>Feature sequence001 2081 3307 gene locus_tag LOCUS_00010 2081 3307 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S410 protein_id gnl|my_center|LOCUS_00010 3340 6273 gene locus_tag LOCUS_00020 3340 6273 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_00020 6511 7110 gene locus_tag LOCUS_00030 6511 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402887.1 protein_id gnl|my_center|LOCUS_00030 7170 8009 gene locus_tag LOCUS_00040 7170 8009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 8126 8815 gene locus_tag LOCUS_00050 8126 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 8907 9344 gene locus_tag LOCUS_00060 8907 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10879 9353 gene locus_tag LOCUS_00070 10879 9353 CDS product multifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/5'-nucleotidase/3'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390236.1 protein_id gnl|my_center|LOCUS_00070 11027 11299 gene locus_tag LOCUS_00080 11027 11299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404867.1 protein_id gnl|my_center|LOCUS_00080 12248 11379 gene locus_tag LOCUS_00090 gene dnaJ 12248 11379 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403245.1 protein_id gnl|my_center|LOCUS_00090 12332 13849 gene locus_tag LOCUS_00100 gene accC 12332 13849 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_00100 13996 14478 gene locus_tag LOCUS_00110 13996 14478 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_00110 14594 16984 gene locus_tag LOCUS_00120 14594 16984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 17015 18043 gene locus_tag LOCUS_00130 17015 18043 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_00130 18040 19098 gene locus_tag LOCUS_00140 gene rffG 18040 19098 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0WAE8 protein_id gnl|my_center|LOCUS_00140 19095 19961 gene locus_tag LOCUS_00150 gene rmlA 19095 19961 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:H7C760 protein_id gnl|my_center|LOCUS_00150 19958 20476 gene locus_tag LOCUS_00160 19958 20476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 21032 20775 gene locus_tag LOCUS_00170 21032 20775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 21198 23534 gene locus_tag LOCUS_00180 21198 23534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 23781 24215 gene locus_tag LOCUS_00190 23781 24215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 24578 26308 gene locus_tag LOCUS_00200 24578 26308 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_00200 26310 27248 gene locus_tag LOCUS_00210 26310 27248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 27287 28003 gene locus_tag LOCUS_00220 27287 28003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28000 28938 gene locus_tag LOCUS_00230 28000 28938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 28992 29648 gene locus_tag LOCUS_00240 28992 29648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 30235 29942 gene locus_tag LOCUS_00250 30235 29942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 30281 30778 gene locus_tag LOCUS_00260 30281 30778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 31395 31973 gene locus_tag LOCUS_00270 31395 31973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32021 33142 gene locus_tag LOCUS_00280 32021 33142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33184 34224 gene locus_tag LOCUS_00290 33184 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701760.1 protein_id gnl|my_center|LOCUS_00290 34750 36228 gene locus_tag LOCUS_00300 34750 36228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 36225 37256 gene locus_tag LOCUS_00310 36225 37256 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_00310 37530 39350 gene locus_tag LOCUS_00320 37530 39350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_00320 39391 40572 gene locus_tag LOCUS_00330 gene tagO 39391 40572 CDS product putative undecaprenyl-phosphate N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34753 protein_id gnl|my_center|LOCUS_00330 40634 41473 gene locus_tag LOCUS_00340 40634 41473 CDS product isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123301.1 protein_id gnl|my_center|LOCUS_00340 41470 41979 gene locus_tag LOCUS_00350 gene pyrR 41470 41979 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ46 protein_id gnl|my_center|LOCUS_00350 41994 42758 gene locus_tag LOCUS_00360 41994 42758 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267696.1 protein_id gnl|my_center|LOCUS_00360 42870 44045 gene locus_tag LOCUS_00370 42870 44045 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_00370 44049 45119 gene locus_tag LOCUS_00380 44049 45119 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540386.1 protein_id gnl|my_center|LOCUS_00380 45280 45660 gene locus_tag LOCUS_00390 45280 45660 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_00390 45660 46061 gene locus_tag LOCUS_00400 45660 46061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 46100 46846 gene locus_tag LOCUS_00410 46100 46846 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114603.1 protein_id gnl|my_center|LOCUS_00410 47097 47846 gene locus_tag LOCUS_00420 47097 47846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888398.1 protein_id gnl|my_center|LOCUS_00420 48846 47899 gene locus_tag LOCUS_00430 48846 47899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 <49661 48851 gene locus_tag LOCUS_00440 <49661 48851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S3F9:Holliday junction ATP-dependent DNA helicase RuvB >Feature sequence002 121 1440 gene locus_tag LOCUS_00450 121 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 2258 1566 gene locus_tag LOCUS_00460 2258 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 3772 2255 gene locus_tag LOCUS_00470 3772 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 3902 4393 gene locus_tag LOCUS_00480 gene ribH 3902 4393 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97LG8 protein_id gnl|my_center|LOCUS_00480 4452 6845 gene locus_tag LOCUS_00490 4452 6845 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_00490 6957 7031 gene locus_tag LOCUS_t00010 6957 7031 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7091 7163 gene locus_tag LOCUS_t00020 7091 7163 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 7914 7243 gene locus_tag LOCUS_00500 7914 7243 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256010.1 protein_id gnl|my_center|LOCUS_00500 8007 8936 gene locus_tag LOCUS_00510 8007 8936 CDS product manganese transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458881.1 protein_id gnl|my_center|LOCUS_00510 8937 9716 gene locus_tag LOCUS_00520 8937 9716 CDS product manganese ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_00520 9720 10859 gene locus_tag LOCUS_00530 9720 10859 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458883.1 protein_id gnl|my_center|LOCUS_00530 10856 11962 gene locus_tag LOCUS_00540 10856 11962 CDS product zinc ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256103.1 protein_id gnl|my_center|LOCUS_00540 12026 14461 gene locus_tag LOCUS_00550 12026 14461 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203489.1 protein_id gnl|my_center|LOCUS_00550 14500 15480 gene locus_tag LOCUS_00560 14500 15480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 16803 15490 gene locus_tag LOCUS_00570 gene nhaA 16803 15490 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_00570 17186 18625 gene locus_tag LOCUS_00580 gene xynB2 17186 18625 CDS product beta-xylosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920215.1 protein_id gnl|my_center|LOCUS_00580 18625 19977 gene locus_tag LOCUS_00590 18625 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067202.1 protein_id gnl|my_center|LOCUS_00590 25687 20000 gene locus_tag LOCUS_00600 25687 20000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 28013 25692 gene locus_tag LOCUS_00610 28013 25692 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_00610 28333 29976 gene locus_tag LOCUS_00620 28333 29976 CDS product peptidase M1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963149.1 protein_id gnl|my_center|LOCUS_00620 31310 30027 gene locus_tag LOCUS_00630 31310 30027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404600.1 protein_id gnl|my_center|LOCUS_00630 31444 32112 gene locus_tag LOCUS_00640 31444 32112 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390663.1 protein_id gnl|my_center|LOCUS_00640 32154 33482 gene locus_tag LOCUS_00650 32154 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 33482 34315 gene locus_tag LOCUS_00660 33482 34315 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105573.1 protein_id gnl|my_center|LOCUS_00660 34363 34890 gene locus_tag LOCUS_00670 34363 34890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 34981 36105 gene locus_tag LOCUS_00680 34981 36105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 36102 36929 gene locus_tag LOCUS_00690 36102 36929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 36929 37630 gene locus_tag LOCUS_00700 36929 37630 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_00700 37776 38690 gene locus_tag LOCUS_00710 37776 38690 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528466.1 protein_id gnl|my_center|LOCUS_00710 38724 39581 gene locus_tag LOCUS_00720 38724 39581 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404543.1 protein_id gnl|my_center|LOCUS_00720 40359 39913 gene locus_tag LOCUS_00730 40359 39913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 42538 40433 gene locus_tag LOCUS_00740 42538 40433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 43175 42741 gene locus_tag LOCUS_00750 43175 42741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 43080 43328 gene locus_tag LOCUS_00760 43080 43328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 44931 43390 gene locus_tag LOCUS_00770 44931 43390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 45640 44996 gene locus_tag LOCUS_00780 45640 44996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963611.1 protein_id gnl|my_center|LOCUS_00780 46406 45684 gene locus_tag LOCUS_00790 46406 45684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 48557 46446 gene locus_tag LOCUS_00800 48557 46446 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405431.1 protein_id gnl|my_center|LOCUS_00800 >Feature sequence003 1088 1798 gene locus_tag LOCUS_00810 gene purQ 1088 1798 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S567 protein_id gnl|my_center|LOCUS_00810 3435 1864 gene locus_tag LOCUS_00820 3435 1864 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731065.1 protein_id gnl|my_center|LOCUS_00820 4316 3432 gene locus_tag LOCUS_00830 gene dapA 4316 3432 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037553.1 protein_id gnl|my_center|LOCUS_00830 4536 5465 gene locus_tag LOCUS_00840 4536 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 6804 5518 gene locus_tag LOCUS_00850 gene dadA 6804 5518 CDS product D-amino-acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_00850 7736 6801 gene locus_tag LOCUS_00860 7736 6801 CDS product 4-hydroxyproline 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I476 protein_id gnl|my_center|LOCUS_00860 8503 7733 gene locus_tag LOCUS_00870 8503 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 8793 8524 gene locus_tag LOCUS_00880 8793 8524 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_00880 10105 8843 gene locus_tag LOCUS_00890 10105 8843 CDS product flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120592.1 protein_id gnl|my_center|LOCUS_00890 10262 10987 gene locus_tag LOCUS_00900 10262 10987 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXW2 protein_id gnl|my_center|LOCUS_00900 10984 11595 gene locus_tag LOCUS_00910 10984 11595 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708211.1 protein_id gnl|my_center|LOCUS_00910 12054 11608 gene locus_tag LOCUS_00920 12054 11608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 12444 13046 gene locus_tag LOCUS_00930 gene rdgB 12444 13046 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D3 protein_id gnl|my_center|LOCUS_00930 13043 13501 gene locus_tag LOCUS_00940 gene dtd 13043 13501 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3D4 protein_id gnl|my_center|LOCUS_00940 13681 15357 gene locus_tag LOCUS_00950 13681 15357 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403922.1 protein_id gnl|my_center|LOCUS_00950 16078 15527 gene locus_tag LOCUS_00960 16078 15527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142147.1 protein_id gnl|my_center|LOCUS_00960 16359 18578 gene locus_tag LOCUS_00970 16359 18578 CDS product biopolymer transporter Tol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038417.1 protein_id gnl|my_center|LOCUS_00970 18653 19135 gene locus_tag LOCUS_00980 18653 19135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 19254 20249 gene locus_tag LOCUS_00990 gene moaA 19254 20249 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UT69 protein_id gnl|my_center|LOCUS_00990 20511 21215 gene locus_tag LOCUS_01000 20511 21215 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403689.1 protein_id gnl|my_center|LOCUS_01000 21219 22883 gene locus_tag LOCUS_01010 21219 22883 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403688.1 protein_id gnl|my_center|LOCUS_01010 22937 24265 gene locus_tag LOCUS_01020 22937 24265 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403687.1 protein_id gnl|my_center|LOCUS_01020 24328 28275 gene locus_tag LOCUS_01030 24328 28275 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403686.1 protein_id gnl|my_center|LOCUS_01030 28287 28664 gene locus_tag LOCUS_01040 28287 28664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 29623 28898 gene locus_tag LOCUS_01050 29623 28898 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_01050 30571 29738 gene locus_tag LOCUS_01060 30571 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 30750 31478 gene locus_tag LOCUS_01070 gene trmH 30750 31478 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S465 protein_id gnl|my_center|LOCUS_01070 31528 32820 gene locus_tag LOCUS_01080 31528 32820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 33043 34089 gene locus_tag LOCUS_01090 33043 34089 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403889.1 protein_id gnl|my_center|LOCUS_01090 34097 34327 gene locus_tag LOCUS_01100 34097 34327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 35521 34403 gene locus_tag LOCUS_01110 gene manC 35521 34403 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_01110 35729 37120 gene locus_tag LOCUS_01120 35729 37120 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405413.1 protein_id gnl|my_center|LOCUS_01120 37197 38135 gene locus_tag LOCUS_01130 37197 38135 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405412.1 protein_id gnl|my_center|LOCUS_01130 38132 39043 gene locus_tag LOCUS_01140 38132 39043 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387760.1 protein_id gnl|my_center|LOCUS_01140 39076 39210 gene locus_tag LOCUS_01150 39076 39210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 39285 39653 gene locus_tag LOCUS_01160 39285 39653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 40167 39718 gene locus_tag LOCUS_01170 40167 39718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 40328 41503 gene locus_tag LOCUS_01180 40328 41503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 41586 42359 gene locus_tag LOCUS_01190 41586 42359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 42441 42734 gene locus_tag LOCUS_01200 42441 42734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 42811 45594 gene locus_tag LOCUS_01210 42811 45594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 45651 46877 gene locus_tag LOCUS_01220 45651 46877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence004 274 1044 gene locus_tag LOCUS_01230 274 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3704 1050 gene locus_tag LOCUS_01240 3704 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4306 3755 gene locus_tag LOCUS_01250 4306 3755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4897 4457 gene locus_tag LOCUS_01260 4897 4457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5196 4999 gene locus_tag LOCUS_01270 5196 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 6659 5232 gene locus_tag LOCUS_01280 6659 5232 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902502.1 protein_id gnl|my_center|LOCUS_01280 7094 6744 gene locus_tag LOCUS_01290 7094 6744 CDS product bleomycin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708326.1 protein_id gnl|my_center|LOCUS_01290 7296 8276 gene locus_tag LOCUS_01300 7296 8276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 8380 9426 gene locus_tag LOCUS_01310 8380 9426 CDS product succinylglutamate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958325.1 protein_id gnl|my_center|LOCUS_01310 9607 11073 gene locus_tag LOCUS_01320 9607 11073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 12169 11120 gene locus_tag LOCUS_01330 12169 11120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 12355 13776 gene locus_tag LOCUS_01340 12355 13776 CDS product adenylate/guanylate cyclase domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085648.1 protein_id gnl|my_center|LOCUS_01340 13773 17363 gene locus_tag LOCUS_01350 13773 17363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 18366 17548 gene locus_tag LOCUS_01360 18366 17548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 19324 18539 gene locus_tag LOCUS_01370 19324 18539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19467 20045 gene locus_tag LOCUS_01380 19467 20045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 20029 21105 gene locus_tag LOCUS_01390 20029 21105 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_01390 21143 21982 gene locus_tag LOCUS_01400 21143 21982 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_01400 22249 25767 gene locus_tag LOCUS_01410 22249 25767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 25764 27191 gene locus_tag LOCUS_01420 25764 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 27590 27198 gene locus_tag LOCUS_01430 27590 27198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 27855 28361 gene locus_tag LOCUS_01440 gene rfaY 27855 28361 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037773.1 protein_id gnl|my_center|LOCUS_01440 28358 28951 gene locus_tag LOCUS_01450 28358 28951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 28948 29991 gene locus_tag LOCUS_01460 28948 29991 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405425.1 protein_id gnl|my_center|LOCUS_01460 30054 32519 gene locus_tag LOCUS_01470 gene thrA 30054 32519 CDS product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 protein_id gnl|my_center|LOCUS_01470 32516 33442 gene locus_tag LOCUS_01480 gene thrB 32516 33442 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4Q3 protein_id gnl|my_center|LOCUS_01480 33503 34795 gene locus_tag LOCUS_01490 gene thrC 33503 34795 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933690.1 protein_id gnl|my_center|LOCUS_01490 37261 34805 gene locus_tag LOCUS_01500 gene priA 37261 34805 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYZ4 protein_id gnl|my_center|LOCUS_01500 37351 39891 gene locus_tag LOCUS_01510 37351 39891 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_01510 39988 40791 gene locus_tag LOCUS_01520 39988 40791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 41133 40792 gene locus_tag LOCUS_01530 41133 40792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 41191 41613 gene locus_tag LOCUS_01540 41191 41613 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228753.1 protein_id gnl|my_center|LOCUS_01540 41668 41967 gene locus_tag LOCUS_01550 gene eutN 41668 41967 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435411.1 protein_id gnl|my_center|LOCUS_01550 41964 42236 gene locus_tag LOCUS_01560 41964 42236 CDS product ethanolamine utilization protein EutN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721582.1 protein_id gnl|my_center|LOCUS_01560 43166 42255 gene locus_tag LOCUS_01570 43166 42255 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405405.1 protein_id gnl|my_center|LOCUS_01570 43973 43320 gene locus_tag LOCUS_01580 gene pcm 43973 43320 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S176 protein_id gnl|my_center|LOCUS_01580 44806 43970 gene locus_tag LOCUS_01590 44806 43970 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_01590 45636 44803 gene locus_tag LOCUS_01600 gene folP 45636 44803 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S174 protein_id gnl|my_center|LOCUS_01600 >Feature sequence005 183 827 gene locus_tag LOCUS_01610 183 827 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_01610 874 3429 gene locus_tag LOCUS_01620 874 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3510 5222 gene locus_tag LOCUS_01630 3510 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5354 6541 gene locus_tag LOCUS_01640 5354 6541 CDS product GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol dimannoside mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222448.1 protein_id gnl|my_center|LOCUS_01640 6812 6609 gene locus_tag LOCUS_01650 6812 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6888 7520 gene locus_tag LOCUS_01660 6888 7520 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403546.1 protein_id gnl|my_center|LOCUS_01660 7597 8865 gene locus_tag LOCUS_01670 gene pgi 7597 8865 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CT80 protein_id gnl|my_center|LOCUS_01670 9502 10353 gene locus_tag LOCUS_01680 9502 10353 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525378.1 protein_id gnl|my_center|LOCUS_01680 13745 10362 gene locus_tag LOCUS_01690 13745 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 14755 13820 gene locus_tag LOCUS_01700 14755 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 15279 14890 gene locus_tag LOCUS_01710 15279 14890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 16260 15289 gene locus_tag LOCUS_01720 gene gluQ 16260 15289 CDS product glutamyl-Q tRNA(Asp) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DI7 protein_id gnl|my_center|LOCUS_01720 16955 16257 gene locus_tag LOCUS_01730 16955 16257 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_01730 17285 17019 gene locus_tag LOCUS_01740 17285 17019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 17173 19263 gene locus_tag LOCUS_01750 17173 19263 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_01750 19528 19343 gene locus_tag LOCUS_01760 19528 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 19527 20276 gene locus_tag LOCUS_01770 gene fabG 19527 20276 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402833.1 protein_id gnl|my_center|LOCUS_01770 20573 20352 gene locus_tag LOCUS_01780 20573 20352 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403629.1 protein_id gnl|my_center|LOCUS_01780 21565 20570 gene locus_tag LOCUS_01790 21565 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 22905 21598 gene locus_tag LOCUS_01800 22905 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 24896 22917 gene locus_tag LOCUS_01810 24896 22917 CDS product ligand-gated channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403633.1 protein_id gnl|my_center|LOCUS_01810 25327 25749 gene locus_tag LOCUS_01820 25327 25749 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528627.1 protein_id gnl|my_center|LOCUS_01820 25857 26540 gene locus_tag LOCUS_01830 25857 26540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141154.1 protein_id gnl|my_center|LOCUS_01830 26537 27328 gene locus_tag LOCUS_01840 26537 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526525.1 protein_id gnl|my_center|LOCUS_01840 28736 27408 gene locus_tag LOCUS_01850 gene glyA1 28736 27408 CDS product 2-amino-3-ketobutyrate CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546431.1 protein_id gnl|my_center|LOCUS_01850 30254 28857 gene locus_tag LOCUS_01860 30254 28857 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_01860 30364 31680 gene locus_tag LOCUS_01870 30364 31680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 31713 32963 gene locus_tag LOCUS_01880 31713 32963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 33916 33047 gene locus_tag LOCUS_01890 33916 33047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 34134 35432 gene locus_tag LOCUS_01900 gene purB 34134 35432 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5K0 protein_id gnl|my_center|LOCUS_01900 36024 35437 gene locus_tag LOCUS_01910 36024 35437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140040.1 protein_id gnl|my_center|LOCUS_01910 37149 36043 gene locus_tag LOCUS_01920 37149 36043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 39163 37301 gene locus_tag LOCUS_01930 39163 37301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 40095 39370 gene locus_tag LOCUS_01940 40095 39370 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977726.1 protein_id gnl|my_center|LOCUS_01940 43588 40190 gene locus_tag LOCUS_01950 gene mfd 43588 40190 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6G5 protein_id gnl|my_center|LOCUS_01950 >Feature sequence006 2131 905 gene locus_tag LOCUS_01960 2131 905 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392245.1 protein_id gnl|my_center|LOCUS_01960 2357 3247 gene locus_tag LOCUS_01970 gene nadK 2357 3247 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S251 protein_id gnl|my_center|LOCUS_01970 4859 3291 gene locus_tag LOCUS_01980 4859 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 5045 6547 gene locus_tag LOCUS_01990 gene clsA 5045 6547 CDS product cardiolipin synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63SZ7 protein_id gnl|my_center|LOCUS_01990 6839 6609 gene locus_tag LOCUS_02000 6839 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 6741 7046 gene locus_tag LOCUS_02010 6741 7046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 7894 7055 gene locus_tag LOCUS_02020 7894 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 8002 8880 gene locus_tag LOCUS_02030 8002 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8873 9811 gene locus_tag LOCUS_02040 8873 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 12124 9974 gene locus_tag LOCUS_02050 12124 9974 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405415.1 protein_id gnl|my_center|LOCUS_02050 12381 14633 gene locus_tag LOCUS_02060 gene rnr 12381 14633 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2D1 protein_id gnl|my_center|LOCUS_02060 14655 15710 gene locus_tag LOCUS_02070 14655 15710 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035337.1 protein_id gnl|my_center|LOCUS_02070 15778 16713 gene locus_tag LOCUS_02080 15778 16713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 16967 16710 gene locus_tag LOCUS_02090 16967 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008719771.1 protein_id gnl|my_center|LOCUS_02090 17609 17034 gene locus_tag LOCUS_02100 17609 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140753.1 protein_id gnl|my_center|LOCUS_02100 18140 17646 gene locus_tag LOCUS_02110 18140 17646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 19344 18154 gene locus_tag LOCUS_02120 gene hemH 19344 18154 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ44 protein_id gnl|my_center|LOCUS_02120 21863 19680 gene locus_tag LOCUS_02130 21863 19680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 23398 21947 gene locus_tag LOCUS_02140 23398 21947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 25264 23459 gene locus_tag LOCUS_02150 gene pepF 25264 23459 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404064.1 protein_id gnl|my_center|LOCUS_02150 25413 25757 gene locus_tag LOCUS_02160 25413 25757 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404063.1 protein_id gnl|my_center|LOCUS_02160 25780 26583 gene locus_tag LOCUS_02170 25780 26583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 26580 27149 gene locus_tag LOCUS_02180 26580 27149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 27293 27208 gene locus_tag LOCUS_t00030 27293 27208 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27347 28108 gene locus_tag LOCUS_02190 27347 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 28183 29226 gene locus_tag LOCUS_02200 28183 29226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 29573 29223 gene locus_tag LOCUS_02210 29573 29223 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088312.1 protein_id gnl|my_center|LOCUS_02210 30639 29575 gene locus_tag LOCUS_02220 30639 29575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403703.1 protein_id gnl|my_center|LOCUS_02220 32273 30639 gene locus_tag LOCUS_02230 32273 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403702.1 protein_id gnl|my_center|LOCUS_02230 33121 32273 gene locus_tag LOCUS_02240 33121 32273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 34142 33222 gene locus_tag LOCUS_02250 34142 33222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 34345 34692 gene locus_tag LOCUS_02260 34345 34692 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_02260 34695 35528 gene locus_tag LOCUS_02270 34695 35528 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948483.1 protein_id gnl|my_center|LOCUS_02270 35577 36464 gene locus_tag LOCUS_02280 35577 36464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 37761 36469 gene locus_tag LOCUS_02290 37761 36469 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405384.1 protein_id gnl|my_center|LOCUS_02290 <39045 38194 gene locus_tag LOCUS_02300 <39045 38194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405102.1:rod shape-determining protein RodA >Feature sequence007 2078 1023 gene locus_tag LOCUS_02310 2078 1023 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_02310 3155 2196 gene locus_tag LOCUS_02320 gene yrbG 3155 2196 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_02320 4404 3277 gene locus_tag LOCUS_02330 4404 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5302 4397 gene locus_tag LOCUS_02340 5302 4397 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_02340 6047 5331 gene locus_tag LOCUS_02350 6047 5331 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403455.1 protein_id gnl|my_center|LOCUS_02350 6237 7001 gene locus_tag LOCUS_02360 6237 7001 CDS product UDP-2,3-diacylglucosamine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403456.1 protein_id gnl|my_center|LOCUS_02360 7033 9993 gene locus_tag LOCUS_02370 7033 9993 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403457.1 protein_id gnl|my_center|LOCUS_02370 10207 11343 gene locus_tag LOCUS_02380 gene sbcD 10207 11343 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4Q6 protein_id gnl|my_center|LOCUS_02380 12227 11340 gene locus_tag LOCUS_02390 gene ispE 12227 11340 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4Q4 protein_id gnl|my_center|LOCUS_02390 12367 14043 gene locus_tag LOCUS_02400 12367 14043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 14060 15352 gene locus_tag LOCUS_02410 14060 15352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 15342 16790 gene locus_tag LOCUS_02420 15342 16790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 16790 18091 gene locus_tag LOCUS_02430 16790 18091 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259589.1 protein_id gnl|my_center|LOCUS_02430 18165 18824 gene locus_tag LOCUS_02440 18165 18824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 18871 20010 gene locus_tag LOCUS_02450 18871 20010 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107852.1 protein_id gnl|my_center|LOCUS_02450 21150 20017 gene locus_tag LOCUS_02460 21150 20017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 21364 21185 gene locus_tag LOCUS_02470 21364 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 21335 21637 gene locus_tag LOCUS_02480 21335 21637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 22009 23205 gene locus_tag LOCUS_02490 22009 23205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 23198 23926 gene locus_tag LOCUS_02500 23198 23926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23923 24948 gene locus_tag LOCUS_02510 23923 24948 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966336.1 protein_id gnl|my_center|LOCUS_02510 25013 25624 gene locus_tag LOCUS_02520 gene gmhA 25013 25624 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RR43 protein_id gnl|my_center|LOCUS_02520 25621 26199 gene locus_tag LOCUS_02530 gene gmhB 25621 26199 CDS product D,D-heptose 1,7-bisphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BF7 protein_id gnl|my_center|LOCUS_02530 26739 26278 gene locus_tag LOCUS_02540 gene dut 26739 26278 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S160 protein_id gnl|my_center|LOCUS_02540 28375 26804 gene locus_tag LOCUS_02550 gene yclF 28375 26804 CDS product putative transporter YclF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94408 protein_id gnl|my_center|LOCUS_02550 29268 28501 gene locus_tag LOCUS_02560 gene algR 29268 28501 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403194.1 protein_id gnl|my_center|LOCUS_02560 30350 29265 gene locus_tag LOCUS_02570 30350 29265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 31072 30362 gene locus_tag LOCUS_02580 31072 30362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 32133 31168 gene locus_tag LOCUS_02590 32133 31168 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_02590 32781 32203 gene locus_tag LOCUS_02600 32781 32203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 35443 32795 gene locus_tag LOCUS_02610 35443 32795 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141097.