>Feature sequence0001 180 821 gene locus_tag LOCUS_00010 gene rpe 180 821 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56188 protein_id gnl|my_center|LOCUS_00010 830 1423 gene locus_tag LOCUS_00020 gene trpF 830 1423 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YKL4 protein_id gnl|my_center|LOCUS_00020 1413 2216 gene locus_tag LOCUS_00030 gene dnaQ 1413 2216 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_00030 2845 2276 gene locus_tag LOCUS_00040 gene oorC 2845 2276 CDS product 2-oxoglutarate:acceptor oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_00040 3690 2857 gene locus_tag LOCUS_00050 gene oorB 3690 2857 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_00050 4822 3692 gene locus_tag LOCUS_00060 gene oorA 4822 3692 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_00060 5149 4832 gene locus_tag LOCUS_00070 gene oorD 5149 4832 CDS product 2-oxoglutarate:acceptor oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_00070 6895 5405 gene locus_tag LOCUS_00080 6895 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7023 7733 gene locus_tag LOCUS_00090 7023 7733 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_00090 7730 8116 gene locus_tag LOCUS_00100 7730 8116 CDS product zinc/iron-chelating domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_00100 8089 9381 gene locus_tag LOCUS_00110 8089 9381 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_00110 9381 10172 gene locus_tag LOCUS_00120 gene trpC 9381 10172 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI11 protein_id gnl|my_center|LOCUS_00120 11272 10790 gene locus_tag LOCUS_00130 11272 10790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 >Feature sequence0002 1483 149 gene locus_tag LOCUS_00140 gene rimO 1483 149 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8G1 protein_id gnl|my_center|LOCUS_00140 2261 1539 gene locus_tag LOCUS_00150 2261 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 5251 2261 gene locus_tag LOCUS_00160 5251 2261 CDS product multidrug transporter AcrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839353.1 protein_id gnl|my_center|LOCUS_00160 5498 6178 gene locus_tag LOCUS_00170 5498 6178 CDS product CheY-P-specific phosphatase CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_00170 6175 7890 gene locus_tag LOCUS_00180 6175 7890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 8807 7899 gene locus_tag LOCUS_00190 8807 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261704.1 protein_id gnl|my_center|LOCUS_00190 9698 8877 gene locus_tag LOCUS_00200 gene panC 9698 8877 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56061 protein_id gnl|my_center|LOCUS_00200 >Feature sequence0003 <1 2202 gene locus_tag LOCUS_00210 <1 2202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975761.1:chemotaxis protein 2964 2254 gene locus_tag LOCUS_00220 gene ycbC 2964 2254 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000899608.1 protein_id gnl|my_center|LOCUS_00220 3904 2966 gene locus_tag LOCUS_00230 gene hemH 3904 2966 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56107 protein_id gnl|my_center|LOCUS_00230 4490 3897 gene locus_tag LOCUS_00240 4490 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 4646 4933 gene locus_tag LOCUS_00250 gene cyf 4646 4933 CDS product cytochrome c-553 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04032 protein_id gnl|my_center|LOCUS_00250 5092 6711 gene locus_tag LOCUS_00260 5092 6711 CDS product REC domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000528391.1 protein_id gnl|my_center|LOCUS_00260 7346 6720 gene locus_tag LOCUS_00270 gene gmk 7346 6720 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNB8 protein_id gnl|my_center|LOCUS_00270 8016 7339 gene locus_tag LOCUS_00280 8016 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 8807 8115 gene locus_tag LOCUS_00290 8807 8115 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588225.1 protein_id gnl|my_center|LOCUS_00290 <9476 8830 gene locus_tag LOCUS_00300 <9476 8830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNB4:elongation factor Ts >Feature sequence0004 1199 267 gene locus_tag LOCUS_00310 1199 267 CDS product fluoroacetate dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_00310 1318 2148 gene locus_tag LOCUS_00320 1318 2148 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948372.1 protein_id gnl|my_center|LOCUS_00320 2758 2204 gene locus_tag LOCUS_00330 2758 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929871.1 protein_id gnl|my_center|LOCUS_00330 3456 2866 gene locus_tag LOCUS_00340 3456 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975418.1 protein_id gnl|my_center|LOCUS_00340 3667 5289 gene locus_tag LOCUS_00350 3667 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 5493 6263 gene locus_tag LOCUS_00360 5493 6263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 6377 7636 gene locus_tag LOCUS_00370 gene cysJ 6377 7636 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971988.1 protein_id gnl|my_center|LOCUS_00370 7707 8303 gene locus_tag LOCUS_00380 7707 8303 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_00380 8363 9097 gene locus_tag LOCUS_00390 gene dltE 8363 9097 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963857.1 protein_id gnl|my_center|LOCUS_00390 >Feature sequence0005 483 914 gene locus_tag LOCUS_00400 483 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 959 1510 gene locus_tag LOCUS_00410 959 1510 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 protein_id gnl|my_center|LOCUS_00410 1990 1520 gene locus_tag LOCUS_00420 1990 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 3205 2003 gene locus_tag LOCUS_00430 3205 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 3784 3209 gene locus_tag LOCUS_00440 3784 3209 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858112.1 protein_id gnl|my_center|LOCUS_00440 3843 4379 gene locus_tag LOCUS_00450 3843 4379 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P948 protein_id gnl|my_center|LOCUS_00450 4407 5951 gene locus_tag LOCUS_00460 gene rny 4407 5951 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PN86 protein_id gnl|my_center|LOCUS_00460 6594 6118 gene locus_tag LOCUS_00470 6594 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 6784 7377 gene locus_tag LOCUS_00480 6784 7377 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_00480 7386 8186 gene locus_tag LOCUS_00490 7386 8186 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_00490 >Feature sequence0006 707 2287 gene locus_tag LOCUS_00500 707 2287 CDS product HcpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946906.1 protein_id gnl|my_center|LOCUS_00500 2403 2930 gene locus_tag LOCUS_00510 2403 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 3073 3897 gene locus_tag LOCUS_00520 3073 3897 CDS product universal stress protein family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265717.1 protein_id gnl|my_center|LOCUS_00520 4417 4343 gene locus_tag LOCUS_t00010 4417 4343 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5509 4478 gene locus_tag LOCUS_00530 5509 4478 CDS product cobalamin biosynthesis protein CbiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016779.1 protein_id gnl|my_center|LOCUS_00530 6254 5502 gene locus_tag LOCUS_00540 6254 5502 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016784.1 protein_id gnl|my_center|LOCUS_00540 7411 6251 gene locus_tag LOCUS_00550 gene cbiE 7411 6251 CDS product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000649057.1 protein_id gnl|my_center|LOCUS_00550 <8347 7509 gene locus_tag LOCUS_00560 <8347 7509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869514.1:cobalt-precorrin-6A synthase >Feature sequence0007 523 320 gene locus_tag LOCUS_00570 523 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00570 815 534 gene locus_tag LOCUS_00580 gene rplW 815 534 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7S6 protein_id gnl|my_center|LOCUS_00580 1429 818 gene locus_tag LOCUS_00590 gene rplD 1429 818 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX2 protein_id gnl|my_center|LOCUS_00590 2004 1426 gene locus_tag LOCUS_00600 gene rplC 2004 1426 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX1 protein_id gnl|my_center|LOCUS_00600 2331 2017 gene locus_tag LOCUS_00610 gene rpsJ 2331 2017 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX0 protein_id gnl|my_center|LOCUS_00610 2728 2994 gene locus_tag LOCUS_00620 2728 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 4429 3002 gene locus_tag LOCUS_00630 4429 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5264 4431 gene locus_tag LOCUS_00640 5264 4431 CDS product alkylphosphonate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477713.1 protein_id gnl|my_center|LOCUS_00640 6065 5373 gene locus_tag LOCUS_00650 6065 5373 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770108.1 protein_id gnl|my_center|LOCUS_00650 6457 6065 gene locus_tag LOCUS_00660 6457 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 7062 6565 gene locus_tag LOCUS_00670 7062 6565 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_00670 7470 7114 gene locus_tag LOCUS_00680 7470 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760643.1 protein_id gnl|my_center|LOCUS_00680 <8242 7540 gene locus_tag LOCUS_00690 <8242 7540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001191311.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence0008 <1 995 gene locus_tag LOCUS_00700 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972214.1:MFS transporter 2230 998 gene locus_tag LOCUS_00710 2230 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 3651 2242 gene locus_tag LOCUS_00720 3651 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 3771 4637 gene locus_tag LOCUS_00730 3771 4637 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000013300.1 protein_id gnl|my_center|LOCUS_00730 5332 4652 gene locus_tag LOCUS_00740 5332 4652 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2T6 protein_id gnl|my_center|LOCUS_00740 6086 5436 gene locus_tag LOCUS_00750 gene rhtC 6086 5436 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208463.1 protein_id gnl|my_center|LOCUS_00750 6228 6428 gene locus_tag LOCUS_00760 6228 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7148 6432 gene locus_tag LOCUS_00770 7148 6432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 <8124 7278 gene locus_tag LOCUS_00780 <8124 7278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97I29:homoserine O-succinyltransferase >Feature sequence0009 1737 319 gene locus_tag LOCUS_00790 gene cca 1737 319 CDS product multifunctional CCA protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KJ91 protein_id gnl|my_center|LOCUS_00790 2527 1661 gene locus_tag LOCUS_00800 2527 1661 CDS product mechanosensitive ion channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482477.1 protein_id gnl|my_center|LOCUS_00800 4390 2666 gene locus_tag LOCUS_00810 gene proS 4390 2666 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHX1 protein_id gnl|my_center|LOCUS_00810 5703 4399 gene locus_tag LOCUS_00820 gene hemA 5703 4399 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHX2 protein_id gnl|my_center|LOCUS_00820 6599 5703 gene locus_tag LOCUS_00830 6599 5703 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_00830 6907 6608 gene locus_tag LOCUS_00840 6907 6608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 <8016 6929 gene locus_tag LOCUS_00850 <8016 6929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHM2:histidinol dehydrogenase >Feature sequence0010 2125 1379 gene locus_tag LOCUS_00860 gene aapP 2125 1379 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_00860 3292 2213 gene locus_tag LOCUS_00870 3292 2213 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_00870 4476 3292 gene locus_tag LOCUS_00880 gene aapQ 4476 3292 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419738.1 protein_id gnl|my_center|LOCUS_00880 5566 4550 gene locus_tag LOCUS_00890 5566 4550 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388759.1 protein_id gnl|my_center|LOCUS_00890 5987 6931 gene locus_tag LOCUS_00900 5987 6931 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_00900 7839 7000 gene locus_tag LOCUS_00910 7839 7000 CDS product 3-keto-5-aminohexanoate cleavage enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975163.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence0011 1051 200 gene locus_tag LOCUS_00920 gene bioB 1051 200 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7U6 protein_id gnl|my_center|LOCUS_00920 1553 1041 gene locus_tag LOCUS_00930 1553 1041 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_00930 4020 1564 gene locus_tag LOCUS_00940 gene topA 4020 1564 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64MY0 protein_id gnl|my_center|LOCUS_00940 4270 4124 gene locus_tag LOCUS_00950 4270 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 4903 4352 gene locus_tag LOCUS_00960 4903 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00960 5808 4945 gene locus_tag LOCUS_00970 gene mqnD 5808 4945 CDS product 1,4-dihydroxy-6-naphtoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O24963 protein_id gnl|my_center|LOCUS_00970 5982 6455 gene locus_tag LOCUS_00980 5982 6455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 <7878 6515 gene locus_tag LOCUS_00990 <7878 6515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25863:NADH-quinone oxidoreductase subunit N >Feature sequence0012 2300 621 gene locus_tag LOCUS_01000 2300 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 3174 2287 gene locus_tag LOCUS_01010 3174 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5063 3171 gene locus_tag LOCUS_01020 5063 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 6283 5060 gene locus_tag LOCUS_01030 6283 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 7547 6285 gene locus_tag LOCUS_01040 7547 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 7816 7547 gene locus_tag LOCUS_01050 7816 7547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence0013 1710 49 gene locus_tag LOCUS_01060 gene hutU 1710 49 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0C5 protein_id gnl|my_center|LOCUS_01060 2029 3246 gene locus_tag LOCUS_01070 gene hutI 2029 3246 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KI05 protein_id gnl|my_center|LOCUS_01070 3239 4204 gene locus_tag LOCUS_01080 gene hutG 3239 4204 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KF85 protein_id gnl|my_center|LOCUS_01080 4579 4211 gene locus_tag LOCUS_01090 4579 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 4636 5910 gene locus_tag LOCUS_01100 gene cobB 4636 5910 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180T2 protein_id gnl|my_center|LOCUS_01100 5900 6610 gene locus_tag LOCUS_01110 5900 6610 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258429.1 protein_id gnl|my_center|LOCUS_01110 6582 7091 gene locus_tag LOCUS_01120 6582 7091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 7091 7393 gene locus_tag LOCUS_01130 7091 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 >Feature sequence0014 1007 696 gene locus_tag LOCUS_01140 gene folB 1007 696 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854273.1 protein_id gnl|my_center|LOCUS_01140 1679 1056 gene locus_tag LOCUS_01150 gene plsY 1679 1056 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIE4 protein_id gnl|my_center|LOCUS_01150 1834 2826 gene locus_tag LOCUS_01160 gene nadA 1834 2826 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25910 protein_id gnl|my_center|LOCUS_01160 2823 3644 gene locus_tag LOCUS_01170 gene nadC 2823 3644 CDS product putative nicotinate-nucleotide pyrophosphorylase [carboxylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25909 protein_id gnl|my_center|LOCUS_01170 3696 4676 gene locus_tag LOCUS_01180 3696 4676 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_01180 4666 6036 gene locus_tag LOCUS_01190 4666 6036 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_01190 6042 6941 gene locus_tag LOCUS_01200 gene lpxC 6042 6941 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25692 protein_id gnl|my_center|LOCUS_01200 6952 7404 gene locus_tag LOCUS_01210 6952 7404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 >Feature sequence0015 3267 442 gene locus_tag LOCUS_01220 3267 442 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112791.1 protein_id gnl|my_center|LOCUS_01220 3454 4134 gene locus_tag LOCUS_01230 gene vncR 3454 4134 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699093.1 protein_id gnl|my_center|LOCUS_01230 4088 4300 gene locus_tag LOCUS_01240 4088 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 4418 5962 gene locus_tag LOCUS_01250 4418 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 6104 7102 gene locus_tag LOCUS_01260 6104 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815709.1 protein_id gnl|my_center|LOCUS_01260 >Feature sequence0016 266 883 gene locus_tag LOCUS_01270 gene cheC 266 883 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072503.1 protein_id gnl|my_center|LOCUS_01270 1007 1807 gene locus_tag LOCUS_01280 1007 1807 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070909.1 protein_id gnl|my_center|LOCUS_01280 1900 2478 gene locus_tag LOCUS_01290 gene purN 1900 2478 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020374.1 protein_id gnl|my_center|LOCUS_01290 2935 2483 gene locus_tag LOCUS_01300 2935 2483 CDS product periplasmic protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073835.1 protein_id gnl|my_center|LOCUS_01300 3074 3928 gene locus_tag LOCUS_01310 3074 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3928 4611 gene locus_tag LOCUS_01320 3928 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 4984 6246 gene locus_tag LOCUS_01330 gene glyA 4984 6246 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24531 protein_id gnl|my_center|LOCUS_01330 >Feature sequence0017 1164 2162 gene locus_tag LOCUS_01340 1164 2162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3010 2180 gene locus_tag LOCUS_01350 3010 2180 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263669.1 protein_id gnl|my_center|LOCUS_01350 3198 3590 gene locus_tag LOCUS_01360 3198 3590 CDS product rhodanese inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211247.1 protein_id gnl|my_center|LOCUS_01360 3619 4074 gene locus_tag LOCUS_01370 3619 4074 CDS product N-acetyltransferase GCN5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728014.1 protein_id gnl|my_center|LOCUS_01370 4158 5057 gene locus_tag LOCUS_01380 4158 5057 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882747.1 protein_id gnl|my_center|LOCUS_01380 5321 5058 gene locus_tag LOCUS_01390 5321 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 5684 5346 gene locus_tag LOCUS_01400 5684 5346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01400 6937 6434 gene locus_tag LOCUS_01410 6937 6434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01410 >Feature sequence0018 632 321 gene locus_tag LOCUS_01420 632 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01420 715 1257 gene locus_tag LOCUS_01430 gene nadD 715 1257 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMQ3 protein_id gnl|my_center|LOCUS_01430 1229 1591 gene locus_tag LOCUS_01440 gene rsfS 1229 1591 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8K9 protein_id gnl|my_center|LOCUS_01440 3322 1733 gene locus_tag LOCUS_01450 gene argS 3322 1733 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNC0 protein_id gnl|my_center|LOCUS_01450 3576 3334 gene locus_tag LOCUS_01460 3576 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4082 3696 gene locus_tag LOCUS_01470 gene crcB 4082 3696 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHZ4 protein_id gnl|my_center|LOCUS_01470 4756 4082 gene locus_tag LOCUS_01480 gene plsC 4756 4082 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAZ9 protein_id gnl|my_center|LOCUS_01480 6071 4743 gene locus_tag LOCUS_01490 6071 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858517.1 protein_id gnl|my_center|LOCUS_01490 6797 6123 gene locus_tag LOCUS_01500 gene purQ 6797 6123 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHZ7 protein_id gnl|my_center|LOCUS_01500 7047 6802 gene locus_tag LOCUS_01510 gene purS 7047 6802 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB02 protein_id gnl|my_center|LOCUS_01510 >Feature sequence0019 316 1797 gene locus_tag LOCUS_01520 gene thrC 316 1797 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852451.1 protein_id gnl|my_center|LOCUS_01520 1969 2466 gene locus_tag LOCUS_01530 gene petA 1969 2466 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P970 protein_id gnl|my_center|LOCUS_01530 2480 3730 gene locus_tag LOCUS_01540 gene petB 2480 3730 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P971 protein_id gnl|my_center|LOCUS_01540 3730 4314 gene locus_tag LOCUS_01550 3730 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01550 4318 4602 gene locus_tag LOCUS_01560 4318 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01560 5378 4710 gene locus_tag LOCUS_01570 5378 4710 CDS product ribosomal RNA small subunit methyltransferase E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBY1 protein_id gnl|my_center|LOCUS_01570 5782 5378 gene locus_tag LOCUS_01580 5782 5378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence0020 251 856 gene locus_tag LOCUS_01590 251 856 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_01590 849 1490 gene locus_tag LOCUS_01600 849 1490 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 protein_id gnl|my_center|LOCUS_01600 1563 2270 gene locus_tag LOCUS_01610 1563 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3020 2280 gene locus_tag LOCUS_01620 3020 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3820 3041 gene locus_tag LOCUS_01630 gene cobJ 3820 3041 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681809.1 protein_id gnl|my_center|LOCUS_01630 3997 4476 gene locus_tag LOCUS_01640 3997 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4570 4902 gene locus_tag LOCUS_01650 4570 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 4871 5515 gene locus_tag LOCUS_01660 gene coaX 4871 5515 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBB6 protein_id gnl|my_center|LOCUS_01660 5493 6101 gene locus_tag LOCUS_01670 gene hisG 5493 6101 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F6P1 protein_id gnl|my_center|LOCUS_01670 6101 6796 gene locus_tag LOCUS_01680 6101 6796 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084830.1 protein_id gnl|my_center|LOCUS_01680 >Feature sequence0021 471 1853 gene locus_tag LOCUS_01690 471 1853 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_01690 1912 2742 gene locus_tag LOCUS_01700 1912 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01700 2743 3096 gene locus_tag LOCUS_01710 2743 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01710 3096 3890 gene locus_tag LOCUS_01720 3096 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 4016 4393 gene locus_tag LOCUS_01730 4016 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 5795 4467 gene locus_tag LOCUS_01740 gene dinF 5795 4467 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244661.1 protein_id gnl|my_center|LOCUS_01740 5924 6106 gene locus_tag LOCUS_01750 5924 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 >Feature sequence0022 1209 4 gene locus_tag LOCUS_01760 1209 4 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403189.1 protein_id gnl|my_center|LOCUS_01760 1450 1947 gene locus_tag LOCUS_01770 1450 1947 CDS product protein disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262849.1 protein_id gnl|my_center|LOCUS_01770 3727 2105 gene locus_tag LOCUS_01780 gene kefB 3727 2105 CDS product potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_01780 3950 4741 gene locus_tag LOCUS_01790 3950 4741 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811658.1 protein_id gnl|my_center|LOCUS_01790 4785 5693 gene locus_tag LOCUS_01800 4785 5693 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_01800 6559 5732 gene locus_tag LOCUS_01810 gene oxyR 6559 5732 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207332.