene locus_tag LOCUS_00920 7095 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 7285 7893 gene locus_tag LOCUS_00930 7285 7893 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005498652.1 protein_id gnl|my_center|LOCUS_00930 8125 8370 gene locus_tag LOCUS_00940 8125 8370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 <9532 8399 gene locus_tag LOCUS_00950 <9532 8399 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002370929.1:type 2 lantibiotic biosynthesis protein >Feature sequence011 1665 544 gene locus_tag LOCUS_00960 1665 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_00960 2753 1662 gene locus_tag LOCUS_00970 2753 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480487.1 protein_id gnl|my_center|LOCUS_00970 2960 3526 gene locus_tag LOCUS_00980 2960 3526 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_00980 4211 3519 gene locus_tag LOCUS_00990 gene lolD 4211 3519 CDS product lipoprotein-releasing system ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB4 protein_id gnl|my_center|LOCUS_00990 5029 4271 gene locus_tag LOCUS_01000 5029 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 6053 5055 gene locus_tag LOCUS_01010 gene rpoA 6053 5055 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3N9 protein_id gnl|my_center|LOCUS_01010 6491 6111 gene locus_tag LOCUS_01020 gene rpsK 6491 6111 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ6 protein_id gnl|my_center|LOCUS_01020 6882 6508 gene locus_tag LOCUS_01030 gene rpsM 6882 6508 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ76 protein_id gnl|my_center|LOCUS_01030 7245 7027 gene locus_tag LOCUS_01040 gene infA 7245 7027 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A498 protein_id gnl|my_center|LOCUS_01040 8665 7316 gene locus_tag LOCUS_01050 gene secY 8665 7316 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAJ1 protein_id gnl|my_center|LOCUS_01050 9119 8658 gene locus_tag LOCUS_01060 gene rplO 9119 8658 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73PL3 protein_id gnl|my_center|LOCUS_01060 9325 9140 gene locus_tag LOCUS_01070 gene rpmD 9325 9140 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAI9 protein_id gnl|my_center|LOCUS_01070 >Feature sequence012 1223 390 gene locus_tag LOCUS_01080 1223 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 1841 1260 gene locus_tag LOCUS_01090 1841 1260 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932924.1 protein_id gnl|my_center|LOCUS_01090 1831 4761 gene locus_tag LOCUS_01100 1831 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 4861 6495 gene locus_tag LOCUS_01110 4861 6495 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108599.1 protein_id gnl|my_center|LOCUS_01110 6578 7360 gene locus_tag LOCUS_01120 6578 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 7447 8394 gene locus_tag LOCUS_01130 7447 8394 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439905.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence013 626 195 gene locus_tag LOCUS_01140 626 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 1054 623 gene locus_tag LOCUS_01150 1054 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 2109 1054 gene locus_tag LOCUS_01160 2109 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2480 2109 gene locus_tag LOCUS_01170 2480 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 3603 2509 gene locus_tag LOCUS_01180 3603 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 3792 4481 gene locus_tag LOCUS_01190 3792 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 4453 5199 gene locus_tag LOCUS_01200 4453 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 5201 5656 gene locus_tag LOCUS_01210 5201 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 5653 6468 gene locus_tag LOCUS_01220 5653 6468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 6468 7607 gene locus_tag LOCUS_01230 6468 7607 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001285506.1 protein_id gnl|my_center|LOCUS_01230 7604 8110 gene locus_tag LOCUS_01240 7604 8110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088853.1 protein_id gnl|my_center|LOCUS_01240 8107 8736 gene locus_tag LOCUS_01250 8107 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 >Feature sequence014 2533 4077 gene locus_tag LOCUS_01260 2533 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4126 4524 gene locus_tag LOCUS_01270 4126 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4633 5376 gene locus_tag LOCUS_01280 gene ste14 4633 5376 CDS product lipid A Kdo2 1-phosphate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173879.1 protein_id gnl|my_center|LOCUS_01280 5384 5698 gene locus_tag LOCUS_01290 5384 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5784 6290 gene locus_tag LOCUS_01300 5784 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 6521 6448 gene locus_tag LOCUS_t00010 6521 6448 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6774 6595 gene locus_tag LOCUS_01310 6774 6595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6909 8543 gene locus_tag LOCUS_01320 6909 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 >Feature sequence015 167 1606 gene locus_tag LOCUS_01330 167 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 1606 2148 gene locus_tag LOCUS_01340 1606 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 4002 2371 gene locus_tag LOCUS_01350 4002 2371 CDS product peptidase C69 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_01350 6730 4085 gene locus_tag LOCUS_01360 6730 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7486 6800 gene locus_tag LOCUS_01370 gene ispD 7486 6800 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E113 protein_id gnl|my_center|LOCUS_01370 >Feature sequence016 636 2729 gene locus_tag LOCUS_01380 gene fusA 636 2729 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F983 protein_id gnl|my_center|LOCUS_01380 2831 3202 gene locus_tag LOCUS_01390 gene rpsL 2831 3202 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MC93 protein_id gnl|my_center|LOCUS_01390 3216 3683 gene locus_tag LOCUS_01400 gene rpsG 3216 3683 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38526 protein_id gnl|my_center|LOCUS_01400 3729 5768 gene locus_tag LOCUS_01410 gene fusA2 3729 5768 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748Y8 protein_id gnl|my_center|LOCUS_01410 5813 7021 gene locus_tag LOCUS_01420 gene tuf-2 5813 7021 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_953913.1 protein_id gnl|my_center|LOCUS_01420 7051 7359 gene locus_tag LOCUS_01430 gene rpsJ 7051 7359 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3R5 protein_id gnl|my_center|LOCUS_01430 7369 7989 gene locus_tag LOCUS_01440 gene rplC 7369 7989 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NK8 protein_id gnl|my_center|LOCUS_01440 8000 8623 gene locus_tag LOCUS_01450 gene rplD 8000 8623 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH3 protein_id gnl|my_center|LOCUS_01450 >Feature sequence017 1069 74 gene locus_tag LOCUS_01460 1069 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2508 1069 gene locus_tag LOCUS_01470 gene flgK 2508 1069 CDS product flagellar hook-associated protein 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKH5 protein_id gnl|my_center|LOCUS_01470 2951 2511 gene locus_tag LOCUS_01480 2951 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3765 2953 gene locus_tag LOCUS_01490 3765 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4865 3762 gene locus_tag LOCUS_01500 gene flgI 4865 3762 CDS product flagellar P-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F5 protein_id gnl|my_center|LOCUS_01500 5433 4867 gene locus_tag LOCUS_01510 5433 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6061 5435 gene locus_tag LOCUS_01520 6061 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 6890 6102 gene locus_tag LOCUS_01530 gene flgG2 6890 6102 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880505.1 protein_id gnl|my_center|LOCUS_01530 7710 6934 gene locus_tag LOCUS_01540 gene flgF 7710 6934 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748F0 protein_id gnl|my_center|LOCUS_01540 7937 7722 gene locus_tag LOCUS_01550 7937 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 <8621 8102 gene locus_tag LOCUS_01560 <8621 8102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404265.1:permease >Feature sequence018 979 3084 gene locus_tag LOCUS_01570 979 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3805 3098 gene locus_tag LOCUS_01580 3805 3098 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_01580 4257 3805 gene locus_tag LOCUS_01590 gene ccoH 4257 3805 CDS product cytochrome Cbb3 oxidase maturation protein CcoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_01590 5764 4247 gene locus_tag LOCUS_01600 gene ccoG 5764 4247 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_01600 6333 5770 gene locus_tag LOCUS_01610 6333 5770 CDS product cytochrome CBB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120870.1 protein_id gnl|my_center|LOCUS_01610 6520 6335 gene locus_tag LOCUS_01620 6520 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 <8317 6536 gene locus_tag LOCUS_01630 <8317 6536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963294.1:bifunctional cbb3-type cytochrome C oxidase subunit I/II >Feature sequence019 1015 1593 gene locus_tag LOCUS_01640 1015 1593 CDS product alkylated DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_01640 1590 2714 gene locus_tag LOCUS_01650 gene anmK 1590 2714 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EHB5 protein_id gnl|my_center|LOCUS_01650 3070 3336 gene locus_tag LOCUS_01660 3070 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3333 3914 gene locus_tag LOCUS_01670 3333 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 4682 3981 gene locus_tag LOCUS_01680 4682 3981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 <8214 4808 gene locus_tag LOCUS_01690 <8214 4808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072981.1:diguanylate cyclase >Feature sequence020 <1 2245 gene locus_tag LOCUS_01700 <1 2245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:multidrug ABC transporter 2400 3935 gene locus_tag LOCUS_01710 2400 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481841.1 protein_id gnl|my_center|LOCUS_01710 4051 5322 gene locus_tag LOCUS_01720 gene rhlE 4051 5322 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSL5 protein_id gnl|my_center|LOCUS_01720 6119 5394 gene locus_tag LOCUS_01730 6119 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 >Feature sequence021 <1 2291 gene locus_tag LOCUS_01740 <1 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109349.1:ATP-dependent helicase 2339 3820 gene locus_tag LOCUS_01750 2339 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000447105.1 protein_id gnl|my_center|LOCUS_01750 5130 3835 gene locus_tag LOCUS_01760 5130 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5668 5462 gene locus_tag LOCUS_01770 5668 5462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 5946 5689 gene locus_tag LOCUS_01780 5946 5689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 6293 6814 gene locus_tag LOCUS_01790 6293 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 >Feature sequence022 <1 580 gene locus_tag LOCUS_01800 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJQ5:dihydropteroate synthase 1851 610 gene locus_tag LOCUS_01810 1851 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 2429 1860 gene locus_tag LOCUS_01820 2429 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461816.1 protein_id gnl|my_center|LOCUS_01820 3485 2781 gene locus_tag LOCUS_01830 3485 2781 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_01830 6423 3508 gene locus_tag LOCUS_01840 6423 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6661 6924 gene locus_tag LOCUS_01850 6661 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 >Feature sequence023 4920 3235 gene locus_tag LOCUS_01860 4920 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 5201 6307 gene locus_tag LOCUS_01870 5201 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 7597 6308 gene locus_tag LOCUS_01880 7597 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence024 1704 403 gene locus_tag LOCUS_01890 1704 403 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403495.1 protein_id gnl|my_center|LOCUS_01890 4882 1697 gene locus_tag LOCUS_01900 4882 1697 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403251.1 protein_id gnl|my_center|LOCUS_01900 5995 4886 gene locus_tag LOCUS_01910 5995 4886 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071990.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence025 541 2490 gene locus_tag LOCUS_01920 541 2490 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_01920 2727 3350 gene locus_tag LOCUS_01930 2727 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 3438 4736 gene locus_tag LOCUS_01940 3438 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 5439 5023 gene locus_tag LOCUS_01950 5439 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_01950 7571 5439 gene locus_tag LOCUS_01960 7571 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 >Feature sequence026 1082 2419 gene locus_tag LOCUS_01970 gene gcvPA 1082 2419 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC05 protein_id gnl|my_center|LOCUS_01970 2434 2769 gene locus_tag LOCUS_01980 2434 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2750 3658 gene locus_tag LOCUS_01990 2750 3658 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_01990 3655 4035 gene locus_tag LOCUS_02000 3655 4035 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583691.1 protein_id gnl|my_center|LOCUS_02000 4029 4628 gene locus_tag LOCUS_02010 4029 4628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7437 4612 gene locus_tag LOCUS_02020 7437 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence027 2599 710 gene locus_tag LOCUS_02030 2599 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 3190 2615 gene locus_tag LOCUS_02040 3190 2615 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016342.1 protein_id gnl|my_center|LOCUS_02040 5000 3402 gene locus_tag LOCUS_02050 5000 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584157.1 protein_id gnl|my_center|LOCUS_02050 5208 5663 gene locus_tag LOCUS_02060 5208 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02060 5758 6048 gene locus_tag LOCUS_02070 5758 6048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7289 6045 gene locus_tag LOCUS_02080 7289 6045 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123294.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence028 1023 1724 gene locus_tag LOCUS_02090 gene flgD 1023 1724 CDS product basal-body rod modification protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G32 protein_id gnl|my_center|LOCUS_02090 1740 2129 gene locus_tag LOCUS_02100 1740 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_02100 2249 3571 gene locus_tag LOCUS_02110 gene flgE 2249 3571 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F7IUZ4 protein_id gnl|my_center|LOCUS_02110 5257 3758 gene locus_tag LOCUS_02120 gene lysS 5257 3758 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCM7 protein_id gnl|my_center|LOCUS_02120 5414 5974 gene locus_tag LOCUS_02130 gene infC 5414 5974 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P65138 protein_id gnl|my_center|LOCUS_02130 6069 6266 gene locus_tag LOCUS_02140 gene rpmI 6069 6266 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT6 protein_id gnl|my_center|LOCUS_02140 6365 6709 gene locus_tag LOCUS_02150 gene rplT 6365 6709 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AAN9 protein_id gnl|my_center|LOCUS_02150 >Feature sequence029 36 1166 gene locus_tag LOCUS_02160 gene ftsW 36 1166 CDS product cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931729.1 protein_id gnl|my_center|LOCUS_02160 1607 1278 gene locus_tag LOCUS_02170 1607 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3324 2026 gene locus_tag LOCUS_02180 3324 2026 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405384.1 protein_id gnl|my_center|LOCUS_02180 4249 3317 gene locus_tag LOCUS_02190 4249 3317 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_02190 4796 4233 gene locus_tag LOCUS_02200 4796 4233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5584 5144 gene locus_tag LOCUS_02210 gene nuoE 5584 5144 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_02210 6549 5638 gene locus_tag LOCUS_02220 6549 5638 CDS product squalene synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930256.1 protein_id gnl|my_center|LOCUS_02220 7448 6546 gene locus_tag LOCUS_02230 gene ctrB 7448 6546 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122225.1 protein_id gnl|my_center|LOCUS_02230 >Feature sequence030 274 1185 gene locus_tag LOCUS_02240 274 1185 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202149.1 protein_id gnl|my_center|LOCUS_02240 1175 2008 gene locus_tag LOCUS_02250 1175 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 1995 3485 gene locus_tag LOCUS_02260 1995 3485 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_02260 3615 5732 gene locus_tag LOCUS_02270 gene rpsA 3615 5732 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_661192.2 protein_id gnl|my_center|LOCUS_02270 5839 6279 gene locus_tag LOCUS_02280 5839 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 6962 6276 gene locus_tag LOCUS_02290 6962 6276 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861070.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence031 263 1249 gene locus_tag LOCUS_02300 263 1249 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_02300 1253 2128 gene locus_tag LOCUS_02310 1253 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_02310 2132 5506 gene locus_tag LOCUS_02320 2132 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5503 6450 gene locus_tag LOCUS_02330 5503 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence032 151 426 gene locus_tag LOCUS_02340 151 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 1912 458 gene locus_tag LOCUS_02350 gene nadB 1912 458 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEY9 protein_id gnl|my_center|LOCUS_02350 2841 1915 gene locus_tag LOCUS_02360 gene nadA 2841 1915 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A2Z1 protein_id gnl|my_center|LOCUS_02360 3588 2887 gene locus_tag LOCUS_02370 gene scdA 3588 2887 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_02370 3743 5197 gene locus_tag LOCUS_02380 3743 5197 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_02380 5210 5845 gene locus_tag LOCUS_02390 5210 5845 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_02390 >Feature sequence033 757 5076 gene locus_tag LOCUS_02400 757 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 5775 5137 gene locus_tag LOCUS_02410 5775 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6376 6170 gene locus_tag LOCUS_02420 6376 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 7138 6749 gene locus_tag LOCUS_02430 7138 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence034 754 308 gene locus_tag LOCUS_02440 754 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249810.1 protein_id gnl|my_center|LOCUS_02440 954 751 gene locus_tag LOCUS_02450 954 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 1633 1169 gene locus_tag LOCUS_02460 1633 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 2119 1706 gene locus_tag LOCUS_02470 2119 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 2348 2638 gene locus_tag LOCUS_02480 2348 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2635 3138 gene locus_tag LOCUS_02490 2635 3138 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_02490 3524 4300 gene locus_tag LOCUS_02500 gene paaB1 3524 4300 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709123.1 protein_id gnl|my_center|LOCUS_02500 4306 5757 gene locus_tag LOCUS_02510 4306 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 5788 6684 gene locus_tag LOCUS_02520 5788 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence035 690 202 gene locus_tag LOCUS_02530 690 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 1185 694 gene locus_tag LOCUS_02540 1185 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 1748 1188 gene locus_tag LOCUS_02550 1748 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 1791 2339 gene locus_tag LOCUS_02560 1791 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 2650 2375 gene locus_tag LOCUS_02570 2650 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2812 4269 gene locus_tag LOCUS_02580 2812 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4298 5806 gene locus_tag LOCUS_02590 4298 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5870 6808 gene locus_tag LOCUS_02600 gene pip 5870 6808 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774253.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence036 2736 3614 gene locus_tag LOCUS_02610 2736 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02610 3696 3926 gene locus_tag LOCUS_02620 3696 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02620 4108 5013 gene locus_tag LOCUS_02630 4108 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_02630 6036 4984 gene locus_tag LOCUS_02640 6036 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 6436 6813 gene locus_tag LOCUS_02650 6436 6813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 >Feature sequence037 346 3192 gene locus_tag LOCUS_02660 gene tolB 346 3192 CDS product TolB protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120765.1 protein_id gnl|my_center|LOCUS_02660 3852 3166 gene locus_tag LOCUS_02670 3852 3166 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963752.1 protein_id gnl|my_center|LOCUS_02670 4003 5544 gene locus_tag LOCUS_02680 4003 5544 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963722.1 protein_id gnl|my_center|LOCUS_02680 5828 6424 gene locus_tag LOCUS_02690 5828 6424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6529 6864 gene locus_tag LOCUS_02700 6529 6864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence038 1961 699 gene locus_tag LOCUS_02710 1961 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001011239.1 protein_id gnl|my_center|LOCUS_02710 2240 3019 gene locus_tag LOCUS_02720 2240 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3019 3969 gene locus_tag LOCUS_02730 3019 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 4066 4488 gene locus_tag LOCUS_02740 gene phnB 4066 4488 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001173977.1 protein_id gnl|my_center|LOCUS_02740 5270 4500 gene locus_tag LOCUS_02750 5270 4500 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_02750 6686 5286 gene locus_tag LOCUS_02760 6686 5286 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence039 <1 3194 gene locus_tag LOCUS_02770 <1 3194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403927.1:alpha-ketoglutarate decarboxylase 3982 3269 gene locus_tag LOCUS_02780 3982 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4951 4046 gene locus_tag LOCUS_02790 4951 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5790 4948 gene locus_tag LOCUS_02800 gene prmA 5790 4948 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64VV4 protein_id gnl|my_center|LOCUS_02800 5858 6355 gene locus_tag LOCUS_02810 5858 6355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 6364 6789 gene locus_tag LOCUS_02820 6364 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence040 816 1214 gene locus_tag LOCUS_02830 gene apaG 816 1214 CDS product protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VU61 protein_id gnl|my_center|LOCUS_02830 1216 1986 gene locus_tag LOCUS_02840 1216 1986 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_02840 1983 2657 gene locus_tag LOCUS_02850 gene trmB 1983 2657 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDU8 protein_id gnl|my_center|LOCUS_02850 2647 3540 gene locus_tag LOCUS_02860 2647 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 3694 4437 gene locus_tag LOCUS_02870 3694 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 4635 6032 gene locus_tag LOCUS_02880 gene lpxC/fabZ 4635 6032 CDS product bifunctional enzyme LpxC/FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBX0 protein_id gnl|my_center|LOCUS_02880 6042 6809 gene locus_tag LOCUS_02890 6042 6809 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A016 protein_id gnl|my_center|LOCUS_02890 >Feature sequence041 551 1180 gene locus_tag LOCUS_02900 551 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 1228 1917 gene locus_tag LOCUS_02910 1228 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_02910 3124 1928 gene locus_tag LOCUS_02920 3124 1928 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117973.1 protein_id gnl|my_center|LOCUS_02920 3634 3197 gene locus_tag LOCUS_02930 3634 3197 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_02930 4332 3634 gene locus_tag LOCUS_02940 4332 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4763 4329 gene locus_tag LOCUS_02950 4763 4329 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462120.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence042 533 1618 gene locus_tag LOCUS_02960 533 1618 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403879.1 protein_id gnl|my_center|LOCUS_02960 1622 2425 gene locus_tag LOCUS_02970 1622 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2400 3821 gene locus_tag LOCUS_02980 2400 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3880 4695 gene locus_tag LOCUS_02990 3880 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 4837 5208 gene locus_tag LOCUS_03000 4837 5208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 5221 5829 gene locus_tag LOCUS_03010 5221 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence043 <1 1323 gene locus_tag LOCUS_03020 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204384.1:hemagglutinin 1421 1918 gene locus_tag LOCUS_03030 1421 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1927 2742 gene locus_tag LOCUS_03040 1927 2742 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070553.1 protein_id gnl|my_center|LOCUS_03040 4241 2763 gene locus_tag LOCUS_03050 4241 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 5209 4364 gene locus_tag LOCUS_03060 5209 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 5382 5609 gene locus_tag LOCUS_03070 5382 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence044 1130 21 gene locus_tag LOCUS_03080 gene pyrD 1130 21 CDS product dihydroorotate dehydrogenase A (fumarate) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FJB5 protein_id gnl|my_center|LOCUS_03080 2758 1127 gene locus_tag LOCUS_03090 2758 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3434 2883 gene locus_tag LOCUS_03100 3434 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_03100 3910 3677 gene locus_tag LOCUS_03110 3910 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 3954 5267 gene locus_tag LOCUS_03120 3954 5267 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974524.1 protein_id gnl|my_center|LOCUS_03120 5264 6238 gene locus_tag LOCUS_03130 5264 6238 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435855.