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence008 438 1064 gene locus_tag LOCUS_02620 gene coaE 438 1064 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU8 protein_id gnl|my_center|LOCUS_02620 1170 1622 gene locus_tag LOCUS_02630 1170 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 2156 1701 gene locus_tag LOCUS_02640 2156 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2279 3760 gene locus_tag LOCUS_02650 2279 3760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 4953 3757 gene locus_tag LOCUS_02660 4953 3757 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706209.1 protein_id gnl|my_center|LOCUS_02660 5903 4950 gene locus_tag LOCUS_02670 5903 4950 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403186.1 protein_id gnl|my_center|LOCUS_02670 7597 5945 gene locus_tag LOCUS_02680 7597 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 9539 7689 gene locus_tag LOCUS_02690 gene typA 9539 7689 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403243.1 protein_id gnl|my_center|LOCUS_02690 10826 9711 gene locus_tag LOCUS_02700 10826 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 11414 11076 gene locus_tag LOCUS_02710 11414 11076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 11678 11469 gene locus_tag LOCUS_02720 11678 11469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 11884 12639 gene locus_tag LOCUS_02730 11884 12639 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405485.1 protein_id gnl|my_center|LOCUS_02730 12754 13593 gene locus_tag LOCUS_02740 12754 13593 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768991.1 protein_id gnl|my_center|LOCUS_02740 13678 15324 gene locus_tag LOCUS_02750 13678 15324 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_02750 17157 15328 gene locus_tag LOCUS_02760 17157 15328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 17383 19911 gene locus_tag LOCUS_02770 17383 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 19908 20726 gene locus_tag LOCUS_02780 19908 20726 CDS product acetoin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090078.1 protein_id gnl|my_center|LOCUS_02780 21586 20777 gene locus_tag LOCUS_02790 21586 20777 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_02790 23183 21645 gene locus_tag LOCUS_02800 23183 21645 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405199.1 protein_id gnl|my_center|LOCUS_02800 23895 23176 gene locus_tag LOCUS_02810 gene drrA 23895 23176 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_02810 24749 24000 gene locus_tag LOCUS_02820 24749 24000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 25685 24804 gene locus_tag LOCUS_02830 25685 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P29370 protein_id gnl|my_center|LOCUS_02830 27119 25707 gene locus_tag LOCUS_02840 27119 25707 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918774.1 protein_id gnl|my_center|LOCUS_02840 28143 27184 gene locus_tag LOCUS_02850 28143 27184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 28284 29954 gene locus_tag LOCUS_02860 gene katA 28284 29954 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119871.1 protein_id gnl|my_center|LOCUS_02860 30931 30059 gene locus_tag LOCUS_02870 30931 30059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 31431 30928 gene locus_tag LOCUS_02880 31431 30928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 32746 31595 gene locus_tag LOCUS_02890 32746 31595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 34999 32882 gene locus_tag LOCUS_02900 34999 32882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence009 296 402 gene locus_tag LOCUS_r00010 296 402 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1146 532 gene locus_tag LOCUS_02910 gene tmk 1146 532 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCU7 protein_id gnl|my_center|LOCUS_02910 1308 2738 gene locus_tag LOCUS_02920 1308 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_02920 2735 3586 gene locus_tag LOCUS_02930 gene aroE 2735 3586 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0A0 protein_id gnl|my_center|LOCUS_02930 3583 4272 gene locus_tag LOCUS_02940 3583 4272 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E5 protein_id gnl|my_center|LOCUS_02940 4513 6309 gene locus_tag LOCUS_02950 gene recJ 4513 6309 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404959.1 protein_id gnl|my_center|LOCUS_02950 6312 6917 gene locus_tag LOCUS_02960 6312 6917 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230536.1 protein_id gnl|my_center|LOCUS_02960 8620 6914 gene locus_tag LOCUS_02970 8620 6914 CDS product Mur ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021312.1 protein_id gnl|my_center|LOCUS_02970 11504 8631 gene locus_tag LOCUS_02980 gene cphA 11504 8631 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_02980 11815 14481 gene locus_tag LOCUS_02990 11815 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 15440 14523 gene locus_tag LOCUS_03000 gene cphB 15440 14523 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_03000 16657 15476 gene locus_tag LOCUS_03010 16657 15476 CDS product isoaspartyl dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B837 protein_id gnl|my_center|LOCUS_03010 16796 18871 gene locus_tag LOCUS_03020 16796 18871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143126.1 protein_id gnl|my_center|LOCUS_03020 19008 19703 gene locus_tag LOCUS_03030 19008 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 19733 20569 gene locus_tag LOCUS_03040 19733 20569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 22204 20651 gene locus_tag LOCUS_03050 22204 20651 CDS product peptidase S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_03050 22437 24023 gene locus_tag LOCUS_03060 22437 24023 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405135.1 protein_id gnl|my_center|LOCUS_03060 24020 24487 gene locus_tag LOCUS_03070 24020 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 24595 25005 gene locus_tag LOCUS_03080 gene yuxK 24595 25005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40761 protein_id gnl|my_center|LOCUS_03080 27135 25045 gene locus_tag LOCUS_03090 27135 25045 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405513.1 protein_id gnl|my_center|LOCUS_03090 27520 27200 gene locus_tag LOCUS_03100 27520 27200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 29099 27609 gene locus_tag LOCUS_03110 29099 27609 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_03110 29472 29131 gene locus_tag LOCUS_03120 29472 29131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 30759 29923 gene locus_tag LOCUS_03130 30759 29923 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815247.1 protein_id gnl|my_center|LOCUS_03130 30958 31029 gene locus_tag LOCUS_t00040 30958 31029 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31080 32054 gene locus_tag LOCUS_03140 gene prs 31080 32054 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D0 protein_id gnl|my_center|LOCUS_03140 32155 32805 gene locus_tag LOCUS_03150 gene rplY 32155 32805 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D1 protein_id gnl|my_center|LOCUS_03150 32810 33499 gene locus_tag LOCUS_03160 gene pth 32810 33499 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D2 protein_id gnl|my_center|LOCUS_03160 >Feature sequence010 1161 2198 gene locus_tag LOCUS_03170 1161 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2266 4356 gene locus_tag LOCUS_03180 2266 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5391 4375 gene locus_tag LOCUS_03190 5391 4375 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_03190 5938 5465 gene locus_tag LOCUS_03200 gene tadA 5938 5465 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q035W4 protein_id gnl|my_center|LOCUS_03200 5837 6085 gene locus_tag LOCUS_03210 5837 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7263 6013 gene locus_tag LOCUS_03220 7263 6013 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_03220 7471 7328 gene locus_tag LOCUS_03230 7471 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8856 7528 gene locus_tag LOCUS_03240 8856 7528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 9632 8877 gene locus_tag LOCUS_03250 gene truA 9632 8877 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4S9 protein_id gnl|my_center|LOCUS_03250 9622 10377 gene locus_tag LOCUS_03260 9622 10377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 10963 10370 gene locus_tag LOCUS_03270 gene rnhB 10963 10370 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S009 protein_id gnl|my_center|LOCUS_03270 11378 13372 gene locus_tag LOCUS_03280 11378 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 13518 14300 gene locus_tag LOCUS_03290 13518 14300 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S042 protein_id gnl|my_center|LOCUS_03290 14342 16201 gene locus_tag LOCUS_03300 14342 16201 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_03300 16413 17135 gene locus_tag LOCUS_03310 gene nfi 16413 17135 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYT9 protein_id gnl|my_center|LOCUS_03310 17236 18777 gene locus_tag LOCUS_03320 17236 18777 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405487.1 protein_id gnl|my_center|LOCUS_03320 19758 18901 gene locus_tag LOCUS_03330 gene cobB 19758 18901 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D8W3 protein_id gnl|my_center|LOCUS_03330 19841 20764 gene locus_tag LOCUS_03340 19841 20764 CDS product ribonucleotide-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259170.1 protein_id gnl|my_center|LOCUS_03340 20764 21336 gene locus_tag LOCUS_03350 20764 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 21426 21500 gene locus_tag LOCUS_t00050 21426 21500 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 22216 21491 gene locus_tag LOCUS_03360 22216 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 22201 26403 gene locus_tag LOCUS_03370 22201 26403 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766188.1 protein_id gnl|my_center|LOCUS_03370 26607 27782 gene locus_tag LOCUS_03380 26607 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 28085 28615 gene locus_tag LOCUS_03390 28085 28615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 28972 32343 gene locus_tag LOCUS_03400 28972 32343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 32426 32830 gene locus_tag LOCUS_03410 32426 32830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence011 488 138 gene locus_tag LOCUS_03420 488 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1273 485 gene locus_tag LOCUS_03430 1273 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2582 3391 gene locus_tag LOCUS_03440 2582 3391 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403722.1 protein_id gnl|my_center|LOCUS_03440 3391 3663 gene locus_tag LOCUS_03450 gene purS 3391 3663 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3Y6 protein_id gnl|my_center|LOCUS_03450 3660 4007 gene locus_tag LOCUS_03460 3660 4007 CDS product ATP-dependent Clp protease adaptor protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403724.1 protein_id gnl|my_center|LOCUS_03460 4008 4631 gene locus_tag LOCUS_03470 4008 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403937.1 protein_id gnl|my_center|LOCUS_03470 6630 4642 gene locus_tag LOCUS_03480 6630 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 7216 6620 gene locus_tag LOCUS_03490 7216 6620 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_03490 8091 7213 gene locus_tag LOCUS_03500 8091 7213 CDS product hemin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404045.1 protein_id gnl|my_center|LOCUS_03500 8090 8548 gene locus_tag LOCUS_03510 8090 8548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9437 8628 gene locus_tag LOCUS_03520 9437 8628 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405557.1 protein_id gnl|my_center|LOCUS_03520 10531 9434 gene locus_tag LOCUS_03530 10531 9434 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405047.1 protein_id gnl|my_center|LOCUS_03530 13943 10521 gene locus_tag LOCUS_03540 13943 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404554.1 protein_id gnl|my_center|LOCUS_03540 14673 16148 gene locus_tag LOCUS_03550 gene glgA 14673 16148 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CM04 protein_id gnl|my_center|LOCUS_03550 16376 17644 gene locus_tag LOCUS_03560 gene glgC 16376 17644 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404664.1 protein_id gnl|my_center|LOCUS_03560 18778 17753 gene locus_tag LOCUS_03570 18778 17753 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403976.1 protein_id gnl|my_center|LOCUS_03570 20322 18991 gene locus_tag LOCUS_03580 20322 18991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404551.1 protein_id gnl|my_center|LOCUS_03580 21086 21532 gene locus_tag LOCUS_03590 21086 21532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 22364 21642 gene locus_tag LOCUS_03600 22364 21642 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_03600 23879 22422 gene locus_tag LOCUS_03610 gene zwf 23879 22422 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6F0 protein_id gnl|my_center|LOCUS_03610 25469 23946 gene locus_tag LOCUS_03620 25469 23946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 27118 25562 gene locus_tag LOCUS_03630 27118 25562 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_03630 28249 27374 gene locus_tag LOCUS_03640 gene gdh 28249 27374 CDS product glucose-1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089920.1 protein_id gnl|my_center|LOCUS_03640 29099 28335 gene locus_tag LOCUS_03650 29099 28335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 29214 30362 gene locus_tag LOCUS_03660 29214 30362 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404932.1 protein_id gnl|my_center|LOCUS_03660 30362 30682 gene locus_tag LOCUS_03670 30362 30682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404931.1 protein_id gnl|my_center|LOCUS_03670 30686 32101 gene locus_tag LOCUS_03680 30686 32101 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H2 protein_id gnl|my_center|LOCUS_03680 >Feature sequence012 1998 2438 gene locus_tag LOCUS_03690 1998 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2435 3226 gene locus_tag LOCUS_03700 2435 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3372 4580 gene locus_tag LOCUS_03710 3372 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 4756 5835 gene locus_tag LOCUS_03720 4756 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 7492 5807 gene locus_tag LOCUS_03730 7492 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 8123 7548 gene locus_tag LOCUS_03740 gene folA 8123 7548 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5H3 protein_id gnl|my_center|LOCUS_03740 9105 8161 gene locus_tag LOCUS_03750 gene thyA 9105 8161 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EDZ2 protein_id gnl|my_center|LOCUS_03750 9179 9454 gene locus_tag LOCUS_03760 9179 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10173 9451 gene locus_tag LOCUS_03770 gene rpiA 10173 9451 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S577 protein_id gnl|my_center|LOCUS_03770 12616 10259 gene locus_tag LOCUS_03780 12616 10259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 13872 12658 gene locus_tag LOCUS_03790 13872 12658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405553.1 protein_id gnl|my_center|LOCUS_03790 15104 13878 gene locus_tag LOCUS_03800 gene ybjZ 15104 13878 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_03800 15206 15364 gene locus_tag LOCUS_03810 15206 15364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976110.1 protein_id gnl|my_center|LOCUS_03810 15407 17095 gene locus_tag LOCUS_03820 15407 17095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 17563 17105 gene locus_tag LOCUS_03830 17563 17105 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403288.1 protein_id gnl|my_center|LOCUS_03830 19685 17616 gene locus_tag LOCUS_03840 gene uvrd 19685 17616 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S575 protein_id gnl|my_center|LOCUS_03840 19817 21493 gene locus_tag LOCUS_03850 19817 21493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 22826 21498 gene locus_tag LOCUS_03860 22826 21498 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403202.1 protein_id gnl|my_center|LOCUS_03860 24847 22892 gene locus_tag LOCUS_03870 24847 22892 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403201.1 protein_id gnl|my_center|LOCUS_03870 25043 25828 gene locus_tag LOCUS_03880 25043 25828 CDS product photosystem I assembly BtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257265.1 protein_id gnl|my_center|LOCUS_03880 25880 26263 gene locus_tag LOCUS_03890 gene apaG 25880 26263 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403199.1 protein_id gnl|my_center|LOCUS_03890 27050 26349 gene locus_tag LOCUS_03900 27050 26349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 27893 27183 gene locus_tag LOCUS_03910 27893 27183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 28394 28035 gene locus_tag LOCUS_03920 28394 28035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 29944 28391 gene locus_tag LOCUS_03930 gene nnr 29944 28391 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S580 protein_id gnl|my_center|LOCUS_03930 31582 29945 gene locus_tag LOCUS_03940 31582 29945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403283.1 protein_id gnl|my_center|LOCUS_03940 >Feature sequence013 325 1137 gene locus_tag LOCUS_03950 325 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1140 1937 gene locus_tag LOCUS_03960 1140 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2766 1951 gene locus_tag LOCUS_03970 2766 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 2859 4076 gene locus_tag LOCUS_03980 2859 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 5096 4086 gene locus_tag LOCUS_03990 5096 4086 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_03990 5265 7940 gene locus_tag LOCUS_04000 5265 7940 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919020.1 protein_id gnl|my_center|LOCUS_04000 8100 9695 gene locus_tag LOCUS_04010 8100 9695 CDS product sodium/glucose cotransporter 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403134.1 protein_id gnl|my_center|LOCUS_04010 9708 11861 gene locus_tag LOCUS_04020 9708 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 12345 11938 gene locus_tag LOCUS_04030 12345 11938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 14381 12534 gene locus_tag LOCUS_04040 14381 12534 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_04040 14909 14460 gene locus_tag LOCUS_04050 14909 14460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 15104 14910 gene locus_tag LOCUS_04060 15104 14910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 15340 15747 gene locus_tag LOCUS_04070 15340 15747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 15836 17203 gene locus_tag LOCUS_04080 15836 17203 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000671775.1 protein_id gnl|my_center|LOCUS_04080 17923 17228 gene locus_tag LOCUS_04090 17923 17228 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038463.1 protein_id gnl|my_center|LOCUS_04090 19155 17920 gene locus_tag LOCUS_04100 gene coaBC 19155 17920 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402817.1 protein_id gnl|my_center|LOCUS_04100 19491 19162 gene locus_tag LOCUS_04110 19491 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402818.1 protein_id gnl|my_center|LOCUS_04110 19669 20418 gene locus_tag LOCUS_04120 gene etfB 19669 20418 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_04120 20461 21444 gene locus_tag LOCUS_04130 20461 21444 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027564.1 protein_id gnl|my_center|LOCUS_04130 21629 22960 gene locus_tag LOCUS_04140 gene fixC 21629 22960 CDS product protein FixC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z9K9 protein_id gnl|my_center|LOCUS_04140 22965 23282 gene locus_tag LOCUS_04150 22965 23282 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461371.1 protein_id gnl|my_center|LOCUS_04150 23363 24634 gene locus_tag LOCUS_04160 gene gcdH 23363 24634 CDS product glutaryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002055095.1 protein_id gnl|my_center|LOCUS_04160 25211 24645 gene locus_tag LOCUS_04170 gene gmk 25211 24645 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6J5 protein_id gnl|my_center|LOCUS_04170 26202 25285 gene locus_tag LOCUS_04180 26202 25285 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402820.1 protein_id gnl|my_center|LOCUS_04180 26686 27099 gene locus_tag LOCUS_04190 26686 27099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 27870 27121 gene locus_tag LOCUS_04200 27870 27121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405193.1 protein_id gnl|my_center|LOCUS_04200 29198 27882 gene locus_tag LOCUS_04210 29198 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405190.1 protein_id gnl|my_center|LOCUS_04210 29095 29484 gene locus_tag LOCUS_04220 29095 29484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 29804 29714 gene locus_tag LOCUS_t00060 29804 29714 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 30467 29898 gene locus_tag LOCUS_04230 gene frr 30467 29898 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6J3 protein_id gnl|my_center|LOCUS_04230 >Feature sequence014 3044 324 gene locus_tag LOCUS_04240 3044 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 3184 3456 gene locus_tag LOCUS_04250 3184 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3601 4023 gene locus_tag LOCUS_04260 3601 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 7884 4084 gene locus_tag LOCUS_04270 7884 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 8353 10683 gene locus_tag LOCUS_04280 8353 10683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 10938 12251 gene locus_tag LOCUS_04290 10938 12251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 12288 12917 gene locus_tag LOCUS_04300 12288 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 13856 12930 gene locus_tag LOCUS_04310 13856 12930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 13950 14894 gene locus_tag LOCUS_04320 13950 14894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 14899 17436 gene locus_tag LOCUS_04330 14899 17436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 19360 17546 gene locus_tag LOCUS_04340 19360 17546 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205060.1 protein_id gnl|my_center|LOCUS_04340 20821 19445 gene locus_tag LOCUS_04350 20821 19445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 22125 20875 gene locus_tag LOCUS_04360 22125 20875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 23192 22152 gene locus_tag LOCUS_04370 23192 22152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 25383 23221 gene locus_tag LOCUS_04380 25383 23221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 28622 25452 gene locus_tag LOCUS_04390 28622 25452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 <30456 28756 gene locus_tag LOCUS_04400 <30456 28756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405242.1:glucosamine-6-phosphate deaminase >Feature sequence015 347 1516 gene locus_tag LOCUS_04410 347 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2585 1620 gene locus_tag LOCUS_04420 2585 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2979 2578 gene locus_tag LOCUS_04430 2979 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228843.1 protein_id gnl|my_center|LOCUS_04430 5174 3048 gene locus_tag LOCUS_04440 5174 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 5296 6015 gene locus_tag LOCUS_04450 5296 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 6025 7734 gene locus_tag LOCUS_04460 6025 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 7786 8250 gene locus_tag LOCUS_04470 7786 8250 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531248.1 protein_id gnl|my_center|LOCUS_04470 8279 9109 gene locus_tag LOCUS_04480 8279 9109 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_04480 9255 9731 gene locus_tag LOCUS_04490 9255 9731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 11403 9745 gene locus_tag LOCUS_04500 11403 9745 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088817.1 protein_id gnl|my_center|LOCUS_04500 11733 13094 gene locus_tag LOCUS_04510 11733 13094 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000778115.1 protein_id gnl|my_center|LOCUS_04510 14939 13269 gene locus_tag LOCUS_04520 14939 13269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 15046 17556 gene locus_tag LOCUS_04530 gene hrpB 15046 17556 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_04530 18503 17553 gene locus_tag LOCUS_04540 gene uvsE 18503 17553 CDS product UV DNA damage endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45864 protein_id gnl|my_center|LOCUS_04540 18596 19147 gene locus_tag LOCUS_04550 18596 19147 CDS product putative cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P48636 protein_id gnl|my_center|LOCUS_04550 19151 20797 gene locus_tag LOCUS_04560 19151 20797 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804130.1 protein_id gnl|my_center|LOCUS_04560 20896 21666 gene locus_tag LOCUS_04570 20896 21666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 23298 21730 gene locus_tag LOCUS_04580 23298 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 26286 23359 gene locus_tag LOCUS_04590 26286 23359 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921413.1 protein_id gnl|my_center|LOCUS_04590 28456 26465 gene locus_tag LOCUS_04600 28456 26465 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198575.1 protein_id gnl|my_center|LOCUS_04600 <30348 28674 gene locus_tag LOCUS_04610 <30348 28674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S2B6:alanine--tRNA ligase >Feature sequence016 4170 1159 gene locus_tag LOCUS_04620 4170 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7001 4494 gene locus_tag LOCUS_04630 7001 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 7633 7052 gene locus_tag LOCUS_04640 7633 7052 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_04640 7829 8341 gene locus_tag LOCUS_04650 7829 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 9407 8367 gene locus_tag LOCUS_04660 gene glpQ 9407 8367 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102904.1 protein_id gnl|my_center|LOCUS_04660 11952 9412 gene locus_tag LOCUS_04670 11952 9412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 12539 11949 gene locus_tag LOCUS_04680 12539 11949 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144059.1 protein_id gnl|my_center|LOCUS_04680 14448 12646 gene locus_tag LOCUS_04690 14448 12646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 14824 14441 gene locus_tag LOCUS_04700 14824 14441 CDS product BlaI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403946.1 protein_id gnl|my_center|LOCUS_04700 16308 14953 gene locus_tag LOCUS_04710 16308 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 17158 16427 gene locus_tag LOCUS_04720 17158 16427 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_04720 18040 17174 gene locus_tag LOCUS_04730 18040 17174 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403948.1 protein_id gnl|my_center|LOCUS_04730 18398 18072 gene locus_tag LOCUS_04740 18398 18072 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404552.1 protein_id gnl|my_center|LOCUS_04740 18493 20013 gene locus_tag LOCUS_04750 18493 20013 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802904.1 protein_id gnl|my_center|LOCUS_04750 20096 20314 gene locus_tag LOCUS_04760 20096 20314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 20376 21401 gene locus_tag LOCUS_04770 20376 21401 CDS product putative 2-aminoethylphosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813124.1 protein_id gnl|my_center|LOCUS_04770 22602 21427 gene locus_tag LOCUS_04780 22602 21427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 22971 23339 gene locus_tag LOCUS_04790 gene crcB 22971 23339 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHY7 protein_id gnl|my_center|LOCUS_04790 23681 23406 gene locus_tag LOCUS_04800 23681 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405232.1 protein_id gnl|my_center|LOCUS_04800 23960 23730 gene locus_tag LOCUS_04810 23960 23730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 24118 25203 gene locus_tag LOCUS_04820 24118 25203 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405231.1 protein_id gnl|my_center|LOCUS_04820 25779 25210 gene locus_tag LOCUS_04830 25779 25210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 27407 25836 gene locus_tag LOCUS_04840 27407 25836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 27978 27412 gene locus_tag LOCUS_04850 27978 27412 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_04850 <29477 27989 gene locus_tag LOCUS_04860 <29477 27989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405097.1:AMP-binding protein >Feature sequence017 <1 759 gene locus_tag LOCUS_04870 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403927.1:alpha-ketoglutarate decarboxylase 1068 871 gene locus_tag LOCUS_04880 1068 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 1284 1445 gene locus_tag LOCUS_04890 1284 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 1659 1973 gene locus_tag LOCUS_04900 1659 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403301.1 protein_id gnl|my_center|LOCUS_04900 2017 2916 gene locus_tag LOCUS_04910 2017 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403302.1 protein_id gnl|my_center|LOCUS_04910 2982 3542 gene locus_tag LOCUS_04920 gene udk 2982 3542 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S561 protein_id gnl|my_center|LOCUS_04920 4343 3567 gene locus_tag LOCUS_04930 gene coaX 4343 3567 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S560 protein_id gnl|my_center|LOCUS_04930 5044 4343 gene locus_tag LOCUS_04940 5044 4343 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403305.1 protein_id gnl|my_center|LOCUS_04940 7219 5129 gene locus_tag LOCUS_04950 7219 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8175 7360 gene locus_tag LOCUS_04960 8175 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 9076 8180 gene locus_tag LOCUS_04970 9076 8180 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S167 protein_id gnl|my_center|LOCUS_04970 10688 9138 gene locus_tag LOCUS_04980 10688 9138 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403298.1 protein_id gnl|my_center|LOCUS_04980 10816 11526 gene locus_tag LOCUS_04990 10816 11526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 11614 13377 gene locus_tag LOCUS_05000 gene ggt 11614 13377 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403657.1 protein_id gnl|my_center|LOCUS_05000 13656 15950 gene locus_tag LOCUS_05010 13656 15950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 16066 18312 gene locus_tag LOCUS_05020 16066 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 18430 20112 gene locus_tag LOCUS_05030 18430 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 20130 23063 gene locus_tag LOCUS_05040 20130 23063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 23139 24155 gene locus_tag LOCUS_05050 23139 24155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 24247 24414 gene locus_tag LOCUS_05060 24247 24414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 24415 25599 gene locus_tag LOCUS_05070 24415 25599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 26269 26445 gene locus_tag LOCUS_05080 26269 26445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 26486 26887 gene locus_tag LOCUS_05090 26486 26887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 27209 27571 gene locus_tag LOCUS_05100 27209 27571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978731.1 protein_id gnl|my_center|LOCUS_05100 28065 28631 gene locus_tag LOCUS_05110 28065 28631 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225832.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence018 79 1524 gene locus_tag LOCUS_05120 79 1524 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403105.1 protein_id gnl|my_center|LOCUS_05120 1587 1829 gene locus_tag LOCUS_05130 1587 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1826 2626 gene locus_tag LOCUS_05140 1826 2626 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5Q8 protein_id gnl|my_center|LOCUS_05140 2683 2985 gene locus_tag LOCUS_05150 2683 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 2997 3317 gene locus_tag LOCUS_05160 2997 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3324 4169 gene locus_tag LOCUS_05170 3324 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 4282 5253 gene locus_tag LOCUS_05180 4282 5253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530666.1 protein_id gnl|my_center|LOCUS_05180 5308 5790 gene locus_tag LOCUS_05190 5308 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 5821 6234 gene locus_tag LOCUS_05200 5821 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05200 7488 6541 gene locus_tag LOCUS_05210 7488 6541 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_05210 7788 8375 gene locus_tag LOCUS_05220 7788 8375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 8409 8978 gene locus_tag LOCUS_05230 8409 8978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 9002 10333 gene locus_tag LOCUS_05240 9002 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 10393 10650 gene locus_tag LOCUS_05250 10393 10650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 10849 12351 gene locus_tag LOCUS_05260 gene leuB 10849 12351 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_05260 13326 12427 gene locus_tag LOCUS_05270 13326 12427 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_05270 14290 13634 gene locus_tag LOCUS_05280 14290 13634 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_05280 15939 14326 gene locus_tag LOCUS_05290 15939 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 17246 16026 gene locus_tag LOCUS_05300 17246 16026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 18231 17278 gene locus_tag LOCUS_05310 18231 17278 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404066.1 protein_id gnl|my_center|LOCUS_05310 19591 18596 gene locus_tag LOCUS_05320 19591 18596 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403447.1 protein_id gnl|my_center|LOCUS_05320 19816 20694 gene locus_tag LOCUS_05330 19816 20694 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404067.1 protein_id gnl|my_center|LOCUS_05330 20700 21719 gene locus_tag LOCUS_05340 20700 21719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227284.1 protein_id gnl|my_center|LOCUS_05340 21754 22722 gene locus_tag LOCUS_05350 21754 22722 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404481.1 protein_id gnl|my_center|LOCUS_05350 22803 24797 gene locus_tag LOCUS_05360 22803 24797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 25217 24819 gene locus_tag LOCUS_05370 25217 24819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 27290 25302 gene locus_tag LOCUS_05380 gene acsA1 27290 25302 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92KX2 protein_id gnl|my_center|LOCUS_05380 28155 27460 gene locus_tag LOCUS_05390 28155 27460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 28039 28338 gene locus_tag LOCUS_05400 28039 28338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 <29263 28404 gene locus_tag LOCUS_05410 <29263 28404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403664.1:alanine dehydrogenase >Feature sequence019 2202 1099 gene locus_tag LOCUS_05420 2202 1099 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_05420 2990 2199 gene locus_tag LOCUS_05430 gene argB 2990 2199 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404945.1 protein_id gnl|my_center|LOCUS_05430 4011 2983 gene locus_tag LOCUS_05440 4011 2983 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404944.1 protein_id gnl|my_center|LOCUS_05440 5186 4008 gene locus_tag LOCUS_05450 gene argD 5186 4008 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0F9 protein_id gnl|my_center|LOCUS_05450 6380 5289 gene locus_tag LOCUS_05460 gene argC 6380 5289 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G0 protein_id gnl|my_center|LOCUS_05460 7498 6377 gene locus_tag LOCUS_05470 7498 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_05470 8923 7619 gene locus_tag LOCUS_05480 gene argG 8923 7619 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G2 protein_id gnl|my_center|LOCUS_05480 11500 9167 gene locus_tag LOCUS_05490 11500 9167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945803.1 protein_id gnl|my_center|LOCUS_05490 13781 11871 gene locus_tag LOCUS_05500 gene pepN 13781 11871 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038579.1 protein_id gnl|my_center|LOCUS_05500 15125 14106 gene locus_tag LOCUS_05510 15125 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 15911 15201 gene locus_tag LOCUS_05520 15911 15201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 16227 19337 gene locus_tag LOCUS_05530 16227 19337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403195.1 protein_id gnl|my_center|LOCUS_05530 20439 19825 gene locus_tag LOCUS_05540 gene ribE 20439 19825 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405026.1 protein_id gnl|my_center|LOCUS_05540 21714 20560 gene locus_tag LOCUS_05550 gene ribD 21714 20560 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S076 protein_id gnl|my_center|LOCUS_05550 22349 21711 gene locus_tag LOCUS_05560 22349 21711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 22413 23204 gene locus_tag LOCUS_05570 22413 23204 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405024.1 protein_id gnl|my_center|LOCUS_05570 23282 23356 gene locus_tag LOCUS_t00070 23282 23356 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 25140 23539 gene locus_tag LOCUS_05580 gene lysS 25140 23539 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S442 protein_id gnl|my_center|LOCUS_05580 25834 25235 gene locus_tag LOCUS_05590 25834 25235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 26937 25942 gene locus_tag LOCUS_05600 26937 25942 CDS product NADP oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_05600 27742 26960 gene locus_tag LOCUS_05610 27742 26960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence020 2113 212 gene locus_tag LOCUS_05620 2113 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 2384 4258 gene locus_tag LOCUS_05630 2384 4258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 4460 7414 gene locus_tag LOCUS_05640 gene uvrA 4460 7414 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5D7 protein_id gnl|my_center|LOCUS_05640 7799 7425 gene locus_tag LOCUS_05650 7799 7425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 7893 8717 gene locus_tag LOCUS_05660 7893 8717 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_05660 9227 8721 gene locus_tag LOCUS_05670 9227 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 9406 11163 gene locus_tag LOCUS_05680 gene pyrG 9406 11163 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S538 protein_id gnl|my_center|LOCUS_05680 11173 11670 gene locus_tag LOCUS_05690 11173 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 11725 12966 gene locus_tag LOCUS_05700 11725 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403742.1 protein_id gnl|my_center|LOCUS_05700 13702 13016 gene locus_tag LOCUS_05710 13702 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 13949 14404 gene locus_tag LOCUS_05720 gene mraZ 13949 14404 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S536 protein_id gnl|my_center|LOCUS_05720 14419 15492 gene locus_tag LOCUS_05730 gene rsmH 14419 15492 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S535 protein_id gnl|my_center|LOCUS_05730 15489 16088 gene locus_tag LOCUS_05740 15489 16088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 16173 18329 gene locus_tag LOCUS_05750 16173 18329 CDS product penicillin-binding protein 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403331.1 protein_id gnl|my_center|LOCUS_05750 18326 19897 gene locus_tag LOCUS_05760 gene murE 18326 19897 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S532 protein_id gnl|my_center|LOCUS_05760 19897 21051 gene locus_tag LOCUS_05770 gene mraY 19897 21051 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S531 protein_id gnl|my_center|LOCUS_05770 21048 22487 gene locus_tag LOCUS_05780 gene murD 21048 22487 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S530 protein_id gnl|my_center|LOCUS_05780 22492 23637 gene locus_tag LOCUS_05790 22492 23637 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403335.1 protein_id gnl|my_center|LOCUS_05790 23717 24868 gene locus_tag LOCUS_05800 gene murG 23717 24868 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S528 protein_id gnl|my_center|LOCUS_05800 24895 26364 gene locus_tag LOCUS_05810 gene murC 24895 26364 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_05810 26361 27173 gene locus_tag LOCUS_05820 gene ftsQ 26361 27173 CDS product cell division protein FtsQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S526 protein_id gnl|my_center|LOCUS_05820 >Feature sequence021 1081 191 gene locus_tag LOCUS_05830 1081 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2026 1178 gene locus_tag LOCUS_05840 2026 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05840 3339 2023 gene locus_tag LOCUS_05850 3339 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4403 3336 gene locus_tag LOCUS_05860 4403 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5485 4403 gene locus_tag LOCUS_05870 5485 4403 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404246.1 protein_id gnl|my_center|LOCUS_05870 6948 5482 gene locus_tag LOCUS_05880 gene guaB 6948 5482 CDS product inosine-5'-monophosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G2 protein_id gnl|my_center|LOCUS_05880 7810 6977 gene locus_tag LOCUS_05890 7810 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 8486 7842 gene locus_tag LOCUS_05900 gene scpB 8486 7842 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G4 protein_id gnl|my_center|LOCUS_05900 9196 8483 gene locus_tag LOCUS_05910 gene scpA 9196 8483 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1P3 protein_id gnl|my_center|LOCUS_05910 10192 9230 gene locus_tag LOCUS_05920 10192 9230 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_05920 10291 10647 gene locus_tag LOCUS_05930 10291 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 11901 10654 gene locus_tag LOCUS_05940 11901 10654 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_05940 13405 11939 gene locus_tag LOCUS_05950 13405 11939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 15493 13481 gene locus_tag LOCUS_05960 15493 13481 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404477.1 protein_id gnl|my_center|LOCUS_05960 16965 15634 gene locus_tag LOCUS_05970 gene vicK 16965 15634 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404564.1 protein_id gnl|my_center|LOCUS_05970 18343 17054 gene locus_tag LOCUS_05980 gene purA 18343 17054 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1J1 protein_id gnl|my_center|LOCUS_05980 18782 18372 gene locus_tag LOCUS_05990 18782 18372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 19731 18814 gene locus_tag LOCUS_06000 gene secF 19731 18814 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1J0 protein_id gnl|my_center|LOCUS_06000 21835 19850 gene locus_tag LOCUS_06010 gene secD 21835 19850 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1I9 protein_id gnl|my_center|LOCUS_06010 22400 21915 gene locus_tag LOCUS_06020 22400 21915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 22775 22497 gene locus_tag LOCUS_06030 22775 22497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_06030 22875 23705 gene locus_tag LOCUS_06040 22875 23705 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533881.1 protein_id gnl|my_center|LOCUS_06040 23779 23705 gene locus_tag LOCUS_t00080 23779 23705 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 23910 25211 gene locus_tag LOCUS_06050 23910 25211 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391408.1 protein_id gnl|my_center|LOCUS_06050 25238 26356 gene locus_tag LOCUS_06060 25238 26356 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404840.1 protein_id gnl|my_center|LOCUS_06060 26452 27207 gene locus_tag LOCUS_06070 26452 27207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404841.