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence0023 21 2501 gene locus_tag LOCUS_01820 21 2501 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851362.1 protein_id gnl|my_center|LOCUS_01820 2662 3033 gene locus_tag LOCUS_01830 2662 3033 CDS product acyl-CoA thioester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_01830 3030 3512 gene locus_tag LOCUS_01840 3030 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 3516 4727 gene locus_tag LOCUS_01850 3516 4727 CDS product peptidase M48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_01850 4727 5917 gene locus_tag LOCUS_01860 4727 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 6834 5962 gene locus_tag LOCUS_01870 6834 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 >Feature sequence0024 132 380 gene locus_tag LOCUS_01880 132 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01880 2305 437 gene locus_tag LOCUS_01890 gene ligA 2305 437 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAT1 protein_id gnl|my_center|LOCUS_01890 2469 3398 gene locus_tag LOCUS_01900 2469 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4712 3420 gene locus_tag LOCUS_01910 4712 3420 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_01910 <6771 4897 gene locus_tag LOCUS_01920 <6771 4897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000793250.1:cytochrome c biogenesis protein >Feature sequence0025 1157 957 gene locus_tag LOCUS_01930 1157 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 1333 2457 gene locus_tag LOCUS_01940 1333 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3346 2489 gene locus_tag LOCUS_01950 gene fliC 3346 2489 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748G4 protein_id gnl|my_center|LOCUS_01950 4689 3526 gene locus_tag LOCUS_01960 gene trmA 4689 3526 CDS product tRNA/tmRNA (uracil-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KM90 protein_id gnl|my_center|LOCUS_01960 4763 5560 gene locus_tag LOCUS_01970 4763 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 >Feature sequence0026 1619 564 gene locus_tag LOCUS_01980 1619 564 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_01980 2245 1682 gene locus_tag LOCUS_01990 2245 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 3489 2530 gene locus_tag LOCUS_02000 3489 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_02000 4750 3683 gene locus_tag LOCUS_02010 gene prfA 4750 3683 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PM63 protein_id gnl|my_center|LOCUS_02010 5033 4773 gene locus_tag LOCUS_02020 gene rpsT 5033 4773 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PM64 protein_id gnl|my_center|LOCUS_02020 5128 6462 gene locus_tag LOCUS_02030 gene glmM 5128 6462 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIE2 protein_id gnl|my_center|LOCUS_02030 >Feature sequence0027 <1 1400 gene locus_tag LOCUS_02040 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P41259:cysteine--tRNA ligase 2060 1518 gene locus_tag LOCUS_02050 2060 1518 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186966.1 protein_id gnl|my_center|LOCUS_02050 2549 2082 gene locus_tag LOCUS_02060 2549 2082 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106218.1 protein_id gnl|my_center|LOCUS_02060 3009 2581 gene locus_tag LOCUS_02070 3009 2581 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524850.1 protein_id gnl|my_center|LOCUS_02070 3986 3024 gene locus_tag LOCUS_02080 3986 3024 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945303.1 protein_id gnl|my_center|LOCUS_02080 4720 4025 gene locus_tag LOCUS_02090 4720 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 5223 4966 gene locus_tag LOCUS_02100 gene rpsR 5223 4966 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66459 protein_id gnl|my_center|LOCUS_02100 5762 5241 gene locus_tag LOCUS_02110 5762 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6139 5786 gene locus_tag LOCUS_02120 gene rpsF 6139 5786 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56013 protein_id gnl|my_center|LOCUS_02120 >Feature sequence0028 1865 2416 gene locus_tag LOCUS_02130 1865 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2434 2730 gene locus_tag LOCUS_02140 2434 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2899 3555 gene locus_tag LOCUS_02150 gene dccR 2899 3555 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_02150 3548 4735 gene locus_tag LOCUS_02160 gene dccS 3548 4735 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_02160 5253 4756 gene locus_tag LOCUS_02170 5253 4756 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878622.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence0029 1529 2086 gene locus_tag LOCUS_02180 1529 2086 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_02180 2124 2792 gene locus_tag LOCUS_02190 2124 2792 CDS product CheY-P-specific phosphatase CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_02190 2899 3621 gene locus_tag LOCUS_02200 2899 3621 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088237.1 protein_id gnl|my_center|LOCUS_02200 5131 3659 gene locus_tag LOCUS_02210 5131 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 <6088 5196 gene locus_tag LOCUS_02220 <6088 5196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942648.1:branched-chain amino acid ABC transporter substrate-binding protein >Feature sequence0030 462 1346 gene locus_tag LOCUS_02230 462 1346 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_02230 1349 3082 gene locus_tag LOCUS_02240 1349 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3069 3446 gene locus_tag LOCUS_02250 3069 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 3462 5147 gene locus_tag LOCUS_02260 3462 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5198 5998 gene locus_tag LOCUS_02270 gene kdsA 5198 5998 CDS product 2-dehydro-3-deoxyphosphooctonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIB8 protein_id gnl|my_center|LOCUS_02270 >Feature sequence0031 1073 198 gene locus_tag LOCUS_02280 1073 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1278 1763 gene locus_tag LOCUS_02290 gene greA 1278 1763 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJG9 protein_id gnl|my_center|LOCUS_02290 2098 3039 gene locus_tag LOCUS_02300 2098 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3051 4148 gene locus_tag LOCUS_02310 3051 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 5140 4193 gene locus_tag LOCUS_02320 5140 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5268 5492 gene locus_tag LOCUS_02330 5268 5492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence0032 862 1500 gene locus_tag LOCUS_02340 862 1500 CDS product cytokinin riboside 5'-monophosphate phosphoribohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8NRE2 protein_id gnl|my_center|LOCUS_02340 2487 1525 gene locus_tag LOCUS_02350 gene pfkA 2487 1525 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WY52 protein_id gnl|my_center|LOCUS_02350 4873 2489 gene locus_tag LOCUS_02360 4873 2489 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_02360 5425 4970 gene locus_tag LOCUS_02370 5425 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 >Feature sequence0033 235 1854 gene locus_tag LOCUS_02380 235 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 1890 3428 gene locus_tag LOCUS_02390 1890 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072353.1 protein_id gnl|my_center|LOCUS_02390 5134 3425 gene locus_tag LOCUS_02400 5134 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 <5797 5156 gene locus_tag LOCUS_02410 <5797 5156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence0034 1227 187 gene locus_tag LOCUS_02420 1227 187 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122363.1 protein_id gnl|my_center|LOCUS_02420 1834 1271 gene locus_tag LOCUS_02430 1834 1271 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703862.1 protein_id gnl|my_center|LOCUS_02430 2523 1990 gene locus_tag LOCUS_02440 2523 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2755 3465 gene locus_tag LOCUS_02450 2755 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3509 4210 gene locus_tag LOCUS_02460 3509 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 5131 4244 gene locus_tag LOCUS_02470 gene cryL1 5131 4244 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206330.1 protein_id gnl|my_center|LOCUS_02470 5608 5276 gene locus_tag LOCUS_02480 5608 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 >Feature sequence0035 804 1784 gene locus_tag LOCUS_02490 gene selD 804 1784 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q8R8W3 protein_id gnl|my_center|LOCUS_02490 2491 1850 gene locus_tag LOCUS_02500 2491 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 2720 3043 gene locus_tag LOCUS_02510 2720 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4378 3050 gene locus_tag LOCUS_02520 4378 3050 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002198156.1 protein_id gnl|my_center|LOCUS_02520 5636 4371 gene locus_tag LOCUS_02530 5636 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 >Feature sequence0036 2248 266 gene locus_tag LOCUS_02540 gene frdA 2248 266 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_02540 3042 2248 gene locus_tag LOCUS_02550 gene frdC 3042 2248 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_02550 4807 3302 gene locus_tag LOCUS_02560 gene nuoN-1 4807 3302 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G95 protein_id gnl|my_center|LOCUS_02560 <5736 4804 gene locus_tag LOCUS_02570 <5736 4804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941018.1:NADH:ubiquinone oxidoreductase subunit M >Feature sequence0037 2 508 gene locus_tag LOCUS_02580 2 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 2058 694 gene locus_tag LOCUS_02590 2058 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 3631 2297 gene locus_tag LOCUS_02600 gene mnmE 3631 2297 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNX9 protein_id gnl|my_center|LOCUS_02600 4573 3644 gene locus_tag LOCUS_02610 4573 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_02610 <5733 4602 gene locus_tag LOCUS_02620 <5733 4602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNX7:membrane protein insertase YidC >Feature sequence0038 1566 718 gene locus_tag LOCUS_02630 1566 718 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887355.1 protein_id gnl|my_center|LOCUS_02630 2390 1632 gene locus_tag LOCUS_02640 2390 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_02640 4296 2431 gene locus_tag LOCUS_02650 4296 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 5154 4396 gene locus_tag LOCUS_02660 5154 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence0039 1544 438 gene locus_tag LOCUS_02670 1544 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2602 1601 gene locus_tag LOCUS_02680 2602 1601 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261788.1 protein_id gnl|my_center|LOCUS_02680 2657 3592 gene locus_tag LOCUS_02690 2657 3592 CDS product methyltransferase type 12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888311.1 protein_id gnl|my_center|LOCUS_02690 3786 4364 gene locus_tag LOCUS_02700 gene sodB 3786 4364 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P31108 protein_id gnl|my_center|LOCUS_02700 4583 5428 gene locus_tag LOCUS_02710 4583 5428 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964635.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence0040 163 495 gene locus_tag LOCUS_02720 163 495 CDS product putative HIT-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64382 protein_id gnl|my_center|LOCUS_02720 1480 542 gene locus_tag LOCUS_02730 gene accA 1480 542 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI62 protein_id gnl|my_center|LOCUS_02730 2804 1536 gene locus_tag LOCUS_02740 gene fabF 2804 1536 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB68 protein_id gnl|my_center|LOCUS_02740 3143 2985 gene locus_tag LOCUS_02750 3143 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02750 3966 3223 gene locus_tag LOCUS_02760 gene fabG 3966 3223 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_02760 4798 4043 gene locus_tag LOCUS_02770 gene queE 4798 4043 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25588 protein_id gnl|my_center|LOCUS_02770 5327 4791 gene locus_tag LOCUS_02780 gene queD 5327 4791 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66626 protein_id gnl|my_center|LOCUS_02780 >Feature sequence0041 3 410 gene locus_tag LOCUS_02790 3 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 491 1159 gene locus_tag LOCUS_02800 491 1159 CDS product cytochrome b561 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_02800 1175 1783 gene locus_tag LOCUS_02810 1175 1783 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979664.1 protein_id gnl|my_center|LOCUS_02810 2523 1792 gene locus_tag LOCUS_02820 2523 1792 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C7MFA9 protein_id gnl|my_center|LOCUS_02820 4475 2541 gene locus_tag LOCUS_02830 4475 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5103 4639 gene locus_tag LOCUS_02840 5103 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence0042 1891 1229 gene locus_tag LOCUS_02850 1891 1229 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_02850 2384 1998 gene locus_tag LOCUS_02860 2384 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 2916 2494 gene locus_tag LOCUS_02870 2916 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3589 2999 gene locus_tag LOCUS_02880 3589 2999 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027532.1 protein_id gnl|my_center|LOCUS_02880 4025 3579 gene locus_tag LOCUS_02890 4025 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4163 5071 gene locus_tag LOCUS_02900 4163 5071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 5162 5452 gene locus_tag LOCUS_02910 5162 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence0043 1650 1417 gene locus_tag LOCUS_02920 1650 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1910 2662 gene locus_tag LOCUS_02930 1910 2662 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073325.1 protein_id gnl|my_center|LOCUS_02930 2930 4081 gene locus_tag LOCUS_02940 2930 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4082 4906 gene locus_tag LOCUS_02950 4082 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 5456 4914 gene locus_tag LOCUS_02960 5456 4914 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence0044 1355 774 gene locus_tag LOCUS_02970 1355 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1751 1368 gene locus_tag LOCUS_02980 gene queF 1751 1368 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLV4 protein_id gnl|my_center|LOCUS_02980 2241 3263 gene locus_tag LOCUS_02990 2241 3263 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_02990 3307 4128 gene locus_tag LOCUS_03000 3307 4128 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104934.1 protein_id gnl|my_center|LOCUS_03000 4526 4143 gene locus_tag LOCUS_03010 4526 4143 CDS product virulence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071869.1 protein_id gnl|my_center|LOCUS_03010 5363 4536 gene locus_tag LOCUS_03020 5363 4536 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351696.1 protein_id gnl|my_center|LOCUS_03020 >Feature sequence0045 17 225 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttgatttcatctttgattttatctttg 795 1454 gene locus_tag LOCUS_03030 795 1454 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972511.1 protein_id gnl|my_center|LOCUS_03030 1710 3026 gene locus_tag LOCUS_03040 1710 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3366 2995 gene locus_tag LOCUS_03050 3366 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4048 3476 gene locus_tag LOCUS_03060 4048 3476 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890772.1 protein_id gnl|my_center|LOCUS_03060 4850 4191 gene locus_tag LOCUS_03070 4850 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947684.1 protein_id gnl|my_center|LOCUS_03070 5048 5479 gene locus_tag LOCUS_03080 5048 5479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037789.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence0046 2892 1714 gene locus_tag LOCUS_03090 2892 1714 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_03090 4114 2894 gene locus_tag LOCUS_03100 4114 2894 CDS product diaminopropionate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969965.1 protein_id gnl|my_center|LOCUS_03100 4210 5037 gene locus_tag LOCUS_03110 4210 5037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192193.1 protein_id gnl|my_center|LOCUS_03110 5214 5290 gene locus_tag LOCUS_t00020 5214 5290 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5299 5375 gene locus_tag LOCUS_t00030 5299 5375 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5391 5467 gene locus_tag LOCUS_t00040 5391 5467 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0047 43 1926 gene locus_tag LOCUS_03120 43 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1926 2582 gene locus_tag LOCUS_03130 gene cynT 1926 2582 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBR7 protein_id gnl|my_center|LOCUS_03130 3066 3875 gene locus_tag LOCUS_03140 3066 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 3887 4627 gene locus_tag LOCUS_03150 3887 4627 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104116.1 protein_id gnl|my_center|LOCUS_03150 4629 5384 gene locus_tag LOCUS_03160 4629 5384 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972970.1 protein_id gnl|my_center|LOCUS_03160 >Feature sequence0048 2469 634 gene locus_tag LOCUS_03170 2469 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 2651 4009 gene locus_tag LOCUS_03180 2651 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 5141 4032 gene locus_tag LOCUS_03190 5141 4032 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267701.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence0049 1330 2685 gene locus_tag LOCUS_03200 gene gdhA 1330 2685 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55990 protein_id gnl|my_center|LOCUS_03200 4825 3413 gene locus_tag LOCUS_03210 4825 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 5275 5033 gene locus_tag LOCUS_03220 5275 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence0050 252 1421 gene locus_tag LOCUS_03230 252 1421 CDS product putative fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702326.1 protein_id gnl|my_center|LOCUS_03230 1568 1918 gene locus_tag LOCUS_03240 1568 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 2134 1922 gene locus_tag LOCUS_03250 2134 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 2218 2913 gene locus_tag LOCUS_03260 gene sfsA 2218 2913 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61664 protein_id gnl|my_center|LOCUS_03260 3004 4788 gene locus_tag LOCUS_03270 3004 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 <5458 4837 gene locus_tag LOCUS_03280 <5458 4837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071744.1:TIGR02453 family protein >Feature sequence0051 308 1189 gene locus_tag LOCUS_03290 308 1189 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_03290 1314 1691 gene locus_tag LOCUS_03300 1314 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 1702 2592 gene locus_tag LOCUS_03310 1702 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3272 2610 gene locus_tag LOCUS_03320 3272 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462121.1 protein_id gnl|my_center|LOCUS_03320 3420 3794 gene locus_tag LOCUS_03330 3420 3794 CDS product RutC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25598 protein_id gnl|my_center|LOCUS_03330 3814 5052 gene locus_tag LOCUS_03340 gene dadA 3814 5052 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25597 protein_id gnl|my_center|LOCUS_03340 >Feature sequence0052 1034 1621 gene locus_tag LOCUS_03350 1034 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 1633 1893 gene locus_tag LOCUS_03360 1633 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 1907 3391 gene locus_tag LOCUS_03370 1907 3391 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262043.1 protein_id gnl|my_center|LOCUS_03370 3449 3871 gene locus_tag LOCUS_03380 3449 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 3902 4465 gene locus_tag LOCUS_03390 3902 4465 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence0053 <1 1276 gene locus_tag LOCUS_03400 <1 1276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PI05:alanine--tRNA ligase 1285 1764 gene locus_tag LOCUS_03410 1285 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550743.1 protein_id gnl|my_center|LOCUS_03410 2431 1751 gene locus_tag LOCUS_03420 2431 1751 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022855.1 protein_id gnl|my_center|LOCUS_03420 2615 4462 gene locus_tag LOCUS_03430 2615 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 4745 4545 gene locus_tag LOCUS_03440 4745 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 5261 4839 gene locus_tag LOCUS_03450 5261 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 >Feature sequence0054 1598 69 gene locus_tag LOCUS_03460 gene recN 1598 69 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHM5 protein_id gnl|my_center|LOCUS_03460 2489 1623 gene locus_tag LOCUS_03470 gene nadK 2489 1623 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHM6 protein_id gnl|my_center|LOCUS_03470 3832 2492 gene locus_tag LOCUS_03480 3832 2492 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_03480 <5345 3825 gene locus_tag LOCUS_03490 <5345 3825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263952.1:ABC transporter >Feature sequence0055 168 1976 gene locus_tag LOCUS_03500 gene cyaA 168 1976 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947053.1 protein_id gnl|my_center|LOCUS_03500 1997 3205 gene locus_tag LOCUS_03510 gene racS 1997 3205 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857920.1 protein_id gnl|my_center|LOCUS_03510 4440 3202 gene locus_tag LOCUS_03520 4440 3202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 <5307 4657 gene locus_tag LOCUS_03530 <5307 4657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PII2:histidinol-phosphate aminotransferase >Feature sequence0056 <1 2139 gene locus_tag LOCUS_03540 <1 2139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:acriflavin resistance protein 2427 2206 gene locus_tag LOCUS_03550 2427 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 3726 2428 gene locus_tag LOCUS_03560 3726 2428 CDS product hydrolase Nlp/P60 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938195.1 protein_id gnl|my_center|LOCUS_03560 3876 4721 gene locus_tag LOCUS_03570 3876 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence0057 559 35 gene locus_tag LOCUS_03580 559 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1831 707 gene locus_tag LOCUS_03590 1831 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 2451 2107 gene locus_tag LOCUS_03600 2451 2107 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KJG4 protein_id gnl|my_center|LOCUS_03600 3252 2509 gene locus_tag LOCUS_03610 3252 2509 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_03610 4577 3249 gene locus_tag LOCUS_03620 4577 3249 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958257.1 protein_id gnl|my_center|LOCUS_03620 >Feature sequence0058 424 1836 gene locus_tag LOCUS_03630 424 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 1863 2315 gene locus_tag LOCUS_03640 1863 2315 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_03640 2409 2768 gene locus_tag LOCUS_03650 2409 2768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_03650 2792 2938 gene locus_tag LOCUS_03660 2792 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 2975 4066 gene locus_tag LOCUS_03670 2975 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 4068 4553 gene locus_tag LOCUS_03680 4068 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence0059 87 485 gene locus_tag LOCUS_03690 87 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1441 482 gene locus_tag LOCUS_03700 1441 482 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757130.1 protein_id gnl|my_center|LOCUS_03700 1572 2768 gene locus_tag LOCUS_03710 1572 2768 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_03710 2791 4140 gene locus_tag LOCUS_03720 2791 4140 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8THA6 protein_id gnl|my_center|LOCUS_03720 4802 4149 gene locus_tag LOCUS_03730 4802 4149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0060 464 1153 gene locus_tag LOCUS_03740 464 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1385 2161 gene locus_tag LOCUS_03750 1385 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 2238 4085 gene locus_tag LOCUS_03760 2238 4085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 <5177 4396 gene locus_tag LOCUS_03770 <5177 4396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891838.1:ABC transporter permease >Feature sequence0061 2000 606 gene locus_tag LOCUS_03780 2000 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 3368 2019 gene locus_tag LOCUS_03790 3368 2019 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_03790 <5170 3358 gene locus_tag LOCUS_03800 <5170 3358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263952.1:ABC transporter >Feature sequence0062 2146 101 gene locus_tag LOCUS_03810 2146 101 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_03810 2497 2183 gene locus_tag LOCUS_03820 2497 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 3063 2620 gene locus_tag LOCUS_03830 3063 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3429 3193 gene locus_tag LOCUS_03840 3429 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3598 4149 gene locus_tag LOCUS_03850 3598 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 4746 4174 gene locus_tag LOCUS_03860 4746 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 4812 5078 gene locus_tag LOCUS_03870 4812 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence0063 <1 887 gene locus_tag LOCUS_03880 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001181015.1:membrane protein 1238 1672 gene locus_tag LOCUS_03890 1238 1672 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_03890 2741 1734 gene locus_tag LOCUS_03900 2741 1734 CDS product NADPH:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_03900 3884 2811 gene locus_tag LOCUS_03910 3884 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4453 4055 gene locus_tag LOCUS_03920 4453 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 4540 4785 gene locus_tag LOCUS_03930 4540 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0064 62 859 gene locus_tag LOCUS_03940 62 859 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197704.1 protein_id gnl|my_center|LOCUS_03940 861 1934 gene locus_tag LOCUS_03950 861 1934 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861561.1 protein_id gnl|my_center|LOCUS_03950 1978 2871 gene locus_tag LOCUS_03960 1978 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2868 3629 gene locus_tag LOCUS_03970 2868 3629 CDS product creatinine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972341.1 protein_id gnl|my_center|LOCUS_03970 >Feature sequence0065 1116 400 gene locus_tag LOCUS_03980 1116 400 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880005.1 protein_id gnl|my_center|LOCUS_03980 2620 1235 gene locus_tag LOCUS_03990 gene algC 2620 1235 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_03990 2794 3423 gene locus_tag LOCUS_04000 2794 3423 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021856.