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence045 1518 3884 gene locus_tag LOCUS_03140 1518 3884 CDS product collagen-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_03140 3877 4794 gene locus_tag LOCUS_03150 3877 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 4914 5786 gene locus_tag LOCUS_03160 4914 5786 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_03160 5974 6585 gene locus_tag LOCUS_03170 5974 6585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6620 6757 gene locus_tag LOCUS_03180 6620 6757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 >Feature sequence046 <1 960 gene locus_tag LOCUS_03190 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932928.1:phosphate starvation protein PhoH 1091 3148 gene locus_tag LOCUS_03200 1091 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3149 4147 gene locus_tag LOCUS_03210 3149 4147 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941435.1 protein_id gnl|my_center|LOCUS_03210 4151 5425 gene locus_tag LOCUS_03220 4151 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265931.1 protein_id gnl|my_center|LOCUS_03220 5614 5429 gene locus_tag LOCUS_03230 5614 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 <6792 5616 gene locus_tag LOCUS_03240 <6792 5616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97HD0:exodeoxyribonuclease 7 large subunit >Feature sequence047 3895 1259 gene locus_tag LOCUS_03250 3895 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 5578 3986 gene locus_tag LOCUS_03260 gene lnt 5578 3986 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_03260 5775 6212 gene locus_tag LOCUS_03270 gene fliW 5775 6212 CDS product flagellar assembly factor FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EYA9 protein_id gnl|my_center|LOCUS_03270 6214 6504 gene locus_tag LOCUS_03280 6214 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence048 23 979 gene locus_tag LOCUS_03290 23 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03290 998 2845 gene locus_tag LOCUS_03300 998 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 4880 2949 gene locus_tag LOCUS_03310 4880 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 >Feature sequence049 1140 2252 gene locus_tag LOCUS_03320 1140 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 2277 2846 gene locus_tag LOCUS_03330 2277 2846 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A7J3 protein_id gnl|my_center|LOCUS_03330 2942 4180 gene locus_tag LOCUS_03340 2942 4180 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933175.1 protein_id gnl|my_center|LOCUS_03340 4489 4181 gene locus_tag LOCUS_03350 4489 4181 CDS product Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933890.1 protein_id gnl|my_center|LOCUS_03350 4631 5200 gene locus_tag LOCUS_03360 4631 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6307 5273 gene locus_tag LOCUS_03370 gene cpx 6307 5273 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence050 3067 1358 gene locus_tag LOCUS_03380 3067 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3300 4103 gene locus_tag LOCUS_03390 3300 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03390 4173 4598 gene locus_tag LOCUS_03400 4173 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03400 >Feature sequence051 4859 219 gene locus_tag LOCUS_03410 4859 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 5113 6438 gene locus_tag LOCUS_03420 gene ahcY 5113 6438 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3G6 protein_id gnl|my_center|LOCUS_03420 >Feature sequence052 355 116 gene locus_tag LOCUS_03430 355 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 781 419 gene locus_tag LOCUS_03440 781 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258318.1 protein_id gnl|my_center|LOCUS_03440 1175 783 gene locus_tag LOCUS_03450 1175 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 2821 1262 gene locus_tag LOCUS_03460 2821 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3353 2901 gene locus_tag LOCUS_03470 3353 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4107 3562 gene locus_tag LOCUS_03480 4107 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 4493 4245 gene locus_tag LOCUS_03490 4493 4245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 5061 4609 gene locus_tag LOCUS_03500 5061 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 6335 5163 gene locus_tag LOCUS_03510 6335 5163 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815952.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence053 <1 1785 gene locus_tag LOCUS_03520 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:cation transporter 1782 2996 gene locus_tag LOCUS_03530 1782 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3001 4983 gene locus_tag LOCUS_03540 3001 4983 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence054 1950 790 gene locus_tag LOCUS_03550 1950 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_03550 2932 2114 gene locus_tag LOCUS_03560 2932 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 5280 3085 gene locus_tag LOCUS_03570 gene hppA1 5280 3085 CDS product putative K(+)-stimulated pyrophosphate-energized sodium pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIS7 protein_id gnl|my_center|LOCUS_03570 5790 5440 gene locus_tag LOCUS_03580 gene rsbV 5790 5440 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74D91 protein_id gnl|my_center|LOCUS_03580 5996 5790 gene locus_tag LOCUS_03590 5996 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 >Feature sequence055 1592 816 gene locus_tag LOCUS_03600 gene purC 1592 816 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFN3 protein_id gnl|my_center|LOCUS_03600 1837 1589 gene locus_tag LOCUS_03610 1837 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1719 2054 gene locus_tag LOCUS_03620 1719 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4114 2210 gene locus_tag LOCUS_03630 4114 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6244 4115 gene locus_tag LOCUS_03640 6244 4115 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_03640 >Feature sequence056 1556 696 gene locus_tag LOCUS_03650 1556 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203200.1 protein_id gnl|my_center|LOCUS_03650 2254 1886 gene locus_tag LOCUS_03660 2254 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 3343 2576 gene locus_tag LOCUS_03670 3343 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3493 3822 gene locus_tag LOCUS_03680 3493 3822 CDS product UPF0339 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6G2 protein_id gnl|my_center|LOCUS_03680 3946 4620 gene locus_tag LOCUS_03690 gene ppa 3946 4620 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9Z6Y8 protein_id gnl|my_center|LOCUS_03690 4714 5649 gene locus_tag LOCUS_03700 4714 5649 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_03700 5711 6340 gene locus_tag LOCUS_03710 5711 6340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144074.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence057 1129 992 gene locus_tag LOCUS_03720 1129 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 1784 1356 gene locus_tag LOCUS_03730 1784 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2274 1846 gene locus_tag LOCUS_03740 gene umuD 2274 1846 CDS product umuD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940167.1 protein_id gnl|my_center|LOCUS_03740 3224 2436 gene locus_tag LOCUS_03750 3224 2436 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249687.1 protein_id gnl|my_center|LOCUS_03750 3410 5377 gene locus_tag LOCUS_03760 3410 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 >Feature sequence058 <1 1269 gene locus_tag LOCUS_03770 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963606.1:type I deoxyribonuclease HsdR 1335 3680 gene locus_tag LOCUS_03780 gene fecA 1335 3680 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963607.1 protein_id gnl|my_center|LOCUS_03780 4600 3677 gene locus_tag LOCUS_03790 4600 3677 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121355.1 protein_id gnl|my_center|LOCUS_03790 4697 6133 gene locus_tag LOCUS_03800 gene leuB 4697 6133 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_03800 6151 6333 gene locus_tag LOCUS_03810 6151 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence059 1017 1253 gene locus_tag LOCUS_03820 1017 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 3046 1214 gene locus_tag LOCUS_03830 gene glmS 3046 1214 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG38 protein_id gnl|my_center|LOCUS_03830 3539 3207 gene locus_tag LOCUS_03840 3539 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3747 4145 gene locus_tag LOCUS_03850 3747 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4279 5202 gene locus_tag LOCUS_03860 4279 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence060 1305 91 gene locus_tag LOCUS_03870 1305 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 2341 1295 gene locus_tag LOCUS_03880 2341 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 2847 3443 gene locus_tag LOCUS_03890 2847 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3447 5720 gene locus_tag LOCUS_03900 3447 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence061 39 1181 gene locus_tag LOCUS_03910 39 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 1234 1983 gene locus_tag LOCUS_03920 gene ygaJ 1234 1983 CDS product putative peptidase YgaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71089 protein_id gnl|my_center|LOCUS_03920 2061 2252 gene locus_tag LOCUS_03930 2061 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2343 3164 gene locus_tag LOCUS_03940 2343 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3239 5458 gene locus_tag LOCUS_03950 3239 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 6179 5574 gene locus_tag LOCUS_03960 6179 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence062 1849 1190 gene locus_tag LOCUS_03970 1849 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2560 4194 gene locus_tag LOCUS_03980 2560 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4199 4672 gene locus_tag LOCUS_03990 4199 4672 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_03990 4672 6114 gene locus_tag LOCUS_04000 4672 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence063 38 1294 gene locus_tag LOCUS_04010 38 1294 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI7 protein_id gnl|my_center|LOCUS_04010 1297 2304 gene locus_tag LOCUS_04020 gene tsaD 1297 2304 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H010 protein_id gnl|my_center|LOCUS_04020 2319 3770 gene locus_tag LOCUS_04030 2319 3770 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107891.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence064 682 1683 gene locus_tag LOCUS_04040 682 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 1695 2057 gene locus_tag LOCUS_04050 1695 2057 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462150.1 protein_id gnl|my_center|LOCUS_04050 2139 2438 gene locus_tag LOCUS_04060 2139 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 3223 2603 gene locus_tag LOCUS_04070 3223 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3627 3226 gene locus_tag LOCUS_04080 3627 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4057 3629 gene locus_tag LOCUS_04090 4057 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 4468 4067 gene locus_tag LOCUS_04100 4468 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4694 5212 gene locus_tag LOCUS_04110 4694 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 <6180 5276 gene locus_tag LOCUS_04120 <6180 5276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392674.1:metallophosphoesterase >Feature sequence065 2726 1572 gene locus_tag LOCUS_04130 2726 1572 CDS product lycopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257690.1 protein_id gnl|my_center|LOCUS_04130 3475 2765 gene locus_tag LOCUS_04140 3475 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4246 3626 gene locus_tag LOCUS_04150 4246 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4636 4247 gene locus_tag LOCUS_04160 4636 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_04160 4772 5419 gene locus_tag LOCUS_04170 4772 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 5868 5557 gene locus_tag LOCUS_04180 5868 5557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 6126 5884 gene locus_tag LOCUS_04190 6126 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 >Feature sequence066 193 759 gene locus_tag LOCUS_04200 193 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963179.1 protein_id gnl|my_center|LOCUS_04200 847 1191 gene locus_tag LOCUS_04210 847 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121877.1 protein_id gnl|my_center|LOCUS_04210 1308 1517 gene locus_tag LOCUS_04220 1308 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 1714 1917 gene locus_tag LOCUS_04230 1714 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 2113 2916 gene locus_tag LOCUS_04240 2113 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 2921 3175 gene locus_tag LOCUS_04250 2921 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3227 3664 gene locus_tag LOCUS_04260 3227 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3657 4244 gene locus_tag LOCUS_04270 3657 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326532.1 protein_id gnl|my_center|LOCUS_04270 4249 4704 gene locus_tag LOCUS_04280 4249 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_04280 4708 5199 gene locus_tag LOCUS_04290 4708 5199 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083839.1 protein_id gnl|my_center|LOCUS_04290 5229 5438 gene locus_tag LOCUS_04300 5229 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 5452 5778 gene locus_tag LOCUS_04310 5452 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence067 1070 216 gene locus_tag LOCUS_04320 1070 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1543 1067 gene locus_tag LOCUS_04330 1543 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04330 4410 1774 gene locus_tag LOCUS_04340 4410 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 5105 4653 gene locus_tag LOCUS_04350 5105 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206314.1 protein_id gnl|my_center|LOCUS_04350 5505 5110 gene locus_tag LOCUS_04360 5505 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 5874 5521 gene locus_tag LOCUS_04370 5874 5521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence068 <1 982 gene locus_tag LOCUS_04380 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021497.1:Trk system potassium transporter TrkH 1100 2539 gene locus_tag LOCUS_04390 1100 2539 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_04390 2709 4106 gene locus_tag LOCUS_04400 2709 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence069 1665 2048 gene locus_tag LOCUS_04410 1665 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2289 4148 gene locus_tag LOCUS_04420 gene yidC 2289 4148 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGG2 protein_id gnl|my_center|LOCUS_04420 >Feature sequence070 114 959 gene locus_tag LOCUS_04430 114 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 967 1179 gene locus_tag LOCUS_04440 967 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1874 1323 gene locus_tag LOCUS_04450 1874 1323 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_04450 1934 2749 gene locus_tag LOCUS_04460 1934 2749 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_04460 2746 3738 gene locus_tag LOCUS_04470 gene asd 2746 3738 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZW9 protein_id gnl|my_center|LOCUS_04470 5763 3835 gene locus_tag LOCUS_04480 5763 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence071 660 2696 gene locus_tag LOCUS_04490 660 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 4181 2775 gene locus_tag LOCUS_04500 4181 2775 CDS product 2,4-diaminobutyrate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097917.1 protein_id gnl|my_center|LOCUS_04500 4342 4266 gene locus_tag LOCUS_t00020 4342 4266 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 <5962 4418 gene locus_tag LOCUS_04510 <5962 4418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963873.1:peptidase S8 >Feature sequence072 768 259 gene locus_tag LOCUS_04520 768 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1154 765 gene locus_tag LOCUS_04530 1154 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1735 1151 gene locus_tag LOCUS_04540 1735 1151 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_04540 3351 1735 gene locus_tag LOCUS_04550 3351 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3763 3356 gene locus_tag LOCUS_04560 3763 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 5713 3893 gene locus_tag LOCUS_04570 5713 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence073 327 1793 gene locus_tag LOCUS_04580 gene dacB 327 1793 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_04580 4430 1794 gene locus_tag LOCUS_04590 4430 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 4514 5146 gene locus_tag LOCUS_04600 4514 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence074 342 1838 gene locus_tag LOCUS_04610 342 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2169 1873 gene locus_tag LOCUS_04620 2169 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2667 3896 gene locus_tag LOCUS_04630 2667 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4461 3886 gene locus_tag LOCUS_04640 4461 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4998 4504 gene locus_tag LOCUS_04650 4998 4504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 <5923 5013 gene locus_tag LOCUS_04660 <5923 5013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202620.1:SOS mutagenesis and repair protein UmuC >Feature sequence075 525 139 gene locus_tag LOCUS_04670 525 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 1707 616 gene locus_tag LOCUS_04680 gene paaE 1707 616 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085679.1 protein_id gnl|my_center|LOCUS_04680 2062 1733 gene locus_tag LOCUS_04690 2062 1733 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_04690 2582 2163 gene locus_tag LOCUS_04700 2582 2163 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_04700 3519 2758 gene locus_tag LOCUS_04710 3519 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4701 3628 gene locus_tag LOCUS_04720 4701 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 5331 4867 gene locus_tag LOCUS_04730 5331 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 5909 5403 gene locus_tag LOCUS_04740 5909 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence076 795 292 gene locus_tag LOCUS_04750 gene accB 795 292 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057135.1 protein_id gnl|my_center|LOCUS_04750 1452 892 gene locus_tag LOCUS_04760 gene efp 1452 892 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFA4 protein_id gnl|my_center|LOCUS_04760 1552 1481 gene locus_tag LOCUS_t00030 1552 1481 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2304 1621 gene locus_tag LOCUS_04770 gene trmD 2304 1621 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD90 protein_id gnl|my_center|LOCUS_04770 2825 2307 gene locus_tag LOCUS_04780 gene rimM 2825 2307 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6A2 protein_id gnl|my_center|LOCUS_04780 3262 2822 gene locus_tag LOCUS_04790 gene dtd 3262 2822 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GW89 protein_id gnl|my_center|LOCUS_04790 4792 3263 gene locus_tag LOCUS_04800 4792 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4974 5507 gene locus_tag LOCUS_04810 4974 5507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence077 <1 1049 gene locus_tag LOCUS_04820 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WBV0:magnesium transporter MgtE 2449 1046 gene locus_tag LOCUS_04830 2449 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3522 2452 gene locus_tag LOCUS_04840 3522 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3638 3722 gene locus_tag LOCUS_t00040 3638 3722 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3868 4542 gene locus_tag LOCUS_04850 3868 4542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4899 4594 gene locus_tag LOCUS_04860 4899 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 5026 5403 gene locus_tag LOCUS_04870 5026 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence078 762 1241 gene locus_tag LOCUS_04880 762 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1262 2941 gene locus_tag LOCUS_04890 1262 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3766 3236 gene locus_tag LOCUS_04900 3766 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_04900 3862 4659 gene locus_tag LOCUS_04910 3862 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 <5831 4664 gene locus_tag LOCUS_04920 <5831 4664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828556.1:methylmalonyl-CoA mutase >Feature sequence079 906 253 gene locus_tag LOCUS_04930 gene rplY 906 253 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89YZ1 protein_id gnl|my_center|LOCUS_04930 1866 928 gene locus_tag LOCUS_04940 gene prs 1866 928 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D0 protein_id gnl|my_center|LOCUS_04940 1958 1884 gene locus_tag LOCUS_t00050 1958 1884 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3563 2127 gene locus_tag LOCUS_04950 3563 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 3617 4573 gene locus_tag LOCUS_04960 3617 4573 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785778.1 protein_id gnl|my_center|LOCUS_04960 5115 4669 gene locus_tag LOCUS_04970 gene rplI 5115 4669 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72DH1 protein_id gnl|my_center|LOCUS_04970 5525 5151 gene locus_tag LOCUS_04980 5525 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence080 465 187 gene locus_tag LOCUS_04990 465 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 824 739 gene locus_tag LOCUS_t00060 824 739 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1043 2452 gene locus_tag LOCUS_05000 gene atpD2 1043 2452 CDS product ATP synthase subunit beta 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAC9 protein_id gnl|my_center|LOCUS_05000 2465 2734 gene locus_tag LOCUS_05010 2465 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787478.1 protein_id gnl|my_center|LOCUS_05010 2841 4307 gene locus_tag LOCUS_05020 gene guaB 2841 4307 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0L3 protein_id gnl|my_center|LOCUS_05020 4328 5605 gene locus_tag LOCUS_05030 gene pepQ-1 4328 5605 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391500.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence081 <1 823 gene locus_tag LOCUS_05040 <1 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931958.1:outer membrane protein assembly factor BamA 898 1422 gene locus_tag LOCUS_05050 gene ompH 898 1422 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931946.1 protein_id gnl|my_center|LOCUS_05050 1451 1903 gene locus_tag LOCUS_05060 1451 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1945 2562 gene locus_tag LOCUS_05070 1945 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2598 3623 gene locus_tag LOCUS_05080 gene lpxD 2598 3623 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64XW8 protein_id gnl|my_center|LOCUS_05080 4281 3685 gene locus_tag LOCUS_05090 4281 3685 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_05090 4733 4272 gene locus_tag LOCUS_05100 4733 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 >Feature sequence082 1403 66 gene locus_tag LOCUS_05110 1403 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 1714 1415 gene locus_tag LOCUS_05120 1714 1415 CDS product toxin, RelE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_05120 1948 1715 gene locus_tag LOCUS_05130 1948 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2339 2761 gene locus_tag LOCUS_05140 gene flgB 2339 2761 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24500 protein_id gnl|my_center|LOCUS_05140 2771 3256 gene locus_tag LOCUS_05150 gene flgC 2771 3256 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAY9 protein_id gnl|my_center|LOCUS_05150 3268 3564 gene locus_tag LOCUS_05160 3268 3564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3620 3931 gene locus_tag LOCUS_05170 gene fliE 3620 3931 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I597 protein_id gnl|my_center|LOCUS_05170 3951 5756 gene locus_tag LOCUS_05180 3951 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence083 1217 213 gene locus_tag LOCUS_05190 1217 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3415 1217 gene locus_tag LOCUS_05200 3415 1217 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963613.1 protein_id gnl|my_center|LOCUS_05200 4711 3416 gene locus_tag LOCUS_05210 4711 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 <5757 4836 gene locus_tag LOCUS_05220 <5757 4836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000781451.1:hybrid sensor histidine kinase/response regulator >Feature sequence084 2583 4196 gene locus_tag LOCUS_05230 2583 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence085 138 2048 gene locus_tag LOCUS_05240 138 2048 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202481.1 protein_id gnl|my_center|LOCUS_05240 2038 2820 gene locus_tag LOCUS_05250 2038 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2879 3991 gene locus_tag LOCUS_05260 2879 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4100 4579 gene locus_tag LOCUS_05270 4100 4579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 <5742 4946 gene locus_tag LOCUS_05280 <5742 4946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073592.1:membrane protein >Feature sequence086 1413 223 gene locus_tag LOCUS_05290 1413 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 1503 2477 gene locus_tag LOCUS_05300 1503 2477 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963819.1 protein_id gnl|my_center|LOCUS_05300 2593 3396 gene locus_tag LOCUS_05310 2593 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 3413 4885 gene locus_tag LOCUS_05320 3413 4885 CDS product cell envelope biogenesis protein OmpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence087 <1 754 gene locus_tag LOCUS_05330 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002671534.1:hydrolase 755 946 gene locus_tag LOCUS_05340 755 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 1884 1189 gene locus_tag LOCUS_05350 gene fkpA 1884 1189 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KGZ9 protein_id gnl|my_center|LOCUS_05350 1979 2449 gene locus_tag LOCUS_05360 gene ribH 1979 2449 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JNS3 protein_id gnl|my_center|LOCUS_05360 2502 4754 gene locus_tag LOCUS_05370 2502 4754 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence088 2772 433 gene locus_tag LOCUS_05380 2772 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2989 5127 gene locus_tag LOCUS_05390 2989 5127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence089 513 4580 gene locus_tag LOCUS_05400 513 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5449 4655 gene locus_tag LOCUS_05410 5449 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence090 1184 345 gene locus_tag LOCUS_05420 1184 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3473 1308 gene locus_tag LOCUS_05430 3473 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 4018 3470 gene locus_tag LOCUS_05440 4018 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4103 4261 gene locus_tag LOCUS_05450 4103 4261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence091 1326 1039 gene locus_tag LOCUS_05460 1326 1039 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007851388.1 protein_id gnl|my_center|LOCUS_05460 1688 1323 gene locus_tag LOCUS_05470 1688 1323 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011199156.1 protein_id gnl|my_center|LOCUS_05470 2694 1810 gene locus_tag LOCUS_05480 2694 1810 CDS product GumN protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402916.1 protein_id gnl|my_center|LOCUS_05480 2896 3747 gene locus_tag LOCUS_05490 2896 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3845 4651 gene locus_tag LOCUS_05500 3845 4651 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990036.