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence022 201 407 gene locus_tag LOCUS_06080 201 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 574 389 gene locus_tag LOCUS_06090 574 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 641 1825 gene locus_tag LOCUS_06100 641 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 1880 3223 gene locus_tag LOCUS_06110 1880 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403554.1 protein_id gnl|my_center|LOCUS_06110 3273 4718 gene locus_tag LOCUS_06120 3273 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 5846 4794 gene locus_tag LOCUS_06130 5846 4794 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_06130 6079 7521 gene locus_tag LOCUS_06140 gene trkH1 6079 7521 CDS product potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404993.1 protein_id gnl|my_center|LOCUS_06140 7546 8205 gene locus_tag LOCUS_06150 7546 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 8279 8491 gene locus_tag LOCUS_06160 8279 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 10311 8488 gene locus_tag LOCUS_06170 gene ptsI 10311 8488 CDS product phosphoenolpyruvate-protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1E7 protein_id gnl|my_center|LOCUS_06170 10583 10314 gene locus_tag LOCUS_06180 10583 10314 CDS product phosphocarrier protein HPr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_06180 11648 10662 gene locus_tag LOCUS_06190 gene idsA 11648 10662 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404611.1 protein_id gnl|my_center|LOCUS_06190 12310 11660 gene locus_tag LOCUS_06200 gene adk 12310 11660 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1E4 protein_id gnl|my_center|LOCUS_06200 13010 12354 gene locus_tag LOCUS_06210 13010 12354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 13555 13016 gene locus_tag LOCUS_06220 13555 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 13696 13965 gene locus_tag LOCUS_06230 13696 13965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 16574 13962 gene locus_tag LOCUS_06240 16574 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 17605 16916 gene locus_tag LOCUS_06250 17605 16916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 19358 17724 gene locus_tag LOCUS_06260 gene betA 19358 17724 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230760.1 protein_id gnl|my_center|LOCUS_06260 21513 19417 gene locus_tag LOCUS_06270 21513 19417 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404295.1 protein_id gnl|my_center|LOCUS_06270 21628 22452 gene locus_tag LOCUS_06280 21628 22452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 23634 22462 gene locus_tag LOCUS_06290 23634 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 25026 23743 gene locus_tag LOCUS_06300 25026 23743 CDS product vitamin K epoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404406.1 protein_id gnl|my_center|LOCUS_06300 25197 26414 gene locus_tag LOCUS_06310 gene hutI 25197 26414 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3MEH1 protein_id gnl|my_center|LOCUS_06310 26904 26569 gene locus_tag LOCUS_06320 26904 26569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence023 <1 996 gene locus_tag LOCUS_06330 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403996.1:peptidase M16 1000 3153 gene locus_tag LOCUS_06340 gene ymxG 1000 3153 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403997.1 protein_id gnl|my_center|LOCUS_06340 3231 3944 gene locus_tag LOCUS_06350 3231 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 4485 3976 gene locus_tag LOCUS_06360 4485 3976 CDS product general stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036864.1 protein_id gnl|my_center|LOCUS_06360 5896 4628 gene locus_tag LOCUS_06370 gene lpdA 5896 4628 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S257 protein_id gnl|my_center|LOCUS_06370 7400 6246 gene locus_tag LOCUS_06380 7400 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 8741 7581 gene locus_tag LOCUS_06390 8741 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 9132 9461 gene locus_tag LOCUS_06400 9132 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 11048 9543 gene locus_tag LOCUS_06410 11048 9543 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404524.1 protein_id gnl|my_center|LOCUS_06410 11152 12381 gene locus_tag LOCUS_06420 gene aspB 11152 12381 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N3 protein_id gnl|my_center|LOCUS_06420 12421 14763 gene locus_tag LOCUS_06430 12421 14763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 14928 15581 gene locus_tag LOCUS_06440 14928 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 15630 16733 gene locus_tag LOCUS_06450 gene prfB 15630 16733 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N4 protein_id gnl|my_center|LOCUS_06450 16801 17184 gene locus_tag LOCUS_06460 16801 17184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 17237 18850 gene locus_tag LOCUS_06470 gene nadB 17237 18850 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KEX1 protein_id gnl|my_center|LOCUS_06470 19035 19703 gene locus_tag LOCUS_06480 19035 19703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 20791 19733 gene locus_tag LOCUS_06490 20791 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403825.1 protein_id gnl|my_center|LOCUS_06490 21915 20788 gene locus_tag LOCUS_06500 21915 20788 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404620.1 protein_id gnl|my_center|LOCUS_06500 21945 23156 gene locus_tag LOCUS_06510 21945 23156 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_06510 23140 24597 gene locus_tag LOCUS_06520 gene pepA 23140 24597 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GB4 protein_id gnl|my_center|LOCUS_06520 24594 25604 gene locus_tag LOCUS_06530 gene pdxA 24594 25604 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3U3 protein_id gnl|my_center|LOCUS_06530 25809 26555 gene locus_tag LOCUS_06540 25809 26555 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873069.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence024 399 1247 gene locus_tag LOCUS_06550 399 1247 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973592.1 protein_id gnl|my_center|LOCUS_06550 1252 1704 gene locus_tag LOCUS_06560 1252 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1759 2247 gene locus_tag LOCUS_06570 gene msrB 1759 2247 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q6 protein_id gnl|my_center|LOCUS_06570 5229 2443 gene locus_tag LOCUS_06580 5229 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 6107 5328 gene locus_tag LOCUS_06590 6107 5328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7892 6375 gene locus_tag LOCUS_06600 7892 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8217 10142 gene locus_tag LOCUS_06610 8217 10142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 10147 10581 gene locus_tag LOCUS_06620 10147 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 10598 10786 gene locus_tag LOCUS_06630 10598 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11086 11571 gene locus_tag LOCUS_06640 gene msrB 11086 11571 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P4Q6 protein_id gnl|my_center|LOCUS_06640 13269 11581 gene locus_tag LOCUS_06650 13269 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 14375 13368 gene locus_tag LOCUS_06660 14375 13368 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978272.1 protein_id gnl|my_center|LOCUS_06660 16019 14391 gene locus_tag LOCUS_06670 16019 14391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142737.1 protein_id gnl|my_center|LOCUS_06670 16280 16065 gene locus_tag LOCUS_06680 16280 16065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 17735 16389 gene locus_tag LOCUS_06690 17735 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 17990 18547 gene locus_tag LOCUS_06700 17990 18547 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141092.1 protein_id gnl|my_center|LOCUS_06700 18552 21155 gene locus_tag LOCUS_06710 18552 21155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 23314 21182 gene locus_tag LOCUS_06720 23314 21182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 23624 23391 gene locus_tag LOCUS_06730 23624 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 24242 23706 gene locus_tag LOCUS_06740 24242 23706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 24478 24738 gene locus_tag LOCUS_06750 gene rpmE 24478 24738 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3E3 protein_id gnl|my_center|LOCUS_06750 25846 24815 gene locus_tag LOCUS_06760 gene fadB5 25846 24815 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409570.1 protein_id gnl|my_center|LOCUS_06760 26354 25899 gene locus_tag LOCUS_06770 26354 25899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 >Feature sequence025 1356 454 gene locus_tag LOCUS_06780 1356 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 3692 1359 gene locus_tag LOCUS_06790 3692 1359 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404901.1 protein_id gnl|my_center|LOCUS_06790 3886 5592 gene locus_tag LOCUS_06800 3886 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 6786 5617 gene locus_tag LOCUS_06810 6786 5617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 6881 7525 gene locus_tag LOCUS_06820 6881 7525 CDS product CDP-alcohol phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404899.1 protein_id gnl|my_center|LOCUS_06820 7714 8679 gene locus_tag LOCUS_06830 gene ftsY 7714 8679 CDS product signal recognition particle receptor FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0K4 protein_id gnl|my_center|LOCUS_06830 8901 10283 gene locus_tag LOCUS_06840 8901 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 10283 10618 gene locus_tag LOCUS_06850 10283 10618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 10654 11679 gene locus_tag LOCUS_06860 gene fmt 10654 11679 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0K5 protein_id gnl|my_center|LOCUS_06860 11676 12701 gene locus_tag LOCUS_06870 11676 12701 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_06870 12790 13821 gene locus_tag LOCUS_06880 gene hprK 12790 13821 CDS product HPr kinase/phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0K7 protein_id gnl|my_center|LOCUS_06880 14140 15123 gene locus_tag LOCUS_06890 14140 15123 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404894.1 protein_id gnl|my_center|LOCUS_06890 15258 15476 gene locus_tag LOCUS_06900 15258 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_06900 15746 15492 gene locus_tag LOCUS_06910 15746 15492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 17304 15925 gene locus_tag LOCUS_06920 17304 15925 CDS product umuC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405594.1 protein_id gnl|my_center|LOCUS_06920 17819 17307 gene locus_tag LOCUS_06930 17819 17307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 18065 18667 gene locus_tag LOCUS_06940 18065 18667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 18615 20537 gene locus_tag LOCUS_06950 18615 20537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 20540 21739 gene locus_tag LOCUS_06960 20540 21739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 22226 21726 gene locus_tag LOCUS_06970 22226 21726 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_06970 23671 22394 gene locus_tag LOCUS_06980 23671 22394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 23746 24090 gene locus_tag LOCUS_06990 23746 24090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 24195 25478 gene locus_tag LOCUS_07000 24195 25478 CDS product NAD(FAD)-utilizing dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385531.1 protein_id gnl|my_center|LOCUS_07000 26770 25745 gene locus_tag LOCUS_07010 26770 25745 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence026 373 1668 gene locus_tag LOCUS_07020 373 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3356 1665 gene locus_tag LOCUS_07030 3356 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3506 4762 gene locus_tag LOCUS_07040 gene ribBA 3506 4762 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KC35 protein_id gnl|my_center|LOCUS_07040 5396 4839 gene locus_tag LOCUS_07050 5396 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 6454 5393 gene locus_tag LOCUS_07060 gene trxB 6454 5393 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ75 protein_id gnl|my_center|LOCUS_07060 6871 6536 gene locus_tag LOCUS_07070 gene trx 6871 6536 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ76 protein_id gnl|my_center|LOCUS_07070 7063 9204 gene locus_tag LOCUS_07080 7063 9204 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403635.1 protein_id gnl|my_center|LOCUS_07080 9361 9597 gene locus_tag LOCUS_07090 gene acpP 9361 9597 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYY5 protein_id gnl|my_center|LOCUS_07090 9744 11018 gene locus_tag LOCUS_07100 gene fabF 9744 11018 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYY6 protein_id gnl|my_center|LOCUS_07100 11078 11668 gene locus_tag LOCUS_07110 11078 11668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11819 14029 gene locus_tag LOCUS_07120 11819 14029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 14152 15501 gene locus_tag LOCUS_07130 14152 15501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 15554 15907 gene locus_tag LOCUS_07140 15554 15907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 15989 19594 gene locus_tag LOCUS_07150 15989 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 19603 20040 gene locus_tag LOCUS_07160 19603 20040 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_07160 20052 21335 gene locus_tag LOCUS_07170 20052 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 21695 21405 gene locus_tag LOCUS_07180 21695 21405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 21754 23061 gene locus_tag LOCUS_07190 21754 23061 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142597.1 protein_id gnl|my_center|LOCUS_07190 23076 23660 gene locus_tag LOCUS_07200 23076 23660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 24301 23657 gene locus_tag LOCUS_07210 24301 23657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 24490 24900 gene locus_tag LOCUS_07220 24490 24900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 25328 24882 gene locus_tag LOCUS_07230 gene yhfO 25328 24882 CDS product putative N-acetyltransferase YhfO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07614 protein_id gnl|my_center|LOCUS_07230 26204 25332 gene locus_tag LOCUS_07240 26204 25332 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403322.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence027 267 719 gene locus_tag LOCUS_07250 267 719 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405066.1 protein_id gnl|my_center|LOCUS_07250 791 1681 gene locus_tag LOCUS_07260 791 1681 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404104.1 protein_id gnl|my_center|LOCUS_07260 1682 2578 gene locus_tag LOCUS_07270 1682 2578 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228350.1 protein_id gnl|my_center|LOCUS_07270 2654 4741 gene locus_tag LOCUS_07280 2654 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4810 6195 gene locus_tag LOCUS_07290 4810 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7198 6386 gene locus_tag LOCUS_07300 7198 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 7547 7125 gene locus_tag LOCUS_07310 7547 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 9169 7586 gene locus_tag LOCUS_07320 9169 7586 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205060.1 protein_id gnl|my_center|LOCUS_07320 9400 10323 gene locus_tag LOCUS_07330 gene rnz 9400 10323 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0L2 protein_id gnl|my_center|LOCUS_07330 10445 12316 gene locus_tag LOCUS_07340 10445 12316 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404889.1 protein_id gnl|my_center|LOCUS_07340 12381 13124 gene locus_tag LOCUS_07350 12381 13124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 13344 13658 gene locus_tag LOCUS_07360 13344 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 13639 14079 gene locus_tag LOCUS_07370 13639 14079 CDS product ArsC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405173.1 protein_id gnl|my_center|LOCUS_07370 14076 14597 gene locus_tag LOCUS_07380 14076 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 14627 14989 gene locus_tag LOCUS_07390 14627 14989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 15141 16529 gene locus_tag LOCUS_07400 gene tig 15141 16529 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RU46 protein_id gnl|my_center|LOCUS_07400 16705 17427 gene locus_tag LOCUS_07410 gene clpP2 16705 17427 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ59 protein_id gnl|my_center|LOCUS_07410 17704 17970 gene locus_tag LOCUS_07420 17704 17970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 19067 17964 gene locus_tag LOCUS_07430 gene thiL 19067 17964 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZV6 protein_id gnl|my_center|LOCUS_07430 20326 19160 gene locus_tag LOCUS_07440 gene anmK 20326 19160 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZV7 protein_id gnl|my_center|LOCUS_07440 20946 20368 gene locus_tag LOCUS_07450 20946 20368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 22383 21028 gene locus_tag LOCUS_07460 22383 21028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 23873 22419 gene locus_tag LOCUS_07470 23873 22419 CDS product glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405140.1 protein_id gnl|my_center|LOCUS_07470 24388 23870 gene locus_tag LOCUS_07480 24388 23870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405363.1 protein_id gnl|my_center|LOCUS_07480 25715 24381 gene locus_tag LOCUS_07490 gene atoC 25715 24381 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405362.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence028 <1 1284 gene locus_tag LOCUS_07500 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942951.1:histidine kinase 1281 1994 gene locus_tag LOCUS_07510 1281 1994 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_07510 4918 2222 gene locus_tag LOCUS_07520 4918 2222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_07520 5630 5239 gene locus_tag LOCUS_tm00010 5630 5239 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6732 5713 gene locus_tag LOCUS_07530 6732 5713 CDS product mammalian cell entry protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405215.1 protein_id gnl|my_center|LOCUS_07530 7510 6755 gene locus_tag LOCUS_07540 7510 6755 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_07540 8354 7515 gene locus_tag LOCUS_07550 8354 7515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_07550 8511 9920 gene locus_tag LOCUS_07560 gene radA 8511 9920 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN3 protein_id gnl|my_center|LOCUS_07560 10582 10010 gene locus_tag LOCUS_07570 10582 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 10666 11616 gene locus_tag LOCUS_07580 10666 11616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_07580 11621 12349 gene locus_tag LOCUS_07590 gene recX 11621 12349 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31575 protein_id gnl|my_center|LOCUS_07590 12462 13295 gene locus_tag LOCUS_07600 gene deoD 12462 13295 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P3 protein_id gnl|my_center|LOCUS_07600 13370 15052 gene locus_tag LOCUS_07610 13370 15052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 16697 15072 gene locus_tag LOCUS_07620 16697 15072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 18163 16694 gene locus_tag LOCUS_07630 18163 16694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 19168 18218 gene locus_tag LOCUS_07640 19168 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 20535 19165 gene locus_tag LOCUS_07650 gene hslU 20535 19165 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S217 protein_id gnl|my_center|LOCUS_07650 21685 20732 gene locus_tag LOCUS_07660 21685 20732 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404389.1 protein_id gnl|my_center|LOCUS_07660 22299 21760 gene locus_tag LOCUS_07670 gene hslV 22299 21760 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S219 protein_id gnl|my_center|LOCUS_07670 23928 22447 gene locus_tag LOCUS_07680 gene dacB 23928 22447 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404492.1 protein_id gnl|my_center|LOCUS_07680 24875 23997 gene locus_tag LOCUS_07690 24875 23997 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404387.1 protein_id gnl|my_center|LOCUS_07690 <25657 24951 gene locus_tag LOCUS_07700 <25657 24951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404386.1:rod shape-determining protein >Feature sequence029 483 52 gene locus_tag LOCUS_07710 483 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07710 1205 495 gene locus_tag LOCUS_07720 gene nuoC 1205 495 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5J1 protein_id gnl|my_center|LOCUS_07720 1831 1208 gene locus_tag LOCUS_07730 gene nuoB 1831 1208 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5J2 protein_id gnl|my_center|LOCUS_07730 2326 1949 gene locus_tag LOCUS_07740 gene nuoA 2326 1949 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5J3 protein_id gnl|my_center|LOCUS_07740 3754 2603 gene locus_tag LOCUS_07750 gene dnaN 3754 2603 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6M1 protein_id gnl|my_center|LOCUS_07750 5417 3870 gene locus_tag LOCUS_07760 gene dnaA 5417 3870 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6M2 protein_id gnl|my_center|LOCUS_07760 5977 6504 gene locus_tag LOCUS_07770 5977 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402827.1 protein_id gnl|my_center|LOCUS_07770 6553 6741 gene locus_tag LOCUS_07780 gene rpmF 6553 6741 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I6 protein_id gnl|my_center|LOCUS_07780 6899 7933 gene locus_tag LOCUS_07790 gene plsX 6899 7933 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I5 protein_id gnl|my_center|LOCUS_07790 7933 8982 gene locus_tag LOCUS_07800 gene fabH 7933 8982 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I4 protein_id gnl|my_center|LOCUS_07800 9055 9660 gene locus_tag LOCUS_07810 9055 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 9657 10583 gene locus_tag LOCUS_07820 gene fabD 9657 10583 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I3 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07820 13106 10605 gene locus_tag LOCUS_07830 13106 10605 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402805.1 protein_id gnl|my_center|LOCUS_07830 13264 13755 gene locus_tag LOCUS_07840 gene nusB 13264 13755 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6K8 protein_id gnl|my_center|LOCUS_07840 13758 14444 gene locus_tag LOCUS_07850 13758 14444 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402807.1 protein_id gnl|my_center|LOCUS_07850 14982 14455 gene locus_tag LOCUS_07860 14982 14455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 15153 16259 gene locus_tag LOCUS_07870 gene ychF 15153 16259 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3XYK0 protein_id gnl|my_center|LOCUS_07870 16329 16703 gene locus_tag LOCUS_07880 16329 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 16801 16727 gene locus_tag LOCUS_t00090 16801 16727 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16895 16821 gene locus_tag LOCUS_t00100 16895 16821 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16966 17403 gene locus_tag LOCUS_07890 16966 17403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 17400 18707 gene locus_tag LOCUS_07900 17400 18707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404749.1 protein_id gnl|my_center|LOCUS_07900 18782 19033 gene locus_tag LOCUS_07910 18782 19033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19240 20559 gene locus_tag LOCUS_07920 19240 20559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404404.1 protein_id gnl|my_center|LOCUS_07920 20840 21922 gene locus_tag LOCUS_07930 20840 21922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 21314 21395 gene locus_tag LOCUS_t00110 21314 21395 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22987 21923 gene locus_tag LOCUS_07940 22987 21923 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228623.1 protein_id gnl|my_center|LOCUS_07940 23137 25443 gene locus_tag LOCUS_07950 23137 25443 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence030 708 274 gene locus_tag LOCUS_07960 708 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 1288 746 gene locus_tag LOCUS_07970 1288 746 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404491.1 protein_id gnl|my_center|LOCUS_07970 2296 1292 gene locus_tag LOCUS_07980 2296 1292 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404490.1 protein_id gnl|my_center|LOCUS_07980 2443 4215 gene locus_tag LOCUS_07990 2443 4215 CDS product putative aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705270.1 protein_id gnl|my_center|LOCUS_07990 4220 4606 gene locus_tag LOCUS_08000 4220 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 5030 4584 gene locus_tag LOCUS_08010 5030 4584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114776.1 protein_id gnl|my_center|LOCUS_08010 5214 8297 gene locus_tag LOCUS_08020 gene yjgC 5214 8297 CDS product putative oxidoreductase YjgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34720 protein_id gnl|my_center|LOCUS_08020 8422 8799 gene locus_tag LOCUS_08030 8422 8799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8796 9653 gene locus_tag LOCUS_08040 gene fdhD 8796 9653 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QNU3 protein_id gnl|my_center|LOCUS_08040 9650 10012 gene locus_tag LOCUS_08050 9650 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10012 10560 gene locus_tag LOCUS_08060 10012 10560 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228583.1 protein_id gnl|my_center|LOCUS_08060 12546 10843 gene locus_tag LOCUS_08070 12546 10843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 12762 13340 gene locus_tag LOCUS_08080 12762 13340 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_08080 13348 14322 gene locus_tag LOCUS_08090 13348 14322 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402961.1 protein_id gnl|my_center|LOCUS_08090 14337 17219 gene locus_tag LOCUS_08100 14337 17219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402960.1 protein_id gnl|my_center|LOCUS_08100 17391 18665 gene locus_tag LOCUS_08110 17391 18665 CDS product type II secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404032.1 protein_id gnl|my_center|LOCUS_08110 20887 18917 gene locus_tag LOCUS_08120 20887 18917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 21769 20912 gene locus_tag LOCUS_08130 21769 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 22843 21842 gene locus_tag LOCUS_08140 22843 21842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 24599 22851 gene locus_tag LOCUS_08150 24599 22851 CDS product fimbrial protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404030.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence031 1660 875 gene locus_tag LOCUS_08160 gene uppS 1660 875 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H2 protein_id gnl|my_center|LOCUS_08160 3062 1677 gene locus_tag LOCUS_08170 3062 1677 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H1 protein_id gnl|my_center|LOCUS_08170 4343 3156 gene locus_tag LOCUS_08180 gene dxr 4343 3156 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H0 protein_id gnl|my_center|LOCUS_08180 4422 6317 gene locus_tag LOCUS_08190 4422 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404587.1 protein_id gnl|my_center|LOCUS_08190 6314 7585 gene locus_tag LOCUS_08200 6314 7585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404588.1 protein_id gnl|my_center|LOCUS_08200 7669 8196 gene locus_tag LOCUS_08210 7669 8196 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_08210 8278 8697 gene locus_tag LOCUS_08220 8278 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 8701 9114 gene locus_tag LOCUS_08230 8701 9114 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459767.1 protein_id gnl|my_center|LOCUS_08230 9204 10052 gene locus_tag LOCUS_08240 9204 10052 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_08240 10588 10058 gene locus_tag LOCUS_08250 10588 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 10595 11866 gene locus_tag LOCUS_08260 gene serS 10595 11866 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1G4 protein_id gnl|my_center|LOCUS_08260 12033 12317 gene locus_tag LOCUS_08270 12033 12317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 12484 13221 gene locus_tag LOCUS_08280 gene cynT2 12484 13221 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7CGY2 protein_id gnl|my_center|LOCUS_08280 13595 13804 gene locus_tag LOCUS_08290 13595 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 13801 14760 gene locus_tag LOCUS_08300 13801 14760 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_08300 14765 15088 gene locus_tag LOCUS_08310 14765 15088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_08310 15091 15693 gene locus_tag LOCUS_08320 15091 15693 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPH7 protein_id gnl|my_center|LOCUS_08320 16133 15690 gene locus_tag LOCUS_08330 gene mscL 16133 15690 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD14 protein_id gnl|my_center|LOCUS_08330 17305 16298 gene locus_tag LOCUS_08340 17305 16298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08340 18544 17390 gene locus_tag LOCUS_08350 18544 17390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08350 19062 18796 gene locus_tag LOCUS_08360 gene rpsO 19062 18796 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BI0 protein_id gnl|my_center|LOCUS_08360 20128 19190 gene locus_tag LOCUS_08370 gene ribF 20128 19190 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N9 protein_id gnl|my_center|LOCUS_08370 20862 20125 gene locus_tag LOCUS_08380 20862 20125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 21279 20866 gene locus_tag LOCUS_08390 gene rbfA 21279 20866 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1N8 protein_id gnl|my_center|LOCUS_08390 24182 21363 gene locus_tag LOCUS_08400 24182 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 <24908 24246 gene locus_tag LOCUS_08410 <24908 24246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1N6:transcription termination/antitermination protein NusA >Feature sequence032 723 484 gene locus_tag LOCUS_08420 723 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 611 1450 gene locus_tag LOCUS_08430 611 1450 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256670.1 protein_id gnl|my_center|LOCUS_08430 1818 1447 gene locus_tag LOCUS_08440 1818 1447 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1V5 protein_id gnl|my_center|LOCUS_08440 1802 2446 gene locus_tag LOCUS_08450 1802 2446 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S230 protein_id gnl|my_center|LOCUS_08450 2491 3300 gene locus_tag LOCUS_08460 2491 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3408 4529 gene locus_tag LOCUS_08470 3408 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_08470 4585 5355 gene locus_tag LOCUS_08480 4585 5355 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403975.1 protein_id gnl|my_center|LOCUS_08480 6207 5377 gene locus_tag LOCUS_08490 gene phhA 6207 5377 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404797.1 protein_id gnl|my_center|LOCUS_08490 6551 6288 gene locus_tag LOCUS_08500 6551 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 6609 8279 gene locus_tag LOCUS_08510 gene hutU 6609 8279 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HFF0 protein_id gnl|my_center|LOCUS_08510 8276 9820 gene locus_tag LOCUS_08520 gene hutH 8276 9820 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4M1 protein_id gnl|my_center|LOCUS_08520 10435 9836 gene locus_tag LOCUS_08530 gene hisB 10435 9836 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A1 protein_id gnl|my_center|LOCUS_08530 10456 11070 gene locus_tag LOCUS_08540 10456 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 11156 11647 gene locus_tag LOCUS_08550 11156 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 11800 13932 gene locus_tag LOCUS_08560 11800 13932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 15012 14098 gene locus_tag LOCUS_08570 15012 14098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 15171 17309 gene locus_tag LOCUS_08580 gene metG 15171 17309 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A3 protein_id gnl|my_center|LOCUS_08580 18859 17306 gene locus_tag LOCUS_08590 18859 17306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 19513 18917 gene locus_tag LOCUS_08600 gene nadD 19513 18917 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V3 protein_id gnl|my_center|LOCUS_08600 19898 19518 gene locus_tag LOCUS_08610 19898 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 20472 20020 gene locus_tag LOCUS_08620 20472 20020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405005.1 protein_id gnl|my_center|LOCUS_08620 21191 20559 gene locus_tag LOCUS_08630 21191 20559 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036331.1 protein_id gnl|my_center|LOCUS_08630 22201 21188 gene locus_tag LOCUS_08640 gene ansA 22201 21188 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035484.1 protein_id gnl|my_center|LOCUS_08640 22312 22614 gene locus_tag LOCUS_08650 22312 22614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 22628 23173 gene locus_tag LOCUS_08660 22628 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 23201 23503 gene locus_tag LOCUS_08670 23201 23503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 <24407 23580 gene locus_tag LOCUS_08680 <24407 23580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEM0:glutamate dehydrogenase >Feature sequence033 2136 934 gene locus_tag LOCUS_08690 2136 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 2720 2157 gene locus_tag LOCUS_08700 2720 2157 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404866.1 protein_id gnl|my_center|LOCUS_08700 3150 3995 gene locus_tag LOCUS_08710 3150 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 4055 4633 gene locus_tag LOCUS_08720 4055 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 5582 4770 gene locus_tag LOCUS_08730 5582 4770 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_08730 7198 5804 gene locus_tag LOCUS_08740 7198 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404802.1 protein_id gnl|my_center|LOCUS_08740 7845 7312 gene locus_tag LOCUS_08750 gene apt 7845 7312 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGZ0 protein_id gnl|my_center|LOCUS_08750 9441 7903 gene locus_tag LOCUS_08760 9441 7903 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405209.1 protein_id gnl|my_center|LOCUS_08760 10216 9494 gene locus_tag LOCUS_08770 10216 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 11937 10216 gene locus_tag LOCUS_08780 11937 10216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 12681 12025 gene locus_tag LOCUS_08790 gene rpoE 12681 12025 CDS product RNA polymerase sigma24 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405211.1 protein_id gnl|my_center|LOCUS_08790 13557 12730 gene locus_tag LOCUS_08800 13557 12730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 14073 13765 gene locus_tag LOCUS_08810 14073 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 14168 14467 gene locus_tag LOCUS_08820 14168 14467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405381.1 protein_id gnl|my_center|LOCUS_08820 15015 14464 gene locus_tag LOCUS_08830 gene ruvC 15015 14464 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ65 protein_id gnl|my_center|LOCUS_08830 15957 15064 gene locus_tag LOCUS_08840 15957 15064 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404660.1 protein_id gnl|my_center|LOCUS_08840 16019 17557 gene locus_tag LOCUS_08850 16019 17557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 18955 17564 gene locus_tag LOCUS_08860 gene pepP 18955 17564 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404547.1 protein_id gnl|my_center|LOCUS_08860 19578 19207 gene locus_tag LOCUS_08870 19578 19207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527883.1 protein_id gnl|my_center|LOCUS_08870 19577 20359 gene locus_tag LOCUS_08880 gene tdk 19577 20359 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH4 