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence0066 <1 708 gene locus_tag LOCUS_04010 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P822:iron-sulfur cluster carrier protein 831 1178 gene locus_tag LOCUS_04020 831 1178 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878674.1 protein_id gnl|my_center|LOCUS_04020 1809 1183 gene locus_tag LOCUS_04030 1809 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2767 2207 gene locus_tag LOCUS_04040 2767 2207 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_04040 4450 2843 gene locus_tag LOCUS_04050 4450 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 <5082 4506 gene locus_tag LOCUS_04060 <5082 4506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864474.1:CheY-P-specific phosphatase CheX >Feature sequence0067 548 108 gene locus_tag LOCUS_04070 gene ytoQ 548 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34305 protein_id gnl|my_center|LOCUS_04070 652 1011 gene locus_tag LOCUS_04080 652 1011 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404521.1 protein_id gnl|my_center|LOCUS_04080 1332 1144 gene locus_tag LOCUS_04090 1332 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 1506 2000 gene locus_tag LOCUS_04100 1506 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028474.1 protein_id gnl|my_center|LOCUS_04100 2087 2695 gene locus_tag LOCUS_04110 2087 2695 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002114795.1 protein_id gnl|my_center|LOCUS_04110 2811 3422 gene locus_tag LOCUS_04120 gene rhtB 2811 3422 CDS product amino acid transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206232.1 protein_id gnl|my_center|LOCUS_04120 3446 3805 gene locus_tag LOCUS_04130 3446 3805 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001071514.1 protein_id gnl|my_center|LOCUS_04130 3918 4136 gene locus_tag LOCUS_04140 3918 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530530.1 protein_id gnl|my_center|LOCUS_04140 4230 4721 gene locus_tag LOCUS_04150 4230 4721 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence0068 2222 1893 gene locus_tag LOCUS_04160 2222 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4572 2275 gene locus_tag LOCUS_04170 4572 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence0069 465 683 gene locus_tag LOCUS_04180 465 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 1418 684 gene locus_tag LOCUS_04190 1418 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_04190 1679 2959 gene locus_tag LOCUS_04200 1679 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 2994 3365 gene locus_tag LOCUS_04210 2994 3365 CDS product polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000909986.1 protein_id gnl|my_center|LOCUS_04210 3467 4717 gene locus_tag LOCUS_04220 3467 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence0070 4084 1616 gene locus_tag LOCUS_04230 4084 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4299 4670 gene locus_tag LOCUS_04240 4299 4670 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249583.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence0071 1570 80 gene locus_tag LOCUS_04250 1570 80 CDS product fumarate hydratase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HW68 protein_id gnl|my_center|LOCUS_04250 2080 1961 gene locus_tag LOCUS_04260 2080 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2270 3124 gene locus_tag LOCUS_04270 2270 3124 CDS product sterol desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_04270 >Feature sequence0072 1150 329 gene locus_tag LOCUS_04280 gene cheR 1150 329 CDS product chemotaxis protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_04280 2235 1147 gene locus_tag LOCUS_04290 2235 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 <4936 2392 gene locus_tag LOCUS_04300 <4936 2392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMY0:histidine kinase note possible pseudo, internal stop codon >Feature sequence0073 401 1126 gene locus_tag LOCUS_04310 401 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1947 1144 gene locus_tag LOCUS_04320 1947 1144 CDS product CheY-P-specific phosphatase CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_04320 2183 3580 gene locus_tag LOCUS_04330 2183 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3598 3990 gene locus_tag LOCUS_04340 3598 3990 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855880.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence0074 2141 1065 gene locus_tag LOCUS_04350 2141 1065 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_04350 2856 2212 gene locus_tag LOCUS_04360 gene dccR 2856 2212 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_04360 <4893 2853 gene locus_tag LOCUS_04370 <4893 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545732.1:sensor histidine kinase >Feature sequence0075 837 241 gene locus_tag LOCUS_04380 837 241 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556052.1 protein_id gnl|my_center|LOCUS_04380 998 1300 gene locus_tag LOCUS_04390 998 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 2316 1369 gene locus_tag LOCUS_04400 gene argC 2316 1369 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WEH7 protein_id gnl|my_center|LOCUS_04400 3569 2391 gene locus_tag LOCUS_04410 gene aba2 3569 2391 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207945.1 protein_id gnl|my_center|LOCUS_04410 3881 3708 gene locus_tag LOCUS_04420 3881 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4517 3969 gene locus_tag LOCUS_04430 gene rpoE3 4517 3969 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263639.1 protein_id gnl|my_center|LOCUS_04430 4773 4591 gene locus_tag LOCUS_04440 4773 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence0076 819 61 gene locus_tag LOCUS_04450 819 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_04450 1678 1043 gene locus_tag LOCUS_04460 1678 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 2319 1780 gene locus_tag LOCUS_04470 gene mogA 2319 1780 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707146.1 protein_id gnl|my_center|LOCUS_04470 2416 3900 gene locus_tag LOCUS_04480 2416 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3948 4232 gene locus_tag LOCUS_04490 3948 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 <4866 4281 gene locus_tag LOCUS_04500 <4866 4281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8ZBM5:deoxyguanosinetriphosphate triphosphohydrolase >Feature sequence0077 1198 605 gene locus_tag LOCUS_04510 1198 605 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_04510 1338 1469 gene locus_tag LOCUS_04520 1338 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1701 2891 gene locus_tag LOCUS_04530 1701 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 3402 2875 gene locus_tag LOCUS_04540 3402 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 4439 3525 gene locus_tag LOCUS_04550 4439 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4693 4517 gene locus_tag LOCUS_04560 4693 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence0078 <1 570 gene locus_tag LOCUS_04570 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O69298:chaperone protein DnaK 735 908 gene locus_tag LOCUS_04580 735 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 1668 910 gene locus_tag LOCUS_04590 1668 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1820 2920 gene locus_tag LOCUS_04600 1820 2920 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815379.1 protein_id gnl|my_center|LOCUS_04600 3013 4545 gene locus_tag LOCUS_04610 3013 4545 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence0079 841 1929 gene locus_tag LOCUS_04620 841 1929 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528745.1 protein_id gnl|my_center|LOCUS_04620 1939 3489 gene locus_tag LOCUS_04630 1939 3489 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551866.1 protein_id gnl|my_center|LOCUS_04630 3500 3913 gene locus_tag LOCUS_04640 3500 3913 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197761.1 protein_id gnl|my_center|LOCUS_04640 4090 4377 gene locus_tag LOCUS_04650 4090 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence0080 519 1073 gene locus_tag LOCUS_04660 519 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2590 1085 gene locus_tag LOCUS_04670 2590 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2768 2974 gene locus_tag LOCUS_04680 2768 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 3063 3518 gene locus_tag LOCUS_04690 3063 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940924.1 protein_id gnl|my_center|LOCUS_04690 4045 3560 gene locus_tag LOCUS_04700 4045 3560 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_04700 4252 4713 gene locus_tag LOCUS_04710 4252 4713 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229404.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence0081 372 1955 gene locus_tag LOCUS_04720 372 1955 CDS product 2,5-dioxovalerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038347.1 protein_id gnl|my_center|LOCUS_04720 1952 2890 gene locus_tag LOCUS_04730 1952 2890 CDS product ornithine cyclodeaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709897.1 protein_id gnl|my_center|LOCUS_04730 2921 3925 gene locus_tag LOCUS_04740 2921 3925 CDS product hydroxyproline-2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0082 1199 486 gene locus_tag LOCUS_04750 1199 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 1308 1964 gene locus_tag LOCUS_04760 gene gph 1308 1964 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_04760 2022 2486 gene locus_tag LOCUS_04770 2022 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2957 2532 gene locus_tag LOCUS_04780 2957 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3173 4126 gene locus_tag LOCUS_04790 3173 4126 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066920.1 protein_id gnl|my_center|LOCUS_04790 4104 4541 gene locus_tag LOCUS_04800 4104 4541 CDS product DUF107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence0083 <1 1398 gene locus_tag LOCUS_04810 <1 1398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937562.1:oxidoreductase 4105 1427 gene locus_tag LOCUS_04820 4105 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 >Feature sequence0084 476 1894 gene locus_tag LOCUS_04830 gene nuoG 476 1894 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_04830 1906 3189 gene locus_tag LOCUS_04840 gene nuoH 1906 3189 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1Q6 protein_id gnl|my_center|LOCUS_04840 3192 3698 gene locus_tag LOCUS_04850 gene nuoI1 3192 3698 CDS product NADH-quinone oxidoreductase subunit I 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74GA0 protein_id gnl|my_center|LOCUS_04850 3688 4209 gene locus_tag LOCUS_04860 3688 4209 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012812.1 protein_id gnl|my_center|LOCUS_04860 4202 4513 gene locus_tag LOCUS_04870 gene nuoK1 4202 4513 CDS product NADH-quinone oxidoreductase subunit K 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G98 protein_id gnl|my_center|LOCUS_04870 >Feature sequence0085 939 172 gene locus_tag LOCUS_04880 939 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 2014 1028 gene locus_tag LOCUS_04890 2014 1028 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001016968.1 protein_id gnl|my_center|LOCUS_04890 2138 2479 gene locus_tag LOCUS_04900 2138 2479 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020391.1 protein_id gnl|my_center|LOCUS_04900 2808 2500 gene locus_tag LOCUS_04910 gene nasE 2808 2500 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037171.1 protein_id gnl|my_center|LOCUS_04910 <4578 2808 gene locus_tag LOCUS_04920 <4578 2808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113579.1:nitrite reductase large subunit >Feature sequence0086 <1 2041 gene locus_tag LOCUS_04930 <1 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958088.1:glutamate dehydrogenase 2058 3830 gene locus_tag LOCUS_04940 2058 3830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 <4557 3848 gene locus_tag LOCUS_04950 <4557 3848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNC3:putative transcriptional regulatory protein >Feature sequence0087 1561 377 gene locus_tag LOCUS_04960 1561 377 CDS product methylaspartate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015877.1 protein_id gnl|my_center|LOCUS_04960 2922 1555 gene locus_tag LOCUS_04970 gene glmE 2922 1555 CDS product glutamate mutase epsilon subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0H4 protein_id gnl|my_center|LOCUS_04970 3332 2919 gene locus_tag LOCUS_04980 gene glmS 3332 2919 CDS product glutamate mutase sigma subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61191 protein_id gnl|my_center|LOCUS_04980 3491 3967 gene locus_tag LOCUS_04990 gene rraA 3491 3967 CDS product 4-hydroxy-4-methyl-2-oxoglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HG94 protein_id gnl|my_center|LOCUS_04990 4439 4005 gene locus_tag LOCUS_05000 4439 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0088 1062 637 gene locus_tag LOCUS_05010 1062 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1718 1248 gene locus_tag LOCUS_05020 gene pgpA 1718 1248 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P818 protein_id gnl|my_center|LOCUS_05020 2606 1725 gene locus_tag LOCUS_05030 2606 1725 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_05030 3727 2603 gene locus_tag LOCUS_05040 gene ispDF 3727 2603 CDS product bifunctional enzyme IspD/IspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PM68 protein_id gnl|my_center|LOCUS_05040 >Feature sequence0089 408 641 gene locus_tag LOCUS_05050 408 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 815 3310 gene locus_tag LOCUS_05060 815 3310 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938001.1 protein_id gnl|my_center|LOCUS_05060 3480 4043 gene locus_tag LOCUS_05070 3480 4043 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096447.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence0090 204 581 gene locus_tag LOCUS_05080 gene atpC 204 581 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ18 protein_id gnl|my_center|LOCUS_05080 590 1156 gene locus_tag LOCUS_05090 590 1156 CDS product putative biopolymer transport protein ExbB-like 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25755 protein_id gnl|my_center|LOCUS_05090 1166 1555 gene locus_tag LOCUS_05100 1166 1555 CDS product putative biopolymer transport protein ExbD-like 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25754 protein_id gnl|my_center|LOCUS_05100 1559 2332 gene locus_tag LOCUS_05110 1559 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2335 3603 gene locus_tag LOCUS_05120 gene tolB 2335 3603 CDS product protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ14 protein_id gnl|my_center|LOCUS_05120 >Feature sequence0091 <1 1194 gene locus_tag LOCUS_05130 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase 2353 1439 gene locus_tag LOCUS_05140 gene secF 2353 1439 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9G2 protein_id gnl|my_center|LOCUS_05140 3978 2410 gene locus_tag LOCUS_05150 gene secD 3978 2410 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9G1 protein_id gnl|my_center|LOCUS_05150 4341 4075 gene locus_tag LOCUS_05160 gene yajC 4341 4075 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence0092 766 167 gene locus_tag LOCUS_05170 766 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2821 953 gene locus_tag LOCUS_05180 2821 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3517 2837 gene locus_tag LOCUS_05190 3517 2837 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897805.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence0093 766 467 gene locus_tag LOCUS_05200 766 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1275 793 gene locus_tag LOCUS_05210 1275 793 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525946.1 protein_id gnl|my_center|LOCUS_05210 1751 1311 gene locus_tag LOCUS_05220 1751 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088783.1 protein_id gnl|my_center|LOCUS_05220 2001 1756 gene locus_tag LOCUS_05230 2001 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2203 1994 gene locus_tag LOCUS_05240 2203 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2689 3234 gene locus_tag LOCUS_05250 2689 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4129 3257 gene locus_tag LOCUS_05260 4129 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707800.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence0094 258 1361 gene locus_tag LOCUS_05270 258 1361 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938039.1 protein_id gnl|my_center|LOCUS_05270 1388 3538 gene locus_tag LOCUS_05280 1388 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence0095 496 1788 gene locus_tag LOCUS_05290 496 1788 CDS product dicarboxylate:amino acid:cation symporter DAACS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_05290 2337 1858 gene locus_tag LOCUS_05300 2337 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 2923 2447 gene locus_tag LOCUS_05310 2923 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 3128 3604 gene locus_tag LOCUS_05320 3128 3604 CDS product thiol-disulfide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013970.1 protein_id gnl|my_center|LOCUS_05320 3591 4304 gene locus_tag LOCUS_05330 3591 4304 CDS product sulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510691.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0096 117 1019 gene locus_tag LOCUS_05340 gene lysR1 117 1019 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_05340 1999 1016 gene locus_tag LOCUS_05350 gene yxfC 1999 1016 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132720.1 protein_id gnl|my_center|LOCUS_05350 3339 2002 gene locus_tag LOCUS_05360 gene purF 3339 2002 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBU3 protein_id gnl|my_center|LOCUS_05360 4125 3352 gene locus_tag LOCUS_05370 gene dapB 4125 3352 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIT2 protein_id gnl|my_center|LOCUS_05370 >Feature sequence0097 <1 825 gene locus_tag LOCUS_05380 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852836.1:methionine adenosyltransferase 957 1823 gene locus_tag LOCUS_05390 gene accD 957 1823 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PC10 protein_id gnl|my_center|LOCUS_05390 1832 2458 gene locus_tag LOCUS_05400 1832 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 2470 2928 gene locus_tag LOCUS_05410 gene rlmH 2470 2928 CDS product ribosomal RNA large subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ01 protein_id gnl|my_center|LOCUS_05410 2977 3333 gene locus_tag LOCUS_05420 2977 3333 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_05420 >Feature sequence0098 763 2058 gene locus_tag LOCUS_05430 gene glmU 763 2058 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25393 protein_id gnl|my_center|LOCUS_05430 2071 3303 gene locus_tag LOCUS_05440 2071 3303 CDS product phosphopantothenate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001009984.1 protein_id gnl|my_center|LOCUS_05440 3305 4012 gene locus_tag LOCUS_05450 gene uppS 3305 4012 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55984 protein_id gnl|my_center|LOCUS_05450 >Feature sequence0099 16 588 gene locus_tag LOCUS_05460 16 588 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464841.1 protein_id gnl|my_center|LOCUS_05460 1105 617 gene locus_tag LOCUS_05470 1105 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 1207 1527 gene locus_tag LOCUS_05480 gene sugE 1207 1527 CDS product QacE family quaternary ammonium compound efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123025.1 protein_id gnl|my_center|LOCUS_05480 1586 2056 gene locus_tag LOCUS_05490 1586 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2892 2149 gene locus_tag LOCUS_05500 gene proC 2892 2149 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9H8 protein_id gnl|my_center|LOCUS_05500 3587 2961 gene locus_tag LOCUS_05510 3587 2961 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708648.