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence092 <1 1737 gene locus_tag LOCUS_05510 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011110242.1:beta-lactam antibiotic acylase 2427 1741 gene locus_tag LOCUS_05520 2427 1741 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HTU9 protein_id gnl|my_center|LOCUS_05520 4831 2603 gene locus_tag LOCUS_05530 gene pnp 4831 2603 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBY3 protein_id gnl|my_center|LOCUS_05530 5268 5002 gene locus_tag LOCUS_05540 gene rpsO 5268 5002 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS7 protein_id gnl|my_center|LOCUS_05540 >Feature sequence093 278 1444 gene locus_tag LOCUS_05550 gene metB 278 1444 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_05550 1567 2853 gene locus_tag LOCUS_05560 1567 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 2921 3694 gene locus_tag LOCUS_05570 2921 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3672 4286 gene locus_tag LOCUS_05580 3672 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963857.1 protein_id gnl|my_center|LOCUS_05580 4273 4890 gene locus_tag LOCUS_05590 4273 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 4890 5324 gene locus_tag LOCUS_05600 4890 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence094 65 511 gene locus_tag LOCUS_05610 65 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 508 1224 gene locus_tag LOCUS_05620 gene pdxJ 508 1224 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83QI7 protein_id gnl|my_center|LOCUS_05620 1243 3141 gene locus_tag LOCUS_05630 gene asnB 1243 3141 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_05630 4668 3145 gene locus_tag LOCUS_05640 4668 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence095 629 3175 gene locus_tag LOCUS_05650 gene leuS 629 3175 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZY7 protein_id gnl|my_center|LOCUS_05650 3245 4324 gene locus_tag LOCUS_05660 gene rlmN 3245 4324 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X240 protein_id gnl|my_center|LOCUS_05660 4372 5214 gene locus_tag LOCUS_05670 4372 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence096 <1 764 gene locus_tag LOCUS_05680 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405135.1:transcriptional regulator 802 1263 gene locus_tag LOCUS_05690 802 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1277 2272 gene locus_tag LOCUS_05700 1277 2272 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250768.1 protein_id gnl|my_center|LOCUS_05700 2265 3287 gene locus_tag LOCUS_05710 gene ruvB 2265 3287 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q650B4 protein_id gnl|my_center|LOCUS_05710 3671 3279 gene locus_tag LOCUS_05720 3671 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4103 3768 gene locus_tag LOCUS_05730 4103 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5249 4509 gene locus_tag LOCUS_05740 5249 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963352.1 protein_id gnl|my_center|LOCUS_05740 5413 5258 gene locus_tag LOCUS_05750 5413 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence097 339 644 gene locus_tag LOCUS_05760 339 644 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764747.1 protein_id gnl|my_center|LOCUS_05760 716 1912 gene locus_tag LOCUS_05770 gene ribBA 716 1912 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHZ1 protein_id gnl|my_center|LOCUS_05770 1931 2407 gene locus_tag LOCUS_05780 gene greA 1931 2407 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCH5 protein_id gnl|my_center|LOCUS_05780 2486 3061 gene locus_tag LOCUS_05790 2486 3061 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_05790 3058 3663 gene locus_tag LOCUS_05800 3058 3663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3644 4096 gene locus_tag LOCUS_05810 3644 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence098 520 1716 gene locus_tag LOCUS_05820 520 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1830 2099 gene locus_tag LOCUS_05830 1830 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2855 4156 gene locus_tag LOCUS_05840 2855 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4161 5336 gene locus_tag LOCUS_05850 4161 5336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence099 559 1005 gene locus_tag LOCUS_05860 559 1005 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261949.1 protein_id gnl|my_center|LOCUS_05860 1002 1853 gene locus_tag LOCUS_05870 1002 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2566 1850 gene locus_tag LOCUS_05880 2566 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2629 4623 gene locus_tag LOCUS_05890 2629 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 >Feature sequence100 846 1262 gene locus_tag LOCUS_05900 846 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 1442 2572 gene locus_tag LOCUS_05910 1442 2572 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790620.1 protein_id gnl|my_center|LOCUS_05910 2594 4105 gene locus_tag LOCUS_05920 2594 4105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence101 754 960 gene locus_tag LOCUS_05930 754 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 >Feature sequence102 1368 121 gene locus_tag LOCUS_05940 1368 121 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259114.1 protein_id gnl|my_center|LOCUS_05940 1505 3763 gene locus_tag LOCUS_05950 1505 3763 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_05950 3771 4652 gene locus_tag LOCUS_05960 3771 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 4725 5138 gene locus_tag LOCUS_05970 4725 5138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5164 5361 gene locus_tag LOCUS_05980 gene rpsU 5164 5361 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB70 protein_id gnl|my_center|LOCUS_05980 >Feature sequence103 1260 355 gene locus_tag LOCUS_05990 gene serA 1260 355 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963344.1 protein_id gnl|my_center|LOCUS_05990 1445 2518 gene locus_tag LOCUS_06000 gene serC 1445 2518 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80862 protein_id gnl|my_center|LOCUS_06000 3927 2545 gene locus_tag LOCUS_06010 3927 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 >Feature sequence104 713 1261 gene locus_tag LOCUS_06020 713 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 1932 1318 gene locus_tag LOCUS_06030 1932 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2939 2331 gene locus_tag LOCUS_06040 2939 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 3526 3005 gene locus_tag LOCUS_06050 3526 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 4130 3597 gene locus_tag LOCUS_06060 4130 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4921 4145 gene locus_tag LOCUS_06070 4921 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5142 4930 gene locus_tag LOCUS_06080 5142 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence105 2478 643 gene locus_tag LOCUS_06090 2478 643 CDS product aerotolerance-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993033.1 protein_id gnl|my_center|LOCUS_06090 3311 2478 gene locus_tag LOCUS_06100 3311 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4245 3304 gene locus_tag LOCUS_06110 4245 3304 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence106 <1 583 gene locus_tag LOCUS_06120 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962644.1:peptidase M28 580 1104 gene locus_tag LOCUS_06130 gene pyrE 580 1104 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HNJ2 protein_id gnl|my_center|LOCUS_06130 2461 1106 gene locus_tag LOCUS_06140 2461 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4024 2531 gene locus_tag LOCUS_06150 4024 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence107 1200 727 gene locus_tag LOCUS_06160 1200 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3718 1442 gene locus_tag LOCUS_06170 3718 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 <5308 3878 gene locus_tag LOCUS_06180 <5308 3878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852436.1:zinc protease >Feature sequence108 484 107 gene locus_tag LOCUS_06190 484 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203198.1 protein_id gnl|my_center|LOCUS_06190 921 514 gene locus_tag LOCUS_06200 921 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 1419 991 gene locus_tag LOCUS_06210 1419 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06210 2079 1444 gene locus_tag LOCUS_06220 2079 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06220 2548 2087 gene locus_tag LOCUS_06230 2548 2087 CDS product glycerol-3-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016760.1 protein_id gnl|my_center|LOCUS_06230 3522 2545 gene locus_tag LOCUS_06240 gene rfaE 3522 2545 CDS product RfaE bifunctional protein, domain I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_06240 4340 3519 gene locus_tag LOCUS_06250 4340 3519 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_06250 <5282 4462 gene locus_tag LOCUS_06260 <5282 4462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S6G8:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG >Feature sequence109 1762 353 gene locus_tag LOCUS_06270 1762 353 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704803.1 protein_id gnl|my_center|LOCUS_06270 2565 1870 gene locus_tag LOCUS_06280 2565 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 3275 2565 gene locus_tag LOCUS_06290 3275 2565 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067283.1 protein_id gnl|my_center|LOCUS_06290 4434 3391 gene locus_tag LOCUS_06300 gene idiA 4434 3391 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_06300 >Feature sequence110 >Feature sequence111 1084 323 gene locus_tag LOCUS_06310 1084 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1605 1138 gene locus_tag LOCUS_06320 1605 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3096 1645 gene locus_tag LOCUS_06330 3096 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3269 3640 gene locus_tag LOCUS_06340 3269 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5149 3800 gene locus_tag LOCUS_06350 5149 3800 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_06350 >Feature sequence112 627 370 gene locus_tag LOCUS_06360 627 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 1496 627 gene locus_tag LOCUS_06370 gene dapD 1496 627 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933909.1 protein_id gnl|my_center|LOCUS_06370 3921 1474 gene locus_tag LOCUS_06380 gene lon 3921 1474 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKD3 protein_id gnl|my_center|LOCUS_06380 5139 4051 gene locus_tag LOCUS_06390 gene ilvK 5139 4051 CDS product branched-chain-amino-acid aminotransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39576 protein_id gnl|my_center|LOCUS_06390 >Feature sequence113 2947 134 gene locus_tag LOCUS_06400 2947 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence114 <1 1689 gene locus_tag LOCUS_06410 <1 1689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KD18:protein translocase subunit SecA 1863 1788 gene locus_tag LOCUS_t00070 1863 1788 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2057 4570 gene locus_tag LOCUS_06420 2057 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence115 2181 799 gene locus_tag LOCUS_06430 2181 799 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_06430 2250 2687 gene locus_tag LOCUS_06440 2250 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2697 3383 gene locus_tag LOCUS_06450 2697 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4444 3377 gene locus_tag LOCUS_06460 4444 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 <5157 4429 gene locus_tag LOCUS_06470 <5157 4429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64NW8:peptidylprolyl isomerase >Feature sequence116 2879 2103 gene locus_tag LOCUS_06480 2879 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3167 2892 gene locus_tag LOCUS_06490 3167 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3222 4493 gene locus_tag LOCUS_06500 3222 4493 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582949.1 protein_id gnl|my_center|LOCUS_06500 4502 4723 gene locus_tag LOCUS_06510 4502 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence117 1700 1218 gene locus_tag LOCUS_06520 1700 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06520 1905 2450 gene locus_tag LOCUS_06530 1905 2450 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119096.1 protein_id gnl|my_center|LOCUS_06530 2472 2966 gene locus_tag LOCUS_06540 2472 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 3621 3028 gene locus_tag LOCUS_06550 3621 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence118 227 694 gene locus_tag LOCUS_06560 227 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 788 1219 gene locus_tag LOCUS_06570 788 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_06570 2080 1277 gene locus_tag LOCUS_06580 2080 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2273 2091 gene locus_tag LOCUS_06590 2273 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2229 4028 gene locus_tag LOCUS_06600 gene lepA 2229 4028 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCH0 protein_id gnl|my_center|LOCUS_06600 4039 4956 gene locus_tag LOCUS_06610 gene lepB 4039 4956 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCH1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence119 1615 152 gene locus_tag LOCUS_06620 gene leuB 1615 152 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_06620 3600 1762 gene locus_tag LOCUS_06630 3600 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 3974 3792 gene locus_tag LOCUS_06640 3974 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3978 4445 gene locus_tag LOCUS_06650 3978 4445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 4467 4919 gene locus_tag LOCUS_06660 4467 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence120 2817 3500 gene locus_tag LOCUS_06670 2817 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3694 4020 gene locus_tag LOCUS_06680 3694 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4877 4398 gene locus_tag LOCUS_06690 4877 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence121 862 182 gene locus_tag LOCUS_06700 862 182 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_06700 1737 859 gene locus_tag LOCUS_06710 1737 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2016 3905 gene locus_tag LOCUS_06720 2016 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3989 4417 gene locus_tag LOCUS_06730 3989 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4600 4812 gene locus_tag LOCUS_06740 4600 4812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence122 266 991 gene locus_tag LOCUS_06750 gene fliP 266 991 CDS product flagellar biosynthetic protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3V8D2 protein_id gnl|my_center|LOCUS_06750 999 1268 gene locus_tag LOCUS_06760 gene fliQ 999 1268 CDS product flagellar biosynthetic protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P35535 protein_id gnl|my_center|LOCUS_06760 1279 2079 gene locus_tag LOCUS_06770 1279 2079 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKD3 protein_id gnl|my_center|LOCUS_06770 2079 3161 gene locus_tag LOCUS_06780 gene flhB 2079 3161 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457645.1 protein_id gnl|my_center|LOCUS_06780 3317 3724 gene locus_tag LOCUS_06790 3317 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 3776 4039 gene locus_tag LOCUS_06800 3776 4039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4227 4838 gene locus_tag LOCUS_06810 4227 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence123 2 181 gene locus_tag LOCUS_06820 2 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 198 1415 gene locus_tag LOCUS_06830 198 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1477 1755 gene locus_tag LOCUS_06840 1477 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2101 3669 gene locus_tag LOCUS_06850 gene rny 2101 3669 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97I38 protein_id gnl|my_center|LOCUS_06850 >Feature sequence124 349 738 gene locus_tag LOCUS_06860 349 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06860 822 3644 gene locus_tag LOCUS_06870 822 3644 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_06870 3777 4214 gene locus_tag LOCUS_06880 3777 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence125 3578 57 gene locus_tag LOCUS_06890 3578 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4352 3885 gene locus_tag LOCUS_06900 4352 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4573 4857 gene locus_tag LOCUS_06910 4573 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence126 2575 2015 gene locus_tag LOCUS_06920 2575 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3635 2592 gene locus_tag LOCUS_06930 3635 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_06930 4343 3714 gene locus_tag LOCUS_06940 4343 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4813 4343 gene locus_tag LOCUS_06950 4813 4343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence127 173 1474 gene locus_tag LOCUS_06960 gene hflX 173 1474 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZX0 protein_id gnl|my_center|LOCUS_06960 1464 4730 gene locus_tag LOCUS_06970 gene mfd 1464 4730 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEN4 protein_id gnl|my_center|LOCUS_06970 >Feature sequence128 1932 2618 gene locus_tag LOCUS_06980 gene queC 1932 2618 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF00 protein_id gnl|my_center|LOCUS_06980 2738 3340 gene locus_tag LOCUS_06990 gene rpsD 2738 3340 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3E9J8 protein_id gnl|my_center|LOCUS_06990 <4972 3689 gene locus_tag LOCUS_07000 <4972 3689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404524.1:aldehyde dehydrogenase >Feature sequence129 3718 176 gene locus_tag LOCUS_07010 3718 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence130 3974 1731 gene locus_tag LOCUS_07020 3974 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4122 4907 gene locus_tag LOCUS_07030 4122 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence131 1896 352 gene locus_tag LOCUS_07040 gene rocA 1896 352 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IP0 protein_id gnl|my_center|LOCUS_07040 3675 2011 gene locus_tag LOCUS_07050 3675 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 3750 4847 gene locus_tag LOCUS_07060 gene dal 3750 4847 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HJQ1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence132 231 1322 gene locus_tag LOCUS_07070 gene gcvT 231 1322 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64WS3 protein_id gnl|my_center|LOCUS_07070 1661 2254 gene locus_tag LOCUS_07080 1661 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 2265 3296 gene locus_tag LOCUS_07090 gene fliM 2265 3296 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405303.1 protein_id gnl|my_center|LOCUS_07090 3299 3709 gene locus_tag LOCUS_07100 gene fliY-2 3299 3709 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228489.1 protein_id gnl|my_center|LOCUS_07100 3709 4071 gene locus_tag LOCUS_07110 3709 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence133 2361 193 gene locus_tag LOCUS_07120 2361 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4589 2487 gene locus_tag LOCUS_07130 4589 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence134 1805 723 gene locus_tag LOCUS_07140 1805 723 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963074.1 protein_id gnl|my_center|LOCUS_07140 2642 2061 gene locus_tag LOCUS_07150 2642 2061 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_07150 4052 2835 gene locus_tag LOCUS_07160 4052 2835 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035575.1 protein_id gnl|my_center|LOCUS_07160 4900 4325 gene locus_tag LOCUS_07170 4900 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence135 <1 1258 gene locus_tag LOCUS_07180 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SMF6:aconitate hydratase A 1956 1396 gene locus_tag LOCUS_07190 1956 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2262 3080 gene locus_tag LOCUS_07200 2262 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 3092 3706 gene locus_tag LOCUS_07210 3092 3706 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405414.1 protein_id gnl|my_center|LOCUS_07210 4434 3781 gene locus_tag LOCUS_07220 4434 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence136 134 1207 gene locus_tag LOCUS_07230 134 1207 CDS product phytase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037526.1 protein_id gnl|my_center|LOCUS_07230 1818 1270 gene locus_tag LOCUS_07240 1818 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 2035 3714 gene locus_tag LOCUS_07250 2035 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence137 694 2067 gene locus_tag LOCUS_07260 gene pbeF 694 2067 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038543.1 protein_id gnl|my_center|LOCUS_07260 3016 2120 gene locus_tag LOCUS_07270 3016 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 3171 3013 gene locus_tag LOCUS_07280 3171 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3442 3191 gene locus_tag LOCUS_07290 3442 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3868 3512 gene locus_tag LOCUS_07300 3868 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence138 3747 1315 gene locus_tag LOCUS_07310 3747 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence139 3488 2124 gene locus_tag LOCUS_07320 gene ppx 3488 2124 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249635.1 protein_id gnl|my_center|LOCUS_07320 3724 3491 gene locus_tag LOCUS_07330 3724 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 4649 3813 gene locus_tag LOCUS_07340 4649 3813 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4K7 protein_id gnl|my_center|LOCUS_07340 >Feature sequence140 2336 3232 gene locus_tag LOCUS_07350 gene putA 2336 3232 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_07350 3229 4068 gene locus_tag LOCUS_07360 3229 4068 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106385.1 protein_id gnl|my_center|LOCUS_07360 <4852 4072 gene locus_tag LOCUS_07370 <4852 4072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000443308.1:membrane protein >Feature sequence141 1107 40 gene locus_tag LOCUS_07380 gene dinB 1107 40 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CNP3 protein_id gnl|my_center|LOCUS_07380 2171 1578 gene locus_tag LOCUS_07390 2171 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2602 2171 gene locus_tag LOCUS_07400 2602 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 2681 3154 gene locus_tag LOCUS_07410 gene tadA 2681 3154 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y3W2 protein_id gnl|my_center|LOCUS_07410 3138 3827 gene locus_tag LOCUS_07420 gene rsmI 3138 3827 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T7 protein_id gnl|my_center|LOCUS_07420 3887 4492 gene locus_tag LOCUS_07430 gene tmk 3887 4492 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCU7 protein_id gnl|my_center|LOCUS_07430 >Feature sequence142 2763 457 gene locus_tag LOCUS_07440 2763 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3004 4344 gene locus_tag LOCUS_07450 3004 4344 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_07450 >Feature sequence143 <1 2042 gene locus_tag LOCUS_07460 <1 2042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932265.1:transcriptional regulator 2331 3752 gene locus_tag LOCUS_07470 2331 3752 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964144.1 protein_id gnl|my_center|LOCUS_07470 4500 3853 gene locus_tag LOCUS_07480 4500 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence144 33 413 gene locus_tag LOCUS_07490 33 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 414 1361 gene locus_tag LOCUS_07500 gene rlmF 414 1361 CDS product ribosomal RNA large subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HXG4 protein_id gnl|my_center|LOCUS_07500 1507 2091 gene locus_tag LOCUS_07510 1507 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2091 2669 gene locus_tag LOCUS_07520 2091 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 <4732 2819 gene locus_tag LOCUS_07530 <4732 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence145 <4717 2038 gene locus_tag LOCUS_07540 <4717 2038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403216.1:outer membrane protein >Feature sequence146 764 1894 gene locus_tag LOCUS_07550 764 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 1911 2933 gene locus_tag LOCUS_07560 1911 2933 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence147 280 2304 gene locus_tag LOCUS_07570 280 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2311 3030 gene locus_tag LOCUS_07580 2311 3030 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057460.1 protein_id gnl|my_center|LOCUS_07580 3603 3046 gene locus_tag LOCUS_07590 3603 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000049030.