protein_id gnl|my_center|LOCUS_08880 20384 20854 gene locus_tag LOCUS_08890 20384 20854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 20943 21428 gene locus_tag LOCUS_08900 20943 21428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 21625 22125 gene locus_tag LOCUS_08910 21625 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence034 2534 1818 gene locus_tag LOCUS_08920 2534 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3829 2540 gene locus_tag LOCUS_08930 3829 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 5761 4046 gene locus_tag LOCUS_08940 5761 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 6805 5822 gene locus_tag LOCUS_08950 6805 5822 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039196.1 protein_id gnl|my_center|LOCUS_08950 7869 6805 gene locus_tag LOCUS_08960 7869 6805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 8322 7870 gene locus_tag LOCUS_08970 8322 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 9337 8336 gene locus_tag LOCUS_08980 gene lipA 9337 8336 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4E9 protein_id gnl|my_center|LOCUS_08980 9483 10829 gene locus_tag LOCUS_08990 9483 10829 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403564.1 protein_id gnl|my_center|LOCUS_08990 13352 10860 gene locus_tag LOCUS_09000 13352 10860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 13539 15035 gene locus_tag LOCUS_09010 13539 15035 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGF9 protein_id gnl|my_center|LOCUS_09010 15040 16047 gene locus_tag LOCUS_09020 15040 16047 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403928.1 protein_id gnl|my_center|LOCUS_09020 16206 17132 gene locus_tag LOCUS_09030 16206 17132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 17307 17080 gene locus_tag LOCUS_09040 17307 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 19985 17454 gene locus_tag LOCUS_09050 19985 17454 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405250.1 protein_id gnl|my_center|LOCUS_09050 21547 20156 gene locus_tag LOCUS_09060 21547 20156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 22400 21708 gene locus_tag LOCUS_09070 22400 21708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 <23396 22410 gene locus_tag LOCUS_09080 <23396 22410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RZJ2:proline--tRNA ligase >Feature sequence035 <1 2091 gene locus_tag LOCUS_09090 <1 2091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404651.1:DNA-binding protein 2318 4153 gene locus_tag LOCUS_09100 gene glmS 2318 4153 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2U4 protein_id gnl|my_center|LOCUS_09100 4182 5246 gene locus_tag LOCUS_09110 4182 5246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 5728 5129 gene locus_tag LOCUS_09120 5728 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887258.1 protein_id gnl|my_center|LOCUS_09120 6423 5725 gene locus_tag LOCUS_09130 6423 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390792.1 protein_id gnl|my_center|LOCUS_09130 8912 6420 gene locus_tag LOCUS_09140 8912 6420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 9203 10288 gene locus_tag LOCUS_09150 gene prfA 9203 10288 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2U3 protein_id gnl|my_center|LOCUS_09150 10452 10817 gene locus_tag LOCUS_09160 10452 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 10823 11254 gene locus_tag LOCUS_09170 10823 11254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 11341 11811 gene locus_tag LOCUS_09180 gene rplI 11341 11811 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2U0 protein_id gnl|my_center|LOCUS_09180 11937 12434 gene locus_tag LOCUS_09190 11937 12434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 12514 12592 gene locus_tag LOCUS_t00120 12514 12592 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12727 15567 gene locus_tag LOCUS_09200 12727 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 16261 15752 gene locus_tag LOCUS_09210 16261 15752 CDS product DNA damage-inducible protein DinB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963000.1 protein_id gnl|my_center|LOCUS_09210 16313 16399 gene locus_tag LOCUS_t00130 16313 16399 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16495 17199 gene locus_tag LOCUS_09220 16495 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 17259 18737 gene locus_tag LOCUS_09230 17259 18737 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933015.1 protein_id gnl|my_center|LOCUS_09230 18786 20204 gene locus_tag LOCUS_09240 18786 20204 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405551.1 protein_id gnl|my_center|LOCUS_09240 20288 21028 gene locus_tag LOCUS_09250 20288 21028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405550.1 protein_id gnl|my_center|LOCUS_09250 21196 21858 gene locus_tag LOCUS_09260 21196 21858 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIN6 protein_id gnl|my_center|LOCUS_09260 21855 22379 gene locus_tag LOCUS_09270 21855 22379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404285.1 protein_id gnl|my_center|LOCUS_09270 <23025 22393 gene locus_tag LOCUS_09280 <23025 22393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331279.1:short-chain dehydrogenase >Feature sequence036 <1 914 gene locus_tag LOCUS_09290 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942289.1:energy-dependent translational throttle protein EttA 1127 2104 gene locus_tag LOCUS_09300 gene porQ 1127 2104 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_09300 2752 2117 gene locus_tag LOCUS_09310 2752 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4030 2759 gene locus_tag LOCUS_09320 4030 2759 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403007.1 protein_id gnl|my_center|LOCUS_09320 4218 7784 gene locus_tag LOCUS_09330 4218 7784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 8742 7801 gene locus_tag LOCUS_09340 8742 7801 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_09340 9331 8747 gene locus_tag LOCUS_09350 9331 8747 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730915.1 protein_id gnl|my_center|LOCUS_09350 10533 9328 gene locus_tag LOCUS_09360 10533 9328 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_345307.1 protein_id gnl|my_center|LOCUS_09360 11747 10530 gene locus_tag LOCUS_09370 11747 10530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 13318 11768 gene locus_tag LOCUS_09380 13318 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 14518 13322 gene locus_tag LOCUS_09390 14518 13322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 15985 14624 gene locus_tag LOCUS_09400 15985 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 17210 16080 gene locus_tag LOCUS_09410 17210 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 18241 17207 gene locus_tag LOCUS_09420 18241 17207 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932520.1 protein_id gnl|my_center|LOCUS_09420 18521 19711 gene locus_tag LOCUS_09430 18521 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 19744 20874 gene locus_tag LOCUS_09440 19744 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 21836 20871 gene locus_tag LOCUS_09450 21836 20871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 <22455 21839 gene locus_tag LOCUS_09460 <22455 21839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259281.1:glycosyl transferase family 1 >Feature sequence037 3284 300 gene locus_tag LOCUS_09470 3284 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3420 4733 gene locus_tag LOCUS_09480 3420 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4848 5195 gene locus_tag LOCUS_09490 4848 5195 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_09490 5192 5872 gene locus_tag LOCUS_09500 5192 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 5934 8684 gene locus_tag LOCUS_09510 gene mutS 5934 8684 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S254 protein_id gnl|my_center|LOCUS_09510 8818 9165 gene locus_tag LOCUS_09520 8818 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 9609 9863 gene locus_tag LOCUS_09530 9609 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 10009 11253 gene locus_tag LOCUS_09540 10009 11253 CDS product DEAD/DEAH box family ATP-dependent RNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786517.1 protein_id gnl|my_center|LOCUS_09540 11302 11820 gene locus_tag LOCUS_09550 gene greB 11302 11820 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6NZD6 protein_id gnl|my_center|LOCUS_09550 14391 11896 gene locus_tag LOCUS_09560 14391 11896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 15996 14605 gene locus_tag LOCUS_09570 gene fumC 15996 14605 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S250 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09570 16927 16112 gene locus_tag LOCUS_09580 16927 16112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 17174 18028 gene locus_tag LOCUS_09590 gene panC 17174 18028 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P6 protein_id gnl|my_center|LOCUS_09590 18054 18512 gene locus_tag LOCUS_09600 gene panD 18054 18512 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P5 protein_id gnl|my_center|LOCUS_09600 20191 18590 gene locus_tag LOCUS_09610 gene cshA 20191 18590 CDS product DEAD-box ATP-dependent RNA helicase CshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF7 protein_id gnl|my_center|LOCUS_09610 20551 21147 gene locus_tag LOCUS_09620 20551 21147 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence038 <1 2670 gene locus_tag LOCUS_09630 <1 2670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMY0:histidine kinase 5260 2627 gene locus_tag LOCUS_09640 5260 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 5847 5335 gene locus_tag LOCUS_09650 5847 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 6567 5923 gene locus_tag LOCUS_09660 gene msrA 6567 5923 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72AK8 protein_id gnl|my_center|LOCUS_09660 6764 8080 gene locus_tag LOCUS_09670 gene der 6764 8080 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5P6 protein_id gnl|my_center|LOCUS_09670 8229 8798 gene locus_tag LOCUS_09680 8229 8798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 8802 9896 gene locus_tag LOCUS_09690 8802 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 9889 10506 gene locus_tag LOCUS_09700 9889 10506 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029146.1 protein_id gnl|my_center|LOCUS_09700 10573 11619 gene locus_tag LOCUS_09710 10573 11619 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226719.1 protein_id gnl|my_center|LOCUS_09710 11612 12763 gene locus_tag LOCUS_09720 11612 12763 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258212.1 protein_id gnl|my_center|LOCUS_09720 12839 14644 gene locus_tag LOCUS_09730 12839 14644 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_09730 15993 14590 gene locus_tag LOCUS_09740 15993 14590 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_09740 16184 18817 gene locus_tag LOCUS_09750 16184 18817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19001 20548 gene locus_tag LOCUS_09760 19001 20548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 20610 21071 gene locus_tag LOCUS_09770 20610 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 21155 21463 gene locus_tag LOCUS_09780 21155 21463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence039 1027 137 gene locus_tag LOCUS_09790 1027 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2073 1111 gene locus_tag LOCUS_09800 2073 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2797 2081 gene locus_tag LOCUS_09810 2797 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3949 2972 gene locus_tag LOCUS_09820 3949 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 5270 3942 gene locus_tag LOCUS_09830 5270 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 6415 5267 gene locus_tag LOCUS_09840 6415 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 8313 6490 gene locus_tag LOCUS_09850 8313 6490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056069.1 protein_id gnl|my_center|LOCUS_09850 9470 8328 gene locus_tag LOCUS_09860 9470 8328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 11302 9467 gene locus_tag LOCUS_09870 11302 9467 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_09870 12162 11497 gene locus_tag LOCUS_09880 12162 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 12113 12412 gene locus_tag LOCUS_09890 12113 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 12592 14970 gene locus_tag LOCUS_09900 12592 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 14991 15545 gene locus_tag LOCUS_09910 14991 15545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 15593 16852 gene locus_tag LOCUS_09920 15593 16852 CDS product undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403045.1 protein_id gnl|my_center|LOCUS_09920 16956 17267 gene locus_tag LOCUS_09930 16956 17267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 17294 17803 gene locus_tag LOCUS_09940 17294 17803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 17800 19872 gene locus_tag LOCUS_09950 17800 19872 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_09950 20095 20262 gene locus_tag LOCUS_09960 20095 20262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 21310 20321 gene locus_tag LOCUS_09970 21310 20321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence040 1022 330 gene locus_tag LOCUS_09980 1022 330 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_09980 1078 3165 gene locus_tag LOCUS_09990 1078 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_09990 3771 3247 gene locus_tag LOCUS_10000 3771 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 3917 5041 gene locus_tag LOCUS_10010 3917 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5148 7490 gene locus_tag LOCUS_10020 5148 7490 CDS product acyl-CoA oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404446.1 protein_id gnl|my_center|LOCUS_10020 7496 7717 gene locus_tag LOCUS_10030 7496 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 7928 8098 gene locus_tag LOCUS_10040 7928 8098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10040 8205 8582 gene locus_tag LOCUS_10050 8205 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 8792 8634 gene locus_tag LOCUS_10060 8792 8634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 10495 9014 gene locus_tag LOCUS_10070 10495 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 11599 10580 gene locus_tag LOCUS_10080 11599 10580 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403242.1 protein_id gnl|my_center|LOCUS_10080 12501 11596 gene locus_tag LOCUS_10090 12501 11596 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921497.1 protein_id gnl|my_center|LOCUS_10090 14765 12498 gene locus_tag LOCUS_10100 14765 12498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 14985 16064 gene locus_tag LOCUS_10110 14985 16064 CDS product endoglucanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405202.1 protein_id gnl|my_center|LOCUS_10110 16067 16345 gene locus_tag LOCUS_10120 16067 16345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 16471 17574 gene locus_tag LOCUS_10130 16471 17574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 19109 17571 gene locus_tag LOCUS_10140 19109 17571 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405197.1 protein_id gnl|my_center|LOCUS_10140 19387 20331 gene locus_tag LOCUS_10150 19387 20331 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210807.1 protein_id gnl|my_center|LOCUS_10150 >Feature sequence041 <1 2254 gene locus_tag LOCUS_10160 <1 2254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S3X0:DNA-directed DNA polymerase 2356 2778 gene locus_tag LOCUS_10170 2356 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3718 2795 gene locus_tag LOCUS_10180 3718 2795 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_10180 3859 12612 gene locus_tag LOCUS_10190 3859 12612 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339463.1 protein_id gnl|my_center|LOCUS_10190 13488 12715 gene locus_tag LOCUS_10200 13488 12715 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_10200 13567 14151 gene locus_tag LOCUS_10210 13567 14151 CDS product biotin biosynthesis protein BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403498.1 protein_id gnl|my_center|LOCUS_10210 14664 14170 gene locus_tag LOCUS_10220 14664 14170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_10220 14868 15752 gene locus_tag LOCUS_10230 14868 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402862.1 protein_id gnl|my_center|LOCUS_10230 17350 15749 gene locus_tag LOCUS_10240 17350 15749 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_10240 17443 17763 gene locus_tag LOCUS_10250 17443 17763 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189573.1 protein_id gnl|my_center|LOCUS_10250 17760 18257 gene locus_tag LOCUS_10260 17760 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 18835 18230 gene locus_tag LOCUS_10270 18835 18230 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083119.1 protein_id gnl|my_center|LOCUS_10270 19211 18837 gene locus_tag LOCUS_10280 19211 18837 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404140.1 protein_id gnl|my_center|LOCUS_10280 >Feature sequence042 1862 1485 gene locus_tag LOCUS_10290 1862 1485 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_10290 2275 5835 gene locus_tag LOCUS_10300 2275 5835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404597.1 protein_id gnl|my_center|LOCUS_10300 6050 6733 gene locus_tag LOCUS_10310 6050 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6734 7837 gene locus_tag LOCUS_10320 6734 7837 CDS product sodium:phosphate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706804.1 protein_id gnl|my_center|LOCUS_10320 7954 8574 gene locus_tag LOCUS_10330 7954 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 9132 8650 gene locus_tag LOCUS_10340 9132 8650 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF2 protein_id gnl|my_center|LOCUS_10340 9486 9181 gene locus_tag LOCUS_10350 9486 9181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 11440 9656 gene locus_tag LOCUS_10360 11440 9656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_10360 12428 11751 gene locus_tag LOCUS_10370 12428 11751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 14565 12610 gene locus_tag LOCUS_10380 14565 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 15477 14887 gene locus_tag LOCUS_10390 15477 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 16446 15484 gene locus_tag LOCUS_10400 gene spo0J 16446 15484 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403291.1 protein_id gnl|my_center|LOCUS_10400 17648 16479 gene locus_tag LOCUS_10410 17648 16479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 18585 17785 gene locus_tag LOCUS_10420 18585 17785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 19780 18674 gene locus_tag LOCUS_10430 19780 18674 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403879.1 protein_id gnl|my_center|LOCUS_10430 19931 20179 gene locus_tag LOCUS_10440 19931 20179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence043 774 400 gene locus_tag LOCUS_10450 774 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 1472 930 gene locus_tag LOCUS_10460 1472 930 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404843.1 protein_id gnl|my_center|LOCUS_10460 3238 1508 gene locus_tag LOCUS_10470 3238 1508 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404845.1 protein_id gnl|my_center|LOCUS_10470 3244 3600 gene locus_tag LOCUS_10480 3244 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 3602 4747 gene locus_tag LOCUS_10490 gene mutY 3602 4747 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404847.1 protein_id gnl|my_center|LOCUS_10490 6774 4774 gene locus_tag LOCUS_10500 6774 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 8606 6771 gene locus_tag LOCUS_10510 8606 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 8985 8722 gene locus_tag LOCUS_10520 8985 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550097.1 protein_id gnl|my_center|LOCUS_10520 10152 8998 gene locus_tag LOCUS_10530 gene rnd 10152 8998 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSM2 protein_id gnl|my_center|LOCUS_10530 10745 10149 gene locus_tag LOCUS_10540 10745 10149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 11296 10781 gene locus_tag LOCUS_10550 11296 10781 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205249.1 protein_id gnl|my_center|LOCUS_10550 12994 11351 gene locus_tag LOCUS_10560 12994 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 14493 12991 gene locus_tag LOCUS_10570 14493 12991 CDS product Na+-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_10570 15332 14493 gene locus_tag LOCUS_10580 15332 14493 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403530.1 protein_id gnl|my_center|LOCUS_10580 15460 17112 gene locus_tag LOCUS_10590 gene lnt 15460 17112 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KCC4 protein_id gnl|my_center|LOCUS_10590 17132 17749 gene locus_tag LOCUS_10600 17132 17749 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4I1 protein_id gnl|my_center|LOCUS_10600 17749 18276 gene locus_tag LOCUS_10610 17749 18276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056075.1 protein_id gnl|my_center|LOCUS_10610 18273 19022 gene locus_tag LOCUS_10620 18273 19022 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404765.1 protein_id gnl|my_center|LOCUS_10620 19046 19342 gene locus_tag LOCUS_10630 19046 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001143646.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence044 1966 689 gene locus_tag LOCUS_10640 1966 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2051 3940 gene locus_tag LOCUS_10650 2051 3940 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546223.1 protein_id gnl|my_center|LOCUS_10650 3942 5195 gene locus_tag LOCUS_10660 3942 5195 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119074.1 protein_id gnl|my_center|LOCUS_10660 6509 5244 gene locus_tag LOCUS_10670 6509 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7859 6513 gene locus_tag LOCUS_10680 7859 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 8627 8007 gene locus_tag LOCUS_10690 8627 8007 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143043.1 protein_id gnl|my_center|LOCUS_10690 9411 8620 gene locus_tag LOCUS_10700 9411 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143042.1 protein_id gnl|my_center|LOCUS_10700 10555 9398 gene locus_tag LOCUS_10710 10555 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143041.1 protein_id gnl|my_center|LOCUS_10710 11644 10559 gene locus_tag LOCUS_10720 11644 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 11804 13168 gene locus_tag LOCUS_10730 11804 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13380 13601 gene locus_tag LOCUS_10740 13380 13601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10740 14103 14588 gene locus_tag LOCUS_10750 14103 14588 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259372.1 protein_id gnl|my_center|LOCUS_10750 14620 15948 gene locus_tag LOCUS_10760 14620 15948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 17203 15980 gene locus_tag LOCUS_10770 17203 15980 CDS product glutathione-dependent formaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140737.1 protein_id gnl|my_center|LOCUS_10770 17383 18702 gene locus_tag LOCUS_10780 17383 18702 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389104.1 protein_id gnl|my_center|LOCUS_10780 <19954 18719 gene locus_tag LOCUS_10790 <19954 18719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011204711.1:penicillin-binding protein 1A >Feature sequence045 3375 1897 gene locus_tag LOCUS_10800 3375 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 3529 5091 gene locus_tag LOCUS_10810 3529 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 5088 6161 gene locus_tag LOCUS_10820 5088 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 6915 6139 gene locus_tag LOCUS_10830 6915 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8045 6963 gene locus_tag LOCUS_10840 8045 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403647.1 protein_id gnl|my_center|LOCUS_10840 8756 8178 gene locus_tag LOCUS_10850 8756 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 10096 8753 gene locus_tag LOCUS_10860 gene sun 10096 8753 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S463 protein_id gnl|my_center|LOCUS_10860 11463 10093 gene locus_tag LOCUS_10870 11463 10093 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_10870 12509 11514 gene locus_tag LOCUS_10880 12509 11514 CDS product cation diffusion facilitator transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404319.1 protein_id gnl|my_center|LOCUS_10880 12601 13767 gene locus_tag LOCUS_10890 12601 13767 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404320.1 protein_id gnl|my_center|LOCUS_10890 14377 13757 gene locus_tag LOCUS_10900 14377 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10900 15516 14374 gene locus_tag LOCUS_10910 15516 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10910 16173 15658 gene locus_tag LOCUS_10920 16173 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 16985 16308 gene locus_tag LOCUS_10930 16985 16308 CDS product putative 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2B5 protein_id gnl|my_center|LOCUS_10930 17049 17552 gene locus_tag LOCUS_10940 17049 17552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 <19894 17549 gene locus_tag LOCUS_10950 <19894 17549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230482.1:carboxypeptidase T >Feature sequence046 2093 1092 gene locus_tag LOCUS_10960 gene purM 2093 1092 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H8 protein_id gnl|my_center|LOCUS_10960 2373 2179 gene locus_tag LOCUS_10970 2373 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3518 2370 gene locus_tag LOCUS_10980 gene mnmA 3518 2370 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZN9 protein_id gnl|my_center|LOCUS_10980 5145 3703 gene locus_tag LOCUS_10990 5145 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6892 5258 gene locus_tag LOCUS_11000 6892 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7883 6963 gene locus_tag LOCUS_11010 7883 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_11010 8340 10412 gene locus_tag LOCUS_11020 8340 10412 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P1 protein_id gnl|my_center|LOCUS_11020 11852 10470 gene locus_tag LOCUS_11030 gene menE 11852 10470 CDS product 2-succinylbenzoate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404107.1 protein_id gnl|my_center|LOCUS_11030 12904 11849 gene locus_tag LOCUS_11040 gene menC 12904 11849 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2V3 protein_id gnl|my_center|LOCUS_11040 13930 12983 gene locus_tag LOCUS_11050 gene menA 13930 12983 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2V4 protein_id gnl|my_center|LOCUS_11050 14835 13927 gene locus_tag LOCUS_11060 gene menB 14835 13927 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE2 protein_id gnl|my_center|LOCUS_11060 15550 14828 gene locus_tag LOCUS_11070 gene menH 15550 14828 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 protein_id gnl|my_center|LOCUS_11070 17391 15550 gene locus_tag LOCUS_11080 gene menD 17391 15550 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2V6 protein_id gnl|my_center|LOCUS_11080 18774 17395 gene locus_tag LOCUS_11090 18774 17395 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404102.1 protein_id gnl|my_center|LOCUS_11090 18918 19652 gene locus_tag LOCUS_11100 gene menG 18918 19652 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C2 protein_id gnl|my_center|LOCUS_11100 >Feature sequence047 <1 1714 gene locus_tag LOCUS_11110 <1 1714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021816.1:ATPase AAA 2477 1722 gene locus_tag LOCUS_11120 2477 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 2563 3837 gene locus_tag LOCUS_11130 2563 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 3899 4147 gene locus_tag LOCUS_11140 3899 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5085 4216 gene locus_tag LOCUS_11150 5085 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5078 6175 gene locus_tag LOCUS_11160 gene pfkA 5078 6175 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0R4 protein_id gnl|my_center|LOCUS_11160 8324 6225 gene locus_tag LOCUS_11170 8324 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 8909 8502 gene locus_tag LOCUS_11180 8909 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 9177 9860 gene locus_tag LOCUS_11190 gene plsY 9177 9860 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2H7 protein_id gnl|my_center|LOCUS_11190 10268 11035 gene locus_tag LOCUS_11200 10268 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 11754 11032 gene locus_tag LOCUS_11210 11754 11032 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943052.1 protein_id gnl|my_center|LOCUS_11210 11947 12651 gene locus_tag LOCUS_11220 11947 12651 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_11220 12682 15228 gene locus_tag LOCUS_11230 12682 15228 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403467.1 protein_id gnl|my_center|LOCUS_11230 15953 15240 gene locus_tag LOCUS_11240 15953 15240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 16888 15968 gene locus_tag LOCUS_11250 gene rimK 16888 15968 CDS product putative alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E743 protein_id gnl|my_center|LOCUS_11250 17479 16937 gene locus_tag LOCUS_11260 gene rimK2 17479 16937 CDS product ribosomal protein S6 modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261389.1 protein_id gnl|my_center|LOCUS_11260 18427 17489 gene locus_tag LOCUS_11270 18427 17489 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947709.1 protein_id gnl|my_center|LOCUS_11270 <19754 18457 gene locus_tag LOCUS_11280 <19754 18457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0V0:GMP synthase [glutamine-hydrolyzing] >Feature sequence048 3 1130 gene locus_tag LOCUS_11290 3 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1127 1567 gene locus_tag LOCUS_11300 1127 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1910 2275 gene locus_tag LOCUS_11310 1910 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3054 2272 gene locus_tag LOCUS_11320 gene dapB 3054 2272 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403839.1 protein_id gnl|my_center|LOCUS_11320 5557 3095 gene locus_tag LOCUS_11330 gene thrA 5557 3095 CDS product bifunctional aspartokinase I/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036970.1 protein_id gnl|my_center|LOCUS_11330 5689 5762 gene locus_tag LOCUS_t00140 5689 5762 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7160 5814 gene locus_tag LOCUS_11340 7160 5814 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_11340 8551 7157 gene locus_tag LOCUS_11350 8551 7157 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_11350 8760 10094 gene locus_tag LOCUS_11360 8760 10094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_11360 10138 10884 gene locus_tag LOCUS_11370 10138 10884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_11370 10910 13306 gene locus_tag LOCUS_11380 10910 13306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_11380 13361 13951 gene locus_tag LOCUS_11390 13361 13951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 13985 15028 gene locus_tag LOCUS_11400 gene pip 13985 15028 CDS product proline iminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0I1 protein_id gnl|my_center|LOCUS_11400 15056 17440 gene locus_tag LOCUS_11410 15056 17440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence049 2982 283 gene locus_tag LOCUS_11420 2982 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403549.1 protein_id gnl|my_center|LOCUS_11420 4076 3072 gene locus_tag LOCUS_11430 4076 3072 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_11430 4433 4077 gene locus_tag LOCUS_11440 4433 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 4958 4446 gene locus_tag LOCUS_11450 4958 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 7740 5044 gene locus_tag LOCUS_11460 7740 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404331.1 protein_id gnl|my_center|LOCUS_11460 7967 8734 gene locus_tag LOCUS_11470 7967 8734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 8865 9824 gene locus_tag LOCUS_11480 8865 9824 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403526.1 protein_id gnl|my_center|LOCUS_11480 9943 12225 gene locus_tag LOCUS_11490 9943 12225 CDS product bifunctional hydroxylase/oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815004.1 protein_id gnl|my_center|LOCUS_11490 12222 13004 gene locus_tag LOCUS_11500 12222 13004 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927121.1 protein_id gnl|my_center|LOCUS_11500 13128 13943 gene locus_tag LOCUS_11510 13128 13943 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815000.1 protein_id gnl|my_center|LOCUS_11510 13943 14881 gene locus_tag LOCUS_11520 13943 14881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142485.1 protein_id gnl|my_center|LOCUS_11520 14878 16023 gene locus_tag LOCUS_11530 14878 16023 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064927.1 protein_id gnl|my_center|LOCUS_11530 16161 16553 gene locus_tag LOCUS_11540 16161 16553 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088816.1 protein_id gnl|my_center|LOCUS_11540 17155 18012 gene locus_tag LOCUS_11550 17155 18012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 19226 18126 gene locus_tag LOCUS_11560 19226 18126 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_11560 19550 19466 gene locus_tag LOCUS_t00150 19550 19466 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence050 296 658 gene locus_tag LOCUS_11570 296 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 897 1049 gene locus_tag LOCUS_11580 897 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1221 1847 gene locus_tag LOCUS_11590 1221 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 2032 3138 gene locus_tag LOCUS_11600 gene mauG 2032 3138 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_11600 3203 3703 gene locus_tag LOCUS_11610 3203 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3823 6132 gene locus_tag LOCUS_11620 3823 6132 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402954.1 protein_id gnl|my_center|LOCUS_11620 6135 7130 gene locus_tag LOCUS_11630 6135 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405441.1 protein_id gnl|my_center|LOCUS_11630 7195 7929 gene locus_tag LOCUS_11640 gene queC 7195 7929 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89LP8 protein_id gnl|my_center|LOCUS_11640 7926 8666 gene locus_tag LOCUS_11650 gene queE 7926 8666 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P0H4 protein_id gnl|my_center|LOCUS_11650 8711 11188 gene locus_tag LOCUS_11660 8711 11188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_11660 12229 11192 gene locus_tag LOCUS_11670 gene tsaD 12229 11192 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI8 protein_id gnl|my_center|LOCUS_11670 14219 12333 gene locus_tag LOCUS_11680 14219 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 14434 15318 gene locus_tag LOCUS_11690 14434 15318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 16632 15331 gene locus_tag LOCUS_11700 gene murF 16632 15331 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2W8 protein_id gnl|my_center|LOCUS_11700 17731 16649 gene locus_tag LOCUS_11710 gene ddlA 17731 16649 CDS product D-alanine--D-alanine ligase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A6J9 protein_id gnl|my_center|LOCUS_11710 18014 18307 gene locus_tag LOCUS_11720 18014 18307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence051 2125 1301 gene locus_tag LOCUS_11730 2125 1301 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403037.1 protein_id gnl|my_center|LOCUS_11730 4632 2107 gene locus_tag LOCUS_11740 4632 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 4713 5579 gene locus_tag LOCUS_11750 4713 5579 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404051.1 protein_id gnl|my_center|LOCUS_11750 5669 6259 gene locus_tag LOCUS_11760 5669 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6927 6499 gene locus_tag LOCUS_11770 6927 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 8692 6986 gene locus_tag LOCUS_11780 gene pruA 8692 6986 CDS product 1-pyrroline-5-carboxylate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_11780 8798 10051 gene locus_tag LOCUS_11790 8798 10051 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404265.1 protein_id gnl|my_center|LOCUS_11790 10520 10059 gene locus_tag LOCUS_11800 10520 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770938.1 protein_id gnl|my_center|LOCUS_11800 10958 10524 gene locus_tag LOCUS_11810 10958 10524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402969.1 protein_id gnl|my_center|LOCUS_11810 11113 11592 gene locus_tag LOCUS_11820 11113 11592 CDS product anti-oxidant AhpCTSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404264.1 protein_id gnl|my_center|LOCUS_11820 11589 12020 gene locus_tag LOCUS_11830 11589 12020 CDS product molybdopterin biosynthesis protein MoeE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973775.1 protein_id gnl|my_center|LOCUS_11830 12025 13035 gene locus_tag LOCUS_11840 gene eutD 12025 13035 CDS product phosphotransacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001254958.1 protein_id gnl|my_center|LOCUS_11840 13032 13838 gene locus_tag LOCUS_11850 13032 13838 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_11850 14782 13835 gene locus_tag LOCUS_11860 gene purC 14782 13835 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2E5 protein_id gnl|my_center|LOCUS_11860 15808 14789 gene locus_tag LOCUS_11870 15808 14789 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404261.1 protein_id gnl|my_center|LOCUS_11870 16665 15835 gene locus_tag LOCUS_11880 16665 15835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404260.1 protein_id gnl|my_center|LOCUS_11880 16772 17878 gene locus_tag LOCUS_11890 gene ugpC 16772 17878 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037286.1 protein_id gnl|my_center|LOCUS_11890 17964 18272 gene locus_tag LOCUS_11900 17964 18272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 >Feature sequence052 268 903 gene locus_tag LOCUS_11910 268 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 905 2755 gene locus_tag LOCUS_11920 905 2755 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404038.1 protein_id gnl|my_center|LOCUS_11920 2757 3383 gene locus_tag LOCUS_11930 gene upp 2757 3383 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S320 protein_id gnl|my_center|LOCUS_11930 3380 5452 gene locus_tag LOCUS_11940 3380 5452 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404041.1 protein_id gnl|my_center|LOCUS_11940 5456 6187 gene locus_tag LOCUS_11950 gene rluA 5456 6187 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404487.1 protein_id gnl|my_center|LOCUS_11950 6774 6211 gene locus_tag LOCUS_11960 6774 6211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 7901 6771 gene locus_tag LOCUS_11970 7901 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 7972 9519 gene locus_tag LOCUS_11980 7972 9519 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404792.1 protein_id gnl|my_center|LOCUS_11980 9592 10809 gene locus_tag LOCUS_11990 gene aroC 9592 10809 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0W2 protein_id gnl|my_center|LOCUS_11990 10996 12474 gene locus_tag LOCUS_12000 gene crtI 10996 12474 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404788.1 protein_id gnl|my_center|LOCUS_12000 13845 12526 gene locus_tag LOCUS_12010 gene murA 13845 12526 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1G0 protein_id gnl|my_center|LOCUS_12010 14186 14377 gene locus_tag LOCUS_12020 14186 14377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 14518 16218 gene locus_tag LOCUS_12030 14518 16218 CDS product propionyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403971.1 protein_id gnl|my_center|LOCUS_12030 17188 16550 gene locus_tag LOCUS_12040 17188 16550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 <18110 17253 gene locus_tag LOCUS_12050 <18110 17253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0Q3:60 kDa chaperonin 2 >Feature sequence053 230 8005 gene locus_tag LOCUS_12060 230 8005 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405265.1 protein_id gnl|my_center|LOCUS_12060 8008 8778 gene locus_tag LOCUS_12070 gene lipB 8008 8778 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI1 protein_id gnl|my_center|LOCUS_12070 8853 9260 gene locus_tag LOCUS_12080 8853 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405262.1 protein_id gnl|my_center|LOCUS_12080 9671 9270 gene locus_tag LOCUS_12090 9671 9270 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_12090 10186 9668 gene locus_tag LOCUS_12100 10186 9668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 10713 10186 gene locus_tag LOCUS_12110 gene rsfS 10713 10186 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZI5 protein_id gnl|my_center|LOCUS_12110 11186 10710 gene locus_tag LOCUS_12120 11186 10710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 11774 11187 gene locus_tag LOCUS_12130 11774 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 13102 11915 gene locus_tag LOCUS_12140 gene agxT 13102 11915 CDS product serine--pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_12140 14534 13227 gene locus_tag LOCUS_12150 14534 13227 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027491.1 protein_id gnl|my_center|LOCUS_12150 16371 14638 gene locus_tag LOCUS_12160 gene aceB 16371 14638 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706619.