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence0100 <1 1161 gene locus_tag LOCUS_05520 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858720.1:ATPase AAA 1217 3484 gene locus_tag LOCUS_05530 1217 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 <4278 3559 gene locus_tag LOCUS_05540 <4278 3559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037042.1:chemotaxis protein >Feature sequence0101 179 1558 gene locus_tag LOCUS_05550 179 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2185 1565 gene locus_tag LOCUS_05560 2185 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 3282 2185 gene locus_tag LOCUS_05570 3282 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851142.1 protein_id gnl|my_center|LOCUS_05570 <4276 3409 gene locus_tag LOCUS_05580 <4276 3409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PP65:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence0102 2 271 gene locus_tag LOCUS_05590 2 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 872 339 gene locus_tag LOCUS_05600 872 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 1209 961 gene locus_tag LOCUS_05610 1209 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1859 1206 gene locus_tag LOCUS_05620 1859 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05620 2486 1962 gene locus_tag LOCUS_05630 2486 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05630 2534 3457 gene locus_tag LOCUS_05640 2534 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence0103 1872 799 gene locus_tag LOCUS_05650 1872 799 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_05650 2373 1879 gene locus_tag LOCUS_05660 gene aroQ 2373 1879 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ53 protein_id gnl|my_center|LOCUS_05660 2501 3526 gene locus_tag LOCUS_05670 2501 3526 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25681 protein_id gnl|my_center|LOCUS_05670 3656 4132 gene locus_tag LOCUS_05680 gene folK 3656 4132 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25680 protein_id gnl|my_center|LOCUS_05680 >Feature sequence0104 <1 2135 gene locus_tag LOCUS_05690 <1 2135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009881803.1:chemotaxis protein 3038 2190 gene locus_tag LOCUS_05700 3038 2190 CDS product 3-hydroxyisobutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545437.1 protein_id gnl|my_center|LOCUS_05700 3280 3065 gene locus_tag LOCUS_05710 3280 3065 CDS product tautomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P901 protein_id gnl|my_center|LOCUS_05710 <4268 3318 gene locus_tag LOCUS_05720 <4268 3318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532852.1:MFS transporter >Feature sequence0105 990 265 gene locus_tag LOCUS_05730 990 265 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975156.1 protein_id gnl|my_center|LOCUS_05730 1709 987 gene locus_tag LOCUS_05740 1709 987 CDS product amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969501.1 protein_id gnl|my_center|LOCUS_05740 2383 1706 gene locus_tag LOCUS_05750 2383 1706 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312403.1 protein_id gnl|my_center|LOCUS_05750 3258 2440 gene locus_tag LOCUS_05760 3258 2440 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082561.1 protein_id gnl|my_center|LOCUS_05760 4022 3348 gene locus_tag LOCUS_05770 4022 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 4254 4024 gene locus_tag LOCUS_05780 4254 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence0106 597 190 gene locus_tag LOCUS_05790 597 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2549 642 gene locus_tag LOCUS_05800 2549 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2913 2635 gene locus_tag LOCUS_05810 2913 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 <4253 2987 gene locus_tag LOCUS_05820 <4253 2987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261721.1:transporter >Feature sequence0107 124 2304 gene locus_tag LOCUS_05830 124 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2355 2975 gene locus_tag LOCUS_05840 2355 2975 CDS product fibrillarin-like rRNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020592.1 protein_id gnl|my_center|LOCUS_05840 2984 3751 gene locus_tag LOCUS_05850 2984 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence0108 1310 210 gene locus_tag LOCUS_05860 1310 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05860 1467 3341 gene locus_tag LOCUS_05870 1467 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3352 4035 gene locus_tag LOCUS_05880 gene vncR 3352 4035 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697956.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0109 330 1598 gene locus_tag LOCUS_05890 gene leuC 330 1598 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18AJ2 protein_id gnl|my_center|LOCUS_05890 1602 2171 gene locus_tag LOCUS_05900 gene mobA 1602 2171 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMU9 protein_id gnl|my_center|LOCUS_05900 2851 3849 gene locus_tag LOCUS_05910 2851 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4150 3926 gene locus_tag LOCUS_05920 4150 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence0110 915 151 gene locus_tag LOCUS_05930 gene proC 915 151 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9H8 protein_id gnl|my_center|LOCUS_05930 1322 1978 gene locus_tag LOCUS_05940 gene bamD 1322 1978 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9I0 protein_id gnl|my_center|LOCUS_05940 >Feature sequence0111 1316 375 gene locus_tag LOCUS_05950 1316 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 2701 1610 gene locus_tag LOCUS_05960 2701 1610 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097629.1 protein_id gnl|my_center|LOCUS_05960 <4164 3021 gene locus_tag LOCUS_05970 <4164 3021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PHK7:argininosuccinate synthase >Feature sequence0112 987 322 gene locus_tag LOCUS_05980 987 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888632.1 protein_id gnl|my_center|LOCUS_05980 1720 1016 gene locus_tag LOCUS_05990 1720 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705790.1 protein_id gnl|my_center|LOCUS_05990 2287 1847 gene locus_tag LOCUS_06000 2287 1847 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481458.1 protein_id gnl|my_center|LOCUS_06000 2922 2275 gene locus_tag LOCUS_06010 2922 2275 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970533.1 protein_id gnl|my_center|LOCUS_06010 3327 2926 gene locus_tag LOCUS_06020 3327 2926 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969811.1 protein_id gnl|my_center|LOCUS_06020 3977 3342 gene locus_tag LOCUS_06030 gene rhtB 3977 3342 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0113 99 815 gene locus_tag LOCUS_06040 99 815 CDS product CheY-P-specific phosphatase CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_06040 2654 861 gene locus_tag LOCUS_06050 2654 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3720 2779 gene locus_tag LOCUS_06060 3720 2779 CDS product cell surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063973.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence0114 837 1283 gene locus_tag LOCUS_06070 837 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1497 2153 gene locus_tag LOCUS_06080 1497 2153 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940643.1 protein_id gnl|my_center|LOCUS_06080 2871 2398 gene locus_tag LOCUS_06090 gene ybaK 2871 2398 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KMZ8 protein_id gnl|my_center|LOCUS_06090 <4135 2917 gene locus_tag LOCUS_06100 <4135 2917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546485.1:aminobutyraldehyde dehydrogenase >Feature sequence0115 629 1216 gene locus_tag LOCUS_06110 629 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 1216 2586 gene locus_tag LOCUS_06120 1216 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 2712 4076 gene locus_tag LOCUS_06130 2712 4076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence0116 785 1582 gene locus_tag LOCUS_06140 785 1582 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962428.1 protein_id gnl|my_center|LOCUS_06140 1610 2521 gene locus_tag LOCUS_06150 1610 2521 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_06150 2536 3759 gene locus_tag LOCUS_06160 2536 3759 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000193978.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence0117 5 766 gene locus_tag LOCUS_06170 5 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106332.1 protein_id gnl|my_center|LOCUS_06170 850 1992 gene locus_tag LOCUS_06180 850 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence0118 2968 734 gene locus_tag LOCUS_06190 gene narB 2968 734 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117877.1 protein_id gnl|my_center|LOCUS_06190 <4103 2968 gene locus_tag LOCUS_06200 <4103 2968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117876.1:molybdopterin oxidoreductase >Feature sequence0119 2525 102 gene locus_tag LOCUS_06210 2525 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4100 2526 gene locus_tag LOCUS_06220 4100 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 >Feature sequence0120 <1 1625 gene locus_tag LOCUS_06230 <1 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851362.1:methyl-accepting chemotaxis protein 2400 1660 gene locus_tag LOCUS_06240 2400 1660 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975050.1 protein_id gnl|my_center|LOCUS_06240 3712 2414 gene locus_tag LOCUS_06250 gene pepQ 3712 2414 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EKR8 protein_id gnl|my_center|LOCUS_06250 4094 3720 gene locus_tag LOCUS_06260 4094 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence0121 2100 1135 gene locus_tag LOCUS_06270 gene mraY 2100 1135 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI72 protein_id gnl|my_center|LOCUS_06270 2271 3755 gene locus_tag LOCUS_06280 gene gpmI 2271 3755 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56196 protein_id gnl|my_center|LOCUS_06280 >Feature sequence0122 136 888 gene locus_tag LOCUS_06290 136 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1021 1287 gene locus_tag LOCUS_06300 1021 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1329 1652 gene locus_tag LOCUS_06310 1329 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 <4062 1706 gene locus_tag LOCUS_06320 <4062 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8EJN9:pyruvate dehydrogenase E1 component >Feature sequence0123 67 600 gene locus_tag LOCUS_06330 gene rplF 67 600 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7T9 protein_id gnl|my_center|LOCUS_06330 608 970 gene locus_tag LOCUS_06340 gene rplR 608 970 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLY7 protein_id gnl|my_center|LOCUS_06340 973 1299 gene locus_tag LOCUS_06350 973 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06350 1417 1815 gene locus_tag LOCUS_06360 gene rp10 1417 1815 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7U2 protein_id gnl|my_center|LOCUS_06360 1890 3080 gene locus_tag LOCUS_06370 gene secY 1890 3080 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7U3 protein_id gnl|my_center|LOCUS_06370 3087 3845 gene locus_tag LOCUS_06380 gene map 3087 3845 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7X7 protein_id gnl|my_center|LOCUS_06380 >Feature sequence0124 <1 1470 gene locus_tag LOCUS_06390 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707871.1:phosphonate ABC transporter, permease protein PhnE 1546 2592 gene locus_tag LOCUS_06400 1546 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 3075 2635 gene locus_tag LOCUS_06410 gene ptp 3075 2635 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250910.1 protein_id gnl|my_center|LOCUS_06410 3750 3085 gene locus_tag LOCUS_06420 3750 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence0125 1125 502 gene locus_tag LOCUS_06430 1125 502 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_06430 2454 1138 gene locus_tag LOCUS_06440 gene miaB 2454 1138 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB55 protein_id gnl|my_center|LOCUS_06440 2702 2460 gene locus_tag LOCUS_06450 2702 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 protein_id gnl|my_center|LOCUS_06450 2852 4024 gene locus_tag LOCUS_06460 gene nusA 2852 4024 CDS product transcription termination/antitermination protein NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB53 protein_id gnl|my_center|LOCUS_06460 >Feature sequence0126 182 1267 gene locus_tag LOCUS_06470 gene cheB 182 1267 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JT63 protein_id gnl|my_center|LOCUS_06470 1479 2534 gene locus_tag LOCUS_06480 gene xerH 1479 2534 CDS product tyrosine recombinase XerH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PA27 protein_id gnl|my_center|LOCUS_06480 2963 2670 gene locus_tag LOCUS_06490 2963 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3446 2970 gene locus_tag LOCUS_06500 3446 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 <4009 3492 gene locus_tag LOCUS_06510 <4009 3492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000483790.1:oligopeptidase A >Feature sequence0127 1723 1079 gene locus_tag LOCUS_06520 1723 1079 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_06520 1970 2521 gene locus_tag LOCUS_06530 gene ubiX 1970 2521 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPF1 protein_id gnl|my_center|LOCUS_06530 2521 3012 gene locus_tag LOCUS_06540 gene coaD 2521 3012 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPF2 protein_id gnl|my_center|LOCUS_06540 3003 3569 gene locus_tag LOCUS_06550 gene tmk 3003 3569 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPF3 protein_id gnl|my_center|LOCUS_06550 >Feature sequence0128 99 500 gene locus_tag LOCUS_06560 99 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 641 1564 gene locus_tag LOCUS_06570 641 1564 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886296.1 protein_id gnl|my_center|LOCUS_06570 2874 1576 gene locus_tag LOCUS_06580 2874 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3664 2876 gene locus_tag LOCUS_06590 3664 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence0129 <1 1054 gene locus_tag LOCUS_06600 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PJ84:CTP synthase 1064 2629 gene locus_tag LOCUS_06610 gene recJ 1064 2629 CDS product single-stranded-DNA-specific exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_06610 3161 2631 gene locus_tag LOCUS_06620 3161 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence0130 <1 1166 gene locus_tag LOCUS_06630 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25170:putative MscS family protein >Feature sequence0131 247 1197 gene locus_tag LOCUS_06640 247 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1194 2363 gene locus_tag LOCUS_06650 gene pstA 1194 2363 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAQ2 protein_id gnl|my_center|LOCUS_06650 2423 3181 gene locus_tag LOCUS_06660 2423 3181 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_06660 3181 3849 gene locus_tag LOCUS_06670 gene phoU 3181 3849 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDZ4 protein_id gnl|my_center|LOCUS_06670 >Feature sequence0132 <1 759 gene locus_tag LOCUS_06680 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase note possible pseudo, internal stop codon 1124 942 gene locus_tag LOCUS_06690 1124 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1042 1680 gene locus_tag LOCUS_06700 1042 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1750 2412 gene locus_tag LOCUS_06710 gene cynT 1750 2412 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBR7 protein_id gnl|my_center|LOCUS_06710 >Feature sequence0133 <1 556 gene locus_tag LOCUS_06720 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X2A5:acetylornithine aminotransferase 537 1727 gene locus_tag LOCUS_06730 537 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3248 1788 gene locus_tag LOCUS_06740 gene pyk 3248 1788 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBB8 protein_id gnl|my_center|LOCUS_06740 3559 3693 gene locus_tag LOCUS_06750 3559 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 >Feature sequence0134 2 145 gene locus_tag LOCUS_06760 2 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 262 1047 gene locus_tag LOCUS_06770 262 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 1120 1440 gene locus_tag LOCUS_06780 1120 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1559 1966 gene locus_tag LOCUS_06790 1559 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06790 1953 2243 gene locus_tag LOCUS_06800 1953 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06800 2255 2566 gene locus_tag LOCUS_06810 2255 2566 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204343.1 protein_id gnl|my_center|LOCUS_06810 2568 3110 gene locus_tag LOCUS_06820 2568 3110 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697198.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence0135 <1 1194 gene locus_tag LOCUS_06830 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966811.1:thioredoxin domain-containing protein 1191 3032 gene locus_tag LOCUS_06840 gene dsbD 1191 3032 CDS product thiol:disulfide interchange protein DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDH5 protein_id gnl|my_center|LOCUS_06840 3192 3452 gene locus_tag LOCUS_06850 3192 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3446 3772 gene locus_tag LOCUS_06860 3446 3772 CDS product mRNA interferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73KH1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence0136 1430 675 gene locus_tag LOCUS_06870 1430 675 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_06870 1568 2221 gene locus_tag LOCUS_06880 1568 2221 CDS product AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966058.1 protein_id gnl|my_center|LOCUS_06880 2280 2861 gene locus_tag LOCUS_06890 2280 2861 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010430079.1 protein_id gnl|my_center|LOCUS_06890 2846 3301 gene locus_tag LOCUS_06900 2846 3301 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038076.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence0137 117 629 gene locus_tag LOCUS_06910 117 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 680 1075 gene locus_tag LOCUS_06920 680 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1122 1574 gene locus_tag LOCUS_06930 1122 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1567 1863 gene locus_tag LOCUS_06940 1567 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1863 2378 gene locus_tag LOCUS_06950 1863 2378 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_06950 2381 3241 gene locus_tag LOCUS_06960 2381 3241 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963867.1 protein_id gnl|my_center|LOCUS_06960 3306 3680 gene locus_tag LOCUS_06970 3306 3680 CDS product 4-carboxymuconolactone decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191582.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence0138 2193 1441 gene locus_tag LOCUS_06980 2193 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 <3824 2204 gene locus_tag LOCUS_06990 <3824 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003124349.1:protein CyaB >Feature sequence0139 524 985 gene locus_tag LOCUS_07000 524 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1008 2111 gene locus_tag LOCUS_07010 1008 2111 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001113032.1 protein_id gnl|my_center|LOCUS_07010 2206 3357 gene locus_tag LOCUS_07020 2206 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence0140 1534 785 gene locus_tag LOCUS_07030 1534 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2998 1661 gene locus_tag LOCUS_07040 2998 1661 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926703.1 protein_id gnl|my_center|LOCUS_07040 3473 2988 gene locus_tag LOCUS_07050 3473 2988 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930617.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence0141 383 583 gene locus_tag LOCUS_07060 gene rpmE 383 583 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIX2 protein_id gnl|my_center|LOCUS_07060 600 1418 gene locus_tag LOCUS_07070 gene rsmI 600 1418 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBY3 protein_id gnl|my_center|LOCUS_07070 1421 2110 gene locus_tag LOCUS_07080 1421 2110 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149319.1 protein_id gnl|my_center|LOCUS_07080 2120 2941 gene locus_tag LOCUS_07090 2120 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792823.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence0142 <1 805 gene locus_tag LOCUS_07100 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015888240.1:ABC transporter substrate-binding protein 848 2455 gene locus_tag LOCUS_07110 848 2455 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976304.1 protein_id gnl|my_center|LOCUS_07110 2459 3622 gene locus_tag LOCUS_07120 2459 3622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084267.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence0143 67 1854 gene locus_tag LOCUS_07130 gene lepA 67 1854 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNR1 protein_id gnl|my_center|LOCUS_07130 2544 1993 gene locus_tag LOCUS_07140 2544 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 <3796 2805 gene locus_tag LOCUS_07150 <3796 2805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023226.1:tetratricopeptide repeat protein >Feature sequence0144 <1 513 gene locus_tag LOCUS_07160 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000193736.1:arginine ABC transporter ATP-binding protein 800 2524 gene locus_tag LOCUS_07170 800 2524 CDS product D-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HG0 protein_id gnl|my_center|LOCUS_07170 >Feature sequence0145 1300 779 gene locus_tag LOCUS_07180 gene rnhA 1300 779 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5HYU6 protein_id gnl|my_center|LOCUS_07180 1984 1367 gene locus_tag LOCUS_07190 1984 1367 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246986.1 protein_id gnl|my_center|LOCUS_07190 2732 2109 gene locus_tag LOCUS_07200 2732 2109 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708648.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence0146 1036 134 gene locus_tag LOCUS_07210 1036 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07210 2364 1033 gene locus_tag LOCUS_07220 gene gcvPA 2364 1033 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74G70 protein_id gnl|my_center|LOCUS_07220 2740 2375 gene locus_tag LOCUS_07230 gene gcvH 2740 2375 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J4D5 protein_id gnl|my_center|LOCUS_07230 <3780 2802 gene locus_tag LOCUS_07240 <3780 2802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74G72:aminomethyltransferase >Feature sequence0147 1636 404 gene locus_tag LOCUS_07250 gene mdeA 1636 404 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071933.1 protein_id gnl|my_center|LOCUS_07250 1944 2537 gene locus_tag LOCUS_07260 1944 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 3726 2584 gene locus_tag LOCUS_07270 3726 2584 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868540.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence0148 3 410 gene locus_tag LOCUS_07280 3 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 461 829 gene locus_tag LOCUS_07290 461 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 829 3129 gene locus_tag LOCUS_07300 gene recD2 829 3129 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18CM1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence0149 1681 395 gene locus_tag LOCUS_07310 1681 395 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811061.1 protein_id gnl|my_center|LOCUS_07310 2199 1678 gene locus_tag LOCUS_07320 2199 1678 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811059.1 protein_id gnl|my_center|LOCUS_07320 3242 2211 gene locus_tag LOCUS_07330 3242 2211 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926712.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence0150 1285 602 gene locus_tag LOCUS_07340 1285 602 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HYX8 protein_id gnl|my_center|LOCUS_07340 1518 1973 gene locus_tag LOCUS_07350 1518 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2425 2009 gene locus_tag LOCUS_07360 2425 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 2968 2531 gene locus_tag LOCUS_07370 2968 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0151 295 534 gene locus_tag LOCUS_07380 295 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 903 550 gene locus_tag LOCUS_07390 903 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1626 919 gene locus_tag LOCUS_07400 gene hisA 1626 919 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y412 protein_id gnl|my_center|LOCUS_07400 2246 1638 gene locus_tag LOCUS_07410 2246 1638 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496519.1 protein_id gnl|my_center|LOCUS_07410 2965 2393 gene locus_tag LOCUS_07420 2965 2393 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_07420 3639 3046 gene locus_tag LOCUS_07430 gene mdaB 3639 3046 CDS product modulator of drug activity B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065430.