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence148 894 127 gene locus_tag LOCUS_07600 894 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1006 1968 gene locus_tag LOCUS_07610 gene ltd 1006 1968 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_07610 2064 3479 gene locus_tag LOCUS_07620 2064 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence149 4 1692 gene locus_tag LOCUS_07630 gene bfmBB 4 1692 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GX72 protein_id gnl|my_center|LOCUS_07630 1827 3740 gene locus_tag LOCUS_07640 1827 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3744 4445 gene locus_tag LOCUS_07650 3744 4445 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66631 protein_id gnl|my_center|LOCUS_07650 >Feature sequence150 993 1622 gene locus_tag LOCUS_07660 993 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 1655 2248 gene locus_tag LOCUS_07670 1655 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766449.1 protein_id gnl|my_center|LOCUS_07670 2205 2375 gene locus_tag LOCUS_07680 2205 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2491 3096 gene locus_tag LOCUS_07690 2491 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 3191 3739 gene locus_tag LOCUS_07700 3191 3739 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797752.1 protein_id gnl|my_center|LOCUS_07700 3846 4571 gene locus_tag LOCUS_07710 3846 4571 CDS product DUF1275 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537627.1 protein_id gnl|my_center|LOCUS_07710 >Feature sequence151 <1 669 gene locus_tag LOCUS_07720 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8A012:orotidine 5'-phosphate decarboxylase 666 1634 gene locus_tag LOCUS_07730 666 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 1650 2552 gene locus_tag LOCUS_07740 1650 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 2722 3474 gene locus_tag LOCUS_07750 2722 3474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <4648 3558 gene locus_tag LOCUS_07760 <4648 3558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S524:cell division protein FtsZ >Feature sequence152 908 2284 gene locus_tag LOCUS_07770 908 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2477 4507 gene locus_tag LOCUS_07780 2477 4507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence153 1 210 gene locus_tag LOCUS_07790 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 207 725 gene locus_tag LOCUS_07800 207 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 718 1341 gene locus_tag LOCUS_07810 718 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 1487 2203 gene locus_tag LOCUS_07820 1487 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2303 4339 gene locus_tag LOCUS_07830 2303 4339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence154 534 872 gene locus_tag LOCUS_07840 gene phnA 534 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357741.1 protein_id gnl|my_center|LOCUS_07840 1006 1575 gene locus_tag LOCUS_07850 1006 1575 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856821.1 protein_id gnl|my_center|LOCUS_07850 3818 1581 gene locus_tag LOCUS_07860 gene ccoI 3818 1581 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_07860 4557 4018 gene locus_tag LOCUS_07870 4557 4018 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7W0 protein_id gnl|my_center|LOCUS_07870 >Feature sequence155 508 732 gene locus_tag LOCUS_07880 508 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 918 1205 gene locus_tag LOCUS_07890 918 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07890 1390 1755 gene locus_tag LOCUS_07900 1390 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2976 3350 gene locus_tag LOCUS_07910 2976 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3353 3751 gene locus_tag LOCUS_07920 3353 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3970 4446 gene locus_tag LOCUS_07930 3970 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence156 3 824 gene locus_tag LOCUS_07940 3 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 844 1251 gene locus_tag LOCUS_07950 844 1251 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793035.1 protein_id gnl|my_center|LOCUS_07950 1255 3984 gene locus_tag LOCUS_07960 gene adi 1255 3984 CDS product amino acid decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907773.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence157 508 741 gene locus_tag LOCUS_07970 508 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 3580 998 gene locus_tag LOCUS_07980 gene clpC 3580 998 CDS product ATP-dependent Clp protease ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence158 498 2756 gene locus_tag LOCUS_07990 498 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 2868 3467 gene locus_tag LOCUS_08000 2868 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence159 <1 644 gene locus_tag LOCUS_08010 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946852.1:serine-type D-Ala-D-Ala carboxypeptidase 661 924 gene locus_tag LOCUS_08020 661 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 921 2012 gene locus_tag LOCUS_08030 921 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2036 3382 gene locus_tag LOCUS_08040 2036 3382 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107635.1 protein_id gnl|my_center|LOCUS_08040 3390 3941 gene locus_tag LOCUS_08050 3390 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4004 4255 gene locus_tag LOCUS_08060 gene parD1 4004 4255 CDS product antitoxin ParD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P58091 protein_id gnl|my_center|LOCUS_08060 >Feature sequence160 815 51 gene locus_tag LOCUS_08070 815 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1365 1054 gene locus_tag LOCUS_08080 gene nuoK 1365 1054 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CWD6 protein_id gnl|my_center|LOCUS_08080 1904 1362 gene locus_tag LOCUS_08090 gene nuoJ 1904 1362 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404193.1 protein_id gnl|my_center|LOCUS_08090 4038 2014 gene locus_tag LOCUS_08100 4038 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4202 4468 gene locus_tag LOCUS_08110 4202 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence161 6 2171 gene locus_tag LOCUS_08120 6 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3029 2223 gene locus_tag LOCUS_08130 gene exoA 3029 2223 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_08130 3999 3040 gene locus_tag LOCUS_08140 3999 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence162 <1 650 gene locus_tag LOCUS_08150 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H168:carbonic anhydrase 795 1283 gene locus_tag LOCUS_08160 795 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1286 1693 gene locus_tag LOCUS_08170 1286 1693 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083398.1 protein_id gnl|my_center|LOCUS_08170 2709 1690 gene locus_tag LOCUS_08180 2709 1690 CDS product ADP-heptose--LPS heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_08180 3575 2694 gene locus_tag LOCUS_08190 3575 2694 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence163 2574 1609 gene locus_tag LOCUS_08200 2574 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4262 2571 gene locus_tag LOCUS_08210 4262 2571 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence164 2413 137 gene locus_tag LOCUS_08220 gene maeB 2413 137 CDS product bifunctional malic enzyme oxidoreductase/phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_08220 3501 2488 gene locus_tag LOCUS_08230 3501 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4328 3501 gene locus_tag LOCUS_08240 gene yvgN 4328 3501 CDS product glyoxal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32210 protein_id gnl|my_center|LOCUS_08240 >Feature sequence165 2579 1254 gene locus_tag LOCUS_08250 2579 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3704 3054 gene locus_tag LOCUS_08260 3704 3054 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence166 1040 2020 gene locus_tag LOCUS_08270 gene tqsA 1040 2020 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_08270 2086 2730 gene locus_tag LOCUS_08280 2086 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2876 3517 gene locus_tag LOCUS_08290 2876 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4058 3555 gene locus_tag LOCUS_08300 gene bar 4058 3555 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence167 484 1113 gene locus_tag LOCUS_08310 484 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1116 2378 gene locus_tag LOCUS_08320 1116 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107761.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence168 358 1659 gene locus_tag LOCUS_08330 358 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence169 307 1782 gene locus_tag LOCUS_08340 gene crtI 307 1782 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_08340 1779 2615 gene locus_tag LOCUS_08350 gene crtB 1779 2615 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_08350 2617 3060 gene locus_tag LOCUS_08360 gene crtZ 2617 3060 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_08360 3420 3112 gene locus_tag LOCUS_08370 3420 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 >Feature sequence170 746 357 gene locus_tag LOCUS_08380 746 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1623 1009 gene locus_tag LOCUS_08390 1623 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 2153 1620 gene locus_tag LOCUS_08400 2153 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 3235 2138 gene locus_tag LOCUS_08410 gene ribD 3235 2138 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I5V2 protein_id gnl|my_center|LOCUS_08410 3699 3232 gene locus_tag LOCUS_08420 3699 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence171 1222 2070 gene locus_tag LOCUS_08430 1222 2070 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_08430 2070 2762 gene locus_tag LOCUS_08440 2070 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08440 2802 2996 gene locus_tag LOCUS_08450 2802 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3684 2989 gene locus_tag LOCUS_08460 3684 2989 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947293.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence172 130 858 gene locus_tag LOCUS_08470 gene terC 130 858 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000422110.1 protein_id gnl|my_center|LOCUS_08470 1985 1026 gene locus_tag LOCUS_08480 1985 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2804 1995 gene locus_tag LOCUS_08490 2804 1995 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_08490 2865 3977 gene locus_tag LOCUS_08500 2865 3977 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence173 <4356 1415 gene locus_tag LOCUS_08510 <4356 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1Q5:DNA-directed RNA polymerase subunit beta >Feature sequence174 >Feature sequence175 1065 694 gene locus_tag LOCUS_08520 1065 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1544 1134 gene locus_tag LOCUS_08530 1544 1134 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_08530 1754 2659 gene locus_tag LOCUS_08540 1754 2659 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081973.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence176 2309 990 gene locus_tag LOCUS_08550 gene murC 2309 990 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_08550 3230 2445 gene locus_tag LOCUS_08560 3230 2445 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931966.1 protein_id gnl|my_center|LOCUS_08560 3316 4155 gene locus_tag LOCUS_08570 3316 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence177 1326 40 gene locus_tag LOCUS_08580 1326 40 CDS product isopenicillin-N epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084098.1 protein_id gnl|my_center|LOCUS_08580 2710 1331 gene locus_tag LOCUS_08590 2710 1331 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926478.1 protein_id gnl|my_center|LOCUS_08590 3560 2712 gene locus_tag LOCUS_08600 3560 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423269.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence178 1530 889 gene locus_tag LOCUS_08610 1530 889 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_08610 1535 1849 gene locus_tag LOCUS_08620 1535 1849 CDS product 6-O-methylguanine DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404905.1 protein_id gnl|my_center|LOCUS_08620 1940 3133 gene locus_tag LOCUS_08630 gene bioF-1 1940 3133 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933608.1 protein_id gnl|my_center|LOCUS_08630 3241 4194 gene locus_tag LOCUS_08640 3241 4194 CDS product serine/threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015888022.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence179 916 563 gene locus_tag LOCUS_08650 916 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 3423 1132 gene locus_tag LOCUS_08660 3423 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence180 <1 2812 gene locus_tag LOCUS_08670 <1 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64TJ3:tricorn protease <4279 3128 gene locus_tag LOCUS_08680 <4279 3128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016482.1:coproporphyrinogen III oxidase >Feature sequence181 1703 366 gene locus_tag LOCUS_08690 gene mnmE 1703 366 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXB2 protein_id gnl|my_center|LOCUS_08690 1798 2133 gene locus_tag LOCUS_08700 1798 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2146 2778 gene locus_tag LOCUS_08710 2146 2778 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771583.1 protein_id gnl|my_center|LOCUS_08710 2775 3983 gene locus_tag LOCUS_08720 2775 3983 CDS product dTDP-4-dehydro-6-deoxyglucose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943648.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence182 364 633 gene locus_tag LOCUS_08730 gene ptsH 364 633 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933864.1 protein_id gnl|my_center|LOCUS_08730 633 2225 gene locus_tag LOCUS_08740 633 2225 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97EM3 protein_id gnl|my_center|LOCUS_08740 >Feature sequence183 1420 905 gene locus_tag LOCUS_08750 1420 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4125 1417 gene locus_tag LOCUS_08760 4125 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence184 <1 1651 gene locus_tag LOCUS_08770 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932828.1:AMP-dependent synthetase 1653 3107 gene locus_tag LOCUS_08780 1653 3107 CDS product FAD-linked oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_08780 4184 3081 gene locus_tag LOCUS_08790 4184 3081 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence185 >Feature sequence186 2685 2044 gene locus_tag LOCUS_08800 gene pdxH 2685 2044 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62M91 protein_id gnl|my_center|LOCUS_08800 4099 2678 gene locus_tag LOCUS_08810 4099 2678 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252906.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence187 560 1003 gene locus_tag LOCUS_08820 560 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 990 2300 gene locus_tag LOCUS_08830 990 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2703 2302 gene locus_tag LOCUS_08840 2703 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2847 3236 gene locus_tag LOCUS_08850 gene folB 2847 3236 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB54 protein_id gnl|my_center|LOCUS_08850 3561 3418 gene locus_tag LOCUS_08860 3561 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence188 <1 903 gene locus_tag LOCUS_08870 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963272.1:glucose-1-phosphate thymidylyltransferase 952 1321 gene locus_tag LOCUS_tm00010 952 1321 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1406 2536 gene locus_tag LOCUS_08880 1406 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3435 2533 gene locus_tag LOCUS_08890 3435 2533 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921475.1 protein_id gnl|my_center|LOCUS_08890 4178 3432 gene locus_tag LOCUS_08900 4178 3432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence189 1085 153 gene locus_tag LOCUS_08910 1085 153 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RRB1 protein_id gnl|my_center|LOCUS_08910 1381 1986 gene locus_tag LOCUS_08920 gene aat 1381 1986 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLT7 protein_id gnl|my_center|LOCUS_08920 2026 3087 gene locus_tag LOCUS_08930 2026 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3103 3792 gene locus_tag LOCUS_08940 3103 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 >Feature sequence190 896 2227 gene locus_tag LOCUS_08950 896 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2234 3286 gene locus_tag LOCUS_08960 2234 3286 CDS product MexH family multidrug efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence191 >Feature sequence192 1577 141 gene locus_tag LOCUS_08970 1577 141 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence193 958 554 gene locus_tag LOCUS_08980 958 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 1468 1148 gene locus_tag LOCUS_08990 1468 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_08990 1698 1465 gene locus_tag LOCUS_09000 1698 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 3534 1891 gene locus_tag LOCUS_09010 gene groL 3534 1891 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KF02 protein_id gnl|my_center|LOCUS_09010 3851 3564 gene locus_tag LOCUS_09020 gene groS 3851 3564 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6U902 protein_id gnl|my_center|LOCUS_09020 >Feature sequence194 <1 526 gene locus_tag LOCUS_09030 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHY3:ADP-L-glycero-D-manno-heptose-6-epimerase 539 1432 gene locus_tag LOCUS_09040 gene atpG 539 1432 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW9 protein_id gnl|my_center|LOCUS_09040 1534 2652 gene locus_tag LOCUS_09050 1534 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2654 3547 gene locus_tag LOCUS_09060 2654 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence195 1918 1361 gene locus_tag LOCUS_09070 1918 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2404 1994 gene locus_tag LOCUS_09080 2404 1994 CDS product redox protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405004.1 protein_id gnl|my_center|LOCUS_09080 3204 2401 gene locus_tag LOCUS_09090 gene phnP 3204 2401 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123462.1 protein_id gnl|my_center|LOCUS_09090 <4078 3185 gene locus_tag LOCUS_09100 <4078 3185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S4E9:lipoyl synthase >Feature sequence196 373 498 gene locus_tag LOCUS_09110 373 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 605 1411 gene locus_tag LOCUS_09120 605 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1428 3500 gene locus_tag LOCUS_09130 1428 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence197 972 490 gene locus_tag LOCUS_09140 972 490 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706386.1 protein_id gnl|my_center|LOCUS_09140 1032 3008 gene locus_tag LOCUS_09150 1032 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence198 300 791 gene locus_tag LOCUS_09160 300 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 819 1937 gene locus_tag LOCUS_09170 819 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 2465 3025 gene locus_tag LOCUS_09180 2465 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3078 3470 gene locus_tag LOCUS_09190 3078 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3680 4069 gene locus_tag LOCUS_09200 3680 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003029036.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence199 2900 2827 gene locus_tag LOCUS_t00080 2900 2827 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <4069 2971 gene locus_tag LOCUS_09210 <4069 2971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FC3:1-deoxy-D-xylulose-5-phosphate synthase 1 >Feature sequence200 150 1961 gene locus_tag LOCUS_09220 150 1961 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence201 >Feature sequence202 1236 754 gene locus_tag LOCUS_09230 1236 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1708 1343 gene locus_tag LOCUS_09240 1708 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2499 1786 gene locus_tag LOCUS_09250 gene lpxH 2499 1786 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_09250 2601 3332 gene locus_tag LOCUS_09260 2601 3332 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249938.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence203 >Feature sequence204 2513 1269 gene locus_tag LOCUS_09270 gene sucC 2513 1269 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFE7 protein_id gnl|my_center|LOCUS_09270 >Feature sequence205 117 338 gene locus_tag LOCUS_09280 117 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 354 767 gene locus_tag LOCUS_09290 354 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 780 986 gene locus_tag LOCUS_09300 780 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 996 1175 gene locus_tag LOCUS_09310 996 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 1454 1161 gene locus_tag LOCUS_09320 1454 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 2089 1556 gene locus_tag LOCUS_09330 2089 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence206 1962 1489 gene locus_tag LOCUS_09340 1962 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2425 1955 gene locus_tag LOCUS_09350 2425 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 2923 2447 gene locus_tag LOCUS_09360 2923 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence207 1951 86 gene locus_tag LOCUS_09370 1951 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2417 1953 gene locus_tag LOCUS_09380 gene folK 2417 1953 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948528.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence208 1991 987 gene locus_tag LOCUS_09390 1991 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679040.1 protein_id gnl|my_center|LOCUS_09390 3316 2234 gene locus_tag LOCUS_09400 3316 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 <4003 3424 gene locus_tag LOCUS_09410 <4003 3424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257502.1:oxidoreductase >Feature sequence209 <1 976 gene locus_tag LOCUS_09420 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E184:asparagine--tRNA ligase 3487 1394 gene locus_tag LOCUS_09430 3487 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence210 >Feature sequence211 225 1124 gene locus_tag LOCUS_09440 gene panC 225 1124 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67891 protein_id gnl|my_center|LOCUS_09440 1174 1623 gene locus_tag LOCUS_09450 1174 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 3570 1627 gene locus_tag LOCUS_09460 3570 1627 CDS product thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203179.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence212 358 840 gene locus_tag LOCUS_09470 358 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1391 837 gene locus_tag LOCUS_09480 1391 837 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721499.1 protein_id gnl|my_center|LOCUS_09480 2368 1391 gene locus_tag LOCUS_09490 2368 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2472 3413 gene locus_tag LOCUS_09500 2472 3413 CDS product LOS biosynthesis enzyme LBGB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017015.1 protein_id gnl|my_center|LOCUS_09500 3414 3866 gene locus_tag LOCUS_09510 3414 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence213 <1 1053 gene locus_tag LOCUS_09520 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1B9V1:peptide chain release factor 1 1058 1480 gene locus_tag LOCUS_09530 1058 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768489.1 protein_id gnl|my_center|LOCUS_09530 1618 2400 gene locus_tag LOCUS_09540 gene rimK 1618 2400 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPT1 protein_id gnl|my_center|LOCUS_09540 3443 2496 gene locus_tag LOCUS_09550 3443 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962863.1 protein_id gnl|my_center|LOCUS_09550 3752 3824 gene locus_tag LOCUS_t00090 3752 3824 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence214 <1 1400 gene locus_tag LOCUS_09560 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482406.1:sodium-independent anion transporter 2217 1411 gene locus_tag LOCUS_09570 2217 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 2828 2295 gene locus_tag LOCUS_09580 2828 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918963.1 protein_id gnl|my_center|LOCUS_09580 3342 2917 gene locus_tag LOCUS_09590 3342 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 <3948 3352 gene locus_tag LOCUS_09600 <3948 3352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889560.1:methylamine utilization protein >Feature sequence215 732 613 gene locus_tag LOCUS_09610 732 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 878 1204 gene locus_tag LOCUS_09620 878 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1874 1176 gene locus_tag LOCUS_09630 1874 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence216 1732 962 gene locus_tag LOCUS_09640 gene sufC 1732 962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_09640 3225 1774 gene locus_tag LOCUS_09650 3225 1774 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769206.1 protein_id gnl|my_center|LOCUS_09650 3622 3227 gene locus_tag LOCUS_09660 3622 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence217 1994 441 gene locus_tag LOCUS_09670 gene atpA 1994 441 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAW8 protein_id gnl|my_center|LOCUS_09670 2568 2032 gene locus_tag LOCUS_09680 2568 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3077 2583 gene locus_tag LOCUS_09690 gene atpF 3077 2583 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGE9 protein_id gnl|my_center|LOCUS_09690 3373 3152 gene locus_tag LOCUS_09700 gene atpE 3373 3152 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGE8 protein_id gnl|my_center|LOCUS_09700 <3934 3432 gene locus_tag LOCUS_09710 <3934 3432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KGE7:ATP synthase subunit a 2 >Feature sequence218 195 1004 gene locus_tag LOCUS_09720 195 1004 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862018.1 protein_id gnl|my_center|LOCUS_09720 1028 1474 gene locus_tag LOCUS_09730 1028 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 1563 1892 gene locus_tag LOCUS_09740 1563 1892 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_09740 1904 2401 gene locus_tag LOCUS_09750 gene yqcK 1904 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45945 protein_id gnl|my_center|LOCUS_09750 2402 3451 gene locus_tag LOCUS_09760 2402 3451 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263675.1 protein_id gnl|my_center|LOCUS_09760 3448 3858 gene locus_tag LOCUS_09770 3448 3858 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963711.