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence054 <1 1383 gene locus_tag LOCUS_12170 <1 1383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74AK4:putative potassium transport system protein kup 1 1803 1396 gene locus_tag LOCUS_12180 1803 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 3853 1943 gene locus_tag LOCUS_12190 3853 1943 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404982.1 protein_id gnl|my_center|LOCUS_12190 3950 4843 gene locus_tag LOCUS_12200 gene vanA 3950 4843 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CX22 protein_id gnl|my_center|LOCUS_12200 4928 7870 gene locus_tag LOCUS_12210 4928 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 8069 8977 gene locus_tag LOCUS_12220 8069 8977 CDS product NAD-dependent nucleoside diphosphate-sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941053.1 protein_id gnl|my_center|LOCUS_12220 9831 9040 gene locus_tag LOCUS_12230 9831 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 10073 10585 gene locus_tag LOCUS_12240 10073 10585 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403271.1 protein_id gnl|my_center|LOCUS_12240 13939 10640 gene locus_tag LOCUS_12250 13939 10640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 14071 16158 gene locus_tag LOCUS_12260 gene ptrB 14071 16158 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038594.1 protein_id gnl|my_center|LOCUS_12260 16216 17547 gene locus_tag LOCUS_12270 16216 17547 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence055 584 1258 gene locus_tag LOCUS_12280 584 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1255 1914 gene locus_tag LOCUS_12290 1255 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1925 3625 gene locus_tag LOCUS_12300 1925 3625 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404644.1 protein_id gnl|my_center|LOCUS_12300 3622 4962 gene locus_tag LOCUS_12310 3622 4962 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404645.1 protein_id gnl|my_center|LOCUS_12310 4955 6313 gene locus_tag LOCUS_12320 4955 6313 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_12320 6734 6321 gene locus_tag LOCUS_12330 6734 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 6893 7507 gene locus_tag LOCUS_12340 6893 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 7573 8649 gene locus_tag LOCUS_12350 gene fabH 7573 8649 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HM07 protein_id gnl|my_center|LOCUS_12350 8736 9173 gene locus_tag LOCUS_12360 8736 9173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 9988 9170 gene locus_tag LOCUS_12370 gene hutG 9988 9170 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CMY5 protein_id gnl|my_center|LOCUS_12370 10101 11027 gene locus_tag LOCUS_12380 gene proC 10101 11027 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A0 protein_id gnl|my_center|LOCUS_12380 11024 12139 gene locus_tag LOCUS_12390 gene purK 11024 12139 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S241 protein_id gnl|my_center|LOCUS_12390 13039 12152 gene locus_tag LOCUS_12400 13039 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 13283 14983 gene locus_tag LOCUS_12410 13283 14983 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389689.1 protein_id gnl|my_center|LOCUS_12410 15142 16728 gene locus_tag LOCUS_12420 gene trpE 15142 16728 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404407.1 protein_id gnl|my_center|LOCUS_12420 16760 17248 gene locus_tag LOCUS_12430 16760 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence056 2218 2850 gene locus_tag LOCUS_12440 2218 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3402 2857 gene locus_tag LOCUS_12450 3402 2857 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403506.1 protein_id gnl|my_center|LOCUS_12450 3513 5450 gene locus_tag LOCUS_12460 gene dxs 3513 5450 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64Y02 protein_id gnl|my_center|LOCUS_12460 5918 5514 gene locus_tag LOCUS_12470 5918 5514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142723.1 protein_id gnl|my_center|LOCUS_12470 6134 6631 gene locus_tag LOCUS_12480 6134 6631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6769 7401 gene locus_tag LOCUS_12490 6769 7401 CDS product cell envelope biogenesis protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404316.1 protein_id gnl|my_center|LOCUS_12490 7473 8507 gene locus_tag LOCUS_12500 7473 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_12500 8504 8980 gene locus_tag LOCUS_12510 8504 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 9003 9308 gene locus_tag LOCUS_12520 9003 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 10249 9461 gene locus_tag LOCUS_12530 10249 9461 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404211.1 protein_id gnl|my_center|LOCUS_12530 11667 10246 gene locus_tag LOCUS_12540 11667 10246 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_12540 12635 11664 gene locus_tag LOCUS_12550 12635 11664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 13971 12679 gene locus_tag LOCUS_12560 gene hisS 13971 12679 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4A7 protein_id gnl|my_center|LOCUS_12560 14523 14050 gene locus_tag LOCUS_12570 14523 14050 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403602.1 protein_id gnl|my_center|LOCUS_12570 15509 14577 gene locus_tag LOCUS_12580 15509 14577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence057 1235 3097 gene locus_tag LOCUS_12590 1235 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 3196 4341 gene locus_tag LOCUS_12600 gene wlbE 3196 4341 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925721.1 protein_id gnl|my_center|LOCUS_12600 4742 5365 gene locus_tag LOCUS_12610 4742 5365 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481406.1 protein_id gnl|my_center|LOCUS_12610 5362 6006 gene locus_tag LOCUS_12620 gene perB 5362 6006 CDS product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_12620 6119 7258 gene locus_tag LOCUS_12630 6119 7258 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_12630 7350 9272 gene locus_tag LOCUS_12640 7350 9272 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868795.1 protein_id gnl|my_center|LOCUS_12640 9269 10384 gene locus_tag LOCUS_12650 9269 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10486 11043 gene locus_tag LOCUS_12660 10486 11043 CDS product exosortase/archaeosortase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403397.1 protein_id gnl|my_center|LOCUS_12660 11043 11648 gene locus_tag LOCUS_12670 11043 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 13275 11593 gene locus_tag LOCUS_12680 13275 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 14183 13272 gene locus_tag LOCUS_12690 gene accD 14183 13272 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3F0 protein_id gnl|my_center|LOCUS_12690 14851 14201 gene locus_tag LOCUS_12700 14851 14201 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403908.1 protein_id gnl|my_center|LOCUS_12700 14971 17085 gene locus_tag LOCUS_12710 gene fus 14971 17085 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403904.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence058 1919 600 gene locus_tag LOCUS_12720 1919 600 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S304 protein_id gnl|my_center|LOCUS_12720 2897 2046 gene locus_tag LOCUS_12730 2897 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3618 2968 gene locus_tag LOCUS_12740 gene pyrE 3618 2968 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S305 protein_id gnl|my_center|LOCUS_12740 4231 3611 gene locus_tag LOCUS_12750 gene pgsA 4231 3611 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404053.1 protein_id gnl|my_center|LOCUS_12750 4590 6533 gene locus_tag LOCUS_12760 gene dnaK 4590 6533 CDS product chaperone protein DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S307 protein_id gnl|my_center|LOCUS_12760 6706 8205 gene locus_tag LOCUS_12770 gene creD 6706 8205 CDS product cell envelope integrity protein CreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113266.1 protein_id gnl|my_center|LOCUS_12770 9781 8609 gene locus_tag LOCUS_12780 9781 8609 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268279.1 protein_id gnl|my_center|LOCUS_12780 10106 12661 gene locus_tag LOCUS_12790 10106 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 13955 12759 gene locus_tag LOCUS_12800 13955 12759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 15234 14041 gene locus_tag LOCUS_12810 15234 14041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404277.1 protein_id gnl|my_center|LOCUS_12810 15409 15481 gene locus_tag LOCUS_t00160 15409 15481 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 <17279 15595 gene locus_tag LOCUS_12820 <17279 15595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404926.1:fibronectin type III >Feature sequence059 823 449 gene locus_tag LOCUS_12830 823 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1570 878 gene locus_tag LOCUS_12840 1570 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403539.1 protein_id gnl|my_center|LOCUS_12840 1607 2677 gene locus_tag LOCUS_12850 1607 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_12850 2803 3405 gene locus_tag LOCUS_12860 gene ruvA 2803 3405 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5C8 protein_id gnl|my_center|LOCUS_12860 3509 4228 gene locus_tag LOCUS_12870 gene drrA 3509 4228 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405016.1 protein_id gnl|my_center|LOCUS_12870 4288 5463 gene locus_tag LOCUS_12880 4288 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5528 5989 gene locus_tag LOCUS_12890 5528 5989 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123033.1 protein_id gnl|my_center|LOCUS_12890 6546 6076 gene locus_tag LOCUS_12900 6546 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 8437 6620 gene locus_tag LOCUS_12910 8437 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 9548 8571 gene locus_tag LOCUS_12920 gene ilvE 9548 8571 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405038.1 protein_id gnl|my_center|LOCUS_12920 10475 9720 gene locus_tag LOCUS_12930 10475 9720 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405039.1 protein_id gnl|my_center|LOCUS_12930 10591 12609 gene locus_tag LOCUS_12940 10591 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 12969 13136 gene locus_tag LOCUS_12950 12969 13136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 13707 13435 gene locus_tag LOCUS_12960 13707 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 13606 14298 gene locus_tag LOCUS_12970 13606 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 14358 16160 gene locus_tag LOCUS_12980 14358 16160 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230927.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence060 1119 256 gene locus_tag LOCUS_12990 1119 256 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229514.1 protein_id gnl|my_center|LOCUS_12990 1192 2127 gene locus_tag LOCUS_13000 1192 2127 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258990.1 protein_id gnl|my_center|LOCUS_13000 3399 2314 gene locus_tag LOCUS_13010 3399 2314 CDS product O6-methylguanine-DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553740.1 protein_id gnl|my_center|LOCUS_13010 4049 3402 gene locus_tag LOCUS_13020 4049 3402 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227066.1 protein_id gnl|my_center|LOCUS_13020 4643 5065 gene locus_tag LOCUS_13030 4643 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 5663 5590 gene locus_tag LOCUS_t00170 5663 5590 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 8082 5764 gene locus_tag LOCUS_13040 gene phuR 8082 5764 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_13040 8497 8123 gene locus_tag LOCUS_13050 8497 8123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8982 8545 gene locus_tag LOCUS_13060 gene ybeY 8982 8545 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T3 protein_id gnl|my_center|LOCUS_13060 9467 8979 gene locus_tag LOCUS_13070 9467 8979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 10942 9536 gene locus_tag LOCUS_13080 10942 9536 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085984871.1 protein_id gnl|my_center|LOCUS_13080 11092 11580 gene locus_tag LOCUS_13090 11092 11580 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384944.1 protein_id gnl|my_center|LOCUS_13090 12953 11685 gene locus_tag LOCUS_13100 12953 11685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 14280 13069 gene locus_tag LOCUS_13110 14280 13069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 <17056 14404 gene locus_tag LOCUS_13120 <17056 14404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405043.1:ATPase >Feature sequence061 <1 3541 gene locus_tag LOCUS_13130 <1 3541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085646.1:ATPase 3550 4821 gene locus_tag LOCUS_13140 3550 4821 CDS product fused response regulator/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_13140 5727 4828 gene locus_tag LOCUS_13150 5727 4828 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_13150 6623 5724 gene locus_tag LOCUS_13160 6623 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 7000 6644 gene locus_tag LOCUS_13170 7000 6644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7500 7057 gene locus_tag LOCUS_13180 7500 7057 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038704.1 protein_id gnl|my_center|LOCUS_13180 7866 12032 gene locus_tag LOCUS_13190 7866 12032 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766188.1 protein_id gnl|my_center|LOCUS_13190 12633 13139 gene locus_tag LOCUS_13200 12633 13139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 13173 13382 gene locus_tag LOCUS_13210 13173 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 16662 13495 gene locus_tag LOCUS_13220 16662 13495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 >Feature sequence062 693 1469 gene locus_tag LOCUS_13230 693 1469 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404707.1 protein_id gnl|my_center|LOCUS_13230 1586 2842 gene locus_tag LOCUS_13240 1586 2842 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RU54 protein_id gnl|my_center|LOCUS_13240 3057 4655 gene locus_tag LOCUS_13250 3057 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4746 7103 gene locus_tag LOCUS_13260 gene acyII 4746 7103 CDS product penicillin acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036584.1 protein_id gnl|my_center|LOCUS_13260 7461 7150 gene locus_tag LOCUS_13270 7461 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 10508 7512 gene locus_tag LOCUS_13280 10508 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 10603 11034 gene locus_tag LOCUS_13290 10603 11034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 11145 12797 gene locus_tag LOCUS_13300 11145 12797 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_13300 12951 14651 gene locus_tag LOCUS_13310 12951 14651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 15085 14726 gene locus_tag LOCUS_13320 15085 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_13320 15848 15129 gene locus_tag LOCUS_13330 15848 15129 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRQ0 protein_id gnl|my_center|LOCUS_13330 >Feature sequence063 2580 274 gene locus_tag LOCUS_13340 2580 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3827 2634 gene locus_tag LOCUS_13350 3827 2634 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2Y3 protein_id gnl|my_center|LOCUS_13350 4040 5467 gene locus_tag LOCUS_13360 4040 5467 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943931.1 protein_id gnl|my_center|LOCUS_13360 6037 5540 gene locus_tag LOCUS_13370 6037 5540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6633 6082 gene locus_tag LOCUS_13380 6633 6082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6944 6630 gene locus_tag LOCUS_13390 6944 6630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 7128 8558 gene locus_tag LOCUS_13400 gene dacB 7128 8558 CDS product peptidase M15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403836.1 protein_id gnl|my_center|LOCUS_13400 9912 8782 gene locus_tag LOCUS_13410 9912 8782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 10010 11158 gene locus_tag LOCUS_13420 10010 11158 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708833.1 protein_id gnl|my_center|LOCUS_13420 13273 11177 gene locus_tag LOCUS_13430 13273 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 13700 13275 gene locus_tag LOCUS_13440 gene msrB 13700 13275 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8UGX7 protein_id gnl|my_center|LOCUS_13440 14798 13704 gene locus_tag LOCUS_13450 14798 13704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_13450 15303 14917 gene locus_tag LOCUS_13460 15303 14917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 <16809 15457 gene locus_tag LOCUS_13470 <16809 15457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404529.1:30S ribosomal protein S1 >Feature sequence064 2 2974 gene locus_tag LOCUS_13480 2 2974 CDS product exonuclease SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404605.1 protein_id gnl|my_center|LOCUS_13480 3923 2979 gene locus_tag LOCUS_13490 3923 2979 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081271.1 protein_id gnl|my_center|LOCUS_13490 4005 4343 gene locus_tag LOCUS_13500 4005 4343 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404604.1 protein_id gnl|my_center|LOCUS_13500 4440 4514 gene locus_tag LOCUS_t00180 4440 4514 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4629 5720 gene locus_tag LOCUS_13510 4629 5720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5724 7922 gene locus_tag LOCUS_13520 gene ligA 5724 7922 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA1 protein_id gnl|my_center|LOCUS_13520 7922 8491 gene locus_tag LOCUS_13530 7922 8491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 8497 10977 gene locus_tag LOCUS_13540 8497 10977 CDS product 7TM receptor with intracellular metal dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404269.1 protein_id gnl|my_center|LOCUS_13540 12066 11146 gene locus_tag LOCUS_13550 12066 11146 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404268.1 protein_id gnl|my_center|LOCUS_13550 12630 12112 gene locus_tag LOCUS_13560 12630 12112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 14632 12854 gene locus_tag LOCUS_13570 gene uvrC 14632 12854 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S280 protein_id gnl|my_center|LOCUS_13570 14894 16048 gene locus_tag LOCUS_13580 14894 16048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence065 652 1053 gene locus_tag LOCUS_13590 652 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1084 1974 gene locus_tag LOCUS_13600 1084 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2671 1994 gene locus_tag LOCUS_13610 2671 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 2831 3574 gene locus_tag LOCUS_13620 2831 3574 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143646.1 protein_id gnl|my_center|LOCUS_13620 5219 3696 gene locus_tag LOCUS_13630 5219 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403217.1 protein_id gnl|my_center|LOCUS_13630 8134 5285 gene locus_tag LOCUS_13640 8134 5285 CDS product outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403216.1 protein_id gnl|my_center|LOCUS_13640 8382 9707 gene locus_tag LOCUS_13650 8382 9707 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403215.1 protein_id gnl|my_center|LOCUS_13650 9720 11078 gene locus_tag LOCUS_13660 9720 11078 CDS product sorbosone dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766669.1 protein_id gnl|my_center|LOCUS_13660 11805 11095 gene locus_tag LOCUS_13670 11805 11095 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404962.1 protein_id gnl|my_center|LOCUS_13670 13253 11862 gene locus_tag LOCUS_13680 gene rho 13253 11862 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0E2 protein_id gnl|my_center|LOCUS_13680 14671 13376 gene locus_tag LOCUS_13690 14671 13376 CDS product folylpolyglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405137.1 protein_id gnl|my_center|LOCUS_13690 15139 14726 gene locus_tag LOCUS_13700 15139 14726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 15281 15790 gene locus_tag LOCUS_13710 15281 15790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence066 1671 46 gene locus_tag LOCUS_13720 1671 46 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KR0 protein_id gnl|my_center|LOCUS_13720 1759 2637 gene locus_tag LOCUS_13730 1759 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2742 3332 gene locus_tag LOCUS_13740 2742 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 3761 3390 gene locus_tag LOCUS_13750 3761 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13750 3871 4707 gene locus_tag LOCUS_13760 3871 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205603.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13760 4709 5701 gene locus_tag LOCUS_13770 4709 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6839 5691 gene locus_tag LOCUS_13780 gene rluD 6839 5691 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3B7 protein_id gnl|my_center|LOCUS_13780 8020 6836 gene locus_tag LOCUS_13790 8020 6836 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403941.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13790 9196 8069 gene locus_tag LOCUS_13800 9196 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119943.1 protein_id gnl|my_center|LOCUS_13800 10420 9269 gene locus_tag LOCUS_13810 gene dprA 10420 9269 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403940.1 protein_id gnl|my_center|LOCUS_13810 10496 11029 gene locus_tag LOCUS_13820 10496 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 12209 11052 gene locus_tag LOCUS_13830 12209 11052 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_13830 12424 12206 gene locus_tag LOCUS_13840 12424 12206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 12535 13284 gene locus_tag LOCUS_13850 gene comF 12535 13284 CDS product competence protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403831.1 protein_id gnl|my_center|LOCUS_13850 13290 14411 gene locus_tag LOCUS_13860 13290 14411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence067 109 618 gene locus_tag LOCUS_13870 109 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 650 2536 gene locus_tag LOCUS_13880 gene dnaG 650 2536 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3X9 protein_id gnl|my_center|LOCUS_13880 2625 3398 gene locus_tag LOCUS_13890 2625 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3506 6025 gene locus_tag LOCUS_13900 gene ppk 3506 6025 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 protein_id gnl|my_center|LOCUS_13900 6118 6633 gene locus_tag LOCUS_13910 6118 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6722 9415 gene locus_tag LOCUS_13920 6722 9415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 9457 9861 gene locus_tag LOCUS_13930 9457 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 9910 10245 gene locus_tag LOCUS_13940 9910 10245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10248 10553 gene locus_tag LOCUS_13950 10248 10553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 11628 10447 gene locus_tag LOCUS_13960 11628 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 12700 11654 gene locus_tag LOCUS_13970 12700 11654 CDS product acid phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797170.1 protein_id gnl|my_center|LOCUS_13970 13509 12709 gene locus_tag LOCUS_13980 13509 12709 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403528.1 protein_id gnl|my_center|LOCUS_13980 13636 14166 gene locus_tag LOCUS_13990 gene msrA 13636 14166 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_13990 15489 14767 gene locus_tag LOCUS_14000 15489 14767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence068 901 1245 gene locus_tag LOCUS_14010 901 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1364 2245 gene locus_tag LOCUS_14020 gene sucD 1364 2245 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4S3 protein_id gnl|my_center|LOCUS_14020 2306 2980 gene locus_tag LOCUS_14030 gene engB 2306 2980 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WUI3 protein_id gnl|my_center|LOCUS_14030 3349 2996 gene locus_tag LOCUS_14040 3349 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 3413 4018 gene locus_tag LOCUS_14050 3413 4018 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403296.1 protein_id gnl|my_center|LOCUS_14050 4741 4031 gene locus_tag LOCUS_14060 4741 4031 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403295.1 protein_id gnl|my_center|LOCUS_14060 6117 4921 gene locus_tag LOCUS_14070 6117 4921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403294.1 protein_id gnl|my_center|LOCUS_14070 6564 6172 gene locus_tag LOCUS_14080 6564 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 7951 6590 gene locus_tag LOCUS_14090 gene bioF 7951 6590 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403293.1 protein_id gnl|my_center|LOCUS_14090 9062 7965 gene locus_tag LOCUS_14100 9062 7965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 10494 9199 gene locus_tag LOCUS_14110 10494 9199 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404451.1 protein_id gnl|my_center|LOCUS_14110 10596 11960 gene locus_tag LOCUS_14120 10596 11960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 12094 14307 gene locus_tag LOCUS_14130 12094 14307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 14307 14987 gene locus_tag LOCUS_14140 14307 14987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404594.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence069 962 588 gene locus_tag LOCUS_14150 962 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2066 1197 gene locus_tag LOCUS_14160 2066 1197 CDS product ATP-grasp domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265999.1 protein_id gnl|my_center|LOCUS_14160 2348 2112 gene locus_tag LOCUS_14170 2348 2112 CDS product DUF3072 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227672.1 protein_id gnl|my_center|LOCUS_14170 2532 4325 gene locus_tag LOCUS_14180 2532 4325 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_14180 6469 4322 gene locus_tag LOCUS_14190 6469 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 6876 7343 gene locus_tag LOCUS_14200 6876 7343 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403162.1 protein_id gnl|my_center|LOCUS_14200 7390 9543 gene locus_tag LOCUS_14210 7390 9543 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888665.1 protein_id gnl|my_center|LOCUS_14210 9736 11115 gene locus_tag LOCUS_14220 9736 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 11352 11681 gene locus_tag LOCUS_14230 11352 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 12501 11683 gene locus_tag LOCUS_14240 12501 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 12500 14410 gene locus_tag LOCUS_14250 gene msbA 12500 14410 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036606.1 protein_id gnl|my_center|LOCUS_14250 14594 14926 gene locus_tag LOCUS_14260 14594 14926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence070 2808 1909 gene locus_tag LOCUS_14270 2808 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2998 3645 gene locus_tag LOCUS_14280 2998 3645 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_14280 3678 6227 gene locus_tag LOCUS_14290 3678 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 7265 6330 gene locus_tag LOCUS_14300 gene pqqB 7265 6330 CDS product coenzyme PQQ synthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IZR4 protein_id gnl|my_center|LOCUS_14300 9529 7268 gene locus_tag LOCUS_14310 gene dpp4 9529 7268 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118275.1 protein_id gnl|my_center|LOCUS_14310 10702 9809 gene locus_tag LOCUS_14320 10702 9809 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022027.1 protein_id gnl|my_center|LOCUS_14320 11862 10789 gene locus_tag LOCUS_14330 gene rfbE 11862 10789 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121410.1 protein_id gnl|my_center|LOCUS_14330 13114 11876 gene locus_tag LOCUS_14340 13114 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 13261 13186 gene locus_tag LOCUS_t00190 13261 13186 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13449 13847 gene locus_tag LOCUS_14350 13449 13847 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405207.1 protein_id gnl|my_center|LOCUS_14350 14969 13947 gene locus_tag LOCUS_14360 gene pyrB 14969 13947 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2X3 protein_id gnl|my_center|LOCUS_14360 15185 14985 gene locus_tag LOCUS_14370 15185 14985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence071 1518 529 gene locus_tag LOCUS_14380 gene lipH 1518 529 CDS product carboxylesterase NlhH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407276.1 protein_id gnl|my_center|LOCUS_14380 2044 2625 gene locus_tag LOCUS_14390 2044 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 3192 2704 gene locus_tag LOCUS_14400 3192 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 3629 3189 gene locus_tag LOCUS_14410 3629 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3872 6535 gene locus_tag LOCUS_14420 3872 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 6724 7644 gene locus_tag LOCUS_14430 6724 7644 CDS product cytochrome oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256898.1 protein_id gnl|my_center|LOCUS_14430 7647 8426 gene locus_tag LOCUS_14440 7647 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_14440 9862 8483 gene locus_tag LOCUS_14450 gene pgm 9862 8483 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405085.1 protein_id gnl|my_center|LOCUS_14450 10098 10997 gene locus_tag LOCUS_14460 gene ctaB 10098 10997 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S012 protein_id gnl|my_center|LOCUS_14460 10994 11926 gene locus_tag LOCUS_14470 gene drrA 10994 11926 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405088.1 protein_id gnl|my_center|LOCUS_14470 11923 12702 gene locus_tag LOCUS_14480 11923 12702 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S010 protein_id gnl|my_center|LOCUS_14480 12699 13142 gene locus_tag LOCUS_14490 gene yqaA 12699 13142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209451.1 protein_id gnl|my_center|LOCUS_14490 13264 13566 gene locus_tag LOCUS_14500 13264 13566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 14311 13922 gene locus_tag LOCUS_14510 14311 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence072 904 530 gene locus_tag LOCUS_14520 gene rpsL 904 530 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GK0 protein_id gnl|my_center|LOCUS_14520 3691 1169 gene locus_tag LOCUS_14530 3691 1169 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_14530 6042 3835 gene locus_tag LOCUS_14540 6042 3835 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_14540 6295 7269 gene locus_tag LOCUS_14550 6295 7269 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403951.1 protein_id gnl|my_center|LOCUS_14550 7317 8294 gene locus_tag LOCUS_14560 7317 8294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403950.1 protein_id gnl|my_center|LOCUS_14560 8414 9370 gene locus_tag LOCUS_14570 8414 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 9373 10386 gene locus_tag LOCUS_14580 9373 10386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 11450 10500 gene locus_tag LOCUS_14590 11450 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 11487 11675 gene locus_tag LOCUS_14600 11487 11675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 13593 11656 gene locus_tag LOCUS_14610 13593 11656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 14052 13645 gene locus_tag LOCUS_14620 14052 13645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 <14956 14264 gene locus_tag LOCUS_14630 <14956 14264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836566.1:aldehyde dehydrogenase >Feature sequence073 <1 590 gene locus_tag LOCUS_14640 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875973.1:aminotransferase DegT 587 1378 gene locus_tag LOCUS_14650 587 1378 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404618.1 protein_id gnl|my_center|LOCUS_14650 1386 2240 gene locus_tag LOCUS_14660 1386 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 2289 3527 gene locus_tag LOCUS_14670 gene yjhB 2289 3527 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021355.1 protein_id gnl|my_center|LOCUS_14670 3579 4238 gene locus_tag LOCUS_14680 3579 4238 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_14680 5123 4308 gene locus_tag LOCUS_14690 5123 4308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 5422 5120 gene locus_tag LOCUS_14700 5422 5120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404092.1 protein_id gnl|my_center|LOCUS_14700 5554 6603 gene locus_tag LOCUS_14710 5554 6603 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028993.1 protein_id gnl|my_center|LOCUS_14710 7951 6671 gene locus_tag LOCUS_14720 7951 6671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 8945 8025 gene locus_tag LOCUS_14730 8945 8025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10031 9108 gene locus_tag LOCUS_14740 10031 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 11454 10168 gene locus_tag LOCUS_14750 11454 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_14750 11624 12343 gene locus_tag LOCUS_14760 11624 12343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 12722 12793 gene locus_tag LOCUS_t00200 12722 12793 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 13108 14202 gene locus_tag LOCUS_14770 13108 14202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 14744 14256 gene locus_tag LOCUS_14780 14744 14256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence074 2134 626 gene locus_tag LOCUS_14790 2134 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3375 2320 gene locus_tag LOCUS_14800 3375 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 3374 4567 gene locus_tag LOCUS_14810 3374 4567 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028742.1 protein_id gnl|my_center|LOCUS_14810 5894 4575 gene locus_tag LOCUS_14820 5894 4575 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405428.1 protein_id gnl|my_center|LOCUS_14820 6148 7638 gene locus_tag LOCUS_14830 gene atpD 6148 7638 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZV3 protein_id gnl|my_center|LOCUS_14830 7719 8126 gene locus_tag LOCUS_14840 gene atpC 7719 8126 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZV2 protein_id gnl|my_center|LOCUS_14840 8354 8773 gene locus_tag LOCUS_14850 8354 8773 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266257.1 protein_id gnl|my_center|LOCUS_14850 9464 8835 gene locus_tag LOCUS_14860 gene mmyQ 9464 8835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039531.1 protein_id gnl|my_center|LOCUS_14860 9638 12889 gene locus_tag LOCUS_14870 9638 12889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 12900 14117 gene locus_tag LOCUS_14880 12900 14117 CDS product metal-activated pyridoxal enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405150.