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence0152 >Feature sequence0153 356 1342 gene locus_tag LOCUS_07440 356 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705146.1 protein_id gnl|my_center|LOCUS_07440 1509 2204 gene locus_tag LOCUS_07450 gene bioH 1509 2204 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206998.1 protein_id gnl|my_center|LOCUS_07450 2285 3025 gene locus_tag LOCUS_07460 2285 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 <3734 3078 gene locus_tag LOCUS_07470 <3734 3078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531526.1:multicopper oxidase >Feature sequence0154 347 1018 gene locus_tag LOCUS_07480 gene mqnA 347 1018 CDS product chorismate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25468 protein_id gnl|my_center|LOCUS_07480 1021 1785 gene locus_tag LOCUS_07490 gene uppP 1021 1785 CDS product undecaprenyl-diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIS4 protein_id gnl|my_center|LOCUS_07490 2812 1778 gene locus_tag LOCUS_07500 gene murG 2812 1778 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNQ2 protein_id gnl|my_center|LOCUS_07500 <3723 2812 gene locus_tag LOCUS_07510 <3723 2812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56096:putative lipid II flippase FtsW >Feature sequence0155 1823 918 gene locus_tag LOCUS_07520 1823 918 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192875.1 protein_id gnl|my_center|LOCUS_07520 2100 3212 gene locus_tag LOCUS_07530 2100 3212 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659003.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence0156 1060 380 gene locus_tag LOCUS_07540 gene ureAB 1060 380 CDS product urease subunit gamma/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RYJ3 protein_id gnl|my_center|LOCUS_07540 1715 1074 gene locus_tag LOCUS_07550 1715 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2464 1715 gene locus_tag LOCUS_07560 2464 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3161 2466 gene locus_tag LOCUS_07570 3161 2466 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002223523.1 protein_id gnl|my_center|LOCUS_07570 <3702 3164 gene locus_tag LOCUS_07580 <3702 3164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003376420.1:ABC transporter ATP-binding protein >Feature sequence0157 271 771 gene locus_tag LOCUS_07590 271 771 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_07590 768 1010 gene locus_tag LOCUS_07600 768 1010 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654684.1 protein_id gnl|my_center|LOCUS_07600 1007 1366 gene locus_tag LOCUS_07610 gene arsR 1007 1366 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918377.1 protein_id gnl|my_center|LOCUS_07610 1439 2002 gene locus_tag LOCUS_07620 1439 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3253 2036 gene locus_tag LOCUS_07630 3253 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence0158 1424 858 gene locus_tag LOCUS_07640 gene folE 1424 858 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51594 protein_id gnl|my_center|LOCUS_07640 2629 1436 gene locus_tag LOCUS_07650 gene pilC 2629 1436 CDS product type II secretion system protein F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707570.1 protein_id gnl|my_center|LOCUS_07650 <3686 2629 gene locus_tag LOCUS_07660 <3686 2629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864463.1:general secretion pathway protein GspE >Feature sequence0159 679 68 gene locus_tag LOCUS_07670 679 68 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74F12 protein_id gnl|my_center|LOCUS_07670 1759 683 gene locus_tag LOCUS_07680 1759 683 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 protein_id gnl|my_center|LOCUS_07680 2567 1749 gene locus_tag LOCUS_07690 2567 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2784 2614 gene locus_tag LOCUS_07700 2784 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3457 2891 gene locus_tag LOCUS_07710 3457 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence0160 2128 1391 gene locus_tag LOCUS_07720 2128 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 2260 2556 gene locus_tag LOCUS_07730 2260 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence0161 3 542 gene locus_tag LOCUS_07740 3 542 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_07740 539 1915 gene locus_tag LOCUS_07750 539 1915 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_07750 2056 2178 gene locus_tag LOCUS_07760 2056 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence0162 1145 372 gene locus_tag LOCUS_07770 1145 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_251636.2 protein_id gnl|my_center|LOCUS_07770 1340 1155 gene locus_tag LOCUS_07780 1340 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1907 1641 gene locus_tag LOCUS_07790 1907 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 3511 2108 gene locus_tag LOCUS_07800 gene gltX2 3511 2108 CDS product glutamate--tRNA ligase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O52914 protein_id gnl|my_center|LOCUS_07800 >Feature sequence0163 1155 496 gene locus_tag LOCUS_07810 gene dccR 1155 496 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_07810 1641 1168 gene locus_tag LOCUS_07820 gene trmL 1641 1168 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9Z4 protein_id gnl|my_center|LOCUS_07820 2488 1655 gene locus_tag LOCUS_07830 gene purU 2488 1655 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KHV0 protein_id gnl|my_center|LOCUS_07830 <3653 2602 gene locus_tag LOCUS_07840 <3653 2602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790429.1:NADP-dependent malic enzyme >Feature sequence0164 <1 1001 gene locus_tag LOCUS_07850 <1 1001 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PIH0:phosphate acyltransferase 1017 2015 gene locus_tag LOCUS_07860 gene fabH 1017 2015 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIH1 protein_id gnl|my_center|LOCUS_07860 2145 2807 gene locus_tag LOCUS_07870 gene basR 2145 2807 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812947.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence0165 1122 1832 gene locus_tag LOCUS_07880 1122 1832 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002285815.1 protein_id gnl|my_center|LOCUS_07880 2844 1870 gene locus_tag LOCUS_07890 2844 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 3436 2855 gene locus_tag LOCUS_07900 3436 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence0166 <1 921 gene locus_tag LOCUS_07910 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853122.1:O-acetylhomoserine (thiol)-lyase 1011 1346 gene locus_tag LOCUS_07920 1011 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1365 2285 gene locus_tag LOCUS_07930 1365 2285 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_07930 2323 2547 gene locus_tag LOCUS_07940 2323 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2557 3255 gene locus_tag LOCUS_07950 2557 3255 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980652.1 protein_id gnl|my_center|LOCUS_07950 >Feature sequence0167 1662 307 gene locus_tag LOCUS_07960 gene fliD 1662 307 CDS product flagellar hook-associated protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CIC9 protein_id gnl|my_center|LOCUS_07960 3429 1678 gene locus_tag LOCUS_07970 gene flgK 3429 1678 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508899.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence0168 <1 3045 gene locus_tag LOCUS_07980 <1 3045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P8E1:pyruvate-flavodoxin oxidoreductase 3510 3226 gene locus_tag LOCUS_07990 gene ppiC 3510 3226 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5NEY4 protein_id gnl|my_center|LOCUS_07990 >Feature sequence0169 197 1387 gene locus_tag LOCUS_08000 197 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence0170 37 249 gene locus_tag LOCUS_08010 37 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 246 617 gene locus_tag LOCUS_08020 246 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 630 812 gene locus_tag LOCUS_08030 630 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 805 2820 gene locus_tag LOCUS_08040 gene glyS 805 2820 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P922 protein_id gnl|my_center|LOCUS_08040 >Feature sequence0171 571 855 gene locus_tag LOCUS_08050 571 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_08050 1178 1059 gene locus_tag LOCUS_08060 1178 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1341 3110 gene locus_tag LOCUS_08070 gene pbpC 1341 3110 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence0172 2401 914 gene locus_tag LOCUS_08080 2401 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08080 <3564 2451 gene locus_tag LOCUS_08090 <3564 2451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545777.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0173 26 232 gene locus_tag LOCUS_08100 26 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 249 2189 gene locus_tag LOCUS_08110 gene metG 249 2189 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PP85 protein_id gnl|my_center|LOCUS_08110 2191 2982 gene locus_tag LOCUS_08120 2191 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3037 3180 gene locus_tag LOCUS_08130 3037 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence0174 2370 1201 gene locus_tag LOCUS_08140 2370 1201 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_08140 2938 2387 gene locus_tag LOCUS_08150 2938 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08150 >Feature sequence0175 514 1761 gene locus_tag LOCUS_08160 514 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2433 1807 gene locus_tag LOCUS_08170 gene yrhP 2433 1807 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207414.1 protein_id gnl|my_center|LOCUS_08170 3080 2472 gene locus_tag LOCUS_08180 3080 2472 CDS product catabolite gene activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016232.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence0176 927 103 gene locus_tag LOCUS_08190 927 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1555 950 gene locus_tag LOCUS_08200 1555 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2780 1575 gene locus_tag LOCUS_08210 2780 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 3109 2783 gene locus_tag LOCUS_08220 3109 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence0177 2228 135 gene locus_tag LOCUS_08230 2228 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 2606 3082 gene locus_tag LOCUS_08240 2606 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 >Feature sequence0178 44 451 gene locus_tag LOCUS_08250 44 451 CDS product flagellar basal-body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_08250 469 2202 gene locus_tag LOCUS_08260 469 2202 CDS product flagellar M-ring protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25118 protein_id gnl|my_center|LOCUS_08260 2211 3230 gene locus_tag LOCUS_08270 gene fliG 2211 3230 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence0179 870 409 gene locus_tag LOCUS_08280 870 409 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_08280 1468 860 gene locus_tag LOCUS_08290 gene engB 1468 860 CDS product putative GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHL7 protein_id gnl|my_center|LOCUS_08290 1971 1471 gene locus_tag LOCUS_08300 1971 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2506 1973 gene locus_tag LOCUS_08310 2506 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2994 2497 gene locus_tag LOCUS_08320 2994 2497 CDS product 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593725.1 protein_id gnl|my_center|LOCUS_08320 <3515 2991 gene locus_tag LOCUS_08330 <3515 2991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8GW12:imidazoleglycerol-phosphate dehydratase >Feature sequence0180 393 229 gene locus_tag LOCUS_08340 393 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 756 409 gene locus_tag LOCUS_08350 756 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 985 1920 gene locus_tag LOCUS_08360 985 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3281 1935 gene locus_tag LOCUS_08370 3281 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074165.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0181 <1 1219 gene locus_tag LOCUS_08380 <1 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809603.1:ABC transporter substrate-binding protein 1295 2917 gene locus_tag LOCUS_08390 1295 2917 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819869.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence0182 687 1874 gene locus_tag LOCUS_08400 687 1874 CDS product ammonium transporter channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_08400 2096 2434 gene locus_tag LOCUS_08410 2096 2434 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106041.1 protein_id gnl|my_center|LOCUS_08410 2436 3449 gene locus_tag LOCUS_08420 gene pyrC 2436 3449 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBP6 protein_id gnl|my_center|LOCUS_08420 >Feature sequence0183 2812 191 gene locus_tag LOCUS_08430 gene secA 2812 191 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9V7 protein_id gnl|my_center|LOCUS_08430 2896 3396 gene locus_tag LOCUS_08440 2896 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence0184 424 1179 gene locus_tag LOCUS_08450 424 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 >Feature sequence0185 765 196 gene locus_tag LOCUS_08460 gene resA 765 196 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81FU5 protein_id gnl|my_center|LOCUS_08460 1421 774 gene locus_tag LOCUS_08470 1421 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1843 1424 gene locus_tag LOCUS_08480 gene bdbC 1843 1424 CDS product disulfide bond formation protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O32217 protein_id gnl|my_center|LOCUS_08480 2025 2774 gene locus_tag LOCUS_08490 2025 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3096 2785 gene locus_tag LOCUS_08500 3096 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence0186 1456 842 gene locus_tag LOCUS_08510 1456 842 CDS product UPF0323 lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PID1 protein_id gnl|my_center|LOCUS_08510 2630 1824 gene locus_tag LOCUS_08520 gene aroE 2630 1824 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBA5 protein_id gnl|my_center|LOCUS_08520 2929 2684 gene locus_tag LOCUS_08530 2929 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 <3485 2929 gene locus_tag LOCUS_08540 <3485 2929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457104.1:paraquat-inducible protein B >Feature sequence0187 1158 22 gene locus_tag LOCUS_08550 gene glxK 1158 22 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44507 protein_id gnl|my_center|LOCUS_08550 1275 1994 gene locus_tag LOCUS_08560 1275 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072727.1 protein_id gnl|my_center|LOCUS_08560 1997 2290 gene locus_tag LOCUS_08570 1997 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 >Feature sequence0188 428 1129 gene locus_tag LOCUS_08580 gene fabG 428 1129 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43713 protein_id gnl|my_center|LOCUS_08580 1859 1317 gene locus_tag LOCUS_08590 1859 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 2036 2764 gene locus_tag LOCUS_08600 2036 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707502.1 protein_id gnl|my_center|LOCUS_08600 <3480 2798 gene locus_tag LOCUS_08610 <3480 2798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640518.1:AraC family transcriptional regulator >Feature sequence0189 938 402 gene locus_tag LOCUS_08620 938 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1711 935 gene locus_tag LOCUS_08630 1711 935 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_08630 2100 1807 gene locus_tag LOCUS_08640 2100 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2565 2125 gene locus_tag LOCUS_08650 2565 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_08650 2655 3086 gene locus_tag LOCUS_08660 2655 3086 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083908.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence0190 550 2889 gene locus_tag LOCUS_08670 550 2889 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857319.1 protein_id gnl|my_center|LOCUS_08670 >Feature sequence0191 1360 425 gene locus_tag LOCUS_08680 1360 425 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940923.1 protein_id gnl|my_center|LOCUS_08680 1495 2319 gene locus_tag LOCUS_08690 1495 2319 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261705.1 protein_id gnl|my_center|LOCUS_08690 2482 3252 gene locus_tag LOCUS_08700 2482 3252 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence0192 <1 2464 gene locus_tag LOCUS_08710 <1 2464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0193 366 112 gene locus_tag LOCUS_08720 366 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 717 391 gene locus_tag LOCUS_08730 717 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1697 759 gene locus_tag LOCUS_08740 1697 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1916 2518 gene locus_tag LOCUS_08750 1916 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 3288 2605 gene locus_tag LOCUS_08760 3288 2605 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861097.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence0194 <1 692 gene locus_tag LOCUS_08770 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P8L4:enoyl-[acyl-carrier-protein] reductase [NADH] 897 2105 gene locus_tag LOCUS_08780 gene lysA 897 2105 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PII5 protein_id gnl|my_center|LOCUS_08780 2136 3203 gene locus_tag LOCUS_08790 gene pheA 2136 3203 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence0195 <1 1760 gene locus_tag LOCUS_08800 <1 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000370122.1:RNA-binding transcriptional accessory protein 1882 3222 gene locus_tag LOCUS_08810 gene pleD 1882 3222 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598537.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence0196 1519 422 gene locus_tag LOCUS_08820 1519 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 1644 3188 gene locus_tag LOCUS_08830 1644 3188 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022095.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence0197 1176 352 gene locus_tag LOCUS_08840 1176 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1456 1193 gene locus_tag LOCUS_08850 1456 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1923 1492 gene locus_tag LOCUS_08860 gene moaC 1923 1492 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIP3 protein_id gnl|my_center|LOCUS_08860 2051 2200 gene locus_tag LOCUS_08870 2051 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3329 2313 gene locus_tag LOCUS_08880 3329 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence0198 1787 1371 gene locus_tag LOCUS_08890 1787 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2701 1730 gene locus_tag LOCUS_08900 2701 1730 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852904.1 protein_id gnl|my_center|LOCUS_08900 <3406 2763 gene locus_tag LOCUS_08910 <3406 2763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891906.1:bifunctional folylpolyglutamate synthase/dihydrofolate synthase note possible pseudo, internal stop codon >Feature sequence0199 561 1598 gene locus_tag LOCUS_08920 561 1598 CDS product UPF0324 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A6G5 protein_id gnl|my_center|LOCUS_08920 1814 2782 gene locus_tag LOCUS_08930 1814 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 <3395 2824 gene locus_tag LOCUS_08940 <3395 2824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0200 1139 675 gene locus_tag LOCUS_08950 gene accB 1139 675 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262775.1 protein_id gnl|my_center|LOCUS_08950 1494 1793 gene locus_tag LOCUS_08960 1494 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1810 2250 gene locus_tag LOCUS_08970 1810 2250 CDS product dCMP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_08970 2253 2822 gene locus_tag LOCUS_08980 2253 2822 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477331.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence0201 738 469 gene locus_tag LOCUS_08990 738 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 1085 912 gene locus_tag LOCUS_09000 1085 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 1298 1792 gene locus_tag LOCUS_09010 1298 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263638.1 protein_id gnl|my_center|LOCUS_09010 1807 2271 gene locus_tag LOCUS_09020 1807 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2271 2840 gene locus_tag LOCUS_09030 2271 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence0202 <1 1234 gene locus_tag LOCUS_09040 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:ATPase 1346 1975 gene locus_tag LOCUS_09050 1346 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2030 3226 gene locus_tag LOCUS_09060 2030 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence0203 2203 26 gene locus_tag LOCUS_09070 2203 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 2754 2407 gene locus_tag LOCUS_09080 2754 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2984 2772 gene locus_tag LOCUS_09090 2984 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 >Feature sequence0204 496 104 gene locus_tag LOCUS_09100 496 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 759 496 gene locus_tag LOCUS_09110 759 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 1453 770 gene locus_tag LOCUS_09120 1453 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1768 1454 gene locus_tag LOCUS_09130 1768 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2426 1980 gene locus_tag LOCUS_09140 gene fur 2426 1980 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C631 protein_id gnl|my_center|LOCUS_09140 2758 3171 gene locus_tag LOCUS_09150 2758 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 >Feature sequence0205 1224 205 gene locus_tag LOCUS_09160 1224 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1916 1221 gene locus_tag LOCUS_09170 1916 1221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938047.1 protein_id gnl|my_center|LOCUS_09170 2724 1942 gene locus_tag LOCUS_09180 2724 1942 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938046.1 protein_id gnl|my_center|LOCUS_09180 3313 2789 gene locus_tag LOCUS_09190 3313 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence0206 324 743 gene locus_tag LOCUS_09200 324 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1167 790 gene locus_tag LOCUS_09210 1167 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 2657 1251 gene locus_tag LOCUS_09220 2657 1251 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RI54 protein_id gnl|my_center|LOCUS_09220 >Feature sequence0207 >Feature sequence0208 590 1441 gene locus_tag LOCUS_09230 590 1441 CDS product DUF350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000425211.1 protein_id gnl|my_center|LOCUS_09230 1462 3138 gene locus_tag LOCUS_09240 gene speE1 1462 3138 CDS product polyamine aminopropyltransferase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EZP1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence0209 594 394 gene locus_tag LOCUS_09250 594 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1121 903 gene locus_tag LOCUS_09260 gene cspA 1121 903 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A9X9 protein_id gnl|my_center|LOCUS_09260 1540 2700 gene locus_tag LOCUS_09270 1540 2700 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972869.1 protein_id gnl|my_center|LOCUS_09270 3140 2757 gene locus_tag LOCUS_09280 3140 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence0210 <1 715 gene locus_tag LOCUS_09290 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55999:peptide chain release factor 2 3140 789 gene locus_tag LOCUS_09300 3140 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891938.