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence219 >Feature sequence220 <1 523 gene locus_tag LOCUS_09780 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965570.1:MBL fold hydrolase 520 1008 gene locus_tag LOCUS_09790 520 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933430.1 protein_id gnl|my_center|LOCUS_09790 1178 2626 gene locus_tag LOCUS_09800 1178 2626 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_09800 <3901 2864 gene locus_tag LOCUS_09810 <3901 2864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89BK7:phosphoenolpyruvate carboxykinase [ATP] >Feature sequence221 1369 386 gene locus_tag LOCUS_09820 1369 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1953 1366 gene locus_tag LOCUS_09830 1953 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2568 1972 gene locus_tag LOCUS_09840 2568 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 3138 2590 gene locus_tag LOCUS_09850 3138 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 3761 3219 gene locus_tag LOCUS_09860 3761 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence222 <1 904 gene locus_tag LOCUS_09870 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941871.1:SAM-dependent methyltransferase 1853 1080 gene locus_tag LOCUS_09880 1853 1080 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766786.1 protein_id gnl|my_center|LOCUS_09880 2673 1897 gene locus_tag LOCUS_09890 2673 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089666.1 protein_id gnl|my_center|LOCUS_09890 3534 2686 gene locus_tag LOCUS_09900 3534 2686 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776404.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence223 316 1089 gene locus_tag LOCUS_09910 316 1089 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481810.1 protein_id gnl|my_center|LOCUS_09910 1129 1812 gene locus_tag LOCUS_09920 gene plsY 1129 1812 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG75 protein_id gnl|my_center|LOCUS_09920 1827 2843 gene locus_tag LOCUS_09930 gene gpsA 1827 2843 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q834C1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence224 >Feature sequence225 2664 652 gene locus_tag LOCUS_09940 gene yyaL 2664 652 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964202.1 protein_id gnl|my_center|LOCUS_09940 2869 3066 gene locus_tag LOCUS_09950 2869 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3067 3405 gene locus_tag LOCUS_09960 3067 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence226 260 1042 gene locus_tag LOCUS_09970 gene pssA 260 1042 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_09970 1075 1332 gene locus_tag LOCUS_09980 gene purS 1075 1332 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCS4 protein_id gnl|my_center|LOCUS_09980 1334 2029 gene locus_tag LOCUS_09990 gene purQ 1334 2029 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_09990 2045 2203 gene locus_tag LOCUS_10000 2045 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2207 2488 gene locus_tag LOCUS_10010 2207 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence227 376 846 gene locus_tag LOCUS_10020 376 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 901 1665 gene locus_tag LOCUS_10030 901 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 1667 2764 gene locus_tag LOCUS_10040 1667 2764 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_10040 2774 3730 gene locus_tag LOCUS_10050 2774 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence228 827 543 gene locus_tag LOCUS_10060 827 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2090 942 gene locus_tag LOCUS_10070 gene bcd 2090 942 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_10070 2907 2107 gene locus_tag LOCUS_10080 2907 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence229 <1 537 gene locus_tag LOCUS_10090 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963081.1:RND transporter 945 631 gene locus_tag LOCUS_10100 945 631 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963921.1 protein_id gnl|my_center|LOCUS_10100 2373 967 gene locus_tag LOCUS_10110 2373 967 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963922.1 protein_id gnl|my_center|LOCUS_10110 3194 2400 gene locus_tag LOCUS_10120 3194 2400 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K9 protein_id gnl|my_center|LOCUS_10120 3557 3246 gene locus_tag LOCUS_10130 3557 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence230 598 945 gene locus_tag LOCUS_10140 598 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 929 3052 gene locus_tag LOCUS_10150 gene ftsI 929 3052 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence231 425 1810 gene locus_tag LOCUS_10160 425 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1908 3236 gene locus_tag LOCUS_10170 1908 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence232 1962 355 gene locus_tag LOCUS_10180 gene mccC2 1962 355 CDS product methylcrotonoyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206450.1 protein_id gnl|my_center|LOCUS_10180 3479 2103 gene locus_tag LOCUS_10190 3479 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence233 <1 1725 gene locus_tag LOCUS_10200 <1 1725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108104.1:multidrug transporter AcrB 2013 3203 gene locus_tag LOCUS_10210 2013 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_10210 3204 3638 gene locus_tag LOCUS_10220 3204 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962255.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence234 >Feature sequence235 >Feature sequence236 829 1371 gene locus_tag LOCUS_10230 829 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1392 2216 gene locus_tag LOCUS_10240 1392 2216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2465 2785 gene locus_tag LOCUS_10250 2465 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence237 1287 214 gene locus_tag LOCUS_10260 1287 214 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254505.1 protein_id gnl|my_center|LOCUS_10260 1732 1289 gene locus_tag LOCUS_10270 1732 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1901 2311 gene locus_tag LOCUS_10280 1901 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107464.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence238 <3701 1094 gene locus_tag LOCUS_10290 <3701 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257612.1:glycosyl transferase >Feature sequence239 301 756 gene locus_tag LOCUS_10300 gene dut 301 756 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZDD2 protein_id gnl|my_center|LOCUS_10300 753 1679 gene locus_tag LOCUS_10310 gene fmt 753 1679 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GW4 protein_id gnl|my_center|LOCUS_10310 1775 2638 gene locus_tag LOCUS_10320 gene pfkA 1775 2638 CDS product ATP-dependent 6-phosphofructokinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21777 protein_id gnl|my_center|LOCUS_10320 2642 3514 gene locus_tag LOCUS_10330 gene nadK 2642 3514 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A0V4 protein_id gnl|my_center|LOCUS_10330 >Feature sequence240 <1 843 gene locus_tag LOCUS_10340 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5FL65:glycogen synthase 846 2090 gene locus_tag LOCUS_10350 846 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2087 3313 gene locus_tag LOCUS_10360 2087 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403554.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence241 <1 621 gene locus_tag LOCUS_10370 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545129.1:helix-turn-helix domain-containing protein 1579 623 gene locus_tag LOCUS_10380 1579 623 CDS product putative phosphosugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67500 protein_id gnl|my_center|LOCUS_10380 1957 1613 gene locus_tag LOCUS_10390 gene hit 1957 1613 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence242 <1 2632 gene locus_tag LOCUS_10400 <1 2632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963036.1:acriflavine resistance protein B 2696 3505 gene locus_tag LOCUS_10410 2696 3505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence243 <1 1962 gene locus_tag LOCUS_10420 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG04:alanine--tRNA ligase 1977 2501 gene locus_tag LOCUS_10430 1977 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2875 2579 gene locus_tag LOCUS_10440 2875 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3653 3015 gene locus_tag LOCUS_10450 3653 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence244 268 3606 gene locus_tag LOCUS_10460 268 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence245 <1 534 gene locus_tag LOCUS_10470 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E005:threonylcarbamoyl-AMP synthase 534 1496 gene locus_tag LOCUS_10480 534 1496 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence246 1843 3561 gene locus_tag LOCUS_10490 1843 3561 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987017.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence247 1566 592 gene locus_tag LOCUS_10500 1566 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2140 1712 gene locus_tag LOCUS_10510 gene ndk 2140 1712 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAZ6 protein_id gnl|my_center|LOCUS_10510 3082 2183 gene locus_tag LOCUS_10520 gene sucD 3082 2183 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFQ3 protein_id gnl|my_center|LOCUS_10520 >Feature sequence248 2428 803 gene locus_tag LOCUS_10530 2428 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 <3616 2422 gene locus_tag LOCUS_10540 <3616 2422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WGJ1:N5-carboxyaminoimidazole ribonucleotide synthase >Feature sequence249 <1 1438 gene locus_tag LOCUS_10550 <1 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:bifunctional TolB-family protein/amidohydrolase >Feature sequence250 1673 519 gene locus_tag LOCUS_10560 1673 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2873 1761 gene locus_tag LOCUS_10570 2873 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_10570 >Feature sequence251 525 40 gene locus_tag LOCUS_10580 525 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 882 598 gene locus_tag LOCUS_10590 882 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1196 1074 gene locus_tag LOCUS_10600 1196 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1318 1569 gene locus_tag LOCUS_10610 1318 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2012 1509 gene locus_tag LOCUS_10620 2012 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 2268 2876 gene locus_tag LOCUS_10630 2268 2876 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence252 520 1086 gene locus_tag LOCUS_10640 520 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2345 1083 gene locus_tag LOCUS_10650 2345 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3200 2352 gene locus_tag LOCUS_10660 3200 2352 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_10660 3522 3193 gene locus_tag LOCUS_10670 3522 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence253 538 1908 gene locus_tag LOCUS_10680 538 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3317 1905 gene locus_tag LOCUS_10690 3317 1905 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797884.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence254 <1 926 gene locus_tag LOCUS_10700 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760045.1:sigma-54-dependent Fis family transcriptional regulator 1023 1367 gene locus_tag LOCUS_10710 1023 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2324 1617 gene locus_tag LOCUS_10720 2324 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 3099 2377 gene locus_tag LOCUS_10730 3099 2377 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence255 <1 1938 gene locus_tag LOCUS_10740 <1 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405439.1:TonB-dependent receptor 2237 2028 gene locus_tag LOCUS_10750 2237 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 <3556 2339 gene locus_tag LOCUS_10760 <3556 2339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003359159.1:flagellar biosynthesis protein FlhA >Feature sequence256 2275 326 gene locus_tag LOCUS_10770 gene nadE 2275 326 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_10770 2395 2562 gene locus_tag LOCUS_10780 2395 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2724 3368 gene locus_tag LOCUS_10790 gene coaE 2724 3368 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34932 protein_id gnl|my_center|LOCUS_10790 >Feature sequence257 2113 101 gene locus_tag LOCUS_10800 gene priA 2113 101 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0P5 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10800 2183 3325 gene locus_tag LOCUS_10810 2183 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence258 1321 275 gene locus_tag LOCUS_10820 1321 275 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966339.1 protein_id gnl|my_center|LOCUS_10820 1907 1335 gene locus_tag LOCUS_10830 1907 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence259 475 1272 gene locus_tag LOCUS_10840 475 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1256 1873 gene locus_tag LOCUS_10850 1256 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2935 1877 gene locus_tag LOCUS_10860 2935 1877 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB61 protein_id gnl|my_center|LOCUS_10860 >Feature sequence260 <1 908 gene locus_tag LOCUS_10870 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1I9:protein translocase subunit SecD 927 1862 gene locus_tag LOCUS_10880 gene secF 927 1862 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NFV4 protein_id gnl|my_center|LOCUS_10880 1865 2194 gene locus_tag LOCUS_10890 1865 2194 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1Q9 protein_id gnl|my_center|LOCUS_10890 >Feature sequence261 1345 1770 gene locus_tag LOCUS_10900 1345 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1843 3114 gene locus_tag LOCUS_10910 1843 3114 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963537.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence262 <1 2007 gene locus_tag LOCUS_10920 <1 2007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:T9SS C-terminal target domain-containing protein 3274 2351 gene locus_tag LOCUS_10930 gene murQ 3274 2351 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6G3 protein_id gnl|my_center|LOCUS_10930 >Feature sequence263 <3450 2655 gene locus_tag LOCUS_10940 <3450 2655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808599.1:thioredoxin >Feature sequence264 168 602 gene locus_tag LOCUS_10950 168 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2246 609 gene locus_tag LOCUS_10960 2246 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence265 1067 231 gene locus_tag LOCUS_10970 1067 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2400 1051 gene locus_tag LOCUS_10980 2400 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2490 2906 gene locus_tag LOCUS_10990 2490 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence266 1579 932 gene locus_tag LOCUS_11000 1579 932 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYK9 protein_id gnl|my_center|LOCUS_11000 1790 2581 gene locus_tag LOCUS_11010 1790 2581 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence267 3091 3348 gene locus_tag LOCUS_11020 3091 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence268 53 670 gene locus_tag LOCUS_11030 gene gpmA 53 670 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6L3 protein_id gnl|my_center|LOCUS_11030 663 2333 gene locus_tag LOCUS_11040 663 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2338 2871 gene locus_tag LOCUS_11050 2338 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence269 2187 208 gene locus_tag LOCUS_11060 2187 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence270 1014 412 gene locus_tag LOCUS_11070 1014 412 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530472.1 protein_id gnl|my_center|LOCUS_11070 1318 1085 gene locus_tag LOCUS_11080 1318 1085 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086058.1 protein_id gnl|my_center|LOCUS_11080 2796 1405 gene locus_tag LOCUS_11090 2796 1405 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962589.1 protein_id gnl|my_center|LOCUS_11090 <3399 2789 gene locus_tag LOCUS_11100 <3399 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962590.1:biotin attachment protein >Feature sequence271 1047 538 gene locus_tag LOCUS_11110 1047 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 1405 1058 gene locus_tag LOCUS_11120 1405 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2336 1425 gene locus_tag LOCUS_11130 2336 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 <3396 2397 gene locus_tag LOCUS_11140 <3396 2397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963904.1:glycosyl transferase family 1 >Feature sequence272 1293 838 gene locus_tag LOCUS_11150 1293 838 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015889.1 protein_id gnl|my_center|LOCUS_11150 2890 1637 gene locus_tag LOCUS_11160 gene serS 2890 1637 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KES6 protein_id gnl|my_center|LOCUS_11160 >Feature sequence273 1679 417 gene locus_tag LOCUS_11170 1679 417 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211395.1 protein_id gnl|my_center|LOCUS_11170 2423 1698 gene locus_tag LOCUS_11180 2423 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2656 2943 gene locus_tag LOCUS_11190 2656 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence274 <1 2403 gene locus_tag LOCUS_11200 <1 2403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18BB2:chromosome partition protein Smc 2421 3056 gene locus_tag LOCUS_11210 2421 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence275 430 1284 gene locus_tag LOCUS_11220 430 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 1357 2181 gene locus_tag LOCUS_11230 1357 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence276 <1 1182 gene locus_tag LOCUS_11240 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109099.1:DNA helicase 1247 1999 gene locus_tag LOCUS_11250 1247 1999 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIE0 protein_id gnl|my_center|LOCUS_11250 1999 2538 gene locus_tag LOCUS_11260 gene ruvC 1999 2538 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ65 protein_id gnl|my_center|LOCUS_11260 >Feature sequence277 80 1258 gene locus_tag LOCUS_11270 80 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence278 <1 570 gene locus_tag LOCUS_11280 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932340.1:DNA-binding response regulator 575 2314 gene locus_tag LOCUS_11290 575 2314 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986853.1 protein_id gnl|my_center|LOCUS_11290 2348 2971 gene locus_tag LOCUS_11300 gene sigW 2348 2971 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_11300 >Feature sequence279 <1 929 gene locus_tag LOCUS_11310 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766276.1:type II restriction endonuclease note possible pseudo, frameshifted 922 2424 gene locus_tag LOCUS_11320 922 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence280 3 2189 gene locus_tag LOCUS_11330 3 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2305 2970 gene locus_tag LOCUS_11340 2305 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence281 1736 336 gene locus_tag LOCUS_11350 1736 336 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932440.1 protein_id gnl|my_center|LOCUS_11350 2359 1733 gene locus_tag LOCUS_11360 2359 1733 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence282 814 1173 gene locus_tag LOCUS_11370 814 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2316 1198 gene locus_tag LOCUS_11380 2316 1198 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763226.1 protein_id gnl|my_center|LOCUS_11380 2472 3317 gene locus_tag LOCUS_11390 2472 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence283 2069 3097 gene locus_tag LOCUS_11400 2069 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence284 240 632 gene locus_tag LOCUS_11410 240 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 854 780 gene locus_tag LOCUS_t00100 854 780 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2326 857 gene locus_tag LOCUS_11420 2326 857 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023666.1 protein_id gnl|my_center|LOCUS_11420 3224 2511 gene locus_tag LOCUS_11430 gene scpB 3224 2511 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAN0 protein_id gnl|my_center|LOCUS_11430 >Feature sequence285 393 1757 gene locus_tag LOCUS_11440 gene norB 393 1757 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707560.1 protein_id gnl|my_center|LOCUS_11440 1878 2657 gene locus_tag LOCUS_11450 gene nirQ 1878 2657 CDS product denitrification regulatory protein NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q51481 protein_id gnl|my_center|LOCUS_11450 >Feature sequence286 629 24 gene locus_tag LOCUS_11460 629 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 2069 660 gene locus_tag LOCUS_11470 2069 660 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_11470 2467 2147 gene locus_tag LOCUS_11480 2467 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence287 37 1170 gene locus_tag LOCUS_11490 37 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1167 2369 gene locus_tag LOCUS_11500 1167 2369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence288 109 1218 gene locus_tag LOCUS_11510 109 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1218 1820 gene locus_tag LOCUS_11520 gene paaY 1218 1820 CDS product phenylacetic acid degradation protein PaaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P77181 protein_id gnl|my_center|LOCUS_11520 1823 2428 gene locus_tag LOCUS_11530 gene glpG 1823 2428 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631577.1 protein_id gnl|my_center|LOCUS_11530 <3285 2489 gene locus_tag LOCUS_11540 <3285 2489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HTV1:transcription termination factor Rho >Feature sequence289 >Feature sequence290 1577 39 gene locus_tag LOCUS_11550 1577 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2121 1660 gene locus_tag LOCUS_11560 2121 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 2650 2135 gene locus_tag LOCUS_11570 gene apt 2650 2135 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183I0 protein_id gnl|my_center|LOCUS_11570 3166 2828 gene locus_tag LOCUS_11580 3166 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence291 3002 1938 gene locus_tag LOCUS_11590 3002 1938 CDS product peptidase S66 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_11590 3089 3176 gene locus_tag LOCUS_t00110 3089 3176 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence292 >Feature sequence293 971 2236 gene locus_tag LOCUS_11600 gene icd 971 2236 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_11600 >Feature sequence294 460 1323 gene locus_tag LOCUS_11610 460 1323 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674768.1 protein_id gnl|my_center|LOCUS_11610 1374 1610 gene locus_tag LOCUS_11620 1374 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3088 1913 gene locus_tag LOCUS_11630 3088 1913 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704093.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence295 <1 2789 gene locus_tag LOCUS_11640 <1 2789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H0Y2:Fused isobutyryl-CoA mutase >Feature sequence296 >Feature sequence297 1424 120 gene locus_tag LOCUS_11650 gene tig 1424 120 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89KG0 protein_id gnl|my_center|LOCUS_11650 2060 1512 gene locus_tag LOCUS_11660 gene prx-1 2060 1512 CDS product thioredoxin peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941557.