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence075 4212 2368 gene locus_tag LOCUS_14890 4212 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 4787 4281 gene locus_tag LOCUS_14900 gene coaD 4787 4281 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0U8 protein_id gnl|my_center|LOCUS_14900 5476 4922 gene locus_tag LOCUS_14910 5476 4922 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404806.1 protein_id gnl|my_center|LOCUS_14910 6405 5482 gene locus_tag LOCUS_14920 6405 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 6905 6429 gene locus_tag LOCUS_14930 6905 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 7020 7892 gene locus_tag LOCUS_14940 gene pdxJ 7020 7892 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PEG8 protein_id gnl|my_center|LOCUS_14940 8108 8647 gene locus_tag LOCUS_14950 8108 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 8660 9538 gene locus_tag LOCUS_14960 8660 9538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 9585 11747 gene locus_tag LOCUS_14970 9585 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 11824 12834 gene locus_tag LOCUS_14980 gene era 11824 12834 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0U4 protein_id gnl|my_center|LOCUS_14980 <14074 12919 gene locus_tag LOCUS_14990 <14074 12919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S0U3:erythronate-4-phosphate dehydrogenase >Feature sequence076 2291 1062 gene locus_tag LOCUS_15000 2291 1062 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027702.1 protein_id gnl|my_center|LOCUS_15000 2449 2817 gene locus_tag LOCUS_15010 2449 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3706 2885 gene locus_tag LOCUS_15020 3706 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4685 3780 gene locus_tag LOCUS_15030 4685 3780 CDS product GumN protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402916.1 protein_id gnl|my_center|LOCUS_15030 4772 6130 gene locus_tag LOCUS_15040 4772 6130 CDS product succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404096.1 protein_id gnl|my_center|LOCUS_15040 8371 6152 gene locus_tag LOCUS_15050 8371 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8497 8817 gene locus_tag LOCUS_15060 8497 8817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 8841 9893 gene locus_tag LOCUS_15070 8841 9893 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258490.1 protein_id gnl|my_center|LOCUS_15070 9981 10817 gene locus_tag LOCUS_15080 9981 10817 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389061.1 protein_id gnl|my_center|LOCUS_15080 11270 10929 gene locus_tag LOCUS_15090 11270 10929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 11254 11877 gene locus_tag LOCUS_15100 11254 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 11888 12220 gene locus_tag LOCUS_15110 11888 12220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 12254 12838 gene locus_tag LOCUS_15120 12254 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 >Feature sequence077 1148 543 gene locus_tag LOCUS_15130 1148 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 2329 1238 gene locus_tag LOCUS_15140 2329 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2562 4322 gene locus_tag LOCUS_15150 2562 4322 CDS product dynamin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_15150 4905 4354 gene locus_tag LOCUS_15160 gene paaY 4905 4354 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404393.1 protein_id gnl|my_center|LOCUS_15160 5029 5316 gene locus_tag LOCUS_15170 5029 5316 CDS product polyhydroxyalkanoic acid system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404968.1 protein_id gnl|my_center|LOCUS_15170 5318 6034 gene locus_tag LOCUS_15180 5318 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105970.1 protein_id gnl|my_center|LOCUS_15180 6068 6445 gene locus_tag LOCUS_15190 6068 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 6482 6709 gene locus_tag LOCUS_15200 6482 6709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6760 7710 gene locus_tag LOCUS_15210 gene dapA 6760 7710 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3M1 protein_id gnl|my_center|LOCUS_15210 7714 8085 gene locus_tag LOCUS_15220 7714 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971116.1 protein_id gnl|my_center|LOCUS_15220 8102 8938 gene locus_tag LOCUS_15230 gene dapD 8102 8938 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403729.1 protein_id gnl|my_center|LOCUS_15230 9443 8967 gene locus_tag LOCUS_15240 9443 8967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 10300 9494 gene locus_tag LOCUS_15250 10300 9494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 10397 12181 gene locus_tag LOCUS_15260 10397 12181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence078 1347 952 gene locus_tag LOCUS_15270 1347 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1769 1359 gene locus_tag LOCUS_15280 1769 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 3352 1772 gene locus_tag LOCUS_15290 3352 1772 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064509.1 protein_id gnl|my_center|LOCUS_15290 4357 3503 gene locus_tag LOCUS_15300 4357 3503 CDS product beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89JC3 protein_id gnl|my_center|LOCUS_15300 5845 4418 gene locus_tag LOCUS_15310 5845 4418 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_15310 8721 5983 gene locus_tag LOCUS_15320 8721 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143648.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence079 451 1908 gene locus_tag LOCUS_15330 451 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2028 4349 gene locus_tag LOCUS_15340 2028 4349 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403348.1 protein_id gnl|my_center|LOCUS_15340 4507 4283 gene locus_tag LOCUS_15350 4507 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4724 4903 gene locus_tag LOCUS_15360 4724 4903 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_15360 4984 5877 gene locus_tag LOCUS_15370 4984 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404474.1 protein_id gnl|my_center|LOCUS_15370 5937 8150 gene locus_tag LOCUS_15380 5937 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404473.1 protein_id gnl|my_center|LOCUS_15380 8362 9498 gene locus_tag LOCUS_15390 8362 9498 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_15390 9579 12083 gene locus_tag LOCUS_15400 9579 12083 CDS product glutaminyl-tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405453.1 protein_id gnl|my_center|LOCUS_15400 12089 12577 gene locus_tag LOCUS_15410 12089 12577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 12604 13719 gene locus_tag LOCUS_15420 12604 13719 CDS product peptidase M14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404470.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence080 151 798 gene locus_tag LOCUS_15430 gene rsmG 151 798 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6G7 protein_id gnl|my_center|LOCUS_15430 849 1199 gene locus_tag LOCUS_15440 849 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1267 2649 gene locus_tag LOCUS_15450 gene yqeZ 1267 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54465 protein_id gnl|my_center|LOCUS_15450 2669 3148 gene locus_tag LOCUS_15460 2669 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 3194 3841 gene locus_tag LOCUS_15470 3194 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3831 4226 gene locus_tag LOCUS_15480 3831 4226 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_15480 4624 4223 gene locus_tag LOCUS_15490 4624 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 6123 4717 gene locus_tag LOCUS_15500 6123 4717 CDS product nucleoside transporter NupC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_15500 7467 6295 gene locus_tag LOCUS_15510 7467 6295 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405138.1 protein_id gnl|my_center|LOCUS_15510 7778 8014 gene locus_tag LOCUS_15520 gene rpmB 7778 8014 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZI6 protein_id gnl|my_center|LOCUS_15520 8043 8213 gene locus_tag LOCUS_15530 gene rpmG 8043 8213 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6K1 protein_id gnl|my_center|LOCUS_15530 8271 8447 gene locus_tag LOCUS_15540 8271 8447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 9575 8514 gene locus_tag LOCUS_15550 9575 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 10716 9577 gene locus_tag LOCUS_15560 10716 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 10886 13141 gene locus_tag LOCUS_15570 10886 13141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 >Feature sequence081 254 2821 gene locus_tag LOCUS_15580 254 2821 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931165.1 protein_id gnl|my_center|LOCUS_15580 2877 3134 gene locus_tag LOCUS_15590 2877 3134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 4463 3417 gene locus_tag LOCUS_15600 4463 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 5533 4499 gene locus_tag LOCUS_15610 5533 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_15610 7249 5552 gene locus_tag LOCUS_15620 7249 5552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 8786 7254 gene locus_tag LOCUS_15630 8786 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 9190 10719 gene locus_tag LOCUS_15640 gene ybaR 9190 10719 CDS product putative sulfate transporter YbaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55189 protein_id gnl|my_center|LOCUS_15640 11501 10722 gene locus_tag LOCUS_15650 11501 10722 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_15650 12327 11581 gene locus_tag LOCUS_15660 12327 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404225.1 protein_id gnl|my_center|LOCUS_15660 <13200 12389 gene locus_tag LOCUS_15670 <13200 12389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1G3:fructose-1,6-bisphosphatase class 1 2 >Feature sequence082 2666 3295 gene locus_tag LOCUS_15680 gene hisH 2666 3295 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S299 protein_id gnl|my_center|LOCUS_15680 3300 4100 gene locus_tag LOCUS_15690 gene hisA 3300 4100 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S296 protein_id gnl|my_center|LOCUS_15690 4104 4889 gene locus_tag LOCUS_15700 gene hisF 4104 4889 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S295 protein_id gnl|my_center|LOCUS_15700 4886 5233 gene locus_tag LOCUS_15710 4886 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5238 5741 gene locus_tag LOCUS_15720 5238 5741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5773 6798 gene locus_tag LOCUS_15730 5773 6798 CDS product potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403187.1 protein_id gnl|my_center|LOCUS_15730 7038 8066 gene locus_tag LOCUS_15740 7038 8066 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403186.1 protein_id gnl|my_center|LOCUS_15740 8544 8071 gene locus_tag LOCUS_15750 8544 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 9611 8544 gene locus_tag LOCUS_15760 gene asd 9611 8544 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404575.1 protein_id gnl|my_center|LOCUS_15760 9768 10649 gene locus_tag LOCUS_15770 gene folD 9768 10649 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73RS2 protein_id gnl|my_center|LOCUS_15770 10655 11701 gene locus_tag LOCUS_15780 10655 11701 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404577.1 protein_id gnl|my_center|LOCUS_15780 11851 12477 gene locus_tag LOCUS_15790 gene cdsA 11851 12477 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404449.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence083 2393 2956 gene locus_tag LOCUS_15800 2393 2956 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_15800 3568 2972 gene locus_tag LOCUS_15810 3568 2972 CDS product NAD(P)H dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYU4 protein_id gnl|my_center|LOCUS_15810 4269 3685 gene locus_tag LOCUS_15820 4269 3685 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404817.1 protein_id gnl|my_center|LOCUS_15820 4949 4281 gene locus_tag LOCUS_15830 gene rsmI 4949 4281 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0T7 protein_id gnl|my_center|LOCUS_15830 6505 5039 gene locus_tag LOCUS_15840 6505 5039 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404815.1 protein_id gnl|my_center|LOCUS_15840 6638 7294 gene locus_tag LOCUS_15850 6638 7294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404814.1 protein_id gnl|my_center|LOCUS_15850 7905 7285 gene locus_tag LOCUS_15860 7905 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 8813 7947 gene locus_tag LOCUS_15870 8813 7947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 10096 8957 gene locus_tag LOCUS_15880 10096 8957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 10229 12565 gene locus_tag LOCUS_15890 10229 12565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023927.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence084 1421 909 gene locus_tag LOCUS_15900 1421 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2053 1418 gene locus_tag LOCUS_15910 2053 1418 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886826.1 protein_id gnl|my_center|LOCUS_15910 2138 2734 gene locus_tag LOCUS_15920 2138 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3469 2741 gene locus_tag LOCUS_15930 3469 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 5035 3560 gene locus_tag LOCUS_15940 5035 3560 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889294.1 protein_id gnl|my_center|LOCUS_15940 6867 5080 gene locus_tag LOCUS_15950 6867 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 7535 6882 gene locus_tag LOCUS_15960 7535 6882 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_15960 8373 7537 gene locus_tag LOCUS_15970 8373 7537 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_15970 9752 8370 gene locus_tag LOCUS_15980 gene hemL 9752 8370 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887443.1 protein_id gnl|my_center|LOCUS_15980 11100 9745 gene locus_tag LOCUS_15990 11100 9745 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222496.1 protein_id gnl|my_center|LOCUS_15990 11296 11514 gene locus_tag LOCUS_16000 11296 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 <12696 11590 gene locus_tag LOCUS_16010 <12696 11590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001091255.1:two-component system sensor histidine kinase UhpB >Feature sequence085 3671 1602 gene locus_tag LOCUS_16020 gene pepO 3671 1602 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_16020 3816 4502 gene locus_tag LOCUS_16030 3816 4502 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S184 protein_id gnl|my_center|LOCUS_16030 4617 5990 gene locus_tag LOCUS_16040 gene mauG 4617 5990 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119189.1 protein_id gnl|my_center|LOCUS_16040 5999 6688 gene locus_tag LOCUS_16050 5999 6688 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_16050 6712 8136 gene locus_tag LOCUS_16060 6712 8136 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_16060 8175 8795 gene locus_tag LOCUS_16070 8175 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 8785 9447 gene locus_tag LOCUS_16080 gene folE 8785 9447 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYU5 protein_id gnl|my_center|LOCUS_16080 9530 10150 gene locus_tag LOCUS_16090 9530 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118787.1 protein_id gnl|my_center|LOCUS_16090 10157 10861 gene locus_tag LOCUS_16100 10157 10861 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405499.1 protein_id gnl|my_center|LOCUS_16100 10864 11436 gene locus_tag LOCUS_16110 10864 11436 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267057.1 protein_id gnl|my_center|LOCUS_16110 11441 11749 gene locus_tag LOCUS_16120 11441 11749 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087485.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence086 <1 778 gene locus_tag LOCUS_16130 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975718.1:hydrolase 1044 1796 gene locus_tag LOCUS_16140 1044 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1832 2200 gene locus_tag LOCUS_16150 1832 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2305 3021 gene locus_tag LOCUS_16160 2305 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3915 3157 gene locus_tag LOCUS_16170 3915 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 4735 4037 gene locus_tag LOCUS_16180 4735 4037 CDS product TIGR02453 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403639.1 protein_id gnl|my_center|LOCUS_16180 4880 5101 gene locus_tag LOCUS_16190 4880 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 6382 5177 gene locus_tag LOCUS_16200 6382 5177 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403533.1 protein_id gnl|my_center|LOCUS_16200 6484 7680 gene locus_tag LOCUS_16210 6484 7680 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403619.1 protein_id gnl|my_center|LOCUS_16210 8134 9891 gene locus_tag LOCUS_16220 gene ggt 8134 9891 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403657.1 protein_id gnl|my_center|LOCUS_16220 10054 10806 gene locus_tag LOCUS_16230 gene gph 10054 10806 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XT39 protein_id gnl|my_center|LOCUS_16230 10846 11235 gene locus_tag LOCUS_16240 10846 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 11777 11286 gene locus_tag LOCUS_16250 11777 11286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 <12513 11845 gene locus_tag LOCUS_16260 <12513 11845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S450:amidophosphoribosyltransferase >Feature sequence087 379 768 gene locus_tag LOCUS_16270 379 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1211 765 gene locus_tag LOCUS_16280 1211 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 1339 2172 gene locus_tag LOCUS_16290 1339 2172 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_16290 2284 3462 gene locus_tag LOCUS_16300 2284 3462 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224399.1 protein_id gnl|my_center|LOCUS_16300 3639 6641 gene locus_tag LOCUS_16310 gene uvrA2 3639 6641 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GXX6 protein_id gnl|my_center|LOCUS_16310 8282 6681 gene locus_tag LOCUS_16320 8282 6681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 8565 8311 gene locus_tag LOCUS_16330 8565 8311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 9029 9796 gene locus_tag LOCUS_16340 9029 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 10532 9894 gene locus_tag LOCUS_16350 10532 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902507.1 protein_id gnl|my_center|LOCUS_16350 10594 12066 gene locus_tag LOCUS_16360 10594 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence088 25 699 gene locus_tag LOCUS_16370 25 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 1268 696 gene locus_tag LOCUS_16380 1268 696 CDS product UPF0301 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S591 protein_id gnl|my_center|LOCUS_16380 1408 3093 gene locus_tag LOCUS_16390 gene ctp 1408 3093 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404678.1 protein_id gnl|my_center|LOCUS_16390 3366 4130 gene locus_tag LOCUS_16400 3366 4130 CDS product flagellar motor protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404426.1 protein_id gnl|my_center|LOCUS_16400 4205 4489 gene locus_tag LOCUS_16410 4205 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 4514 5065 gene locus_tag LOCUS_16420 4514 5065 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404424.1 protein_id gnl|my_center|LOCUS_16420 5126 5578 gene locus_tag LOCUS_16430 5126 5578 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_16430 5738 6751 gene locus_tag LOCUS_16440 5738 6751 CDS product isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404422.1 protein_id gnl|my_center|LOCUS_16440 6760 7173 gene locus_tag LOCUS_16450 6760 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404421.1 protein_id gnl|my_center|LOCUS_16450 7174 8061 gene locus_tag LOCUS_16460 7174 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404420.1 protein_id gnl|my_center|LOCUS_16460 9112 8033 gene locus_tag LOCUS_16470 9112 8033 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404419.1 protein_id gnl|my_center|LOCUS_16470 9337 11343 gene locus_tag LOCUS_16480 9337 11343 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404418.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence089 381 1436 gene locus_tag LOCUS_16490 381 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1736 3760 gene locus_tag LOCUS_16500 gene acs 1736 3760 CDS product acetyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404558.1 protein_id gnl|my_center|LOCUS_16500 4886 4260 gene locus_tag LOCUS_16510 4886 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 5387 4965 gene locus_tag LOCUS_16520 5387 4965 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B849 protein_id gnl|my_center|LOCUS_16520 5446 6204 gene locus_tag LOCUS_16530 5446 6204 CDS product acyl-ACP thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812571.1 protein_id gnl|my_center|LOCUS_16530 6201 6584 gene locus_tag LOCUS_16540 6201 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 7094 6603 gene locus_tag LOCUS_16550 7094 6603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 10463 7386 gene locus_tag LOCUS_16560 gene polA 10463 7386 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08307 protein_id gnl|my_center|LOCUS_16560 10671 11345 gene locus_tag LOCUS_16570 10671 11345 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404382.1 protein_id gnl|my_center|LOCUS_16570 <12409 11267 gene locus_tag LOCUS_16580 <12409 11267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase >Feature sequence090 521 3259 gene locus_tag LOCUS_16590 521 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 3377 4966 gene locus_tag LOCUS_16600 3377 4966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 5021 5620 gene locus_tag LOCUS_16610 5021 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_16610 5682 7148 gene locus_tag LOCUS_16620 gene rpoN 5682 7148 CDS product RNA polymerase sigma-54 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_16620 7219 7794 gene locus_tag LOCUS_16630 7219 7794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8109 8333 gene locus_tag LOCUS_16640 8109 8333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 8627 9835 gene locus_tag LOCUS_16650 8627 9835 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_16650 9953 10924 gene locus_tag LOCUS_16660 9953 10924 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403186.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence091 3365 63 gene locus_tag LOCUS_16670 3365 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3782 3369 gene locus_tag LOCUS_16680 3782 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 4723 3731 gene locus_tag LOCUS_16690 4723 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 5327 4860 gene locus_tag LOCUS_16700 gene ygaU 5327 4860 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522413.1 protein_id gnl|my_center|LOCUS_16700 5600 6226 gene locus_tag LOCUS_16710 5600 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 8170 6296 gene locus_tag LOCUS_16720 8170 6296 CDS product angiotensin-converting enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143136.1 protein_id gnl|my_center|LOCUS_16720 8297 9385 gene locus_tag LOCUS_16730 gene aroB 8297 9385 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2D3 protein_id gnl|my_center|LOCUS_16730 10351 9389 gene locus_tag LOCUS_16740 gene trxB 10351 9389 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226059.1 protein_id gnl|my_center|LOCUS_16740 11275 10409 gene locus_tag LOCUS_16750 11275 10409 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403867.1 protein_id gnl|my_center|LOCUS_16750 11481 11978 gene locus_tag LOCUS_16760 gene ssb 11481 11978 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S565 protein_id gnl|my_center|LOCUS_16760 >Feature sequence092 85 2 gene locus_tag LOCUS_t00210 85 2 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 184 111 gene locus_tag LOCUS_t00220 184 111 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 907 245 gene locus_tag LOCUS_16770 907 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16770 1386 910 gene locus_tag LOCUS_16780 gene ispF 1386 910 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S211 protein_id gnl|my_center|LOCUS_16780 2248 1568 gene locus_tag LOCUS_16790 gene ispD 2248 1568 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S210 protein_id gnl|my_center|LOCUS_16790 3476 2310 gene locus_tag LOCUS_16800 gene queA 3476 2310 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S209 protein_id gnl|my_center|LOCUS_16800 4799 3525 gene locus_tag LOCUS_16810 gene fahA 4799 3525 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405078.1 protein_id gnl|my_center|LOCUS_16810 5865 4924 gene locus_tag LOCUS_16820 5865 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405079.1 protein_id gnl|my_center|LOCUS_16820 6073 7233 gene locus_tag LOCUS_16830 6073 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 7329 8489 gene locus_tag LOCUS_16840 7329 8489 CDS product cystathionine beta-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405081.1 protein_id gnl|my_center|LOCUS_16840 8568 9278 gene locus_tag LOCUS_16850 8568 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 9743 9282 gene locus_tag LOCUS_16860 9743 9282 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258387.1 protein_id gnl|my_center|LOCUS_16860 10723 9902 gene locus_tag LOCUS_16870 10723 9902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 11555 10773 gene locus_tag LOCUS_16880 11555 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 <12273 11627 gene locus_tag LOCUS_16890 <12273 11627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403352.1:tungsten formylmethanofuran dehydrogenase subunit E >Feature sequence093 596 195 gene locus_tag LOCUS_16900 596 195 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979519.1 protein_id gnl|my_center|LOCUS_16900 1863 658 gene locus_tag LOCUS_16910 gene moeA 1863 658 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_16910 2034 2678 gene locus_tag LOCUS_16920 2034 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3416 2748 gene locus_tag LOCUS_16930 3416 2748 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_16930 3502 4641 gene locus_tag LOCUS_16940 3502 4641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_16940 4700 5524 gene locus_tag LOCUS_16950 gene rsmA 4700 5524 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0I2 protein_id gnl|my_center|LOCUS_16950 5530 6909 gene locus_tag LOCUS_16960 gene mgtE 5530 6909 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0I3 protein_id gnl|my_center|LOCUS_16960 7012 7677 gene locus_tag LOCUS_16970 7012 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8086 7577 gene locus_tag LOCUS_16980 8086 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 8667 8218 gene locus_tag LOCUS_16990 8667 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404918.1 protein_id gnl|my_center|LOCUS_16990 9110 8664 gene locus_tag LOCUS_17000 9110 8664 CDS product cytochrome C biogenesis protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_17000 9398 9153 gene locus_tag LOCUS_17010 9398 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 10146 9403 gene locus_tag LOCUS_17020 10146 9403 CDS product heme exporter protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404915.1 protein_id gnl|my_center|LOCUS_17020 10292 11743 gene locus_tag LOCUS_17030 gene pykA 10292 11743 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3S2 protein_id gnl|my_center|LOCUS_17030 >Feature sequence094 1777 299 gene locus_tag LOCUS_17040 1777 299 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405109.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17040 1854 2183 gene locus_tag LOCUS_17050 1854 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 2176 3291 gene locus_tag LOCUS_17060 2176 3291 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402890.1 protein_id gnl|my_center|LOCUS_17060 3529 5463 gene locus_tag LOCUS_17070 3529 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5520 6356 gene locus_tag LOCUS_17080 5520 6356 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402891.1 protein_id gnl|my_center|LOCUS_17080 7533 6409 gene locus_tag LOCUS_17090 gene deoB 7533 6409 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RID0 protein_id gnl|my_center|LOCUS_17090 9158 7632 gene locus_tag LOCUS_17100 9158 7632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 9157 9489 gene locus_tag LOCUS_17110 9157 9489 CDS product alkyl hydroperoxide reductase AhpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DK3 protein_id gnl|my_center|LOCUS_17110 9583 10746 gene locus_tag LOCUS_17120 9583 10746 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_17120 10813 11088 gene locus_tag LOCUS_17130 10813 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 <12103 11124 gene locus_tag LOCUS_17140 <12103 11124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403887.1:lysine 2,3-aminomutase >Feature sequence095 716 387 gene locus_tag LOCUS_17150 716 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2272 758 gene locus_tag LOCUS_17160 2272 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3473 2394 gene locus_tag LOCUS_17170 3473 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405256.1 protein_id gnl|my_center|LOCUS_17170 4088 3570 gene locus_tag LOCUS_17180 4088 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 4373 5164 gene locus_tag LOCUS_17190 4373 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 5265 5657 gene locus_tag LOCUS_17200 5265 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 6594 5794 gene locus_tag LOCUS_17210 6594 5794 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_17210 7021 7803 gene locus_tag LOCUS_17220 7021 7803 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403465.1 protein_id gnl|my_center|LOCUS_17220 7834 8151 gene locus_tag LOCUS_17230 7834 8151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8148 9332 gene locus_tag LOCUS_17240 8148 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403464.1 protein_id gnl|my_center|LOCUS_17240 9423 10256 gene locus_tag LOCUS_17250 gene deoD 9423 10256 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBH2 protein_id gnl|my_center|LOCUS_17250 11431 10286 gene locus_tag LOCUS_17260 11431 10286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 >Feature sequence096 <1 876 gene locus_tag LOCUS_17270 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259145.1:apolipoprotein acyltransferase 948 2033 gene locus_tag LOCUS_17280 948 2033 CDS product agmatine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_17280 2809 2030 gene locus_tag LOCUS_17290 2809 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140913.1 protein_id gnl|my_center|LOCUS_17290 3736 2819 gene locus_tag LOCUS_17300 3736 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3735 3908 gene locus_tag LOCUS_17310 3735 3908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 4084 3836 gene locus_tag LOCUS_17320 4084 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 5908 4169 gene locus_tag LOCUS_17330 gene asnB 5908 4169 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337566.1 protein_id gnl|my_center|LOCUS_17330 6749 6081 gene locus_tag LOCUS_17340 6749 6081 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_17340 11182 6842 gene locus_tag LOCUS_17350 11182 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 11814 11275 gene locus_tag LOCUS_17360 11814 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404199.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence097 2257 908 gene locus_tag LOCUS_17370 2257 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 2864 2367 gene locus_tag LOCUS_17380 gene aspG 2864 2367 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_17380 3212 2874 gene locus_tag LOCUS_17390 3212 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 3523 3209 gene locus_tag LOCUS_17400 3523 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_17400 4502 3582 gene locus_tag LOCUS_17410 gene hisG 4502 3582 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KB10 protein_id gnl|my_center|LOCUS_17410 5627 4515 gene locus_tag LOCUS_17420 5627 4515 CDS product DUF4837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_17420 6469 5624 gene locus_tag LOCUS_17430 gene trpA 6469 5624 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z2 protein_id gnl|my_center|LOCUS_17430 7701 6466 gene locus_tag LOCUS_17440 gene trpB 7701 6466 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z3 protein_id gnl|my_center|LOCUS_17440 8335 7694 gene locus_tag LOCUS_17450 gene trpF 8335 7694 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z4 protein_id gnl|my_center|LOCUS_17450 9168 8332 gene locus_tag LOCUS_17460 gene trpC 9168 8332 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z5 protein_id gnl|my_center|LOCUS_17460 10220 9165 gene locus_tag LOCUS_17470 gene trpD 10220 9165 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Z6 protein_id gnl|my_center|LOCUS_17470 10849 10259 gene locus_tag LOCUS_17480 gene trpG 10849 10259 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_17480 <11805 10866 gene locus_tag LOCUS_17490 <11805 10866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1Z8:tryptophan--tRNA ligase >Feature sequence098 1906 707 gene locus_tag LOCUS_17500 1906 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 3282 2011 gene locus_tag LOCUS_17510 gene clpX 3282 2011 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFC3 protein_id gnl|my_center|LOCUS_17510 3456 4460 gene locus_tag LOCUS_17520 3456 4460 CDS product rRNA cytosine-C5-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943378.1 protein_id gnl|my_center|LOCUS_17520 7292 4629 gene locus_tag LOCUS_17530 7292 4629 CDS product peptidase M36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962454.1 protein_id gnl|my_center|LOCUS_17530 11140 7505 gene locus_tag LOCUS_17540 11140 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence099 473 916 gene locus_tag LOCUS_17550 473 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1005 3128 gene locus_tag LOCUS_17560 1005 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 4052 3132 gene locus_tag LOCUS_17570 4052 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 4683 4111 gene locus_tag LOCUS_17580 4683 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 5257 4676 gene locus_tag LOCUS_17590 5257 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 6058 5270 gene locus_tag LOCUS_17600 6058 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 6561 6055 gene locus_tag LOCUS_17610 6561 6055 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404452.1 protein_id gnl|my_center|LOCUS_17610 7412 6621 gene locus_tag LOCUS_17620 gene pyrF 7412 6621 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1S9 protein_id gnl|my_center|LOCUS_17620 8083 7409 gene locus_tag LOCUS_17630 8083 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 8909 8061 gene locus_tag LOCUS_17640 8909 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404562.1 protein_id gnl|my_center|LOCUS_17640 8979 9575 gene locus_tag LOCUS_17650 8979 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404561.1 protein_id gnl|my_center|LOCUS_17650 9572 9952 gene locus_tag LOCUS_17660 9572 9952 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1J6 protein_id gnl|my_center|LOCUS_17660 9993 10859 gene locus_tag LOCUS_17670 9993 10859 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259348.