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence0211 <1 1658 gene locus_tag LOCUS_09310 <1 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105802.1:RND transporter 1636 2445 gene locus_tag LOCUS_09320 1636 2445 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence0212 675 1289 gene locus_tag LOCUS_09330 675 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09330 1326 2066 gene locus_tag LOCUS_09340 1326 2066 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881385.1 protein_id gnl|my_center|LOCUS_09340 2164 2766 gene locus_tag LOCUS_09350 2164 2766 CDS product cAMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence0213 1735 554 gene locus_tag LOCUS_09360 1735 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2478 1738 gene locus_tag LOCUS_09370 gene sufC 2478 1738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771014.1 protein_id gnl|my_center|LOCUS_09370 <3244 2496 gene locus_tag LOCUS_09380 <3244 2496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958177.1:Fe-S cluster assembly protein SufB >Feature sequence0214 <1 502 gene locus_tag LOCUS_09390 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O26104:flagellar basal-body rod protein FlgG 514 942 gene locus_tag LOCUS_09400 514 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 935 2194 gene locus_tag LOCUS_09410 935 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2736 2191 gene locus_tag LOCUS_09420 gene rimM 2736 2191 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPJ5 protein_id gnl|my_center|LOCUS_09420 3006 2767 gene locus_tag LOCUS_09430 3006 2767 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0215 653 204 gene locus_tag LOCUS_09440 gene soxY 653 204 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_09440 1022 669 gene locus_tag LOCUS_09450 1022 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2143 1058 gene locus_tag LOCUS_09460 2143 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2348 2124 gene locus_tag LOCUS_09470 2348 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 <3241 2391 gene locus_tag LOCUS_09480 <3241 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086300.1:sulfite dehydrogenase note possible pseudo, internal stop codon >Feature sequence0216 1447 428 gene locus_tag LOCUS_09490 1447 428 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_09490 2255 1554 gene locus_tag LOCUS_09500 2255 1554 CDS product CheY-P-specific phosphatase CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_09500 <3231 2248 gene locus_tag LOCUS_09510 <3231 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0217 613 1518 gene locus_tag LOCUS_09520 613 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09520 1555 2490 gene locus_tag LOCUS_09530 1555 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09530 >Feature sequence0218 621 2534 gene locus_tag LOCUS_09540 gene tkt 621 2534 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7Y3 protein_id gnl|my_center|LOCUS_09540 >Feature sequence0219 777 175 gene locus_tag LOCUS_09550 777 175 CDS product nitroimidazole resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001253368.1 protein_id gnl|my_center|LOCUS_09550 888 2264 gene locus_tag LOCUS_09560 888 2264 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000891898.1 protein_id gnl|my_center|LOCUS_09560 2897 2283 gene locus_tag LOCUS_09570 2897 2283 CDS product ACP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence0220 2104 620 gene locus_tag LOCUS_09580 2104 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 2999 2427 gene locus_tag LOCUS_09590 gene recR 2999 2427 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PN35 protein_id gnl|my_center|LOCUS_09590 >Feature sequence0221 194 475 gene locus_tag LOCUS_09600 gene ppiC2 194 475 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HWK5 protein_id gnl|my_center|LOCUS_09600 715 518 gene locus_tag LOCUS_09610 715 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 2203 797 gene locus_tag LOCUS_09620 gene ylaK 2203 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07635 protein_id gnl|my_center|LOCUS_09620 >Feature sequence0222 51 800 gene locus_tag LOCUS_09630 51 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 892 1686 gene locus_tag LOCUS_09640 gene fdhD 892 1686 CDS product sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P8B0 protein_id gnl|my_center|LOCUS_09640 1673 2077 gene locus_tag LOCUS_09650 1673 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09650 2061 2435 gene locus_tag LOCUS_09660 2061 2435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09660 >Feature sequence0223 768 571 gene locus_tag LOCUS_09670 768 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 976 800 gene locus_tag LOCUS_09680 976 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1144 2172 gene locus_tag LOCUS_09690 1144 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2248 3012 gene locus_tag LOCUS_09700 2248 3012 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence0224 1099 458 gene locus_tag LOCUS_09710 1099 458 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890811.1 protein_id gnl|my_center|LOCUS_09710 2024 1356 gene locus_tag LOCUS_09720 2024 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531642.1 protein_id gnl|my_center|LOCUS_09720 2162 2284 gene locus_tag LOCUS_09730 2162 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2517 3101 gene locus_tag LOCUS_09740 2517 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence0225 3073 2267 gene locus_tag LOCUS_09750 gene psd 3073 2267 CDS product phosphatidylserine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PP76 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0226 216 1520 gene locus_tag LOCUS_09760 216 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 1614 1745 gene locus_tag LOCUS_09770 1614 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 2902 1952 gene locus_tag LOCUS_09780 2902 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence0227 <1 1165 gene locus_tag LOCUS_09790 <1 1165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000447623.1:transporter 1271 2650 gene locus_tag LOCUS_09800 gene dsdA 1271 2650 CDS product putative D-serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HKG3 protein_id gnl|my_center|LOCUS_09800 >Feature sequence0228 1122 451 gene locus_tag LOCUS_09810 gene dccR 1122 451 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09810 1345 1127 gene locus_tag LOCUS_09820 1345 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1535 1702 gene locus_tag LOCUS_09830 1535 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 <3128 1907 gene locus_tag LOCUS_09840 <3128 1907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004195322.1:acyl-CoA ligase (AMP-forming), exosortase A system-associated >Feature sequence0229 398 1222 gene locus_tag LOCUS_09850 gene ispH 398 1222 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C632 protein_id gnl|my_center|LOCUS_09850 1373 2521 gene locus_tag LOCUS_09860 1373 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3045 2434 gene locus_tag LOCUS_09870 3045 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09870 >Feature sequence0230 <1 1803 gene locus_tag LOCUS_09880 <1 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PIZ1:translation initiation factor IF-2 1812 2171 gene locus_tag LOCUS_09890 gene rbfA 1812 2171 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIZ0 protein_id gnl|my_center|LOCUS_09890 2171 2599 gene locus_tag LOCUS_09900 gene rimP 2171 2599 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIY9 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0231 525 1580 gene locus_tag LOCUS_09910 525 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2965 1664 gene locus_tag LOCUS_09920 2965 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3119 2955 gene locus_tag LOCUS_09930 3119 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence0232 1271 84 gene locus_tag LOCUS_09940 gene dapD 1271 84 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P823 protein_id gnl|my_center|LOCUS_09940 <3118 1336 gene locus_tag LOCUS_09950 <3118 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0PAJ5:primosomal protein N' >Feature sequence0233 <1 783 gene locus_tag LOCUS_09960 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q93Q55:gamma-glutamyl phosphate reductase 819 1775 gene locus_tag LOCUS_09970 819 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1784 2137 gene locus_tag LOCUS_09980 1784 2137 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q32D73 protein_id gnl|my_center|LOCUS_09980 2427 2197 gene locus_tag LOCUS_09990 2427 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2543 2962 gene locus_tag LOCUS_10000 2543 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence0234 <1 1863 gene locus_tag LOCUS_10010 <1 1863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211638.1:autotransporter 1863 2693 gene locus_tag LOCUS_10020 1863 2693 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596814.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0235 70 1053 gene locus_tag LOCUS_10030 gene citE 70 1053 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000041092.1 protein_id gnl|my_center|LOCUS_10030 1118 1243 gene locus_tag LOCUS_10040 1118 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 1427 2269 gene locus_tag LOCUS_10050 1427 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262201.1 protein_id gnl|my_center|LOCUS_10050 2870 2307 gene locus_tag LOCUS_10060 2870 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence0236 1796 2527 gene locus_tag LOCUS_10070 1796 2527 CDS product UPF0271 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87HS9 protein_id gnl|my_center|LOCUS_10070 >Feature sequence0237 418 74 gene locus_tag LOCUS_10080 418 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 591 1268 gene locus_tag LOCUS_10090 gene trmD 591 1268 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPJ4 protein_id gnl|my_center|LOCUS_10090 1265 1621 gene locus_tag LOCUS_10100 gene rplS 1265 1621 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPJ3 protein_id gnl|my_center|LOCUS_10100 1667 2197 gene locus_tag LOCUS_10110 1667 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence0238 232 1650 gene locus_tag LOCUS_10120 gene lpd 232 1650 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPF6 protein_id gnl|my_center|LOCUS_10120 2271 1699 gene locus_tag LOCUS_10130 2271 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2402 2773 gene locus_tag LOCUS_10140 2402 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0239 973 383 gene locus_tag LOCUS_10150 gene coaE 973 383 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25502 protein_id gnl|my_center|LOCUS_10150 1604 1047 gene locus_tag LOCUS_10160 1604 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 1787 2782 gene locus_tag LOCUS_10170 gene purM 1787 2782 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P896 protein_id gnl|my_center|LOCUS_10170 >Feature sequence0240 >Feature sequence0241 <1 515 gene locus_tag LOCUS_10180 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261705.1:AraC family transcriptional regulator 659 955 gene locus_tag LOCUS_10190 659 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1121 1984 gene locus_tag LOCUS_10200 1121 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2007 2900 gene locus_tag LOCUS_10210 2007 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence0242 1062 142 gene locus_tag LOCUS_10220 gene fmt 1062 142 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ28 protein_id gnl|my_center|LOCUS_10220 1835 1065 gene locus_tag LOCUS_10230 gene proB 1835 1065 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ29 protein_id gnl|my_center|LOCUS_10230 2923 1832 gene locus_tag LOCUS_10240 gene obg 2923 1832 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PC41 protein_id gnl|my_center|LOCUS_10240 >Feature sequence0243 1277 612 gene locus_tag LOCUS_10250 1277 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10250 2480 1515 gene locus_tag LOCUS_10260 2480 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10260 3013 2657 gene locus_tag LOCUS_10270 3013 2657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence0244 2104 1631 gene locus_tag LOCUS_10280 2104 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2049 2306 gene locus_tag LOCUS_10290 2049 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 2400 2558 gene locus_tag LOCUS_10300 2400 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 2661 2834 gene locus_tag LOCUS_10310 2661 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence0245 644 1399 gene locus_tag LOCUS_10320 644 1399 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974643.1 protein_id gnl|my_center|LOCUS_10320 1510 2091 gene locus_tag LOCUS_10330 1510 2091 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_10330 2133 2711 gene locus_tag LOCUS_10340 2133 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence0246 1516 383 gene locus_tag LOCUS_10350 1516 383 CDS product cell division protein Fic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_10350 3005 1656 gene locus_tag LOCUS_10360 3005 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence0247 1172 636 gene locus_tag LOCUS_10370 1172 636 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118423.1 protein_id gnl|my_center|LOCUS_10370 1606 1181 gene locus_tag LOCUS_10380 1606 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1922 1635 gene locus_tag LOCUS_10390 1922 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2979 1912 gene locus_tag LOCUS_10400 gene dxr 2979 1912 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56139 protein_id gnl|my_center|LOCUS_10400 >Feature sequence0248 1882 242 gene locus_tag LOCUS_10410 1882 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2850 1882 gene locus_tag LOCUS_10420 2850 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence0249 176 694 gene locus_tag LOCUS_10430 176 694 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109808.1 protein_id gnl|my_center|LOCUS_10430 709 1794 gene locus_tag LOCUS_10440 709 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1926 2720 gene locus_tag LOCUS_10450 gene rbn 1926 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence0250 >Feature sequence0251 108 383 gene locus_tag LOCUS_10460 108 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 404 958 gene locus_tag LOCUS_10470 404 958 CDS product dienelactone hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937337.1 protein_id gnl|my_center|LOCUS_10470 1046 1945 gene locus_tag LOCUS_10480 1046 1945 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_10480 2567 2001 gene locus_tag LOCUS_10490 2567 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence0252 2047 692 gene locus_tag LOCUS_10500 gene ftsA 2047 692 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAI4 protein_id gnl|my_center|LOCUS_10500 >Feature sequence0253 <1 968 gene locus_tag LOCUS_10510 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390978.1:GGDEF domain-containing protein 1041 2750 gene locus_tag LOCUS_10520 1041 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0254 <1 968 gene locus_tag LOCUS_10530 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase 2290 1007 gene locus_tag LOCUS_10540 gene nhaA 2290 1007 CDS product Na(+)/H(+) antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O26076 protein_id gnl|my_center|LOCUS_10540 >Feature sequence0255 389 913 gene locus_tag LOCUS_10550 389 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 923 1282 gene locus_tag LOCUS_10560 923 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1306 2145 gene locus_tag LOCUS_10570 1306 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence0256 <2921 586 gene locus_tag LOCUS_10580 <2921 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DJ61:histidine kinase >Feature sequence0257 1470 631 gene locus_tag LOCUS_10590 gene cheR 1470 631 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O51069 protein_id gnl|my_center|LOCUS_10590 2755 1472 gene locus_tag LOCUS_10600 2755 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 >Feature sequence0258 437 189 gene locus_tag LOCUS_10610 437 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 463 966 gene locus_tag LOCUS_10620 463 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 979 1428 gene locus_tag LOCUS_10630 979 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 1915 1457 gene locus_tag LOCUS_10640 1915 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence0259 26 283 gene locus_tag LOCUS_10650 26 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 332 2206 gene locus_tag LOCUS_10660 gene pcoA 332 2206 CDS product copper resistance protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114867.1 protein_id gnl|my_center|LOCUS_10660 2206 2889 gene locus_tag LOCUS_10670 2206 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence0260 72 1163 gene locus_tag LOCUS_10680 gene luxP 72 1163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261430.1 protein_id gnl|my_center|LOCUS_10680 2420 1242 gene locus_tag LOCUS_10690 2420 1242 CDS product putative methylaconitate Delta-isomerase PrpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477855.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence0261 555 1067 gene locus_tag LOCUS_10700 gene paiA 555 1067 CDS product spermidine/spermine N(1)-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P21340 protein_id gnl|my_center|LOCUS_10700 1064 1561 gene locus_tag LOCUS_10710 1064 1561 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808849.1 protein_id gnl|my_center|LOCUS_10710 1685 1969 gene locus_tag LOCUS_10720 1685 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence0262 1255 413 gene locus_tag LOCUS_10730 gene nfo 1255 413 CDS product putative endonuclease 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7NMX3 protein_id gnl|my_center|LOCUS_10730 1736 1353 gene locus_tag LOCUS_10740 1736 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1807 2895 gene locus_tag LOCUS_10750 1807 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence0263 <1 1854 gene locus_tag LOCUS_10760 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858465.1:membrane protein 2390 1893 gene locus_tag LOCUS_10770 2390 1893 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81E04 protein_id gnl|my_center|LOCUS_10770 <2902 2390 gene locus_tag LOCUS_10780 <2902 2390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5F732:thymidylate synthase >Feature sequence0264 1289 711 gene locus_tag LOCUS_10790 1289 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2412 1282 gene locus_tag LOCUS_10800 2412 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence0265 481 284 gene locus_tag LOCUS_10810 481 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 1347 574 gene locus_tag LOCUS_10820 1347 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1523 1891 gene locus_tag LOCUS_10830 1523 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2475 1945 gene locus_tag LOCUS_10840 2475 1945 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393406.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence0266 1880 2122 gene locus_tag LOCUS_10850 1880 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence0267 809 1912 gene locus_tag LOCUS_10860 809 1912 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_10860 2668 1994 gene locus_tag LOCUS_10870 2668 1994 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence0268 538 1422 gene locus_tag LOCUS_10880 538 1422 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004531039.1 protein_id gnl|my_center|LOCUS_10880 2559 1423 gene locus_tag LOCUS_10890 2559 1423 CDS product NADH-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479145.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence0269 426 1034 gene locus_tag LOCUS_10900 426 1034 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942192.1 protein_id gnl|my_center|LOCUS_10900 1237 2382 gene locus_tag LOCUS_10910 1237 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence0270 384 1202 gene locus_tag LOCUS_10920 384 1202 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PC70 protein_id gnl|my_center|LOCUS_10920 1287 1607 gene locus_tag LOCUS_10930 1287 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 1623 1922 gene locus_tag LOCUS_10940 1623 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 1960 2415 gene locus_tag LOCUS_10950 gene flgC 1960 2415 CDS product flagellar basal-body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAY9 protein_id gnl|my_center|LOCUS_10950 >Feature sequence0271 602 450 gene locus_tag LOCUS_10960 602 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1633 791 gene locus_tag LOCUS_10970 1633 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1785 2021 gene locus_tag LOCUS_10980 1785 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2413 2069 gene locus_tag LOCUS_10990 gene hxlR 2413 2069 CDS product HTH-type transcriptional activator HxlR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P42406 protein_id gnl|my_center|LOCUS_10990 >Feature sequence0272 472 1971 gene locus_tag LOCUS_11000 gene mmsA 472 1971 CDS product methylmalonate-semialdehyde dehydrogenase [acylating] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28810 protein_id gnl|my_center|LOCUS_11000 2006 2782 gene locus_tag LOCUS_11010 2006 2782 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000258445.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0273 584 721 gene locus_tag LOCUS_11020 584 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 739 2829 gene locus_tag LOCUS_11030 739 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence0274 <1 652 gene locus_tag LOCUS_11040 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q83R52:chemotaxis response regulator protein-glutamate methylesterase 1850 699 gene locus_tag LOCUS_11050 1850 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2299 1886 gene locus_tag LOCUS_11060 2299 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2693 2391 gene locus_tag LOCUS_11070 2693 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence0275 <2830 1820 gene locus_tag LOCUS_11080 <2830 1820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3ELR7:fatty acid oxidation complex subunit alpha >Feature sequence0276 536 910 gene locus_tag LOCUS_11090 536 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11090 1019 1348 gene locus_tag LOCUS_11100 1019 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11100 1341 1985 gene locus_tag LOCUS_11110 1341 1985 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887243.1 protein_id gnl|my_center|LOCUS_11110 2014 2805 gene locus_tag LOCUS_11120 2014 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence0277 664 978 gene locus_tag LOCUS_11130 664 978 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261939.1 protein_id gnl|my_center|LOCUS_11130 987 2216 gene locus_tag LOCUS_11140 987 2216 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272482.1 protein_id gnl|my_center|LOCUS_11140 2400 2798 gene locus_tag LOCUS_11150 2400 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence0278 1543 818 gene locus_tag LOCUS_11160 1543 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_11160 2291 1536 gene locus_tag LOCUS_11170 2291 1536 CDS product GTP cyclohydrolase 1 type 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPK2 protein_id gnl|my_center|LOCUS_11170 <2813 2304 gene locus_tag LOCUS_11180 <2813 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56453:glycine--tRNA ligase alpha subunit >Feature sequence0279 1236 685 gene locus_tag LOCUS_11190 gene pth 1236 685 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PII7 protein_id gnl|my_center|LOCUS_11190 1779 1243 gene locus_tag LOCUS_11200 gene rplY 1779 1243 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PII8 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0280 1044 1406 gene locus_tag LOCUS_11210 gene acpS 1044 1406 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMP8 protein_id gnl|my_center|LOCUS_11210 1651 2100 gene locus_tag LOCUS_11220 1651 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0281 535 128 gene locus_tag LOCUS_11230 535 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1407 532 gene locus_tag LOCUS_11240 gene cobD 1407 532 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64TE1 protein_id gnl|my_center|LOCUS_11240 <2795 1397 gene locus_tag LOCUS_11250 <2795 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q97JB2:cobyric acid synthase >Feature sequence0282 583 23 gene locus_tag LOCUS_11260 583 23 CDS product polyisoprenoid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257692.1 protein_id gnl|my_center|LOCUS_11260 1373 690 gene locus_tag LOCUS_11270 gene hisI 1373 690 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18C73 protein_id gnl|my_center|LOCUS_11270 2597 1500 gene locus_tag LOCUS_11280 2597 1500 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence0283 1669 236 gene locus_tag LOCUS_11290 1669 236 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074089.1 protein_id gnl|my_center|LOCUS_11290 2292 1681 gene locus_tag LOCUS_11300 gene ycgM 2292 1681 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261691.1 protein_id gnl|my_center|LOCUS_11300 2404 2748 gene locus_tag LOCUS_11310 2404 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence0284 164 2101 gene locus_tag LOCUS_11320 164 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence0285 <1 973 gene locus_tag LOCUS_11330 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851465.1:A/G-specific adenine glycosylase 1009 1203 gene locus_tag LOCUS_11340 1009 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1282 1896 gene locus_tag LOCUS_11350 gene yhgN 1282 1896 CDS product UPF0056 inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JSJ8 protein_id gnl|my_center|LOCUS_11350 2469 1915 gene locus_tag LOCUS_11360 gene rhtB 2469 1915 CDS product flagellar biosynthesis protein FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261935.