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence298 1000 497 gene locus_tag LOCUS_11670 1000 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2032 1064 gene locus_tag LOCUS_11680 2032 1064 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930763.1 protein_id gnl|my_center|LOCUS_11680 2163 3056 gene locus_tag LOCUS_11690 2163 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence299 748 377 gene locus_tag LOCUS_11700 gene rplR 748 377 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RIH2 protein_id gnl|my_center|LOCUS_11700 1311 772 gene locus_tag LOCUS_11710 gene rplF 1311 772 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46898 protein_id gnl|my_center|LOCUS_11710 1725 1330 gene locus_tag LOCUS_11720 gene rpsH 1725 1330 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CH0 protein_id gnl|my_center|LOCUS_11720 2013 1744 gene locus_tag LOCUS_11730 gene rpsN 2013 1744 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66420 protein_id gnl|my_center|LOCUS_11730 2661 2029 gene locus_tag LOCUS_11740 gene rplE 2661 2029 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAI4 protein_id gnl|my_center|LOCUS_11740 2918 2688 gene locus_tag LOCUS_11750 2918 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence300 485 1042 gene locus_tag LOCUS_11760 485 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2712 1741 gene locus_tag LOCUS_11770 2712 1741 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence301 <1 832 gene locus_tag LOCUS_11780 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964490.1:RND transporter >Feature sequence302 <1 1648 gene locus_tag LOCUS_11790 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765159.1:cadmium/zinc/cobalt-transporting ATPase 1802 1933 gene locus_tag LOCUS_11800 1802 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence303 896 171 gene locus_tag LOCUS_11810 896 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1661 909 gene locus_tag LOCUS_11820 1661 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1730 2101 gene locus_tag LOCUS_11830 1730 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2098 3111 gene locus_tag LOCUS_11840 2098 3111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence304 >Feature sequence305 1563 1225 gene locus_tag LOCUS_11850 1563 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1996 1553 gene locus_tag LOCUS_11860 1996 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2812 2360 gene locus_tag LOCUS_11870 2812 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence306 80 7 gene locus_tag LOCUS_t00120 80 7 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 277 2328 gene locus_tag LOCUS_11880 277 2328 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_11880 <3173 2330 gene locus_tag LOCUS_11890 <3173 2330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081007.1:sodium:calcium antiporter >Feature sequence307 <1 2276 gene locus_tag LOCUS_11900 <1 2276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963080.1:multidrug transporter AcrB >Feature sequence308 2409 973 gene locus_tag LOCUS_11910 2409 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090685.1 protein_id gnl|my_center|LOCUS_11910 2960 2409 gene locus_tag LOCUS_11920 2960 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence309 1335 13 gene locus_tag LOCUS_11930 1335 13 CDS product EscN/YscN/HrcN family type III secretion system ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_11930 2122 1328 gene locus_tag LOCUS_11940 2122 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 <3163 2144 gene locus_tag LOCUS_11950 <3163 2144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P23448:flagellar motor switch protein FliG >Feature sequence310 219 494 gene locus_tag LOCUS_11960 219 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1660 584 gene locus_tag LOCUS_11970 1660 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2561 1653 gene locus_tag LOCUS_11980 2561 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence311 1023 262 gene locus_tag LOCUS_11990 1023 262 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683251.1 protein_id gnl|my_center|LOCUS_11990 1259 2392 gene locus_tag LOCUS_12000 1259 2392 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001037063.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence312 2373 1933 gene locus_tag LOCUS_12010 2373 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 <3149 2387 gene locus_tag LOCUS_12020 <3149 2387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000476820.1:murein transglycosylase B >Feature sequence313 1526 420 gene locus_tag LOCUS_12030 1526 420 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_12030 2536 1523 gene locus_tag LOCUS_12040 2536 1523 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence314 895 191 gene locus_tag LOCUS_12050 895 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12050 >Feature sequence315 513 1670 gene locus_tag LOCUS_12060 513 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1955 2560 gene locus_tag LOCUS_12070 1955 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence316 607 173 gene locus_tag LOCUS_12080 607 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1233 604 gene locus_tag LOCUS_12090 gene ogg 1233 604 CDS product putative N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R689 protein_id gnl|my_center|LOCUS_12090 1290 2468 gene locus_tag LOCUS_12100 1290 2468 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_12100 3117 2545 gene locus_tag LOCUS_12110 3117 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence317 191 349 gene locus_tag LOCUS_12120 191 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 964 395 gene locus_tag LOCUS_12130 964 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 <3120 964 gene locus_tag LOCUS_12140 <3120 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P59077:methionine--tRNA ligase >Feature sequence318 <1 545 gene locus_tag LOCUS_12150 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0WKN3:2-amino-3-ketobutyrate coenzyme A ligase 532 687 gene locus_tag LOCUS_12160 532 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1071 1655 gene locus_tag LOCUS_12170 1071 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3021 1723 gene locus_tag LOCUS_12180 gene glyA 3021 1723 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC36 protein_id gnl|my_center|LOCUS_12180 >Feature sequence319 2 289 gene locus_tag LOCUS_12190 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1708 383 gene locus_tag LOCUS_12200 gene der 1708 383 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHH9 protein_id gnl|my_center|LOCUS_12200 1781 2326 gene locus_tag LOCUS_12210 1781 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 2326 2985 gene locus_tag LOCUS_12220 2326 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 >Feature sequence320 2225 975 gene locus_tag LOCUS_12230 2225 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence321 1645 353 gene locus_tag LOCUS_12240 gene eno 1645 353 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AR6 protein_id gnl|my_center|LOCUS_12240 1957 1649 gene locus_tag LOCUS_12250 1957 1649 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_12250 2290 1964 gene locus_tag LOCUS_12260 2290 1964 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP7 protein_id gnl|my_center|LOCUS_12260 2901 2374 gene locus_tag LOCUS_12270 gene gmhB 2901 2374 CDS product D-glycero-beta-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25531 protein_id gnl|my_center|LOCUS_12270 >Feature sequence322 739 206 gene locus_tag LOCUS_12280 739 206 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404802.1 protein_id gnl|my_center|LOCUS_12280 1622 801 gene locus_tag LOCUS_12290 1622 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2176 1619 gene locus_tag LOCUS_12300 gene rpoE 2176 1619 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D2T1 protein_id gnl|my_center|LOCUS_12300 3006 2245 gene locus_tag LOCUS_12310 3006 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence323 <1 1027 gene locus_tag LOCUS_12320 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XR8:DNA replication and repair protein RecF 1030 1323 gene locus_tag LOCUS_12330 1030 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence324 2908 2357 gene locus_tag LOCUS_12340 2908 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence325 271 1275 gene locus_tag LOCUS_12350 271 1275 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK73 protein_id gnl|my_center|LOCUS_12350 1275 1610 gene locus_tag LOCUS_12360 1275 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886784.1 protein_id gnl|my_center|LOCUS_12360 1615 1998 gene locus_tag LOCUS_12370 1615 1998 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963098.1 protein_id gnl|my_center|LOCUS_12370 1995 2384 gene locus_tag LOCUS_12380 1995 2384 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551711.1 protein_id gnl|my_center|LOCUS_12380 <3055 2371 gene locus_tag LOCUS_12390 <3055 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EZB0:ATP-dependent DNA helicase RecG >Feature sequence326 350 210 gene locus_tag LOCUS_12400 350 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 546 974 gene locus_tag LOCUS_12410 546 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence327 <1 996 gene locus_tag LOCUS_12420 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963032.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence328 1298 327 gene locus_tag LOCUS_12430 gene queA 1298 327 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S209 protein_id gnl|my_center|LOCUS_12430 <3008 1450 gene locus_tag LOCUS_12440 <3008 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KE61:chaperone protein HtpG >Feature sequence329 1180 272 gene locus_tag LOCUS_12450 gene hslO 1180 272 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3N1U7 protein_id gnl|my_center|LOCUS_12450 2340 1177 gene locus_tag LOCUS_12460 gene gcdH 2340 1177 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence330 >Feature sequence331 1193 354 gene locus_tag LOCUS_12470 gene ispE 1193 354 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N18 protein_id gnl|my_center|LOCUS_12470 1428 1871 gene locus_tag LOCUS_12480 1428 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence332 151 1308 gene locus_tag LOCUS_12490 151 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence333 894 1433 gene locus_tag LOCUS_12500 894 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1447 2151 gene locus_tag LOCUS_12510 1447 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 2678 2442 gene locus_tag LOCUS_12520 2678 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence334 2023 644 gene locus_tag LOCUS_12530 gene rsmB 2023 644 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q182R9 protein_id gnl|my_center|LOCUS_12530 2096 2929 gene locus_tag LOCUS_12540 2096 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence335 >Feature sequence336 <2972 900 gene locus_tag LOCUS_12550 <2972 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088650.1:CHRD domain-containing protein >Feature sequence337 961 401 gene locus_tag LOCUS_12560 961 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1628 990 gene locus_tag LOCUS_12570 gene folE 1628 990 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125729.1 protein_id gnl|my_center|LOCUS_12570 2058 1621 gene locus_tag LOCUS_12580 2058 1621 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU6 protein_id gnl|my_center|LOCUS_12580 2151 2897 gene locus_tag LOCUS_12590 2151 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence338 >Feature sequence339 2509 1007 gene locus_tag LOCUS_12600 2509 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence340 483 1259 gene locus_tag LOCUS_12610 483 1259 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_12610 1249 2082 gene locus_tag LOCUS_12620 gene dapF 1249 2082 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYX5 protein_id gnl|my_center|LOCUS_12620 >Feature sequence341 121 1323 gene locus_tag LOCUS_12630 121 1323 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038285.1 protein_id gnl|my_center|LOCUS_12630 2013 1333 gene locus_tag LOCUS_12640 2013 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 2858 2064 gene locus_tag LOCUS_12650 2858 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence342 1176 226 gene locus_tag LOCUS_12660 gene rsmH 1176 226 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8R6F5 protein_id gnl|my_center|LOCUS_12660 1635 1183 gene locus_tag LOCUS_12670 gene mraZ 1635 1183 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S536 protein_id gnl|my_center|LOCUS_12670 2848 1994 gene locus_tag LOCUS_12680 2848 1994 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence343 445 1005 gene locus_tag LOCUS_12690 445 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1052 1126 gene locus_tag LOCUS_t00130 1052 1126 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1215 2918 gene locus_tag LOCUS_12700 gene cafA 1215 2918 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933910.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence344 1389 1847 gene locus_tag LOCUS_12710 1389 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 1851 2078 gene locus_tag LOCUS_12720 1851 2078 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_12720 2075 2299 gene locus_tag LOCUS_12730 2075 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence345 294 1067 gene locus_tag LOCUS_12740 294 1067 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F306 protein_id gnl|my_center|LOCUS_12740 1069 1482 gene locus_tag LOCUS_12750 1069 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1507 2268 gene locus_tag LOCUS_12760 gene fliA 1507 2268 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667112.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence346 839 765 gene locus_tag LOCUS_t00140 839 765 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1651 920 gene locus_tag LOCUS_12770 1651 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 2488 1715 gene locus_tag LOCUS_12780 2488 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence347 743 1021 gene locus_tag LOCUS_12790 743 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259603.1 protein_id gnl|my_center|LOCUS_12790 1029 1727 gene locus_tag LOCUS_12800 1029 1727 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339011.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence348 305 1252 gene locus_tag LOCUS_12810 305 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1384 2181 gene locus_tag LOCUS_12820 1384 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence349 1498 554 gene locus_tag LOCUS_12830 gene trxB 1498 554 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KE48 protein_id gnl|my_center|LOCUS_12830 2501 1566 gene locus_tag LOCUS_12840 gene queG 2501 1566 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1G2 protein_id gnl|my_center|LOCUS_12840 2877 2503 gene locus_tag LOCUS_12850 2877 2503 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256599.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence350 >Feature sequence351 >Feature sequence352 869 1468 gene locus_tag LOCUS_12860 869 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 1468 2799 gene locus_tag LOCUS_12870 1468 2799 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence353 <1 871 gene locus_tag LOCUS_12880 <1 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFW5:replicative DNA helicase 1123 2463 gene locus_tag LOCUS_12890 gene ffh 1123 2463 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64RB9 protein_id gnl|my_center|LOCUS_12890 >Feature sequence354 >Feature sequence355 1801 146 gene locus_tag LOCUS_12900 1801 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 <2882 1917 gene locus_tag LOCUS_12910 <2882 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966231.1:heme ABC transporter ATP-binding protein >Feature sequence356 892 302 gene locus_tag LOCUS_12920 892 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2099 927 gene locus_tag LOCUS_12930 2099 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence357 855 1514 gene locus_tag LOCUS_12940 gene omt 855 1514 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880979.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence358 678 605 gene locus_tag LOCUS_t00150 678 605 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <2850 739 gene locus_tag LOCUS_12950 <2850 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962262.1:peptidase M1 >Feature sequence359 652 2445 gene locus_tag LOCUS_12960 652 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence360 >Feature sequence361 1580 864 gene locus_tag LOCUS_12970 1580 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 2460 1780 gene locus_tag LOCUS_12980 2460 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2781 2464 gene locus_tag LOCUS_12990 gene coxD 2781 2464 CDS product cytochrome-c oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940896.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence362 112 1281 gene locus_tag LOCUS_13000 112 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962429.1 protein_id gnl|my_center|LOCUS_13000 2070 1267 gene locus_tag LOCUS_13010 2070 1267 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008116.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence363 477 2048 gene locus_tag LOCUS_13020 gene nuoM-1 477 2048 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence364 2271 1468 gene locus_tag LOCUS_13030 2271 1468 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence365 93 1313 gene locus_tag LOCUS_13040 93 1313 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767676.1 protein_id gnl|my_center|LOCUS_13040 1405 2100 gene locus_tag LOCUS_13050 1405 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 2273 2461 gene locus_tag LOCUS_13060 2273 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence366 26 520 gene locus_tag LOCUS_13070 gene purE 26 520 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGJ0 protein_id gnl|my_center|LOCUS_13070 812 507 gene locus_tag LOCUS_13080 812 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1326 802 gene locus_tag LOCUS_13090 1326 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1404 2789 gene locus_tag LOCUS_13100 gene murF 1404 2789 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGD0 protein_id gnl|my_center|LOCUS_13100 >Feature sequence367 395 99 gene locus_tag LOCUS_13110 395 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1048 392 gene locus_tag LOCUS_13120 1048 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2067 1045 gene locus_tag LOCUS_13130 2067 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2353 2081 gene locus_tag LOCUS_13140 2353 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2627 2346 gene locus_tag LOCUS_13150 2627 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence368 1248 136 gene locus_tag LOCUS_13160 1248 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2311 1256 gene locus_tag LOCUS_13170 2311 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 <2819 2304 gene locus_tag LOCUS_13180 <2819 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891828.1:type II restriction endonuclease >Feature sequence369 525 55 gene locus_tag LOCUS_13190 525 55 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403433.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence370 <1 591 gene locus_tag LOCUS_13200 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963973.1:membrane protein 812 1252 gene locus_tag LOCUS_13210 812 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 2063 1344 gene locus_tag LOCUS_13220 2063 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence371 3 233 gene locus_tag LOCUS_13230 3 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1132 506 gene locus_tag LOCUS_13240 1132 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 <2797 1185 gene locus_tag LOCUS_13250 <2797 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918848.1:copper-binding protein >Feature sequence372 2 400 gene locus_tag LOCUS_13260 2 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 390 1310 gene locus_tag LOCUS_13270 gene xerD 390 1310 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KET0 protein_id gnl|my_center|LOCUS_13270 2420 1311 gene locus_tag LOCUS_13280 2420 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence373 3 872 gene locus_tag LOCUS_13290 3 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1555 884 gene locus_tag LOCUS_13300 1555 884 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H011 protein_id gnl|my_center|LOCUS_13300 2219 1608 gene locus_tag LOCUS_13310 2219 1608 CDS product alkyl hydroperoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259068.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence374 <1 702 gene locus_tag LOCUS_13320 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8P4F3:DNA topoisomerase 1 865 2157 gene locus_tag LOCUS_13330 865 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence375 525 382 gene locus_tag LOCUS_13340 525 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 606 1232 gene locus_tag LOCUS_13350 606 1232 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939847.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence376 <1 816 gene locus_tag LOCUS_13360 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012708972.1:hemin-degrading factor 816 1160 gene locus_tag LOCUS_13370 816 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1336 1557 gene locus_tag LOCUS_13380 1336 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1681 2070 gene locus_tag LOCUS_13390 1681 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence377 2764 1115 gene locus_tag LOCUS_13400 2764 1115 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964133.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence378 1172 1993 gene locus_tag LOCUS_13410 1172 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence379 290 781 gene locus_tag LOCUS_13420 290 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 890 1339 gene locus_tag LOCUS_13430 890 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 2514 1345 gene locus_tag LOCUS_13440 2514 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence380 2017 1130 gene locus_tag LOCUS_13450 2017 1130 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13450 2245 2018 gene locus_tag LOCUS_13460 2245 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13460 >Feature sequence381 180 106 gene locus_tag LOCUS_t00160 180 106 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 789 211 gene locus_tag LOCUS_13470 789 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931957.1 protein_id gnl|my_center|LOCUS_13470 926 789 gene locus_tag LOCUS_13480 926 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13480 1748 933 gene locus_tag LOCUS_13490 gene etfA 1748 933 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13490 2507 1758 gene locus_tag LOCUS_13500 gene etfB 2507 1758 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001029033.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence382 996 526 gene locus_tag LOCUS_13510 996 526 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461991.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence383 1778 1434 gene locus_tag LOCUS_13520 1778 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence384 1427 663 gene locus_tag LOCUS_13530 1427 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence385 333 1259 gene locus_tag LOCUS_13540 333 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1984 1256 gene locus_tag LOCUS_13550 1984 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence386 >Feature sequence387 >Feature sequence388 >Feature sequence389 2457 472 gene locus_tag LOCUS_13560 2457 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence390 2084 2521 gene locus_tag LOCUS_13570 2084 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence391 1203 1469 gene locus_tag LOCUS_13580 1203 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 1645 2040 gene locus_tag LOCUS_13590 1645 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence392 2180 1194 gene locus_tag LOCUS_13600 2180 1194 CDS product isoprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_13600 <2684 2180 gene locus_tag LOCUS_13610 <2684 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403940.1:DNA processing protein DprA >Feature sequence393 1183 170 gene locus_tag LOCUS_13620 gene murB 1183 170 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H136 protein_id gnl|my_center|LOCUS_13620 2622 1231 gene locus_tag LOCUS_13630 gene fumC 2622 1231 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9L0 protein_id gnl|my_center|LOCUS_13630 >Feature sequence394 >Feature sequence395 962 315 gene locus_tag LOCUS_13640 962 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13640 2304 976 gene locus_tag LOCUS_13650 2304 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 2658 2407 gene locus_tag LOCUS_13660 2658 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence396 17 1027 gene locus_tag LOCUS_13670 17 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1113 2384 gene locus_tag LOCUS_13680 1113 2384 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence397 <1 709 gene locus_tag LOCUS_13690 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813298.1:phenylacetic acid degradation protein 729 1034 gene locus_tag LOCUS_13700 gene paaB 729 1034 CDS product phenylacetate-CoA oxygenase subunit PaaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551024.1 protein_id gnl|my_center|LOCUS_13700 1021 1794 gene locus_tag LOCUS_13710 gene paaC 1021 1794 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085677.1 protein_id gnl|my_center|LOCUS_13710 1788 2279 gene locus_tag LOCUS_13720 gene paaD 1788 2279 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085678.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence398 >Feature sequence399 568 2595 gene locus_tag LOCUS_13730 gene ligA 568 2595 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9C1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence400 781 1335 gene locus_tag LOCUS_13740 gene thiJ 781 1335 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence401 436 762 gene locus_tag LOCUS_13750 436 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 789 1424 gene locus_tag LOCUS_13760 gene msrA 789 1424 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_13760 1491 2468 gene locus_tag LOCUS_13770 1491 2468 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338139.