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence100 3008 657 gene locus_tag LOCUS_17680 3008 657 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659317.1 protein_id gnl|my_center|LOCUS_17680 5459 3042 gene locus_tag LOCUS_17690 5459 3042 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_17690 7889 5481 gene locus_tag LOCUS_17700 7889 5481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_17700 10394 8019 gene locus_tag LOCUS_17710 10394 8019 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107802.1 protein_id gnl|my_center|LOCUS_17710 <11042 10439 gene locus_tag LOCUS_17720 <11042 10439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107499.1:ABC transporter permease >Feature sequence101 3146 1689 gene locus_tag LOCUS_17730 3146 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 3889 3212 gene locus_tag LOCUS_17740 3889 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4566 3904 gene locus_tag LOCUS_17750 4566 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6662 4737 gene locus_tag LOCUS_17760 6662 4737 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404025.1 protein_id gnl|my_center|LOCUS_17760 8067 6715 gene locus_tag LOCUS_17770 8067 6715 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404024.1 protein_id gnl|my_center|LOCUS_17770 9820 8126 gene locus_tag LOCUS_17780 9820 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence102 230 2560 gene locus_tag LOCUS_17790 gene spoT 230 2560 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_17790 2791 3180 gene locus_tag LOCUS_17800 gene hup 2791 3180 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403823.1 protein_id gnl|my_center|LOCUS_17800 3242 3679 gene locus_tag LOCUS_17810 3242 3679 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3N5 protein_id gnl|my_center|LOCUS_17810 3780 4352 gene locus_tag LOCUS_17820 gene def 3780 4352 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S316 protein_id gnl|my_center|LOCUS_17820 4418 4657 gene locus_tag LOCUS_17830 4418 4657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 4706 5497 gene locus_tag LOCUS_17840 4706 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 6500 5529 gene locus_tag LOCUS_17850 gene dfrA 6500 5529 CDS product dihydroflavonol 4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403593.1 protein_id gnl|my_center|LOCUS_17850 7047 6502 gene locus_tag LOCUS_17860 gene pycA 7047 6502 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_17860 7132 7740 gene locus_tag LOCUS_17870 gene aat 7132 7740 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJT7 protein_id gnl|my_center|LOCUS_17870 8594 7737 gene locus_tag LOCUS_17880 8594 7737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 8727 9746 gene locus_tag LOCUS_17890 8727 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403590.1 protein_id gnl|my_center|LOCUS_17890 9800 10780 gene locus_tag LOCUS_17900 gene pfkA 9800 10780 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence103 1627 167 gene locus_tag LOCUS_17910 1627 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1854 2405 gene locus_tag LOCUS_17920 1854 2405 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123671.1 protein_id gnl|my_center|LOCUS_17920 2459 4651 gene locus_tag LOCUS_17930 2459 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 5272 4658 gene locus_tag LOCUS_17940 5272 4658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 6065 5331 gene locus_tag LOCUS_17950 6065 5331 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002070937.1 protein_id gnl|my_center|LOCUS_17950 10210 6107 gene locus_tag LOCUS_17960 10210 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 10409 10771 gene locus_tag LOCUS_17970 10409 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence104 379 546 gene locus_tag LOCUS_17980 379 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1310 558 gene locus_tag LOCUS_17990 gene dck 1310 558 CDS product deoxyadenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403716.1 protein_id gnl|my_center|LOCUS_17990 2127 1315 gene locus_tag LOCUS_18000 2127 1315 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_18000 3093 2206 gene locus_tag LOCUS_18010 3093 2206 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705765.1 protein_id gnl|my_center|LOCUS_18010 3197 5098 gene locus_tag LOCUS_18020 3197 5098 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404643.1 protein_id gnl|my_center|LOCUS_18020 5273 5109 gene locus_tag LOCUS_18030 5273 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 5521 5757 gene locus_tag LOCUS_18040 5521 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 8189 5820 gene locus_tag LOCUS_18050 8189 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 10030 8186 gene locus_tag LOCUS_18060 10030 8186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 <10696 10169 gene locus_tag LOCUS_18070 <10696 10169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S238:tyrosine--tRNA ligase >Feature sequence105 604 1122 gene locus_tag LOCUS_18080 604 1122 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930581.1 protein_id gnl|my_center|LOCUS_18080 1268 1630 gene locus_tag LOCUS_18090 1268 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 1985 3700 gene locus_tag LOCUS_18100 1985 3700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3761 5071 gene locus_tag LOCUS_18110 3761 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5359 6177 gene locus_tag LOCUS_18120 gene uppP 5359 6177 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I2E5 protein_id gnl|my_center|LOCUS_18120 7823 6174 gene locus_tag LOCUS_18130 7823 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_18130 8298 7870 gene locus_tag LOCUS_18140 8298 7870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 8911 8387 gene locus_tag LOCUS_18150 8911 8387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 <10623 9001 gene locus_tag LOCUS_18160 <10623 9001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803940.1:PDK repeat-containing protein >Feature sequence106 1862 711 gene locus_tag LOCUS_18170 gene alr 1862 711 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S515 protein_id gnl|my_center|LOCUS_18170 2453 1878 gene locus_tag LOCUS_18180 2453 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 2580 3662 gene locus_tag LOCUS_18190 gene rlmN 2580 3662 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P9 protein_id gnl|my_center|LOCUS_18190 4468 3782 gene locus_tag LOCUS_18200 4468 3782 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009901.1 protein_id gnl|my_center|LOCUS_18200 5665 4508 gene locus_tag LOCUS_18210 5665 4508 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404125.1 protein_id gnl|my_center|LOCUS_18210 6678 5689 gene locus_tag LOCUS_18220 6678 5689 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404124.1 protein_id gnl|my_center|LOCUS_18220 6922 6764 gene locus_tag LOCUS_18230 6922 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 7085 8209 gene locus_tag LOCUS_18240 gene gcvT 7085 8209 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S244 protein_id gnl|my_center|LOCUS_18240 8212 8940 gene locus_tag LOCUS_18250 gene comB 8212 8940 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S243 protein_id gnl|my_center|LOCUS_18250 9379 9098 gene locus_tag LOCUS_18260 gene acyP 9379 9098 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V7 protein_id gnl|my_center|LOCUS_18260 9941 9384 gene locus_tag LOCUS_18270 9941 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403983.1 protein_id gnl|my_center|LOCUS_18270 <10591 9947 gene locus_tag LOCUS_18280 <10591 9947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A3CMP6:deoxyribose-phosphate aldolase >Feature sequence107 2743 635 gene locus_tag LOCUS_18290 gene nuoL 2743 635 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404195.1 protein_id gnl|my_center|LOCUS_18290 3129 2830 gene locus_tag LOCUS_18300 gene nuoK 3129 2830 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2L3 protein_id gnl|my_center|LOCUS_18300 3661 3158 gene locus_tag LOCUS_18310 gene nuoJ 3661 3158 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404193.1 protein_id gnl|my_center|LOCUS_18310 3804 4952 gene locus_tag LOCUS_18320 3804 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6400 4988 gene locus_tag LOCUS_18330 6400 4988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119919.1 protein_id gnl|my_center|LOCUS_18330 7521 6400 gene locus_tag LOCUS_18340 gene serC 7521 6400 CDS product phosphoserine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0G9 protein_id gnl|my_center|LOCUS_18340 8140 7676 gene locus_tag LOCUS_18350 8140 7676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404629.1 protein_id gnl|my_center|LOCUS_18350 8940 8164 gene locus_tag LOCUS_18360 8940 8164 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889488.1 protein_id gnl|my_center|LOCUS_18360 9647 8937 gene locus_tag LOCUS_18370 9647 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 9987 9913 gene locus_tag LOCUS_t00230 9987 9913 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence108 <1 734 gene locus_tag LOCUS_18380 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404684.1:DNA-directed RNA polymerase sigma-70 factor 772 1905 gene locus_tag LOCUS_18390 772 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 2600 1917 gene locus_tag LOCUS_18400 2600 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 2850 4199 gene locus_tag LOCUS_18410 gene amt 2850 4199 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZZ6 protein_id gnl|my_center|LOCUS_18410 5610 4252 gene locus_tag LOCUS_18420 5610 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 6414 5689 gene locus_tag LOCUS_18430 gene uppS1 6414 5689 CDS product isoprenyl transferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89W41 protein_id gnl|my_center|LOCUS_18430 6823 6485 gene locus_tag LOCUS_18440 6823 6485 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920067.1 protein_id gnl|my_center|LOCUS_18440 7516 6827 gene locus_tag LOCUS_18450 7516 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 8379 7540 gene locus_tag LOCUS_18460 gene nei 8379 7540 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228580.1 protein_id gnl|my_center|LOCUS_18460 8947 8372 gene locus_tag LOCUS_18470 8947 8372 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119942.1 protein_id gnl|my_center|LOCUS_18470 10029 8944 gene locus_tag LOCUS_18480 10029 8944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence109 1903 710 gene locus_tag LOCUS_18490 1903 710 CDS product N-acyl-L-amino acid amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404149.1 protein_id gnl|my_center|LOCUS_18490 3122 1962 gene locus_tag LOCUS_18500 gene ybdK 3122 1962 CDS product putative glutamate--cysteine ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3D0W9 protein_id gnl|my_center|LOCUS_18500 4065 3244 gene locus_tag LOCUS_18510 4065 3244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4539 4147 gene locus_tag LOCUS_18520 4539 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256422.1 protein_id gnl|my_center|LOCUS_18520 5384 4536 gene locus_tag LOCUS_18530 5384 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142761.1 protein_id gnl|my_center|LOCUS_18530 6425 5442 gene locus_tag LOCUS_18540 6425 5442 CDS product hemin ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403977.1 protein_id gnl|my_center|LOCUS_18540 7327 6473 gene locus_tag LOCUS_18550 7327 6473 CDS product periplasmic-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403978.1 protein_id gnl|my_center|LOCUS_18550 7440 8396 gene locus_tag LOCUS_18560 7440 8396 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_18560 8411 9847 gene locus_tag LOCUS_18570 gene rrp 8411 9847 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403979.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence110 1201 719 gene locus_tag LOCUS_18580 gene accB 1201 719 CDS product biotin carboxyl carrier protein of acetyl-CoA carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37799 protein_id gnl|my_center|LOCUS_18580 1217 1417 gene locus_tag LOCUS_18590 1217 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 1884 1390 gene locus_tag LOCUS_18600 gene efp 1884 1390 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S413 protein_id gnl|my_center|LOCUS_18600 2171 2608 gene locus_tag LOCUS_18610 2171 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 2921 2655 gene locus_tag LOCUS_18620 2921 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 8430 3157 gene locus_tag LOCUS_18630 8430 3157 CDS product translocation/assembly module TamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404013.1 protein_id gnl|my_center|LOCUS_18630 <10204 8486 gene locus_tag LOCUS_18640 <10204 8486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404014.1:membrane protein >Feature sequence111 861 619 gene locus_tag LOCUS_18650 861 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1186 998 gene locus_tag LOCUS_18660 1186 998 CDS product UPF0337 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q886I3 protein_id gnl|my_center|LOCUS_18660 1541 2161 gene locus_tag LOCUS_18670 1541 2161 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403542.1 protein_id gnl|my_center|LOCUS_18670 2164 3300 gene locus_tag LOCUS_18680 2164 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3500 5128 gene locus_tag LOCUS_18690 gene prc 3500 5128 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403544.1 protein_id gnl|my_center|LOCUS_18690 7946 5169 gene locus_tag LOCUS_18700 7946 5169 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_18700 9829 8033 gene locus_tag LOCUS_18710 9829 8033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404891.1 protein_id gnl|my_center|LOCUS_18710 >Feature sequence112 2780 2505 gene locus_tag LOCUS_18720 2780 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2887 4953 gene locus_tag LOCUS_18730 2887 4953 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_18730 4950 5279 gene locus_tag LOCUS_18740 4950 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 5276 5644 gene locus_tag LOCUS_18750 5276 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 5702 6664 gene locus_tag LOCUS_18760 5702 6664 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257482.1 protein_id gnl|my_center|LOCUS_18760 6693 7358 gene locus_tag LOCUS_18770 gene rpe 6693 7358 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6L6 protein_id gnl|my_center|LOCUS_18770 7368 8288 gene locus_tag LOCUS_18780 7368 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 8435 9379 gene locus_tag LOCUS_18790 8435 9379 CDS product putative lipid kinase YegS-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8PD82 protein_id gnl|my_center|LOCUS_18790 9540 9334 gene locus_tag LOCUS_18800 9540 9334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence113 1581 337 gene locus_tag LOCUS_18810 1581 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2801 1629 gene locus_tag LOCUS_18820 2801 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616634.1 protein_id gnl|my_center|LOCUS_18820 2963 3691 gene locus_tag LOCUS_18830 gene fecB 2963 3691 CDS product iron ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403682.1 protein_id gnl|my_center|LOCUS_18830 3868 4596 gene locus_tag LOCUS_18840 3868 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 5416 4652 gene locus_tag LOCUS_18850 5416 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 5544 6422 gene locus_tag LOCUS_18860 5544 6422 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888525.1 protein_id gnl|my_center|LOCUS_18860 6507 7700 gene locus_tag LOCUS_18870 6507 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404559.1 protein_id gnl|my_center|LOCUS_18870 7756 8124 gene locus_tag LOCUS_18880 7756 8124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 8273 9388 gene locus_tag LOCUS_18890 8273 9388 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389257.1 protein_id gnl|my_center|LOCUS_18890 <9959 9438 gene locus_tag LOCUS_18900 <9959 9438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S046:glycine--tRNA ligase >Feature sequence114 <1 1648 gene locus_tag LOCUS_18910 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7UI46:vitamin B12-dependent ribonucleotide reductase 1912 2289 gene locus_tag LOCUS_18920 1912 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2424 2759 gene locus_tag LOCUS_18930 2424 2759 CDS product excinuclease ABC subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969264.1 protein_id gnl|my_center|LOCUS_18930 2749 2970 gene locus_tag LOCUS_18940 2749 2970 CDS product HicB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_18940 4132 2978 gene locus_tag LOCUS_18950 4132 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 6196 4316 gene locus_tag LOCUS_18960 6196 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_18960 7000 6206 gene locus_tag LOCUS_18970 7000 6206 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_18970 7159 7803 gene locus_tag LOCUS_18980 7159 7803 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531660.1 protein_id gnl|my_center|LOCUS_18980 7853 8803 gene locus_tag LOCUS_18990 7853 8803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 9094 8834 gene locus_tag LOCUS_19000 9094 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 9701 9159 gene locus_tag LOCUS_19010 9701 9159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence115 292 1455 gene locus_tag LOCUS_19020 292 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1664 2827 gene locus_tag LOCUS_19030 1664 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2849 3586 gene locus_tag LOCUS_19040 2849 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 3652 5442 gene locus_tag LOCUS_19050 3652 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 5454 6458 gene locus_tag LOCUS_19060 5454 6458 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939508.1 protein_id gnl|my_center|LOCUS_19060 8887 6455 gene locus_tag LOCUS_19070 8887 6455 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140201.1 protein_id gnl|my_center|LOCUS_19070 <9743 8986 gene locus_tag LOCUS_19080 <9743 8986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140201.1:alpha-glucosidase >Feature sequence116 <1 854 gene locus_tag LOCUS_19090 <1 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KCE2:glyceraldehyde-3-phosphate dehydrogenase 937 2112 gene locus_tag LOCUS_19100 gene pgk 937 2112 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3A7 protein_id gnl|my_center|LOCUS_19100 2227 2748 gene locus_tag LOCUS_19110 2227 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 3395 2781 gene locus_tag LOCUS_19120 3395 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403868.1 protein_id gnl|my_center|LOCUS_19120 4680 3526 gene locus_tag LOCUS_19130 4680 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404146.1 protein_id gnl|my_center|LOCUS_19130 5242 4715 gene locus_tag LOCUS_19140 5242 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 5279 6430 gene locus_tag LOCUS_19150 5279 6430 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962384.1 protein_id gnl|my_center|LOCUS_19150 7093 6437 gene locus_tag LOCUS_19160 7093 6437 CDS product coenzyme A pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404709.1 protein_id gnl|my_center|LOCUS_19160 7866 7096 gene locus_tag LOCUS_19170 7866 7096 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_19170 8291 7869 gene locus_tag LOCUS_19180 8291 7869 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890858.1 protein_id gnl|my_center|LOCUS_19180 9143 8295 gene locus_tag LOCUS_19190 9143 8295 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404163.1 protein_id gnl|my_center|LOCUS_19190 >Feature sequence117 1952 1470 gene locus_tag LOCUS_19200 1952 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405127.1 protein_id gnl|my_center|LOCUS_19200 2663 2010 gene locus_tag LOCUS_19210 2663 2010 CDS product acetoin utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405128.1 protein_id gnl|my_center|LOCUS_19210 4200 2818 gene locus_tag LOCUS_19220 gene hflX 4200 2818 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZX0 protein_id gnl|my_center|LOCUS_19220 6371 4257 gene locus_tag LOCUS_19230 6371 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405130.1 protein_id gnl|my_center|LOCUS_19230 9634 6506 gene locus_tag LOCUS_19240 9634 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence118 1 237 gene locus_tag LOCUS_19250 1 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 295 1083 gene locus_tag LOCUS_19260 295 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1400 1002 gene locus_tag LOCUS_19270 1400 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1372 2946 gene locus_tag LOCUS_19280 gene htrA 1372 2946 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404358.1 protein_id gnl|my_center|LOCUS_19280 3372 3031 gene locus_tag LOCUS_19290 3372 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 3449 3889 gene locus_tag LOCUS_19300 3449 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 3960 4706 gene locus_tag LOCUS_19310 3960 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 5173 4715 gene locus_tag LOCUS_19320 5173 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 5345 5998 gene locus_tag LOCUS_19330 gene hly3 5345 5998 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037985.1 protein_id gnl|my_center|LOCUS_19330 6519 5995 gene locus_tag LOCUS_19340 gene folK 6519 5995 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403715.1 protein_id gnl|my_center|LOCUS_19340 6875 6516 gene locus_tag LOCUS_19350 gene folB 6875 6516 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4I3 protein_id gnl|my_center|LOCUS_19350 >Feature sequence119 3805 269 gene locus_tag LOCUS_19360 3805 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 5141 3789 gene locus_tag LOCUS_19370 5141 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035976.1 protein_id gnl|my_center|LOCUS_19370 6778 5195 gene locus_tag LOCUS_19380 6778 5195 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766062.1 protein_id gnl|my_center|LOCUS_19380 6968 9499 gene locus_tag LOCUS_19390 gene xloA 6968 9499 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405547.1 protein_id gnl|my_center|LOCUS_19390 >Feature sequence120 <1 1614 gene locus_tag LOCUS_19400 <1 1614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766122.1:solute:sodium symporter family transporter 2854 1646 gene locus_tag LOCUS_19410 2854 1646 CDS product patatin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403190.1 protein_id gnl|my_center|LOCUS_19410 7388 2889 gene locus_tag LOCUS_19420 7388 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 7533 8372 gene locus_tag LOCUS_19430 7533 8372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 >Feature sequence121 741 100 gene locus_tag LOCUS_19440 gene lexA 741 100 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3C8 protein_id gnl|my_center|LOCUS_19440 1655 978 gene locus_tag LOCUS_19450 1655 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 2560 1736 gene locus_tag LOCUS_19460 gene recO 2560 1736 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3C9 protein_id gnl|my_center|LOCUS_19460 2654 3196 gene locus_tag LOCUS_19470 2654 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4860 3253 gene locus_tag LOCUS_19480 gene yhcX 4860 3253 CDS product hydrolase YhcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54608 protein_id gnl|my_center|LOCUS_19480 5214 4993 gene locus_tag LOCUS_19490 5214 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5289 6134 gene locus_tag LOCUS_19500 5289 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 6219 7436 gene locus_tag LOCUS_19510 6219 7436 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_19510 7436 8215 gene locus_tag LOCUS_19520 7436 8215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404658.1 protein_id gnl|my_center|LOCUS_19520 8205 8717 gene locus_tag LOCUS_19530 8205 8717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 >Feature sequence122 1539 523 gene locus_tag LOCUS_19540 gene rbsR 1539 523 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_19540 3345 1672 gene locus_tag LOCUS_19550 3345 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404853.1 protein_id gnl|my_center|LOCUS_19550 4517 3372 gene locus_tag LOCUS_19560 4517 3372 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404710.1 protein_id gnl|my_center|LOCUS_19560 4674 6329 gene locus_tag LOCUS_19570 4674 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 6467 6703 gene locus_tag LOCUS_19580 6467 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 6767 6982 gene locus_tag LOCUS_19590 6767 6982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 6983 7444 gene locus_tag LOCUS_19600 6983 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 7631 7983 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acgtcgcccgagcccgtgtc <9160 8504 gene locus_tag LOCUS_19610 <9160 8504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747S2:Lon protease >Feature sequence123 <1 535 gene locus_tag LOCUS_19620 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229587.1:methyltransferase type 11 3168 532 gene locus_tag LOCUS_19630 3168 532 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205765.1 protein_id gnl|my_center|LOCUS_19630 3583 3161 gene locus_tag LOCUS_19640 3583 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 4490 3723 gene locus_tag LOCUS_19650 4490 3723 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_601116.1 protein_id gnl|my_center|LOCUS_19650 5495 4512 gene locus_tag LOCUS_19660 5495 4512 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404736.1 protein_id gnl|my_center|LOCUS_19660 6885 5530 gene locus_tag LOCUS_19670 6885 5530 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_19670 8180 6954 gene locus_tag LOCUS_19680 8180 6954 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404271.1 protein_id gnl|my_center|LOCUS_19680 <8994 8231 gene locus_tag LOCUS_19690 <8994 8231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201996.1:xanthan lyase >Feature sequence124 1772 2002 gene locus_tag LOCUS_19700 1772 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 2010 2237 gene locus_tag LOCUS_19710 2010 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 2230 4521 gene locus_tag LOCUS_19720 gene feoB 2230 4521 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326708.1 protein_id gnl|my_center|LOCUS_19720 4667 5815 gene locus_tag LOCUS_19730 4667 5815 CDS product stilbene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031818.1 protein_id gnl|my_center|LOCUS_19730 5812 6366 gene locus_tag LOCUS_19740 5812 6366 CDS product isoprenylcysteine carboxyl methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727206.1 protein_id gnl|my_center|LOCUS_19740 6617 6363 gene locus_tag LOCUS_19750 6617 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 8068 6620 gene locus_tag LOCUS_19760 8068 6620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence125 1984 470 gene locus_tag LOCUS_19770 1984 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2673 2104 gene locus_tag LOCUS_19780 2673 2104 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532447.1 protein_id gnl|my_center|LOCUS_19780 3546 2686 gene locus_tag LOCUS_19790 3546 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 7310 3555 gene locus_tag LOCUS_19800 7310 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 8191 7349 gene locus_tag LOCUS_19810 8191 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence126 <1 840 gene locus_tag LOCUS_19820 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S432:ATP synthase subunit alpha 923 1867 gene locus_tag LOCUS_19830 gene atpG 923 1867 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S431 protein_id gnl|my_center|LOCUS_19830 2437 1946 gene locus_tag LOCUS_19840 2437 1946 CDS product YciE/YciF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435461.1 protein_id gnl|my_center|LOCUS_19840 2463 3146 gene locus_tag LOCUS_19850 2463 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3173 3721 gene locus_tag LOCUS_19860 gene rfbC 3173 3721 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143691.1 protein_id gnl|my_center|LOCUS_19860 3860 3949 gene locus_tag LOCUS_t00240 3860 3949 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4044 5828 gene locus_tag LOCUS_19870 4044 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 5927 7546 gene locus_tag LOCUS_19880 5927 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 7610 7828 gene locus_tag LOCUS_19890 7610 7828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 8299 7835 gene locus_tag LOCUS_19900 8299 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 >Feature sequence127 1653 892 gene locus_tag LOCUS_19910 1653 892 CDS product UDP-N-acetyl-D-mannosaminuronic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057274.1 protein_id gnl|my_center|LOCUS_19910 2851 1655 gene locus_tag LOCUS_19920 2851 1655 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119434.1 protein_id gnl|my_center|LOCUS_19920 4316 2811 gene locus_tag LOCUS_19930 4316 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6940 4307 gene locus_tag LOCUS_19940 6940 4307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7495 6983 gene locus_tag LOCUS_19950 7495 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 <8426 7521 gene locus_tag LOCUS_19960 <8426 7521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002338483.1:tyrosine protein kinase >Feature sequence128 1350 622 gene locus_tag LOCUS_19970 1350 622 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784744.1 protein_id gnl|my_center|LOCUS_19970 1351 2475 gene locus_tag LOCUS_19980 1351 2475 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_19980 2472 3551 gene locus_tag LOCUS_19990 2472 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 3548 4297 gene locus_tag LOCUS_20000 3548 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 4294 5541 gene locus_tag LOCUS_20010 4294 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 5570 6613 gene locus_tag LOCUS_20020 5570 6613 CDS product magnesium chelatase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784757.1 protein_id gnl|my_center|LOCUS_20020 6813 8153 gene locus_tag LOCUS_20030 6813 8153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence129 2586 1852 gene locus_tag LOCUS_20040 2586 1852 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403732.1 protein_id gnl|my_center|LOCUS_20040 2936 2610 gene locus_tag LOCUS_20050 2936 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3038 4066 gene locus_tag LOCUS_20060 3038 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 4093 5499 gene locus_tag LOCUS_20070 4093 5499 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920401.1 protein_id gnl|my_center|LOCUS_20070 6421 6915 gene locus_tag LOCUS_20080 6421 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7078 8028 gene locus_tag LOCUS_20090 7078 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence130 <1 1159 gene locus_tag LOCUS_20100 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump 1304 2221 gene locus_tag LOCUS_20110 1304 2221 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338139.1 protein_id gnl|my_center|LOCUS_20110 2410 4329 gene locus_tag LOCUS_20120 2410 4329 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4D4 protein_id gnl|my_center|LOCUS_20120 4451 5392 gene locus_tag LOCUS_20130 4451 5392 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403568.1 protein_id gnl|my_center|LOCUS_20130 5846 5397 gene locus_tag LOCUS_20140 5846 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 6044 8041 gene locus_tag LOCUS_20150 6044 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence131 197 424 gene locus_tag LOCUS_20160 197 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 543 1616 gene locus_tag LOCUS_20170 543 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 1756 2370 gene locus_tag LOCUS_20180 1756 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_20180 2372 3226 gene locus_tag LOCUS_20190 2372 3226 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886780.1 protein_id gnl|my_center|LOCUS_20190 4127 3240 gene locus_tag LOCUS_20200 4127 3240 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403152.1 protein_id gnl|my_center|LOCUS_20200 6129 4129 gene locus_tag LOCUS_20210 6129 4129 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404428.1 protein_id gnl|my_center|LOCUS_20210 7837 6173 gene locus_tag LOCUS_20220 7837 6173 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404427.1 protein_id gnl|my_center|LOCUS_20220 >Feature sequence132 <1 1246 gene locus_tag LOCUS_20230 <1 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403178.1:(2Fe-2S)-binding protein 1313 2386 gene locus_tag LOCUS_20240 gene nuoH 1313 2386 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYV5 protein_id gnl|my_center|LOCUS_20240 2386 2652 gene locus_tag LOCUS_20250 2386 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 3317 2649 gene locus_tag LOCUS_20260 3317 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038317.1 protein_id gnl|my_center|LOCUS_20260 3763 3416 gene locus_tag LOCUS_20270 3763 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124109.1 protein_id gnl|my_center|LOCUS_20270 4050 3805 gene locus_tag LOCUS_20280 4050 3805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6002 4212 gene locus_tag LOCUS_20290 6002 4212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 7536 6250 gene locus_tag LOCUS_20300 gene ftsZ 7536 6250 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S524 protein_id gnl|my_center|LOCUS_20300 <8296 7663 gene locus_tag LOCUS_20310 <8296 7663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S525:cell division protein FtsA >Feature sequence133 1706 318 gene locus_tag LOCUS_20320 1706 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4042 1721 gene locus_tag LOCUS_20330 4042 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 6705 4312 gene locus_tag LOCUS_20340 6705 4312 CDS product peptidase S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404072.1 protein_id gnl|my_center|LOCUS_20340 7539 6754 gene locus_tag LOCUS_20350 7539 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 8069 7617 gene locus_tag LOCUS_20360 8069 7617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence134 87 446 gene locus_tag LOCUS_20370 87 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 510 436 gene locus_tag LOCUS_t00250 510 436 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 628 554 gene locus_tag LOCUS_t00260 628 554 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 912 1067 gene locus_tag LOCUS_20380 gene rpmH 912 1067 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KGG5 protein_id gnl|my_center|LOCUS_20380 1078 1539 gene locus_tag LOCUS_20390 gene rnpA 1078 1539 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6H4 protein_id gnl|my_center|LOCUS_20390 1595 3475 gene locus_tag LOCUS_20400 gene yidC 1595 3475 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6H3 protein_id gnl|my_center|LOCUS_20400 3507 4898 gene locus_tag LOCUS_20410 gene mnmE 3507 4898 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6H2 protein_id gnl|my_center|LOCUS_20410 5381 4926 gene locus_tag LOCUS_20420 5381 4926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 5583 6119 gene locus_tag LOCUS_20430 5583 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 6199 8106 gene locus_tag LOCUS_20440 gene mnmG 6199 8106 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6G8 protein_id gnl|my_center|LOCUS_20440 >Feature sequence135 436 17 gene locus_tag LOCUS_20450 436 17 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_769503.2 protein_id gnl|my_center|LOCUS_20450 520 1167 gene locus_tag LOCUS_20460 gene thiE 520 1167 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2A8 protein_id gnl|my_center|LOCUS_20460 1953 1174 gene locus_tag LOCUS_20470 1953 1174 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404114.1 protein_id gnl|my_center|LOCUS_20470 3716 1950 gene locus_tag LOCUS_20480 3716 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4501 3713 gene locus_tag LOCUS_20490 4501 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4782 5198 gene locus_tag LOCUS_20500 4782 5198 CDS product anti-sigma B factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404111.1 protein_id gnl|my_center|LOCUS_20500 5214 5774 gene locus_tag LOCUS_20510 5214 5774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 5771 6910 gene locus_tag LOCUS_20520 5771 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 7276 6923 gene locus_tag LOCUS_20530 7276 6923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 7968 7321 gene locus_tag LOCUS_20540 gene gpm 7968 7321 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404101.