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence0286 720 556 gene locus_tag LOCUS_11370 720 556 CDS product Rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKT9 protein_id gnl|my_center|LOCUS_11370 2001 793 gene locus_tag LOCUS_11380 2001 793 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_11380 2180 2574 gene locus_tag LOCUS_tm00010 2180 2574 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0287 2380 1214 gene locus_tag LOCUS_11390 2380 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11390 >Feature sequence0288 >Feature sequence0289 >Feature sequence0290 463 2346 gene locus_tag LOCUS_11400 463 2346 CDS product cell division protein FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370329.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence0291 393 806 gene locus_tag LOCUS_11410 393 806 CDS product dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313628.1 protein_id gnl|my_center|LOCUS_11410 803 1747 gene locus_tag LOCUS_11420 803 1747 CDS product glyoxylate/hydroxypyruvate reductase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974703.1 protein_id gnl|my_center|LOCUS_11420 2249 1767 gene locus_tag LOCUS_11430 2249 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence0292 1493 459 gene locus_tag LOCUS_11440 gene ddl 1493 459 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CJF6 protein_id gnl|my_center|LOCUS_11440 2045 1557 gene locus_tag LOCUS_11450 2045 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11450 <2722 2052 gene locus_tag LOCUS_11460 <2722 2052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943292.1:MATE family efflux transporter note possible pseudo, internal stop codon >Feature sequence0293 876 55 gene locus_tag LOCUS_11470 876 55 CDS product N5-glutamine S-adenosyl-L-methionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000176078.1 protein_id gnl|my_center|LOCUS_11470 2027 930 gene locus_tag LOCUS_11480 2027 930 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_11480 2083 2583 gene locus_tag LOCUS_11490 gene rppH 2083 2583 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PHT5 protein_id gnl|my_center|LOCUS_11490 >Feature sequence0294 422 30 gene locus_tag LOCUS_11500 422 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1359 532 gene locus_tag LOCUS_11510 1359 532 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965465.1 protein_id gnl|my_center|LOCUS_11510 2455 1685 gene locus_tag LOCUS_11520 2455 1685 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence0295 2619 766 gene locus_tag LOCUS_11530 2619 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence0296 2118 346 gene locus_tag LOCUS_11540 2118 346 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389201.1 protein_id gnl|my_center|LOCUS_11540 2447 2121 gene locus_tag LOCUS_11550 2447 2121 CDS product arsenical resistance operon transcriptional repressor ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272722.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence0297 556 888 gene locus_tag LOCUS_11560 556 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 966 1199 gene locus_tag LOCUS_11570 966 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1121 1462 gene locus_tag LOCUS_11580 1121 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1472 1663 gene locus_tag LOCUS_11590 1472 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014310.1 protein_id gnl|my_center|LOCUS_11590 1695 2552 gene locus_tag LOCUS_11600 1695 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence0298 >Feature sequence0299 417 4 gene locus_tag LOCUS_11610 417 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11610 741 580 gene locus_tag LOCUS_11620 741 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 1105 746 gene locus_tag LOCUS_11630 1105 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 <2698 1102 gene locus_tag LOCUS_11640 <2698 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000488898.1:methyl-accepting chemotaxis protein >Feature sequence0300 <1 1314 gene locus_tag LOCUS_11650 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q63RL3:urease subunit alpha 1323 1772 gene locus_tag LOCUS_11660 1323 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1789 2436 gene locus_tag LOCUS_11670 1789 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence0301 989 1903 gene locus_tag LOCUS_11680 gene cmoB 989 1903 CDS product tRNA U34 carboxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9S6 protein_id gnl|my_center|LOCUS_11680 <2690 1910 gene locus_tag LOCUS_11690 <2690 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein >Feature sequence0302 620 1057 gene locus_tag LOCUS_11700 620 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 1720 1061 gene locus_tag LOCUS_11710 1720 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 <2688 1817 gene locus_tag LOCUS_11720 <2688 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:ATPase >Feature sequence0303 1635 502 gene locus_tag LOCUS_11730 1635 502 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_11730 <2687 1759 gene locus_tag LOCUS_11740 <2687 1759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0304 103 438 gene locus_tag LOCUS_11750 103 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 463 1659 gene locus_tag LOCUS_11760 463 1659 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965827.1 protein_id gnl|my_center|LOCUS_11760 2552 1668 gene locus_tag LOCUS_11770 2552 1668 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence0305 14 814 gene locus_tag LOCUS_11780 14 814 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937487.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence0306 2 655 gene locus_tag LOCUS_11790 2 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 1648 743 gene locus_tag LOCUS_11800 1648 743 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251148.1 protein_id gnl|my_center|LOCUS_11800 2385 1738 gene locus_tag LOCUS_11810 2385 1738 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863447.1 protein_id gnl|my_center|LOCUS_11810 >Feature sequence0307 2174 774 gene locus_tag LOCUS_11820 2174 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 2670 2594 gene locus_tag LOCUS_t00050 2670 2594 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0308 1934 240 gene locus_tag LOCUS_11830 1934 240 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857979.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence0309 539 150 gene locus_tag LOCUS_11840 gene nuoA 539 150 CDS product NADH-quinone oxidoreductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P849 protein_id gnl|my_center|LOCUS_11840 937 1518 gene locus_tag LOCUS_11850 937 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1528 1836 gene locus_tag LOCUS_11860 1528 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence0310 1592 75 gene locus_tag LOCUS_11870 gene lysS 1592 75 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56126 protein_id gnl|my_center|LOCUS_11870 2327 1605 gene locus_tag LOCUS_11880 2327 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence0311 212 544 gene locus_tag LOCUS_11890 212 544 CDS product thiol reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355583.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence0312 1660 1082 gene locus_tag LOCUS_11900 gene trpG 1660 1082 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767895.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence0313 1241 399 gene locus_tag LOCUS_11910 1241 399 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455010.1 protein_id gnl|my_center|LOCUS_11910 2469 1246 gene locus_tag LOCUS_11920 2469 1246 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480621.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence0314 866 3 gene locus_tag LOCUS_11930 866 3 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920770.1 protein_id gnl|my_center|LOCUS_11930 980 1429 gene locus_tag LOCUS_11940 980 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 1523 2152 gene locus_tag LOCUS_11950 1523 2152 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940859.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence0315 >Feature sequence0316 74 814 gene locus_tag LOCUS_11960 gene lplA 74 814 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941047.1 protein_id gnl|my_center|LOCUS_11960 798 1682 gene locus_tag LOCUS_11970 gene lipA 798 1682 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61196 protein_id gnl|my_center|LOCUS_11970 1977 1792 gene locus_tag LOCUS_11980 1977 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2574 2209 gene locus_tag LOCUS_11990 2574 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence0317 2225 1545 gene locus_tag LOCUS_12000 2225 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181887.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0318 279 34 gene locus_tag LOCUS_12010 279 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 432 914 gene locus_tag LOCUS_12020 432 914 CDS product heme utilization protein HutZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704904.1 protein_id gnl|my_center|LOCUS_12020 927 1157 gene locus_tag LOCUS_12030 927 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 2408 1179 gene locus_tag LOCUS_12040 2408 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence0319 <1 679 gene locus_tag LOCUS_12050 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000573710.1:DNA-binding response regulator 676 1923 gene locus_tag LOCUS_12060 676 1923 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence0320 250 1032 gene locus_tag LOCUS_12070 250 1032 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_12070 1036 1896 gene locus_tag LOCUS_12080 gene parB 1036 1896 CDS product putative chromosome-partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ25 protein_id gnl|my_center|LOCUS_12080 2001 2423 gene locus_tag LOCUS_12090 gene atpF' 2001 2423 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence0321 52 837 gene locus_tag LOCUS_12100 gene hpcH 52 837 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085757.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence0322 141 317 gene locus_tag LOCUS_12110 141 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 791 357 gene locus_tag LOCUS_12120 791 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1094 1420 gene locus_tag LOCUS_12130 1094 1420 CDS product fumarate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855637.1 protein_id gnl|my_center|LOCUS_12130 1424 2188 gene locus_tag LOCUS_12140 1424 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence0323 573 1058 gene locus_tag LOCUS_12150 573 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12150 1176 2405 gene locus_tag LOCUS_12160 1176 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12160 >Feature sequence0324 456 214 gene locus_tag LOCUS_12170 456 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 659 1513 gene locus_tag LOCUS_12180 gene folD 659 1513 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PA35 protein_id gnl|my_center|LOCUS_12180 1522 2304 gene locus_tag LOCUS_12190 gene lepP 1522 2304 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PA34 protein_id gnl|my_center|LOCUS_12190 >Feature sequence0325 490 1602 gene locus_tag LOCUS_12200 490 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1940 1650 gene locus_tag LOCUS_12210 1940 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence0326 408 629 gene locus_tag LOCUS_12220 408 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0327 404 1438 gene locus_tag LOCUS_12230 gene amaA 404 1438 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_12230 1462 2310 gene locus_tag LOCUS_12240 1462 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0328 59 274 gene locus_tag LOCUS_12250 59 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 559 843 gene locus_tag LOCUS_12260 559 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 878 1081 gene locus_tag LOCUS_12270 878 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1321 1193 gene locus_tag LOCUS_12280 1321 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <2548 1770 gene locus_tag LOCUS_12290 <2548 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0329 436 17 gene locus_tag LOCUS_12300 436 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 407 541 gene locus_tag LOCUS_12310 407 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 538 1995 gene locus_tag LOCUS_12320 538 1995 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8DZV2 protein_id gnl|my_center|LOCUS_12320 >Feature sequence0330 322 567 gene locus_tag LOCUS_12330 322 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 573 2387 gene locus_tag LOCUS_12340 gene pycB 573 2387 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence0331 1203 634 gene locus_tag LOCUS_12350 gene grpE 1203 634 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55970 protein_id gnl|my_center|LOCUS_12350 1988 1200 gene locus_tag LOCUS_12360 gene hrcA 1988 1200 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPG2 protein_id gnl|my_center|LOCUS_12360 >Feature sequence0332 915 538 gene locus_tag LOCUS_12370 915 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 1920 1186 gene locus_tag LOCUS_12380 1920 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence0333 1433 63 gene locus_tag LOCUS_12390 gene lpd 1433 63 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000666062.1 protein_id gnl|my_center|LOCUS_12390 <2511 1517 gene locus_tag LOCUS_12400 <2511 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853860.1:peptidase M23 >Feature sequence0334 2167 1472 gene locus_tag LOCUS_12410 2167 1472 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963547.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence0335 <1 1694 gene locus_tag LOCUS_12420 <1 1694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222029.1:citrate lyase subunit beta >Feature sequence0336 709 413 gene locus_tag LOCUS_12430 709 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 <2509 751 gene locus_tag LOCUS_12440 <2509 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:ATPase >Feature sequence0337 <1 649 gene locus_tag LOCUS_12450 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PPB0:NH(3)-dependent NAD(+) synthetase 652 1788 gene locus_tag LOCUS_12460 gene spsC 652 1788 CDS product spore coat polysaccharide biosynthesis protein SpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39623 protein_id gnl|my_center|LOCUS_12460 >Feature sequence0338 1251 127 gene locus_tag LOCUS_12470 1251 127 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837658.1 protein_id gnl|my_center|LOCUS_12470 2319 1261 gene locus_tag LOCUS_12480 gene cheB1 2319 1261 CDS product chemotaxis response regulator protein-glutamate methylesterase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYD3 protein_id gnl|my_center|LOCUS_12480 >Feature sequence0339 1990 692 gene locus_tag LOCUS_12490 1990 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 2485 2075 gene locus_tag LOCUS_12500 2485 2075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence0340 980 657 gene locus_tag LOCUS_12510 980 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44301 protein_id gnl|my_center|LOCUS_12510 1675 977 gene locus_tag LOCUS_12520 1675 977 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_12520 2122 1676 gene locus_tag LOCUS_12530 2122 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852822.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence0341 <1 688 gene locus_tag LOCUS_12540 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PM24:glutamate racemase >Feature sequence0342 848 1126 gene locus_tag LOCUS_12550 848 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1251 1844 gene locus_tag LOCUS_12560 gene mda66 1251 1844 CDS product NADPH quinone reductase MdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817212.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0343 >Feature sequence0344 915 292 gene locus_tag LOCUS_12570 gene nuoI 915 292 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P857 protein_id gnl|my_center|LOCUS_12570 1910 912 gene locus_tag LOCUS_12580 gene nuoH 1910 912 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25857 protein_id gnl|my_center|LOCUS_12580 <2481 1914 gene locus_tag LOCUS_12590 <2481 1914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000632151.1:NADH-quinone oxidoreductase subunit G >Feature sequence0345 282 827 gene locus_tag LOCUS_12600 gene apt 282 827 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PP06 protein_id gnl|my_center|LOCUS_12600 828 2039 gene locus_tag LOCUS_12610 gene trpB 828 2039 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6F2B7 protein_id gnl|my_center|LOCUS_12610 >Feature sequence0346 >Feature sequence0347 <2463 1818 gene locus_tag LOCUS_12620 <2463 1818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q56310:chemotaxis protein CheA >Feature sequence0348 >Feature sequence0349 520 1821 gene locus_tag LOCUS_12630 gene tig 520 1821 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46108 protein_id gnl|my_center|LOCUS_12630 1826 2410 gene locus_tag LOCUS_12640 gene clpP 1826 2410 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54413 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0350 196 552 gene locus_tag LOCUS_12650 196 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 553 1470 gene locus_tag LOCUS_12660 553 1470 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_12660 1517 1873 gene locus_tag LOCUS_12670 1517 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence0351 <2460 1086 gene locus_tag LOCUS_12680 <2460 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858782.1:ABC transporter permease >Feature sequence0352 <2460 915 gene locus_tag LOCUS_12690 <2460 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence0353 461 1543 gene locus_tag LOCUS_12700 gene uxuA 461 1543 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLC8 protein_id gnl|my_center|LOCUS_12700 1536 2453 gene locus_tag LOCUS_12710 gene kdgK 1536 2453 CDS product ketodeoxygluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_709304.2 protein_id gnl|my_center|LOCUS_12710 >Feature sequence0354 2 166 gene locus_tag LOCUS_12720 2 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 192 1310 gene locus_tag LOCUS_12730 gene prpC 192 1310 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I5E3 protein_id gnl|my_center|LOCUS_12730 >Feature sequence0355 <1 1895 gene locus_tag LOCUS_12740 <1 1895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P9D8:ATP-dependent zinc metalloprotease FtsH >Feature sequence0356 1095 2084 gene locus_tag LOCUS_12750 1095 2084 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942619.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence0357 141 860 gene locus_tag LOCUS_12760 141 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 1219 884 gene locus_tag LOCUS_12770 1219 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence0358 1630 659 gene locus_tag LOCUS_12780 1630 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence0359 501 2306 gene locus_tag LOCUS_12790 gene glmS 501 2306 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMT4 protein_id gnl|my_center|LOCUS_12790 >Feature sequence0360 629 147 gene locus_tag LOCUS_12800 629 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 898 1200 gene locus_tag LOCUS_12810 898 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1210 1566 gene locus_tag LOCUS_12820 1210 1566 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112991.1 protein_id gnl|my_center|LOCUS_12820 1563 2240 gene locus_tag LOCUS_12830 1563 2240 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140007.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0361 3 248 gene locus_tag LOCUS_12840 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 252 1619 gene locus_tag LOCUS_12850 252 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 2185 1664 gene locus_tag LOCUS_12860 2185 1664 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y4Q8 protein_id gnl|my_center|LOCUS_12860 >Feature sequence0362 2196 1405 gene locus_tag LOCUS_12870 gene hisK 2196 1405 CDS product putative histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RX45 protein_id gnl|my_center|LOCUS_12870 >Feature sequence0363 1077 331 gene locus_tag LOCUS_12880 1077 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence0364 160 651 gene locus_tag LOCUS_12890 160 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 733 1182 gene locus_tag LOCUS_12900 733 1182 CDS product globin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028501.1 protein_id gnl|my_center|LOCUS_12900 1337 2245 gene locus_tag LOCUS_12910 1337 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0365 412 128 gene locus_tag LOCUS_12920 412 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1067 399 gene locus_tag LOCUS_12930 1067 399 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932617.1 protein_id gnl|my_center|LOCUS_12930 1815 1159 gene locus_tag LOCUS_12940 1815 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 1945 1784 gene locus_tag LOCUS_12950 1945 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0366 2386 269 gene locus_tag LOCUS_12960 gene rnj 2386 269 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7S1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence0367 1614 475 gene locus_tag LOCUS_12970 1614 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 <2403 1731 gene locus_tag LOCUS_12980 <2403 1731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0368 2005 488 gene locus_tag LOCUS_12990 2005 488 CDS product tripartite tricarboxylate transporter TctA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464542.