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence402 <1 669 gene locus_tag LOCUS_13780 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001169648.1:VOC family protein 670 2100 gene locus_tag LOCUS_13790 670 2100 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence403 287 1117 gene locus_tag LOCUS_13800 gene uppP 287 1117 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFJ7 protein_id gnl|my_center|LOCUS_13800 1139 1735 gene locus_tag LOCUS_13810 1139 1735 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_13810 1735 2343 gene locus_tag LOCUS_13820 gene engB 1735 2343 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38424 protein_id gnl|my_center|LOCUS_13820 >Feature sequence404 <1 1223 gene locus_tag LOCUS_13830 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765436.1:glutamate formiminotransferase <2640 1265 gene locus_tag LOCUS_13840 <2640 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071716.1:periplasmic peptidase family S9 >Feature sequence405 >Feature sequence406 456 1901 gene locus_tag LOCUS_13850 456 1901 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931866.1 protein_id gnl|my_center|LOCUS_13850 1901 2590 gene locus_tag LOCUS_13860 1901 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence407 11 94 gene locus_tag LOCUS_t00170 11 94 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 118 191 gene locus_tag LOCUS_t00180 118 191 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 282 356 gene locus_tag LOCUS_t00190 282 356 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 387 460 gene locus_tag LOCUS_t00200 387 460 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 486 677 gene locus_tag LOCUS_13870 486 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 699 1280 gene locus_tag LOCUS_13880 gene nusG 699 1280 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Q0 protein_id gnl|my_center|LOCUS_13880 1303 1728 gene locus_tag LOCUS_13890 gene rplK 1303 1728 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CE5 protein_id gnl|my_center|LOCUS_13890 1760 2458 gene locus_tag LOCUS_13900 gene rplA 1760 2458 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06797 protein_id gnl|my_center|LOCUS_13900 >Feature sequence408 688 1497 gene locus_tag LOCUS_13910 688 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2537 1599 gene locus_tag LOCUS_13920 2537 1599 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence409 2343 886 gene locus_tag LOCUS_13930 gene hsdM 2343 886 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011242272.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence410 2340 913 gene locus_tag LOCUS_13940 2340 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence411 <2593 1109 gene locus_tag LOCUS_13950 <2593 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 >Feature sequence412 <1 1321 gene locus_tag LOCUS_13960 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YL60:aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B >Feature sequence413 >Feature sequence414 202 1893 gene locus_tag LOCUS_13970 gene recN 202 1893 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC12 protein_id gnl|my_center|LOCUS_13970 >Feature sequence415 >Feature sequence416 554 2176 gene locus_tag LOCUS_13980 554 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence417 2304 2173 gene locus_tag LOCUS_13990 2304 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 2495 2310 gene locus_tag LOCUS_14000 2495 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence418 810 2255 gene locus_tag LOCUS_14010 810 2255 CDS product 5-carboxymethyl-2-hydroxymuconate semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008807572.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence419 565 290 gene locus_tag LOCUS_14020 565 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 773 546 gene locus_tag LOCUS_14030 773 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 988 827 gene locus_tag LOCUS_14040 988 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1558 1004 gene locus_tag LOCUS_14050 1558 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 2205 1612 gene locus_tag LOCUS_14060 2205 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence420 <1 879 gene locus_tag LOCUS_14070 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:membrane protein 876 1586 gene locus_tag LOCUS_14080 876 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1583 2539 gene locus_tag LOCUS_14090 1583 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence421 202 486 gene locus_tag LOCUS_14100 202 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 479 1378 gene locus_tag LOCUS_14110 gene era 479 1378 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I626 protein_id gnl|my_center|LOCUS_14110 2008 1883 gene locus_tag LOCUS_14120 2008 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence422 <2542 641 gene locus_tag LOCUS_14130 <2542 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:membrane protein >Feature sequence423 <1 911 gene locus_tag LOCUS_14140 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8RFC2:histidine ammonia-lyase 1 904 1743 gene locus_tag LOCUS_14150 904 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 <2539 1744 gene locus_tag LOCUS_14160 <2539 1744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933019.1:ABC transporter >Feature sequence424 1638 715 gene locus_tag LOCUS_14170 gene menA 1638 715 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1L4 protein_id gnl|my_center|LOCUS_14170 <2535 1649 gene locus_tag LOCUS_14180 <2535 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016315.1:porin >Feature sequence425 1101 628 gene locus_tag LOCUS_14190 1101 628 CDS product DUF1456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073612.1 protein_id gnl|my_center|LOCUS_14190 2145 1120 gene locus_tag LOCUS_14200 2145 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence426 >Feature sequence427 117 1289 gene locus_tag LOCUS_14210 117 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1267 2097 gene locus_tag LOCUS_14220 1267 2097 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence428 <1 1911 gene locus_tag LOCUS_14230 <1 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S575:DNA helicase >Feature sequence429 1 1026 gene locus_tag LOCUS_14240 1 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1604 1023 gene locus_tag LOCUS_14250 gene nadD 1604 1023 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0B1 protein_id gnl|my_center|LOCUS_14250 <2504 1680 gene locus_tag LOCUS_14260 <2504 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403176.1:NADH-quinone oxidoreductase subunit F >Feature sequence430 166 828 gene locus_tag LOCUS_14270 gene pyrH 166 828 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GWS3 protein_id gnl|my_center|LOCUS_14270 839 1402 gene locus_tag LOCUS_14280 gene frr 839 1402 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 protein_id gnl|my_center|LOCUS_14280 2360 1458 gene locus_tag LOCUS_14290 2360 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence431 <2488 1383 gene locus_tag LOCUS_14300 <2488 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963046.1:ion channel >Feature sequence432 1856 537 gene locus_tag LOCUS_14310 1856 537 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_14310 <2485 1857 gene locus_tag LOCUS_14320 <2485 1857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957790.1:GMP synthase >Feature sequence433 >Feature sequence434 >Feature sequence435 172 2424 gene locus_tag LOCUS_14330 172 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence436 913 1596 gene locus_tag LOCUS_14340 913 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1802 2449 gene locus_tag LOCUS_14350 1802 2449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence437 365 835 gene locus_tag LOCUS_14360 365 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 858 1445 gene locus_tag LOCUS_14370 858 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1555 1986 gene locus_tag LOCUS_14380 1555 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962255.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence438 <1 1286 gene locus_tag LOCUS_14390 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1Q6:DNA-directed RNA polymerase subunit beta' 1622 1356 gene locus_tag LOCUS_14400 1622 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence439 2157 1111 gene locus_tag LOCUS_14410 gene holA 2157 1111 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403276.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence440 704 237 gene locus_tag LOCUS_14420 704 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 2040 712 gene locus_tag LOCUS_14430 2040 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2411 2037 gene locus_tag LOCUS_14440 2411 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence441 373 1788 gene locus_tag LOCUS_14450 373 1788 CDS product oligosaccharide translocase/flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639968.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence442 132 2222 gene locus_tag LOCUS_14460 132 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence443 1603 554 gene locus_tag LOCUS_14470 1603 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2111 1641 gene locus_tag LOCUS_14480 2111 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence444 <1 1320 gene locus_tag LOCUS_14490 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943546.1:acetoacetate metabolism regulatory protein AtoC 1313 1717 gene locus_tag LOCUS_14500 1313 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence445 915 2201 gene locus_tag LOCUS_14510 gene gluD 915 2201 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CS0 protein_id gnl|my_center|LOCUS_14510 >Feature sequence446 1796 1134 gene locus_tag LOCUS_14520 1796 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 <2428 1796 gene locus_tag LOCUS_14530 <2428 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962360.1:enoyl-CoA hydratase >Feature sequence447 >Feature sequence448 1634 1284 gene locus_tag LOCUS_14540 1634 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence449 756 1193 gene locus_tag LOCUS_14550 756 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1187 1501 gene locus_tag LOCUS_14560 1187 1501 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098837.1 protein_id gnl|my_center|LOCUS_14560 2248 1502 gene locus_tag LOCUS_14570 2248 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14570 >Feature sequence450 <1 682 gene locus_tag LOCUS_14580 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963865.1:nucleoside triphosphate pyrophosphohydrolase 730 1341 gene locus_tag LOCUS_14590 730 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 <2406 1342 gene locus_tag LOCUS_14600 <2406 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047985.1:cytochrome d ubiquinol oxidase subunit I >Feature sequence451 <1 577 gene locus_tag LOCUS_14610 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404915.1:heme exporter protein C 570 734 gene locus_tag LOCUS_14620 570 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 727 1113 gene locus_tag LOCUS_14630 727 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence452 1645 656 gene locus_tag LOCUS_14640 1645 656 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_14640 1740 2198 gene locus_tag LOCUS_14650 1740 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence453 1031 321 gene locus_tag LOCUS_14660 1031 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 <2375 1272 gene locus_tag LOCUS_14670 <2375 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202503.1:2-oxoisovalerate dehydrogenase subunit beta >Feature sequence454 1484 711 gene locus_tag LOCUS_14680 1484 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963620.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence455 880 1770 gene locus_tag LOCUS_14690 gene xerC 880 1770 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A461 protein_id gnl|my_center|LOCUS_14690 >Feature sequence456 1149 1667 gene locus_tag LOCUS_14700 1149 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1696 2130 gene locus_tag LOCUS_14710 1696 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence457 1176 589 gene locus_tag LOCUS_14720 gene def 1176 589 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UID1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence458 300 1646 gene locus_tag LOCUS_14730 300 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence459 1369 62 gene locus_tag LOCUS_14740 1369 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence460 1176 739 gene locus_tag LOCUS_14750 1176 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1714 1160 gene locus_tag LOCUS_14760 1714 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 <2347 1821 gene locus_tag LOCUS_14770 <2347 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403087.1:nitrous-oxide reductase >Feature sequence461 1385 1714 gene locus_tag LOCUS_14780 1385 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence462 <1 1530 gene locus_tag LOCUS_14790 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072459.1:peptidase M2 >Feature sequence463 <1 1162 gene locus_tag LOCUS_14800 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A6H1P4:kynurenine 3-monooxygenase 1162 2262 gene locus_tag LOCUS_14810 gene hisC 1162 2262 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P17731 protein_id gnl|my_center|LOCUS_14810 >Feature sequence464 1393 47 gene locus_tag LOCUS_14820 1393 47 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence465 1291 545 gene locus_tag LOCUS_14830 1291 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence466 <1 1432 gene locus_tag LOCUS_14840 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931870.1:penicillin-binding protein 1444 2100 gene locus_tag LOCUS_14850 gene ycgM 1444 2100 CDS product acylpyruvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941248.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence467 3 1553 gene locus_tag LOCUS_14860 3 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence468 1669 578 gene locus_tag LOCUS_14870 1669 578 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Z38 protein_id gnl|my_center|LOCUS_14870 2264 1662 gene locus_tag LOCUS_14880 2264 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence469 102 350 gene locus_tag LOCUS_14890 102 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 680 342 gene locus_tag LOCUS_14900 680 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1501 707 gene locus_tag LOCUS_14910 1501 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1613 1891 gene locus_tag LOCUS_14920 1613 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence470 204 692 gene locus_tag LOCUS_14930 204 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1239 667 gene locus_tag LOCUS_14940 1239 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1979 1236 gene locus_tag LOCUS_14950 1979 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence471 2030 222 gene locus_tag LOCUS_14960 gene mutL 2030 222 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GYR1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence472 <1 940 gene locus_tag LOCUS_14970 <1 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142253.1:aminobenzoyl-glutamate transporter 1087 1566 gene locus_tag LOCUS_14980 1087 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14980 >Feature sequence473 492 73 gene locus_tag LOCUS_14990 gene rplP 492 73 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH9 protein_id gnl|my_center|LOCUS_14990 1145 513 gene locus_tag LOCUS_15000 gene rpsC 1145 513 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Q8 protein_id gnl|my_center|LOCUS_15000 1545 1150 gene locus_tag LOCUS_15010 gene rplV 1545 1150 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAH7 protein_id gnl|my_center|LOCUS_15010 1842 1573 gene locus_tag LOCUS_15020 gene rpsS 1842 1573 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64NL2 protein_id gnl|my_center|LOCUS_15020 >Feature sequence474 397 161 gene locus_tag LOCUS_15030 397 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 744 394 gene locus_tag LOCUS_15040 744 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1102 731 gene locus_tag LOCUS_15050 1102 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence475 631 191 gene locus_tag LOCUS_15060 631 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1553 624 gene locus_tag LOCUS_15070 1553 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1691 1921 gene locus_tag LOCUS_15080 1691 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15080 >Feature sequence476 807 175 gene locus_tag LOCUS_15090 807 175 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_15090 1045 2043 gene locus_tag LOCUS_15100 1045 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence477 322 1584 gene locus_tag LOCUS_15110 322 1584 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_15110 2127 1591 gene locus_tag LOCUS_15120 2127 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence478 832 266 gene locus_tag LOCUS_15130 832 266 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084104.1 protein_id gnl|my_center|LOCUS_15130 1459 833 gene locus_tag LOCUS_15140 1459 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence479 >Feature sequence480 <1 518 gene locus_tag LOCUS_15150 <1 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144392.1:membrane protein 894 1160 gene locus_tag LOCUS_15160 894 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1165 1959 gene locus_tag LOCUS_15170 1165 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence481 >Feature sequence482 >Feature sequence483 <1 736 gene locus_tag LOCUS_15180 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763530.1:hybrid sensor histidine kinase/response regulator 906 745 gene locus_tag LOCUS_15190 906 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 1524 1018 gene locus_tag LOCUS_15200 1524 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence484 2207 954 gene locus_tag LOCUS_15210 gene hisS 2207 954 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 protein_id gnl|my_center|LOCUS_15210 >Feature sequence485 1307 828 gene locus_tag LOCUS_15220 gene smpB 1307 828 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228068.1 protein_id gnl|my_center|LOCUS_15220 1804 1310 gene locus_tag LOCUS_15230 1804 1310 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B710 protein_id gnl|my_center|LOCUS_15230 >Feature sequence486 1246 1590 gene locus_tag LOCUS_15240 gene yhaI 1246 1590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198802.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence487 >Feature sequence488 1054 539 gene locus_tag LOCUS_15250 1054 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 1157 1672 gene locus_tag LOCUS_15260 1157 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2112 1723 gene locus_tag LOCUS_15270 gene rplS 2112 1723 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QV42 protein_id gnl|my_center|LOCUS_15270 >Feature sequence489 439 624 gene locus_tag LOCUS_15280 gene rpmF 439 624 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CR43 protein_id gnl|my_center|LOCUS_15280 642 1667 gene locus_tag LOCUS_15290 gene plsX 642 1667 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0Y4 protein_id gnl|my_center|LOCUS_15290 >Feature sequence490 >Feature sequence491 1134 457 gene locus_tag LOCUS_15300 1134 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_15300 1868 1134 gene locus_tag LOCUS_15310 1868 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence492 389 1483 gene locus_tag LOCUS_15320 389 1483 CDS product hemolysin D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963079.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence493 527 1018 gene locus_tag LOCUS_15330 gene sixA 527 1018 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence494 <1 1796 gene locus_tag LOCUS_15340 <1 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069661.1:guanylate cyclase >Feature sequence495 <1 1645 gene locus_tag LOCUS_15350 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405023.1:peptidase 1742 2101 gene locus_tag LOCUS_15360 1742 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence496 342 932 gene locus_tag LOCUS_15370 gene sodC2 342 932 CDS product superoxide dismutase [Cu-Zn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PDZ3 protein_id gnl|my_center|LOCUS_15370 1072 988 gene locus_tag LOCUS_t00210 1072 988 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1895 1080 gene locus_tag LOCUS_15380 1895 1080 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence497 1085 156 gene locus_tag LOCUS_15390 1085 156 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_15390 2147 1137 gene locus_tag LOCUS_15400 2147 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence498 <1 1631 gene locus_tag LOCUS_15410 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023330.1:hybrid sensor histidine kinase/response regulator >Feature sequence499 >Feature sequence500 <1 1193 gene locus_tag LOCUS_15420 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932009.1:glycosyl transferase family 2 1162 1950 gene locus_tag LOCUS_15430 1162 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence501 1830 967 gene locus_tag LOCUS_15440 1830 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2027 1833 gene locus_tag LOCUS_15450 2027 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence502 335 2104 gene locus_tag LOCUS_15460 335 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence503 >Feature sequence504 >Feature sequence505 192 2159 gene locus_tag LOCUS_15470 192 2159 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031492.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence506 1459 488 gene locus_tag LOCUS_15480 1459 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795545.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence507 >Feature sequence508 1619 279 gene locus_tag LOCUS_15490 1619 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 2149 1691 gene locus_tag LOCUS_15500 2149 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence509 180 539 gene locus_tag LOCUS_15510 180 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962382.1 protein_id gnl|my_center|LOCUS_15510 1108 536 gene locus_tag LOCUS_15520 1108 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2126 1554 gene locus_tag LOCUS_15530 2126 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence510 >Feature sequence511 <1 1040 gene locus_tag LOCUS_15540 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KDQ7:glucose-6-phosphate isomerase >Feature sequence512 <1 1055 gene locus_tag LOCUS_15550 <1 1055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DMA8:polyphosphate kinase 1251 1177 gene locus_tag LOCUS_t00220 1251 1177 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1327 2064 gene locus_tag LOCUS_15560 1327 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence513 580 155 gene locus_tag LOCUS_15570 580 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 887 690 gene locus_tag LOCUS_15580 887 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 1397 1639 gene locus_tag LOCUS_15590 1397 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 1791 1985 gene locus_tag LOCUS_15600 1791 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1982 2113 gene locus_tag LOCUS_15610 1982 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence514 876 960 gene locus_tag LOCUS_t00230 876 960 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <2166 925 gene locus_tag LOCUS_15620 <2166 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861147.1:serine recombinase >Feature sequence515 208 435 gene locus_tag LOCUS_15630 208 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1037 432 gene locus_tag LOCUS_15640 1037 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648594.1 protein_id gnl|my_center|LOCUS_15640 1876 2112 gene locus_tag LOCUS_15650 1876 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence516 >Feature sequence517 <2160 1174 gene locus_tag LOCUS_15660 <2160 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1N6:transcription termination/antitermination protein NusA >Feature sequence518 <1 1600 gene locus_tag LOCUS_15670 <1 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KAN0:threonine--tRNA ligase >Feature sequence519 688 1917 gene locus_tag LOCUS_15680 688 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence520 <1 613 gene locus_tag LOCUS_15690 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BG0:cell shape-determining protein MreC 614 1132 gene locus_tag LOCUS_15700 614 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence521 <1 950 gene locus_tag LOCUS_15710 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_010691.2:ATP-dependent protease 950 1621 gene locus_tag LOCUS_15720 gene rpe 950 1621 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34557 protein_id gnl|my_center|LOCUS_15720 >Feature sequence522 588 319 gene locus_tag LOCUS_15730 588 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence523 381 82 gene locus_tag LOCUS_15740 381 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1190 1795 gene locus_tag LOCUS_15750 1190 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence524 87 389 gene locus_tag LOCUS_15760 87 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1102 428 gene locus_tag LOCUS_15770 1102 428 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765986.1 protein_id gnl|my_center|LOCUS_15770 2122 1229 gene locus_tag LOCUS_15780 2122 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence525 1439 591 gene locus_tag LOCUS_15790 1439 591 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120208.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence526 <1 666 gene locus_tag LOCUS_15800 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KFQ5:isoprenyl transferase >Feature sequence527 466 702 gene locus_tag LOCUS_15810 466 702 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 protein_id gnl|my_center|LOCUS_15810 699 1124 gene locus_tag LOCUS_15820 699 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1117 2094 gene locus_tag LOCUS_15830 1117 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence528 <2122 1116 gene locus_tag LOCUS_15840 <2122 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763530.1:hybrid sensor histidine kinase/response regulator >Feature sequence529 759 418 gene locus_tag LOCUS_15850 gene queF 759 418 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F719 protein_id gnl|my_center|LOCUS_15850 877 1422 gene locus_tag LOCUS_15860 877 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15860 >Feature sequence530 768 1832 gene locus_tag LOCUS_15870 768 1832 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787649.