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence136 4924 3506 gene locus_tag LOCUS_20550 4924 3506 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_20550 5016 5867 gene locus_tag LOCUS_20560 5016 5867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 6645 6115 gene locus_tag LOCUS_20570 6645 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 7066 6815 gene locus_tag LOCUS_20580 7066 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 7855 7409 gene locus_tag LOCUS_20590 7855 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence137 1076 2626 gene locus_tag LOCUS_20600 1076 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 2981 2631 gene locus_tag LOCUS_20610 2981 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 3112 4317 gene locus_tag LOCUS_20620 3112 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 4383 5369 gene locus_tag LOCUS_20630 4383 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 5971 5366 gene locus_tag LOCUS_20640 5971 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 6435 6043 gene locus_tag LOCUS_20650 6435 6043 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403235.1 protein_id gnl|my_center|LOCUS_20650 <8012 6448 gene locus_tag LOCUS_20660 <8012 6448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S5D0:isoleucine--tRNA ligase >Feature sequence138 2 484 gene locus_tag LOCUS_20670 2 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 528 1094 gene locus_tag LOCUS_20680 528 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1237 1557 gene locus_tag LOCUS_20690 1237 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 1641 2984 gene locus_tag LOCUS_20700 gene mleA 1641 2984 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942945.1 protein_id gnl|my_center|LOCUS_20700 3042 4487 gene locus_tag LOCUS_20710 3042 4487 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390653.1 protein_id gnl|my_center|LOCUS_20710 4669 6129 gene locus_tag LOCUS_20720 4669 6129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403492.1 protein_id gnl|my_center|LOCUS_20720 6126 6785 gene locus_tag LOCUS_20730 6126 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence139 1163 246 gene locus_tag LOCUS_20740 1163 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20740 1421 1230 gene locus_tag LOCUS_20750 1421 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552967.1 protein_id gnl|my_center|LOCUS_20750 2627 1491 gene locus_tag LOCUS_20760 2627 1491 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_20760 3666 2722 gene locus_tag LOCUS_20770 3666 2722 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403317.1 protein_id gnl|my_center|LOCUS_20770 3753 4652 gene locus_tag LOCUS_20780 3753 4652 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537841.1 protein_id gnl|my_center|LOCUS_20780 7551 4660 gene locus_tag LOCUS_20790 gene gcvP 7551 4660 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_20790 >Feature sequence140 998 1753 gene locus_tag LOCUS_20800 998 1753 CDS product biopolymer transporter ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404334.1 protein_id gnl|my_center|LOCUS_20800 1755 2171 gene locus_tag LOCUS_20810 1755 2171 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_20810 2788 2168 gene locus_tag LOCUS_20820 2788 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 4338 2785 gene locus_tag LOCUS_20830 4338 2785 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404336.1 protein_id gnl|my_center|LOCUS_20830 4416 4784 gene locus_tag LOCUS_20840 4416 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 6162 4801 gene locus_tag LOCUS_20850 6162 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 6407 6168 gene locus_tag LOCUS_20860 6407 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 6882 6436 gene locus_tag LOCUS_20870 6882 6436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 <7587 6946 gene locus_tag LOCUS_20880 <7587 6946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943774.1:(Fe-S)-binding protein >Feature sequence141 <1 3619 gene locus_tag LOCUS_20890 <1 3619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:peptidase C25 3695 4876 gene locus_tag LOCUS_20900 3695 4876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403960.1 protein_id gnl|my_center|LOCUS_20900 4943 6448 gene locus_tag LOCUS_20910 4943 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404500.1 protein_id gnl|my_center|LOCUS_20910 >Feature sequence142 479 1486 gene locus_tag LOCUS_20920 gene moxR 479 1486 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_20920 1542 2114 gene locus_tag LOCUS_20930 1542 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 2464 2045 gene locus_tag LOCUS_20940 2464 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3119 2469 gene locus_tag LOCUS_20950 3119 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3118 3585 gene locus_tag LOCUS_20960 gene fsxA 3118 3585 CDS product exclusion protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938508.1 protein_id gnl|my_center|LOCUS_20960 4180 3596 gene locus_tag LOCUS_20970 4180 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 4275 5648 gene locus_tag LOCUS_20980 4275 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405217.1 protein_id gnl|my_center|LOCUS_20980 5824 6072 gene locus_tag LOCUS_20990 5824 6072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 6074 7405 gene locus_tag LOCUS_21000 6074 7405 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence143 291 782 gene locus_tag LOCUS_21010 291 782 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140300.1 protein_id gnl|my_center|LOCUS_21010 999 915 gene locus_tag LOCUS_t00270 999 915 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1112 2527 gene locus_tag LOCUS_21020 1112 2527 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403345.1 protein_id gnl|my_center|LOCUS_21020 2622 3347 gene locus_tag LOCUS_21030 gene otsB 2622 3347 CDS product trehalose 6-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S520 protein_id gnl|my_center|LOCUS_21030 3395 5407 gene locus_tag LOCUS_21040 3395 5407 CDS product glucoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267573.1 protein_id gnl|my_center|LOCUS_21040 5701 5492 gene locus_tag LOCUS_21050 5701 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 5894 6757 gene locus_tag LOCUS_21060 gene tesB 5894 6757 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093084.1 protein_id gnl|my_center|LOCUS_21060 6762 7409 gene locus_tag LOCUS_21070 6762 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038317.1 protein_id gnl|my_center|LOCUS_21070 >Feature sequence144 1196 738 gene locus_tag LOCUS_21080 1196 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 2183 1503 gene locus_tag LOCUS_21090 2183 1503 CDS product UPF0502 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GL3 protein_id gnl|my_center|LOCUS_21090 3112 2180 gene locus_tag LOCUS_21100 gene prmC 3112 2180 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V8 protein_id gnl|my_center|LOCUS_21100 3252 5300 gene locus_tag LOCUS_21110 3252 5300 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L7 protein_id gnl|my_center|LOCUS_21110 5347 6210 gene locus_tag LOCUS_21120 5347 6210 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L6 protein_id gnl|my_center|LOCUS_21120 >Feature sequence145 <1 2080 gene locus_tag LOCUS_21130 <1 2080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404583.1:outer membrane protein 2101 2640 gene locus_tag LOCUS_21140 2101 2640 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_21140 2677 3276 gene locus_tag LOCUS_21150 2677 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 3402 4241 gene locus_tag LOCUS_21160 gene panB 3402 4241 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H6 protein_id gnl|my_center|LOCUS_21160 4241 5035 gene locus_tag LOCUS_21170 gene surE 4241 5035 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1H7 protein_id gnl|my_center|LOCUS_21170 5040 5516 gene locus_tag LOCUS_21180 5040 5516 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_21180 5574 6308 gene locus_tag LOCUS_21190 gene tpiA 5574 6308 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VZT5 protein_id gnl|my_center|LOCUS_21190 >Feature sequence146 823 242 gene locus_tag LOCUS_21200 823 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 1266 820 gene locus_tag LOCUS_21210 1266 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_21210 2195 1347 gene locus_tag LOCUS_21220 2195 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 3322 2192 gene locus_tag LOCUS_21230 3322 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 6426 3322 gene locus_tag LOCUS_21240 6426 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403086.1 protein_id gnl|my_center|LOCUS_21240 <7300 6476 gene locus_tag LOCUS_21250 <7300 6476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108349.1:glutamine cyclotransferase >Feature sequence147 1135 560 gene locus_tag LOCUS_21260 1135 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1387 1163 gene locus_tag LOCUS_21270 1387 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 3511 2078 gene locus_tag LOCUS_21280 3511 2078 CDS product type II secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404032.1 protein_id gnl|my_center|LOCUS_21280 4672 3581 gene locus_tag LOCUS_21290 4672 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 <7266 4720 gene locus_tag LOCUS_21300 <7266 4720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404030.1:fimbrial protein >Feature sequence148 95 880 gene locus_tag LOCUS_21310 95 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1892 891 gene locus_tag LOCUS_21320 1892 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2746 2168 gene locus_tag LOCUS_21330 2746 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 3865 2771 gene locus_tag LOCUS_21340 gene ybjU 3865 2771 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_21340 4132 3935 gene locus_tag LOCUS_21350 4132 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21350 4642 4139 gene locus_tag LOCUS_21360 4642 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21360 5122 4646 gene locus_tag LOCUS_21370 gene greA 5122 4646 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2N3 protein_id gnl|my_center|LOCUS_21370 5982 5269 gene locus_tag LOCUS_21380 5982 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 6262 6777 gene locus_tag LOCUS_21390 6262 6777 CDS product UPF0403 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2G5 protein_id gnl|my_center|LOCUS_21390 >Feature sequence149 <1 757 gene locus_tag LOCUS_21400 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256447.1:deoxyhypusine synthase 1903 824 gene locus_tag LOCUS_21410 gene fda 1903 824 CDS product fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141027.1 protein_id gnl|my_center|LOCUS_21410 3030 1999 gene locus_tag LOCUS_21420 3030 1999 CDS product glycine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403985.1 protein_id gnl|my_center|LOCUS_21420 3099 4223 gene locus_tag LOCUS_21430 gene thiO 3099 4223 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403986.1 protein_id gnl|my_center|LOCUS_21430 4279 4488 gene locus_tag LOCUS_21440 4279 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 4511 5359 gene locus_tag LOCUS_21450 gene thiG 4511 5359 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S371 protein_id gnl|my_center|LOCUS_21450 5356 5985 gene locus_tag LOCUS_21460 5356 5985 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403989.1 protein_id gnl|my_center|LOCUS_21460 5978 6820 gene locus_tag LOCUS_21470 gene thiD 5978 6820 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403990.1 protein_id gnl|my_center|LOCUS_21470 6899 6973 gene locus_tag LOCUS_t00280 6899 6973 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence150 1631 1209 gene locus_tag LOCUS_21480 1631 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 2309 1731 gene locus_tag LOCUS_21490 2309 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_21490 2498 2881 gene locus_tag LOCUS_21500 2498 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2913 3575 gene locus_tag LOCUS_21510 2913 3575 CDS product extracytoplasmic sigma factor ECF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117997.1 protein_id gnl|my_center|LOCUS_21510 3572 6160 gene locus_tag LOCUS_21520 3572 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 6450 6256 gene locus_tag LOCUS_21530 6450 6256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence151 532 1011 gene locus_tag LOCUS_21540 532 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 1008 1856 gene locus_tag LOCUS_21550 1008 1856 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681784.1 protein_id gnl|my_center|LOCUS_21550 2395 1853 gene locus_tag LOCUS_21560 2395 1853 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405068.1 protein_id gnl|my_center|LOCUS_21560 3672 2488 gene locus_tag LOCUS_21570 gene dnaJ 3672 2488 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S030 protein_id gnl|my_center|LOCUS_21570 4248 3715 gene locus_tag LOCUS_21580 gene grpE 4248 3715 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S029 protein_id gnl|my_center|LOCUS_21580 4534 5079 gene locus_tag LOCUS_21590 gene idi 4534 5079 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1C1 protein_id gnl|my_center|LOCUS_21590 5113 6363 gene locus_tag LOCUS_21600 5113 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404168.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence152 413 1120 gene locus_tag LOCUS_21610 413 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_21610 1123 1782 gene locus_tag LOCUS_21620 1123 1782 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404831.1 protein_id gnl|my_center|LOCUS_21620 1814 3367 gene locus_tag LOCUS_21630 1814 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 3469 4293 gene locus_tag LOCUS_21640 3469 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 4296 5201 gene locus_tag LOCUS_21650 4296 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 5229 6290 gene locus_tag LOCUS_21660 gene coxB1 5229 6290 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0S5 protein_id gnl|my_center|LOCUS_21660 >Feature sequence153 <1 547 gene locus_tag LOCUS_21670 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S5W6:ATP-dependent DNA helicase RecG 537 1190 gene locus_tag LOCUS_21680 537 1190 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405272.1 protein_id gnl|my_center|LOCUS_21680 2733 1201 gene locus_tag LOCUS_21690 2733 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3289 5358 gene locus_tag LOCUS_21700 3289 5358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 5922 5440 gene locus_tag LOCUS_21710 5922 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 6011 6469 gene locus_tag LOCUS_21720 6011 6469 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887462.1 protein_id gnl|my_center|LOCUS_21720 6466 6804 gene locus_tag LOCUS_21730 6466 6804 CDS product peptide chain release factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144028.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence154 199 1338 gene locus_tag LOCUS_21740 199 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082906.1 protein_id gnl|my_center|LOCUS_21740 1335 1649 gene locus_tag LOCUS_21750 1335 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2097 2022 gene locus_tag LOCUS_t00290 2097 2022 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2308 4818 gene locus_tag LOCUS_21760 2308 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5495 4848 gene locus_tag LOCUS_21770 gene pdxH 5495 4848 CDS product pyridoxine/pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63WN7 protein_id gnl|my_center|LOCUS_21770 >Feature sequence155 1082 45 gene locus_tag LOCUS_21780 gene tgt 1082 45 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9I0 protein_id gnl|my_center|LOCUS_21780 2692 1385 gene locus_tag LOCUS_21790 2692 1385 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404090.1 protein_id gnl|my_center|LOCUS_21790 3887 2697 gene locus_tag LOCUS_21800 3887 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 4760 3939 gene locus_tag LOCUS_21810 4760 3939 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_21810 5764 4832 gene locus_tag LOCUS_21820 5764 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 6038 6535 gene locus_tag LOCUS_21830 6038 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 >Feature sequence156 53 661 gene locus_tag LOCUS_21840 53 661 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDP0 protein_id gnl|my_center|LOCUS_21840 2635 668 gene locus_tag LOCUS_21850 gene mutL 2635 668 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V0 protein_id gnl|my_center|LOCUS_21850 2900 2640 gene locus_tag LOCUS_21860 2900 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3903 3049 gene locus_tag LOCUS_21870 gene cdsA 3903 3049 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404459.1 protein_id gnl|my_center|LOCUS_21870 4305 3916 gene locus_tag LOCUS_21880 4305 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404460.1 protein_id gnl|my_center|LOCUS_21880 5378 4302 gene locus_tag LOCUS_21890 5378 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 6802 5636 gene locus_tag LOCUS_21900 6802 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392836.1 protein_id gnl|my_center|LOCUS_21900 >Feature sequence157 2031 268 gene locus_tag LOCUS_21910 2031 268 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886676.1 protein_id gnl|my_center|LOCUS_21910 3382 2093 gene locus_tag LOCUS_21920 gene pyrC 3382 2093 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0H8 protein_id gnl|my_center|LOCUS_21920 3505 4005 gene locus_tag LOCUS_21930 3505 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 4060 4461 gene locus_tag LOCUS_21940 4060 4461 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140042.1 protein_id gnl|my_center|LOCUS_21940 5179 4484 gene locus_tag LOCUS_21950 gene argB 5179 4484 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404476.1 protein_id gnl|my_center|LOCUS_21950 >Feature sequence158 3937 785 gene locus_tag LOCUS_21960 3937 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 4906 3953 gene locus_tag LOCUS_21970 4906 3953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 6266 5016 gene locus_tag LOCUS_21980 6266 5016 CDS product maltose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080109.1 protein_id gnl|my_center|LOCUS_21980 >Feature sequence159 554 3130 gene locus_tag LOCUS_21990 554 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406189.1 protein_id gnl|my_center|LOCUS_21990 3152 3994 gene locus_tag LOCUS_22000 gene nth 3152 3994 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S025 protein_id gnl|my_center|LOCUS_22000 4506 3991 gene locus_tag LOCUS_22010 4506 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405531.1 protein_id gnl|my_center|LOCUS_22010 4475 6115 gene locus_tag LOCUS_22020 gene gpmI 4475 6115 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S026 protein_id gnl|my_center|LOCUS_22020 6247 6321 gene locus_tag LOCUS_t00300 6247 6321 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6437 6513 gene locus_tag LOCUS_t00310 6437 6513 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 270 1946 gene locus_tag LOCUS_22030 270 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2041 4989 gene locus_tag LOCUS_22040 2041 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence161 2029 263 gene locus_tag LOCUS_22050 gene lig2 2029 263 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337472.1 protein_id gnl|my_center|LOCUS_22050 2990 2022 gene locus_tag LOCUS_22060 gene nei 2990 2022 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FQB9 protein_id gnl|my_center|LOCUS_22060 3992 3069 gene locus_tag LOCUS_22070 3992 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 4714 3989 gene locus_tag LOCUS_22080 4714 3989 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402795.1 protein_id gnl|my_center|LOCUS_22080 5042 5503 gene locus_tag LOCUS_22090 gene rplM 5042 5503 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I8 protein_id gnl|my_center|LOCUS_22090 5540 5929 gene locus_tag LOCUS_22100 gene rpsI 5540 5929 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S6I9 protein_id gnl|my_center|LOCUS_22100 >Feature sequence162 501 1040 gene locus_tag LOCUS_22110 501 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1098 2642 gene locus_tag LOCUS_22120 gene cysS 1098 2642 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T5 protein_id gnl|my_center|LOCUS_22120 2724 3221 gene locus_tag LOCUS_22130 2724 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403772.1 protein_id gnl|my_center|LOCUS_22130 3326 4387 gene locus_tag LOCUS_22140 3326 4387 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_22140 4488 4982 gene locus_tag LOCUS_22150 gene purE 4488 4982 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87KE1 protein_id gnl|my_center|LOCUS_22150 5654 4986 gene locus_tag LOCUS_22160 5654 4986 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_22160 5990 6496 gene locus_tag LOCUS_22170 5990 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22170 >Feature sequence163 794 429 gene locus_tag LOCUS_22180 794 429 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P6I1 protein_id gnl|my_center|LOCUS_22180 3025 791 gene locus_tag LOCUS_22190 3025 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 3230 3066 gene locus_tag LOCUS_22200 3230 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 3169 5019 gene locus_tag LOCUS_22210 3169 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 5075 5896 gene locus_tag LOCUS_22220 gene prmA 5075 5896 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S4C3 protein_id gnl|my_center|LOCUS_22220 >Feature sequence164 366 1394 gene locus_tag LOCUS_22230 366 1394 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529828.1 protein_id gnl|my_center|LOCUS_22230 1428 2789 gene locus_tag LOCUS_22240 gene tilS 1428 2789 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V1 protein_id gnl|my_center|LOCUS_22240 2677 3444 gene locus_tag LOCUS_22250 gene hpt 2677 3444 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_22250 3982 3482 gene locus_tag LOCUS_22260 3982 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 <6130 4324 gene locus_tag LOCUS_22270 <6130 4324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933516.1:methionine synthase >Feature sequence165 1106 645 gene locus_tag LOCUS_22280 gene rnhA 1106 645 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKU0 protein_id gnl|my_center|LOCUS_22280 1189 2268 gene locus_tag LOCUS_22290 gene obg 1189 2268 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KAF0 protein_id gnl|my_center|LOCUS_22290 2366 3616 gene locus_tag LOCUS_22300 2366 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 3657 4520 gene locus_tag LOCUS_22310 3657 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 4517 5395 gene locus_tag LOCUS_22320 4517 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 <6082 5460 gene locus_tag LOCUS_22330 <6082 5460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404069.1:ATP-dependent Clp protease ClpC >Feature sequence166 474 1394 gene locus_tag LOCUS_22340 474 1394 CDS product putative methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705418.1 protein_id gnl|my_center|LOCUS_22340 1391 2380 gene locus_tag LOCUS_22350 1391 2380 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405124.1 protein_id gnl|my_center|LOCUS_22350 3536 2370 gene locus_tag LOCUS_22360 3536 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3664 4797 gene locus_tag LOCUS_22370 3664 4797 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_22370 >Feature sequence167 1579 1133 gene locus_tag LOCUS_22380 1579 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 1692 3347 gene locus_tag LOCUS_22390 1692 3347 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085767.1 protein_id gnl|my_center|LOCUS_22390 3550 4878 gene locus_tag LOCUS_22400 3550 4878 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404741.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence168 2236 3603 gene locus_tag LOCUS_22410 2236 3603 CDS product Trk system potassium transport protein TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_22410 3632 5302 gene locus_tag LOCUS_22420 3632 5302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence169 2136 958 gene locus_tag LOCUS_22430 2136 958 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_22430 2235 3041 gene locus_tag LOCUS_22440 2235 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3118 3693 gene locus_tag LOCUS_22450 3118 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404812.1 protein_id gnl|my_center|LOCUS_22450 <5714 3777 gene locus_tag LOCUS_22460 <5714 3777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405586.1:T9SS C-terminal target domain-containing protein >Feature sequence170 <1 1919 gene locus_tag LOCUS_22470 <1 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S6D5:phosphoenolpyruvate carboxylase 2411 1926 gene locus_tag LOCUS_22480 2411 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2662 2456 gene locus_tag LOCUS_22490 2662 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3491 2751 gene locus_tag LOCUS_22500 3491 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3571 3933 gene locus_tag LOCUS_22510 3571 3933 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403022.1 protein_id gnl|my_center|LOCUS_22510 4735 3965 gene locus_tag LOCUS_22520 4735 3965 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405398.1 protein_id gnl|my_center|LOCUS_22520 >Feature sequence171 1520 129 gene locus_tag LOCUS_22530 1520 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 2108 4801 gene locus_tag LOCUS_22540 2108 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 4966 5039 gene locus_tag LOCUS_t00320 4966 5039 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 190 1008 gene locus_tag LOCUS_22550 190 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 1036 1386 gene locus_tag LOCUS_22560 1036 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 1720 2367 gene locus_tag LOCUS_22570 gene recR 1720 2367 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZH8 protein_id gnl|my_center|LOCUS_22570 2938 2333 gene locus_tag LOCUS_22580 2938 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence173 1678 350 gene locus_tag LOCUS_22590 1678 350 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403017.1 protein_id gnl|my_center|LOCUS_22590 1881 2816 gene locus_tag LOCUS_22600 gene mdh 1881 2816 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S289 protein_id gnl|my_center|LOCUS_22600 2890 3321 gene locus_tag LOCUS_22610 2890 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4739 3318 gene locus_tag LOCUS_22620 4739 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 4738 5004 gene locus_tag LOCUS_22630 4738 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 >Feature sequence174 503 1816 gene locus_tag LOCUS_22640 gene sufD 503 1816 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_22640 1868 2224 gene locus_tag LOCUS_22650 1868 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108936.1 protein_id gnl|my_center|LOCUS_22650 2387 2806 gene locus_tag LOCUS_22660 2387 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3799 2813 gene locus_tag LOCUS_22670 3799 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 4458 3796 gene locus_tag LOCUS_22680 4458 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404131.1 protein_id gnl|my_center|LOCUS_22680 5162 4500 gene locus_tag LOCUS_22690 5162 4500 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_22690 5350 5126 gene locus_tag LOCUS_22700 5350 5126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence175 <1 1785 gene locus_tag LOCUS_22710 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404204.1:T9SS C-terminal target domain-containing protein 4792 1967 gene locus_tag LOCUS_22720 gene acnA 4792 1967 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1F3 protein_id gnl|my_center|LOCUS_22720 >Feature sequence176 560 1228 gene locus_tag LOCUS_22730 560 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529957.1 protein_id gnl|my_center|LOCUS_22730 1584 1231 gene locus_tag LOCUS_22740 1584 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2207 1650 gene locus_tag LOCUS_22750 2207 1650 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_22750 2250 4031 gene locus_tag LOCUS_22760 2250 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4157 4232 gene locus_tag LOCUS_t00330 4157 4232 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4976 4473 gene locus_tag LOCUS_22770 4976 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence177 515 1897 gene locus_tag LOCUS_22780 515 1897 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224565.1 protein_id gnl|my_center|LOCUS_22780 1943 2146 gene locus_tag LOCUS_22790 1943 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 2768 2208 gene locus_tag LOCUS_22800 2768 2208 CDS product pyrimidine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529753.1 protein_id gnl|my_center|LOCUS_22800 3954 2998 gene locus_tag LOCUS_22810 3954 2998 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265922.1 protein_id gnl|my_center|LOCUS_22810 4892 4215 gene locus_tag LOCUS_22820 4892 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404182.1 protein_id gnl|my_center|LOCUS_22820 >Feature sequence178 4146 925 gene locus_tag LOCUS_22830 4146 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 4600 4914 gene locus_tag LOCUS_22840 4600 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence179 397 792 gene locus_tag LOCUS_22850 397 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 856 1641 gene locus_tag LOCUS_22860 856 1641 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_22860 1743 2861 gene locus_tag LOCUS_22870 gene queA 1743 2861 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHU2 protein_id gnl|my_center|LOCUS_22870 >Feature sequence180 <1 1458 gene locus_tag LOCUS_22880 <1 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403966.1:acyl-CoA dehydrogenase 1571 4291 gene locus_tag LOCUS_22890 1571 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence181 2096 1575 gene locus_tag LOCUS_22900 2096 1575 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_22900 3414 2140 gene locus_tag LOCUS_22910 3414 2140 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974172.1 protein_id gnl|my_center|LOCUS_22910 4439 3417 gene locus_tag LOCUS_22920 4439 3417 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887434.1 protein_id gnl|my_center|LOCUS_22920 >Feature sequence182 980 129 gene locus_tag LOCUS_22930 980 129 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403958.1 protein_id gnl|my_center|LOCUS_22930 1659 1006 gene locus_tag LOCUS_22940 1659 1006 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403957.1 protein_id gnl|my_center|LOCUS_22940 1788 3137 gene locus_tag LOCUS_22950 1788 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 <4709 3144 gene locus_tag LOCUS_22960 <4709 3144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404793.1:histidine kinase >Feature sequence183 1816 827 gene locus_tag LOCUS_22970 1816 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2592 2023 gene locus_tag LOCUS_22980 2592 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4358 2631 gene locus_tag LOCUS_22990 4358 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 >Feature sequence184 <1 1504 gene locus_tag LOCUS_23000 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403070.1:lytic transglycosylase 2519 2130 gene locus_tag LOCUS_23010 2519 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001703749.1 protein_id gnl|my_center|LOCUS_23010 2621 4144 gene locus_tag LOCUS_23020 gene miaB 2621 4144 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZF8 protein_id gnl|my_center|LOCUS_23020 >Feature sequence185 769 1338 gene locus_tag LOCUS_23030 769 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 1418 2443 gene locus_tag LOCUS_23040 1418 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 2541 3341 gene locus_tag LOCUS_23050 2541 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 >Feature sequence186 2838 1252 gene locus_tag LOCUS_23060 gene gnd 2838 1252 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63JG7 protein_id gnl|my_center|LOCUS_23060 2984 3071 gene locus_tag LOCUS_t00340 2984 3071 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence187 1117 290 gene locus_tag LOCUS_23070 1117 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 1663 1142 gene locus_tag LOCUS_23080 1663 1142 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404532.1 protein_id gnl|my_center|LOCUS_23080 1880 2473 gene locus_tag LOCUS_23090 1880 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 >Feature sequence188 <1 742 gene locus_tag LOCUS_23100 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402902.1:glutaryl-CoA dehydrogenase 757 2412 gene locus_tag LOCUS_23110 757 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 3470 2415 gene locus_tag LOCUS_23120 3470 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 <4216 3573 gene locus_tag LOCUS_23130 <4216 3573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404676.1:Ysh1p: subunit of polyadenylation factor I >Feature sequence189 912 1916 gene locus_tag LOCUS_23140 912 1916 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_23140 1980 2663 gene locus_tag LOCUS_23150 gene tal 1980 2663 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S5V9 protein_id gnl|my_center|LOCUS_23150 >Feature sequence190 1662 535 gene locus_tag LOCUS_23160 1662 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 2234 1689 gene locus_tag LOCUS_23170 2234 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2751 2239 gene locus_tag LOCUS_23180 2751 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 >Feature sequence191 539 1891 gene locus_tag LOCUS_23190 539 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 1970 3181 gene locus_tag LOCUS_23200 1970 3181 CDS product hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029442.1 protein_id gnl|my_center|LOCUS_23200 3907 3242 gene locus_tag LOCUS_23210 3907 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 >Feature sequence192 1433 3811 gene locus_tag LOCUS_23220 1433 3811 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_23220 >Feature sequence193 1274 447 gene locus_tag LOCUS_23230 1274 447 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence194 130 705 gene locus_tag LOCUS_23240 130 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2643 748 gene locus_tag LOCUS_23250 2643 748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932972.1 protein_id gnl|my_center|LOCUS_23250 2845 2917 gene locus_tag LOCUS_t00350 2845 2917 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3033 3182 gene locus_tag LOCUS_23260 3033 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence195 544 2835 gene locus_tag LOCUS_23270 gene glnS 544 2835 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1L9 protein_id gnl|my_center|LOCUS_23270 <3512 2832 gene locus_tag LOCUS_23280 <3512 2832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2S1L8:glutamate--tRNA ligase >Feature sequence196 2515 641 gene locus_tag LOCUS_23290 gene mrdA 2515 641 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405101.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence197 <1 1266 gene locus_tag LOCUS_23300 <1 1266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404213.1:glycerol-3-phosphate dehydrogenase 1358 2671 gene locus_tag LOCUS_23310 gene pvdN 1358 2671 CDS product pyoverdine biosynthesis protein PvdN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114503.1 protein_id gnl|my_center|LOCUS_23310 <3385 2686 gene locus_tag LOCUS_23320 <3385 2686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CY6:RecBCD enzyme subunit RecD >Feature sequence198 1631 825 gene locus_tag LOCUS_23330 1631 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 2065 2460 gene locus_tag LOCUS_23340 2065 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 >Feature sequence199 <1 2678 gene locus_tag LOCUS_23350 <1 2678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405100.1:peptidase S9 >Feature sequence200 1971 1174 gene locus_tag LOCUS_23360 1971 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 >Feature sequence201 261 1799 gene locus_tag LOCUS_23370 261 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 1820 3109 gene locus_tag LOCUS_23380 1820 3109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence202 2181 562 gene locus_tag LOCUS_23390 2181 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2329 2763 gene locus_tag LOCUS_23400 2329 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404661.1 protein_id gnl|my_center|LOCUS_23400 >Feature sequence203 <1 693 gene locus_tag LOCUS_23410 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529737.1:sigma-54-dependent Fis family transcriptional regulator 757 1572 gene locus_tag LOCUS_23420 757 1572 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403117.1 protein_id gnl|my_center|LOCUS_23420 1580 2599 gene locus_tag LOCUS_23430 1580 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888172.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence204 1316 561 gene locus_tag LOCUS_23440 1316 561 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920855.1 protein_id gnl|my_center|LOCUS_23440 1912 1313 gene locus_tag LOCUS_23450 1912 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1960 2376 gene locus_tag LOCUS_23460 1960 2376 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403693.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence205 544 1293 gene locus_tag LOCUS_23470 544 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 1688 1290 gene locus_tag LOCUS_23480 gene hisI 1688 1290 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T1 protein_id gnl|my_center|LOCUS_23480 1807 2547 gene locus_tag LOCUS_23490 1807 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2549 2863 gene locus_tag LOCUS_23500 2549 2863 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S3T2 protein_id gnl|my_center|LOCUS_23500 >Feature sequence206 1451 561 gene locus_tag LOCUS_23510 1451 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 1978 1454 gene locus_tag LOCUS_23520 1978 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 2060 2773 gene locus_tag LOCUS_23530 2060 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence207 2286 319 gene locus_tag LOCUS_23540 gene speA 2286 319 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64ZT8 protein_id gnl|my_center|LOCUS_23540 >Feature sequence208 399 2051 gene locus_tag LOCUS_23550 gene bshC 399 2051 CDS product putative cysteine ligase BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0P5 protein_id gnl|my_center|LOCUS_23550 >Feature sequence209 2512 1133 gene locus_tag LOCUS_23560 2512 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence210 1246 824 gene locus_tag LOCUS_23570 1246 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence211 411 1976 gene locus_tag LOCUS_23580 411 1976 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920922.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence212 >Feature sequence213 <2406 206 gene locus_tag LOCUS_23590 <2406 206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405417.1:T9SS C-terminal target domain-containing protein >Feature sequence214 1854 367 gene locus_tag LOCUS_23600 gene nuoN 1854 367 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2K9 protein_id gnl|my_center|LOCUS_23600 2163 1864 gene locus_tag LOCUS_23610 2163 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence215 1357 515 gene locus_tag LOCUS_23620 1357 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 2109 1459 gene locus_tag LOCUS_23630 2109 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence216 563 411 gene locus_tag LOCUS_23640 563 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 1152 811 gene locus_tag LOCUS_23650 1152 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 1500 2192 gene locus_tag LOCUS_23660 1500 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence217 689 1837 gene locus_tag LOCUS_23670 689 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence218 228 303 gene locus_tag LOCUS_t00360 228 303 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 321 536 gene locus_tag LOCUS_23680 321 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 580 1128 gene locus_tag LOCUS_23690 gene nusG 580 1128 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1Q0 protein_id gnl|my_center|LOCUS_23690 1308 1745 gene locus_tag LOCUS_23700 gene rplK 1308 1745 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG19 protein_id gnl|my_center|LOCUS_23700 >Feature sequence219 1060 158 gene locus_tag LOCUS_23710 gene dapF 1060 158 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S2P2 protein_id gnl|my_center|LOCUS_23710 >Feature sequence220 784 1434 gene locus_tag LOCUS_23720 784 1434 CDS product iron-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528606.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence221 1672 173 gene locus_tag LOCUS_23730 1672 173 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403351.1 protein_id gnl|my_center|LOCUS_23730 2058 1756 gene locus_tag LOCUS_23740 2058 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence222 1501 662 gene locus_tag LOCUS_23750 gene hpaG 1501 662 CDS product 2-hydroxyhepta-2,4-diene-1,7-dioate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_23750 >Feature sequence223 179 1576 gene locus_tag LOCUS_23760 179 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760