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence531 >Feature sequence532 1477 398 gene locus_tag LOCUS_15880 1477 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 1965 1600 gene locus_tag LOCUS_15890 1965 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence533 <2115 1144 gene locus_tag LOCUS_15900 <2115 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117868.1:S-adenosylmethionine--diacylglycerol 3-amino-3-carboxypropyl transferase >Feature sequence534 >Feature sequence535 >Feature sequence536 2101 323 gene locus_tag LOCUS_15910 2101 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence537 <2091 1042 gene locus_tag LOCUS_15920 <2091 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCE2:glyceraldehyde-3-phosphate dehydrogenase >Feature sequence538 1188 856 gene locus_tag LOCUS_15930 1188 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 1515 1207 gene locus_tag LOCUS_15940 1515 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence539 501 1043 gene locus_tag LOCUS_15950 gene hslV 501 1043 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD62 protein_id gnl|my_center|LOCUS_15950 >Feature sequence540 >Feature sequence541 401 1333 gene locus_tag LOCUS_15960 401 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1446 1802 gene locus_tag LOCUS_15970 1446 1802 CDS product flagellar protein FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKF5 protein_id gnl|my_center|LOCUS_15970 >Feature sequence542 941 528 gene locus_tag LOCUS_15980 941 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1743 1027 gene locus_tag LOCUS_15990 1743 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence543 1512 736 gene locus_tag LOCUS_16000 gene ugpE 1512 736 CDS product sn-glycerol-3-phosphate transport system permease protein UgpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6UBW5 protein_id gnl|my_center|LOCUS_16000 2063 1551 gene locus_tag LOCUS_16010 2063 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence544 <1 1110 gene locus_tag LOCUS_16020 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:peptidase S41 1165 2028 gene locus_tag LOCUS_16030 1165 2028 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence545 >Feature sequence546 333 1418 gene locus_tag LOCUS_16040 333 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence547 1918 911 gene locus_tag LOCUS_16050 1918 911 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203247.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence548 >Feature sequence549 422 168 gene locus_tag LOCUS_16060 422 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 760 518 gene locus_tag LOCUS_16070 760 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 1252 1857 gene locus_tag LOCUS_16080 1252 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648594.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence550 221 910 gene locus_tag LOCUS_16090 221 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 907 1893 gene locus_tag LOCUS_16100 907 1893 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962740.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence551 >Feature sequence552 705 103 gene locus_tag LOCUS_16110 705 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence553 1043 372 gene locus_tag LOCUS_16120 gene mtgA 1043 372 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ABA6 protein_id gnl|my_center|LOCUS_16120 1116 1199 gene locus_tag LOCUS_t00240 1116 1199 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <2026 1240 gene locus_tag LOCUS_16130 <2026 1240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964014.1:oxidoreductase >Feature sequence554 >Feature sequence555 1088 522 gene locus_tag LOCUS_16140 1088 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1603 1136 gene locus_tag LOCUS_16150 1603 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 >Feature sequence556 <1 671 gene locus_tag LOCUS_16160 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HFY5:beta-lactamase 668 1087 gene locus_tag LOCUS_16170 668 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209946.1 protein_id gnl|my_center|LOCUS_16170 1154 1915 gene locus_tag LOCUS_16180 1154 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence557 1320 166 gene locus_tag LOCUS_16190 gene dnaJ 1320 166 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCD8 protein_id gnl|my_center|LOCUS_16190 <2008 1336 gene locus_tag LOCUS_16200 <2008 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816478.1:nucleotide exchange factor GrpE >Feature sequence558 1642 473 gene locus_tag LOCUS_16210 gene hmgA 1642 473 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072058.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence559 1224 19 gene locus_tag LOCUS_16220 gene murA 1224 19 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEX7 protein_id gnl|my_center|LOCUS_16220 <2002 1267 gene locus_tag LOCUS_16230 <2002 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403976.1:polyprenyl synthetase >Feature sequence560 159 794 gene locus_tag LOCUS_16240 159 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 <2002 804 gene locus_tag LOCUS_16250 <2002 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S550:DNA helicase >Feature sequence561 >Feature sequence562 822 1058 gene locus_tag LOCUS_16260 822 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 <1997 1065 gene locus_tag LOCUS_16270 <1997 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940450.1:glycosyl transferase >Feature sequence563 >Feature sequence564 572 847 gene locus_tag LOCUS_16280 572 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1264 983 gene locus_tag LOCUS_16290 1264 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1961 1419 gene locus_tag LOCUS_16300 1961 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence565 >Feature sequence566 >Feature sequence567 577 1173 gene locus_tag LOCUS_16310 577 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1243 1881 gene locus_tag LOCUS_16320 gene maf 1243 1881 CDS product septum formation protein Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HD71 protein_id gnl|my_center|LOCUS_16320 >Feature sequence568 1255 41 gene locus_tag LOCUS_16330 gene gltA 1255 41 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence569 454 996 gene locus_tag LOCUS_16340 454 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1751 1053 gene locus_tag LOCUS_16350 1751 1053 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253855.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence570 <1 522 gene locus_tag LOCUS_16360 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HCX6:endonuclease MutS2 >Feature sequence571 <1 580 gene locus_tag LOCUS_16370 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_002345448.1:N-acetylmuramoyl-L-alanine amidase 616 1758 gene locus_tag LOCUS_16380 gene metK 616 1758 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEG7 protein_id gnl|my_center|LOCUS_16380 >Feature sequence572 801 316 gene locus_tag LOCUS_16390 801 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1753 1025 gene locus_tag LOCUS_16400 1753 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence573 >Feature sequence574 356 1060 gene locus_tag LOCUS_16410 356 1060 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence575 <1948 1118 gene locus_tag LOCUS_16420 <1948 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405030.1:MFS transporter >Feature sequence576 1329 607 gene locus_tag LOCUS_16430 gene comB 1329 607 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZQ4 protein_id gnl|my_center|LOCUS_16430 >Feature sequence577 <1946 1016 gene locus_tag LOCUS_16440 <1946 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391442.1:acetoacetyl-CoA synthetase >Feature sequence578 1177 137 gene locus_tag LOCUS_16450 1177 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 >Feature sequence579 1 1650 gene locus_tag LOCUS_16460 1 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence580 1877 1278 gene locus_tag LOCUS_16470 1877 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 >Feature sequence581 438 214 gene locus_tag LOCUS_16480 gene rpmB 438 214 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:K0MGM8 protein_id gnl|my_center|LOCUS_16480 554 961 gene locus_tag LOCUS_16490 554 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 <1921 927 gene locus_tag LOCUS_16500 <1921 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966332.1:glycosyl transferase >Feature sequence582 516 1220 gene locus_tag LOCUS_16510 516 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 >Feature sequence583 656 1480 gene locus_tag LOCUS_16520 656 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 1480 1893 gene locus_tag LOCUS_16530 1480 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence584 >Feature sequence585 >Feature sequence586 359 1207 gene locus_tag LOCUS_16540 359 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence587 >Feature sequence588 968 276 gene locus_tag LOCUS_16550 968 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 <1895 958 gene locus_tag LOCUS_16560 <1895 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964032.1:acyl-CoA dehydrogenase >Feature sequence589 <1894 862 gene locus_tag LOCUS_16570 <1894 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase >Feature sequence590 1363 200 gene locus_tag LOCUS_16580 gene dnaN 1363 200 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6M1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence591 <1 1330 gene locus_tag LOCUS_16590 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q181G3:tRNA(Ile)-lysidine synthase >Feature sequence592 <1 1222 gene locus_tag LOCUS_16600 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931909.1:ABC transporter ATP-binding protein 1777 1226 gene locus_tag LOCUS_16610 1777 1226 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183284.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence593 >Feature sequence594 <1 569 gene locus_tag LOCUS_16620 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461269.1:thioredoxin >Feature sequence595 <1876 938 gene locus_tag LOCUS_16630 <1876 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405413.1:UDP-glucose 6-dehydrogenase >Feature sequence596 1661 1416 gene locus_tag LOCUS_16640 1661 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16640 1832 1680 gene locus_tag LOCUS_16650 1832 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence597 1248 199 gene locus_tag LOCUS_16660 1248 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence598 871 641 gene locus_tag LOCUS_16670 871 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 953 1432 gene locus_tag LOCUS_16680 gene coaD 953 1432 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5K7 protein_id gnl|my_center|LOCUS_16680 >Feature sequence599 >Feature sequence600 <1 640 gene locus_tag LOCUS_16690 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:alginate O-acetyltransferase 698 1696 gene locus_tag LOCUS_16700 698 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence601 1 849 gene locus_tag LOCUS_16710 1 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 <1864 809 gene locus_tag LOCUS_16720 <1864 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266827.1:TonB-dependent receptor >Feature sequence602 475 77 gene locus_tag LOCUS_16730 475 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 773 988 gene locus_tag LOCUS_16740 773 988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_16740 >Feature sequence603 327 728 gene locus_tag LOCUS_16750 327 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 733 1377 gene locus_tag LOCUS_16760 733 1377 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448622.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence604 >Feature sequence605 >Feature sequence606 1043 219 gene locus_tag LOCUS_16770 1043 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16770 >Feature sequence607 1346 288 gene locus_tag LOCUS_16780 gene recA 1346 288 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJG1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence608 >Feature sequence609 >Feature sequence610 789 1028 gene locus_tag LOCUS_16790 789 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 1029 1310 gene locus_tag LOCUS_16800 1029 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence611 1588 1079 gene locus_tag LOCUS_16810 1588 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 >Feature sequence612 287 982 gene locus_tag LOCUS_16820 287 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1405 1259 gene locus_tag LOCUS_16830 1405 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence613 >Feature sequence614 407 736 gene locus_tag LOCUS_16840 407 736 CDS product pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence615 <1 853 gene locus_tag LOCUS_16850 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962463.1:phosphoesterase >Feature sequence616 440 904 gene locus_tag LOCUS_16860 440 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence617 >Feature sequence618 124 438 gene locus_tag LOCUS_16870 124 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16870 490 1419 gene locus_tag LOCUS_16880 490 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16880 >Feature sequence619 >Feature sequence620 >Feature sequence621 >Feature sequence622 296 439 gene locus_tag LOCUS_16890 296 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 464 682 gene locus_tag LOCUS_16900 464 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1277 690 gene locus_tag LOCUS_16910 gene trmH 1277 690 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q729J5 protein_id gnl|my_center|LOCUS_16910 1801 1334 gene locus_tag LOCUS_16920 1801 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence623 <1 1038 gene locus_tag LOCUS_16930 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962730.1:MATE family efflux transporter 1376 1077 gene locus_tag LOCUS_16940 1376 1077 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760436.1 protein_id gnl|my_center|LOCUS_16940 1707 1363 gene locus_tag LOCUS_16950 1707 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766756.1 protein_id gnl|my_center|LOCUS_16950 >Feature sequence624 <1792 736 gene locus_tag LOCUS_16960 <1792 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S028:heat-inducible transcription repressor HrcA >Feature sequence625 >Feature sequence626 >Feature sequence627 >Feature sequence628 1138 983 gene locus_tag LOCUS_16970 1138 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 1189 1359 gene locus_tag LOCUS_16980 1189 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence629 68 1018 gene locus_tag LOCUS_16990 gene rocF 68 1018 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39138 protein_id gnl|my_center|LOCUS_16990 >Feature sequence630 113 577 gene locus_tag LOCUS_17000 113 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 574 1545 gene locus_tag LOCUS_17010 gene lpxK 574 1545 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8REH3 protein_id gnl|my_center|LOCUS_17010 >Feature sequence631 961 290 gene locus_tag LOCUS_17020 961 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence632 <1765 96 gene locus_tag LOCUS_17030 <1765 96 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877123.1:S-layer protein >Feature sequence633 <1 739 gene locus_tag LOCUS_17040 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y9L5:flavin-dependent thymidylate synthase 748 1482 gene locus_tag LOCUS_17050 748 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence634 >Feature sequence635 518 1108 gene locus_tag LOCUS_17060 518 1108 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205255.1 protein_id gnl|my_center|LOCUS_17060 >Feature sequence636 442 885 gene locus_tag LOCUS_17070 442 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence637 133 519 gene locus_tag LOCUS_17080 gene rpsI 133 519 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM58 protein_id gnl|my_center|LOCUS_17080 628 1512 gene locus_tag LOCUS_17090 gene rpsB 628 1512 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBK6 protein_id gnl|my_center|LOCUS_17090 >Feature sequence638 <1 795 gene locus_tag LOCUS_17100 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q73K21:ribonuclease H 906 1112 gene locus_tag LOCUS_17110 906 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 1126 >1748 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcaatactaatatagtaggattaacag >Feature sequence639 <1745 548 gene locus_tag LOCUS_17120 <1745 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008769027.1:TonB-dependent receptor >Feature sequence640 72 527 gene locus_tag LOCUS_17130 72 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 1501 665 gene locus_tag LOCUS_17140 1501 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 >Feature sequence641 >Feature sequence642 <1 695 gene locus_tag LOCUS_17150 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein 805 1539 gene locus_tag LOCUS_17160 805 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence643 117 785 gene locus_tag LOCUS_17170 117 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 1168 782 gene locus_tag LOCUS_17180 1168 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 <1733 1165 gene locus_tag LOCUS_17190 <1733 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YLE7:phosphoribosylamine--glycine ligase >Feature sequence644 758 1570 gene locus_tag LOCUS_17200 758 1570 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence645 185 1075 gene locus_tag LOCUS_17210 gene pyrB 185 1075 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YLE0 protein_id gnl|my_center|LOCUS_17210 >Feature sequence646 <1728 659 gene locus_tag LOCUS_17220 <1728 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q185R8:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence647 98 787 gene locus_tag LOCUS_17230 98 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 1640 849 gene locus_tag LOCUS_17240 1640 849 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786594.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence648 765 61 gene locus_tag LOCUS_17250 765 61 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933371.1 protein_id gnl|my_center|LOCUS_17250 1209 766 gene locus_tag LOCUS_17260 gene ssb 1209 766 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q83EP4 protein_id gnl|my_center|LOCUS_17260 >Feature sequence649 1686 184 gene locus_tag LOCUS_17270 1686 184 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869326.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence650 <1725 1199 gene locus_tag LOCUS_17280 <1725 1199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461976.1:DNA-binding response regulator >Feature sequence651 >Feature sequence652 2 538 gene locus_tag LOCUS_17290 2 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 <1718 612 gene locus_tag LOCUS_17300 <1718 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461269.1:thioredoxin >Feature sequence653 <1 1378 gene locus_tag LOCUS_17310 <1 1378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109857.1:adhesin >Feature sequence654 >Feature sequence655 >Feature sequence656 1683 571 gene locus_tag LOCUS_17320 gene carA 1683 571 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66727 protein_id gnl|my_center|LOCUS_17320 >Feature sequence657 >Feature sequence658 101 553 gene locus_tag LOCUS_17330 101 553 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence659 >Feature sequence660 602 1069 gene locus_tag LOCUS_17340 602 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence661 >Feature sequence662 159 1517 gene locus_tag LOCUS_17350 159 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582879.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence663 >Feature sequence664 1481 234 gene locus_tag LOCUS_17360 gene kdtA 1481 234 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962573.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence665 657 1337 gene locus_tag LOCUS_17370 657 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1378 1629 gene locus_tag LOCUS_17380 1378 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence666 218 565 gene locus_tag LOCUS_17390 218 565 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F1Q9 protein_id gnl|my_center|LOCUS_17390 648 1007 gene locus_tag LOCUS_17400 648 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 1086 1586 gene locus_tag LOCUS_17410 1086 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence667 >Feature sequence668 <1 1238 gene locus_tag LOCUS_17420 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225652.1:type IV secretion protein Rhs >Feature sequence669 >Feature sequence670 3 803 gene locus_tag LOCUS_17430 3 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 <1666 844 gene locus_tag LOCUS_17440 <1666 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KG74:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence671 1295 384 gene locus_tag LOCUS_17450 gene yhcH 1295 384 CDS product putative ABC transporter ATP-binding protein YhcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54592 protein_id gnl|my_center|LOCUS_17450 >Feature sequence672 >Feature sequence673 308 823 gene locus_tag LOCUS_17460 308 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1520 864 gene locus_tag LOCUS_17470 1520 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence674 <1 1578 gene locus_tag LOCUS_17480 <1 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KC74:valine--tRNA ligase >Feature sequence675 <1 677 gene locus_tag LOCUS_17490 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081431.1:UDP-glucose 4-epimerase 776 1204 gene locus_tag LOCUS_17500 776 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence676 >Feature sequence677 212 982 gene locus_tag LOCUS_17510 gene parA 212 982 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence678 <1 531 gene locus_tag LOCUS_17520 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S257:dihydrolipoyl dehydrogenase <1646 701 gene locus_tag LOCUS_17530 <1646 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001011124.1:membrane protein >Feature sequence679 23 352 gene locus_tag LOCUS_17540 23 352 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_17540 349 687 gene locus_tag LOCUS_17550 349 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17550 703 1041 gene locus_tag LOCUS_17560 703 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17560 >Feature sequence680 488 93 gene locus_tag LOCUS_17570 488 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 1211 570 gene locus_tag LOCUS_17580 1211 570 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973894.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence681 <1 556 gene locus_tag LOCUS_17590 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000538869.1:3-hydroxybutyryl-CoA dehydrogenase 1082 645 gene locus_tag LOCUS_17600 1082 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence682 >Feature sequence683 136 972 gene locus_tag LOCUS_17610 gene accD 136 972 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJI7 protein_id gnl|my_center|LOCUS_17610 >Feature sequence684 >Feature sequence685 33 209 gene locus_tag LOCUS_17620 33 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 957 1601 gene locus_tag LOCUS_17630 957 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence686 103 297 gene locus_tag LOCUS_17640 103 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence687 777 424 gene locus_tag LOCUS_17650 777 424 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BD4 protein_id gnl|my_center|LOCUS_17650 <1623 777 gene locus_tag LOCUS_17660 <1623 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962373.1:amidophosphoribosyltransferase >Feature sequence688 665 414 gene locus_tag LOCUS_17670 665 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence689 >Feature sequence690 >Feature sequence691 <1 590 gene locus_tag LOCUS_17680 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64XE6:4-hydroxythreonine-4-phosphate dehydrogenase >Feature sequence692 >Feature sequence693 <1601 130 gene locus_tag LOCUS_17690 <1601 130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q64PX3:phosphate transporter >Feature sequence694 <1599 863 gene locus_tag LOCUS_17700 <1599 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000073260.1:methylmalonyl-CoA mutase >Feature sequence695 >Feature sequence696 1304 879 gene locus_tag LOCUS_17710 1304 879 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_17710 1595 1389 gene locus_tag LOCUS_17720 1595 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence697 <1 600 gene locus_tag LOCUS_17730 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q81FS2:cytidylate kinase 655 1572 gene locus_tag LOCUS_17740 gene ispH 655 1572 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A625 protein_id gnl|my_center|LOCUS_17740 >Feature sequence698 <1 999 gene locus_tag LOCUS_17750 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964489.1:copper transporter 1426 980 gene locus_tag LOCUS_17760 1426 980 CDS product restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence699 >Feature sequence700 >Feature sequence701 1477 1100 gene locus_tag LOCUS_17770 gene rplL 1477 1100 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A472 protein_id gnl|my_center|LOCUS_17770 >Feature sequence702 747 451 gene locus_tag LOCUS_17780 747 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence703 1428 445 gene locus_tag LOCUS_17790 1428 445 CDS product ATPase/protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932480.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence704 185 880 gene locus_tag LOCUS_17800 185 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence705 >Feature sequence706 866 393 gene locus_tag LOCUS_17810 866 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 <1555 958 gene locus_tag LOCUS_17820 <1555 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990020.1:two-component sensor histidine kinase >Feature sequence707 711 1145 gene locus_tag LOCUS_17830 711 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence708 <1 953 gene locus_tag LOCUS_17840 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S3W3:arginine--tRNA ligase 1516 962 gene locus_tag LOCUS_17850 1516 962 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947316.1 protein_id gnl|my_center|LOCUS_17850 >Feature sequence709 <1547 73 gene locus_tag LOCUS_17860 <1547 73 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494280.1:ATP-dependent DNA helicase RecQ >Feature sequence710 >Feature sequence711 149 1384 gene locus_tag LOCUS_17870 149 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17870 >Feature sequence712 >Feature sequence713 >Feature sequence714 >Feature sequence715 >Feature sequence716 1120 593 gene locus_tag LOCUS_17880 gene nbaC 1120 593 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PAD0 protein_id gnl|my_center|LOCUS_17880 >Feature sequence717 >Feature sequence718 >Feature sequence719 >Feature sequence720 >Feature sequence721 >Feature sequence722 1298 630 gene locus_tag LOCUS_17890 1298 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence723 >Feature sequence724 >Feature sequence725 792 37 gene locus_tag LOCUS_17900 792 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 1414 848 gene locus_tag LOCUS_17910 gene tag 1414 848 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_17910