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence0369 >Feature sequence0370 1078 1392 gene locus_tag LOCUS_13000 1078 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1582 2139 gene locus_tag LOCUS_13010 1582 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 >Feature sequence0371 306 79 gene locus_tag LOCUS_13020 306 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 524 997 gene locus_tag LOCUS_13030 524 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1320 1021 gene locus_tag LOCUS_13040 1320 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1618 2025 gene locus_tag LOCUS_13050 1618 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1989 2150 gene locus_tag LOCUS_13060 1989 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence0372 >Feature sequence0373 260 36 gene locus_tag LOCUS_13070 260 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_13070 623 297 gene locus_tag LOCUS_13080 623 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13080 1244 819 gene locus_tag LOCUS_13090 1244 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13090 <2386 1682 gene locus_tag LOCUS_13100 <2386 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase note possible pseudo, internal stop codon >Feature sequence0374 101 691 gene locus_tag LOCUS_13110 101 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 711 1361 gene locus_tag LOCUS_13120 711 1361 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_13120 1929 1423 gene locus_tag LOCUS_13130 1929 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2266 1919 gene locus_tag LOCUS_13140 2266 1919 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816971.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence0375 462 184 gene locus_tag LOCUS_13150 462 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13150 1800 580 gene locus_tag LOCUS_13160 1800 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 <2378 1839 gene locus_tag LOCUS_13170 <2378 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000483221.1:methyl-accepting chemotaxis protein >Feature sequence0376 453 1091 gene locus_tag LOCUS_13180 453 1091 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939913.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence0377 762 31 gene locus_tag LOCUS_13190 762 31 CDS product DNA-binding transcriptional regulator KdgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262189.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence0378 1390 1902 gene locus_tag LOCUS_13200 1390 1902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0379 893 525 gene locus_tag LOCUS_13210 gene dgkA 893 525 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBP8 protein_id gnl|my_center|LOCUS_13210 2245 890 gene locus_tag LOCUS_13220 2245 890 CDS product phosphoethanolamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0380 608 1273 gene locus_tag LOCUS_13230 608 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1270 2274 gene locus_tag LOCUS_13240 1270 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0381 1 222 gene locus_tag LOCUS_13250 1 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 310 1935 gene locus_tag LOCUS_13260 310 1935 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZWH0 protein_id gnl|my_center|LOCUS_13260 >Feature sequence0382 1106 231 gene locus_tag LOCUS_13270 1106 231 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975006.1 protein_id gnl|my_center|LOCUS_13270 1682 1137 gene locus_tag LOCUS_13280 1682 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0383 1348 455 gene locus_tag LOCUS_13290 1348 455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391327.1 protein_id gnl|my_center|LOCUS_13290 1525 1914 gene locus_tag LOCUS_13300 1525 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence0384 >Feature sequence0385 458 3 gene locus_tag LOCUS_13310 gene sodN 458 3 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80735 protein_id gnl|my_center|LOCUS_13310 1054 452 gene locus_tag LOCUS_13320 1054 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1166 1810 gene locus_tag LOCUS_13330 1166 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence0386 >Feature sequence0387 947 1942 gene locus_tag LOCUS_13340 947 1942 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 protein_id gnl|my_center|LOCUS_13340 2100 2255 gene locus_tag LOCUS_13350 2100 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0388 <2346 653 gene locus_tag LOCUS_13360 <2346 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973469.1:dihydroxy-acid dehydratase >Feature sequence0389 1510 632 gene locus_tag LOCUS_13370 1510 632 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528983.1 protein_id gnl|my_center|LOCUS_13370 2188 1514 gene locus_tag LOCUS_13380 2188 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13380 >Feature sequence0390 1816 800 gene locus_tag LOCUS_13390 gene hldD 1816 800 CDS product ADP-L-glycero-D-manno-heptose-6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9A5 protein_id gnl|my_center|LOCUS_13390 >Feature sequence0391 2341 1403 gene locus_tag LOCUS_13400 gene hisC 2341 1403 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PII2 protein_id gnl|my_center|LOCUS_13400 >Feature sequence0392 <1 897 gene locus_tag LOCUS_13410 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706015.1:transporter >Feature sequence0393 1425 616 gene locus_tag LOCUS_13420 1425 616 CDS product putative peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56112 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0394 2315 504 gene locus_tag LOCUS_13430 2315 504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence0395 >Feature sequence0396 1359 526 gene locus_tag LOCUS_13440 1359 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147169.1 protein_id gnl|my_center|LOCUS_13440 2119 1352 gene locus_tag LOCUS_13450 2119 1352 CDS product DUF1445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869458.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence0397 <1 746 gene locus_tag LOCUS_13460 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase 882 1262 gene locus_tag LOCUS_13470 882 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence0398 <2286 466 gene locus_tag LOCUS_13480 <2286 466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P9G9:transcription-repair-coupling factor >Feature sequence0399 376 1122 gene locus_tag LOCUS_13490 376 1122 CDS product putative RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25610 protein_id gnl|my_center|LOCUS_13490 >Feature sequence0400 562 263 gene locus_tag LOCUS_13500 562 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 981 631 gene locus_tag LOCUS_13510 981 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072062.1 protein_id gnl|my_center|LOCUS_13510 1211 1068 gene locus_tag LOCUS_13520 1211 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2246 1506 gene locus_tag LOCUS_13530 2246 1506 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938152.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence0401 23 1210 gene locus_tag LOCUS_13540 gene nhaA2 23 1210 CDS product Na(+)/H(+) antiporter NhaA 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P7X3 protein_id gnl|my_center|LOCUS_13540 >Feature sequence0402 371 868 gene locus_tag LOCUS_13550 371 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 981 1424 gene locus_tag LOCUS_13560 981 1424 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430905.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence0403 <2275 169 gene locus_tag LOCUS_13570 <2275 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103180.1:GGDEF domain-containing protein >Feature sequence0404 1451 861 gene locus_tag LOCUS_13580 1451 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2134 1487 gene locus_tag LOCUS_13590 2134 1487 CDS product threonine efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706096.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence0405 337 753 gene locus_tag LOCUS_13600 337 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1338 748 gene locus_tag LOCUS_13610 1338 748 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMS6 protein_id gnl|my_center|LOCUS_13610 >Feature sequence0406 1086 184 gene locus_tag LOCUS_13620 gene rsmH 1086 184 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPL4 protein_id gnl|my_center|LOCUS_13620 1150 1725 gene locus_tag LOCUS_13630 1150 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189510.1 protein_id gnl|my_center|LOCUS_13630 1851 2135 gene locus_tag LOCUS_13640 gene hup 1851 2135 CDS product DNA-binding protein HU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q46121 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0407 <1 703 gene locus_tag LOCUS_13650 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891920.1:ferrous iron transporter A 710 1906 gene locus_tag LOCUS_13660 gene trmB 710 1906 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PN20 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0408 138 794 gene locus_tag LOCUS_13670 138 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1675 845 gene locus_tag LOCUS_13680 1675 845 CDS product ureidoglycolate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528568.1 protein_id gnl|my_center|LOCUS_13680 1933 2184 gene locus_tag LOCUS_13690 1933 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence0409 203 1147 gene locus_tag LOCUS_13700 gene pdxA 203 1147 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PN58 protein_id gnl|my_center|LOCUS_13700 1151 2218 gene locus_tag LOCUS_13710 1151 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence0410 688 518 gene locus_tag LOCUS_13720 688 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1290 859 gene locus_tag LOCUS_13730 1290 859 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_13730 1596 1300 gene locus_tag LOCUS_13740 1596 1300 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706250.1 protein_id gnl|my_center|LOCUS_13740 <2257 1694 gene locus_tag LOCUS_13750 <2257 1694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000896388.1:methyl-accepting chemotaxis protein >Feature sequence0411 <1 1211 gene locus_tag LOCUS_13760 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55990:NADP-specific glutamate dehydrogenase >Feature sequence0412 117 1520 gene locus_tag LOCUS_13770 117 1520 CDS product zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence0413 73 1293 gene locus_tag LOCUS_13780 73 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1634 1305 gene locus_tag LOCUS_13790 1634 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 1794 2138 gene locus_tag LOCUS_13800 gene phnA 1794 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116259.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0414 277 852 gene locus_tag LOCUS_13810 277 852 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286813.1 protein_id gnl|my_center|LOCUS_13810 911 1147 gene locus_tag LOCUS_13820 911 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1144 1929 gene locus_tag LOCUS_13830 1144 1929 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence0415 757 203 gene locus_tag LOCUS_13840 gene mntP 757 203 CDS product putative manganese efflux pump MntP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIW1 protein_id gnl|my_center|LOCUS_13840 868 1902 gene locus_tag LOCUS_13850 868 1902 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263412.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence0416 <1 727 gene locus_tag LOCUS_13860 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142355.1:gamma-glutamyltranspeptidase 1698 877 gene locus_tag LOCUS_13870 1698 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0417 529 35 gene locus_tag LOCUS_13880 529 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 827 531 gene locus_tag LOCUS_13890 827 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1657 989 gene locus_tag LOCUS_13900 gene ydcL 1657 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261034.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence0418 784 1524 gene locus_tag LOCUS_13910 784 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 <2232 1526 gene locus_tag LOCUS_13920 <2232 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023583.1:molybdenum ABC transporter ATP-binding protein >Feature sequence0419 279 1100 gene locus_tag LOCUS_13930 279 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1415 1125 gene locus_tag LOCUS_13940 1415 1125 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813169.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence0420 227 421 gene locus_tag LOCUS_13950 227 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1500 736 gene locus_tag LOCUS_13960 1500 736 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939681.1 protein_id gnl|my_center|LOCUS_13960 1674 1865 gene locus_tag LOCUS_13970 1674 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0421 1151 342 gene locus_tag LOCUS_13980 gene panB 1151 342 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25698 protein_id gnl|my_center|LOCUS_13980 1369 2109 gene locus_tag LOCUS_13990 1369 2109 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0422 <2222 815 gene locus_tag LOCUS_14000 <2222 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858322.1:invasion antigen B >Feature sequence0423 859 1620 gene locus_tag LOCUS_14010 gene hisF 859 1620 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81G02 protein_id gnl|my_center|LOCUS_14010 1665 2201 gene locus_tag LOCUS_14020 1665 2201 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence0424 <1 1050 gene locus_tag LOCUS_14030 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970861.1:methyl-accepting chemotaxis protein >Feature sequence0425 2 160 gene locus_tag LOCUS_14040 2 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 163 1647 gene locus_tag LOCUS_14050 163 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence0426 1348 368 gene locus_tag LOCUS_14060 1348 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 <2214 1354 gene locus_tag LOCUS_14070 <2214 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNK3:leucine--tRNA ligase >Feature sequence0427 356 1360 gene locus_tag LOCUS_14080 gene argC 356 1360 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIS0 protein_id gnl|my_center|LOCUS_14080 1350 2051 gene locus_tag LOCUS_14090 1350 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence0428 756 319 gene locus_tag LOCUS_14100 756 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 870 1862 gene locus_tag LOCUS_14110 870 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence0429 595 14 gene locus_tag LOCUS_14120 gene sigZ 595 14 CDS product RNA polymerase sigma factor SigZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O05409 protein_id gnl|my_center|LOCUS_14120 1237 647 gene locus_tag LOCUS_14130 1237 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1912 1340 gene locus_tag LOCUS_14140 1912 1340 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence0430 <1 1651 gene locus_tag LOCUS_14150 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000233076.1:NADH dehydrogenase 1653 2189 gene locus_tag LOCUS_14160 1653 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0431 441 818 gene locus_tag LOCUS_14170 441 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 854 1792 gene locus_tag LOCUS_14180 854 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207667.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence0432 69 1265 gene locus_tag LOCUS_14190 gene pgk 69 1265 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMQ5 protein_id gnl|my_center|LOCUS_14190 1335 2045 gene locus_tag LOCUS_14200 gene tpiA 1335 2045 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PMQ6 protein_id gnl|my_center|LOCUS_14200 >Feature sequence0433 <1 1191 gene locus_tag LOCUS_14210 <1 1191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P07363:chemotaxis protein CheA >Feature sequence0434 1327 2091 gene locus_tag LOCUS_14220 1327 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence0435 <1 1355 gene locus_tag LOCUS_14230 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87XJ9:5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase 1480 2145 gene locus_tag LOCUS_14240 1480 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence0436 <1 720 gene locus_tag LOCUS_14250 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87H47:3-hydroxyisobutyrate dehydrogenase 825 1874 gene locus_tag LOCUS_14260 825 1874 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence0437 1148 219 gene locus_tag LOCUS_14270 gene trxB 1148 219 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBZ1 protein_id gnl|my_center|LOCUS_14270 1327 1923 gene locus_tag LOCUS_14280 gene ahpC 1327 1923 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence0438 91 1038 gene locus_tag LOCUS_14290 91 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1721 1047 gene locus_tag LOCUS_14300 1721 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2158 1793 gene locus_tag LOCUS_14310 2158 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence0439 300 674 gene locus_tag LOCUS_14320 300 674 CDS product RutC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25598 protein_id gnl|my_center|LOCUS_14320 686 1699 gene locus_tag LOCUS_14330 686 1699 CDS product 1-aminocyclopropane-1-carboxylate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence0440 >Feature sequence0441 >Feature sequence0442 42 1457 gene locus_tag LOCUS_14340 42 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence0443 <2168 1166 gene locus_tag LOCUS_14350 <2168 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNT2:3-dehydroquinate synthase >Feature sequence0444 76 948 gene locus_tag LOCUS_14360 76 948 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020082.1 protein_id gnl|my_center|LOCUS_14360 1038 1697 gene locus_tag LOCUS_14370 1038 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence0445 97 996 gene locus_tag LOCUS_14380 97 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence0446 377 1597 gene locus_tag LOCUS_14390 377 1597 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_14390 <2161 1637 gene locus_tag LOCUS_14400 <2161 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964688.1:precorrin-2 C(20)-methyltransferase >Feature sequence0447 906 46 gene locus_tag LOCUS_14410 906 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851266.1 protein_id gnl|my_center|LOCUS_14410 1177 887 gene locus_tag LOCUS_14420 1177 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819168.1 protein_id gnl|my_center|LOCUS_14420 <2157 1207 gene locus_tag LOCUS_14430 <2157 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PM99:NADH-quinone oxidoreductase subunit D >Feature sequence0448 292 888 gene locus_tag LOCUS_14440 292 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 903 2093 gene locus_tag LOCUS_14450 gene fumC 903 2093 CDS product fumarate hydratase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81F85 protein_id gnl|my_center|LOCUS_14450 >Feature sequence0449 621 145 gene locus_tag LOCUS_14460 gene cheW 621 145 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811919.1 protein_id gnl|my_center|LOCUS_14460 1918 728 gene locus_tag LOCUS_14470 gene xseA 1918 728 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25039 protein_id gnl|my_center|LOCUS_14470 >Feature sequence0450 1516 647 gene locus_tag LOCUS_14480 1516 647 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719816.1 protein_id gnl|my_center|LOCUS_14480 2148 1513 gene locus_tag LOCUS_14490 2148 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence0451 623 108 gene locus_tag LOCUS_14500 623 108 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_14500 1813 725 gene locus_tag LOCUS_14510 gene truD 1813 725 CDS product tRNA pseudouridine synthase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55985 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0452 477 1376 gene locus_tag LOCUS_14520 gene gpsA 477 1376 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PN99 protein_id gnl|my_center|LOCUS_14520 >Feature sequence0453 1922 579 gene locus_tag LOCUS_14530 gene pyk 1922 579 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBB8 protein_id gnl|my_center|LOCUS_14530 >Feature sequence0454 1251 1748 gene locus_tag LOCUS_14540 1251 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14540 >Feature sequence0455 650 865 gene locus_tag LOCUS_14550 650 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence0456 <2117 698 gene locus_tag LOCUS_14560 <2117 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260958.1:sensor domain-containing phosphodiesterase >Feature sequence0457 471 1691 gene locus_tag LOCUS_14570 471 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 1781 1957 gene locus_tag LOCUS_14580 1781 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence0458 863 303 gene locus_tag LOCUS_14590 863 303 CDS product cell wall assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969473.1 protein_id gnl|my_center|LOCUS_14590 968 1849 gene locus_tag LOCUS_14600 968 1849 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence0459 459 842 gene locus_tag LOCUS_14610 459 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 860 1255 gene locus_tag LOCUS_14620 860 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088113.1 protein_id gnl|my_center|LOCUS_14620 1354 1707 gene locus_tag LOCUS_14630 1354 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_14630 1734 2087 gene locus_tag LOCUS_14640 1734 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence0460 145 846 gene locus_tag LOCUS_14650 145 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 950 1150 gene locus_tag LOCUS_14660 950 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence0461 >Feature sequence0462 >Feature sequence0463 706 302 gene locus_tag LOCUS_14670 706 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1761 910 gene locus_tag LOCUS_14680 1761 910 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8AA23 protein_id gnl|my_center|LOCUS_14680 >Feature sequence0464 >Feature sequence0465 729 313 gene locus_tag LOCUS_14690 729 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 2052 754 gene locus_tag LOCUS_14700 2052 754 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002198156.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence0466 >Feature sequence0467 1577 573 gene locus_tag LOCUS_14710 1577 573 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947999.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence0468 246 680 gene locus_tag LOCUS_14720 246 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 702 926 gene locus_tag LOCUS_14730 702 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1265 972 gene locus_tag LOCUS_14740 1265 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524257.1 protein_id gnl|my_center|LOCUS_14740 1670 1275 gene locus_tag LOCUS_14750 1670 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence0469 284 126 gene locus_tag LOCUS_14760 284 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 394 591 gene locus_tag LOCUS_14770 394 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 635 1138 gene locus_tag LOCUS_14780 635 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817239.1 protein_id gnl|my_center|LOCUS_14780 1287 1757 gene locus_tag LOCUS_14790 1287 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14790 >Feature sequence0470 1719 553 gene locus_tag LOCUS_14800 1719 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873647.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence0471 948 331 gene locus_tag LOCUS_14810 948 331 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_14810 1217 960 gene locus_tag LOCUS_14820 1217 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1430 1741 gene locus_tag LOCUS_14830 1430 1741 CDS product UPF0345 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7H3 protein_id gnl|my_center|LOCUS_14830 >Feature sequence0472 2 77 gene locus_tag LOCUS_t00060 2 77 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 163 345 gene locus_tag LOCUS_14840 gene secE 163 345 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PB41 protein_id gnl|my_center|LOCUS_14840 356 883 gene locus_tag LOCUS_14850 gene nusG 356 883 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI36 protein_id gnl|my_center|LOCUS_14850 975 1397 gene locus_tag LOCUS_14860 gene rplK 975 1397 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI35 protein_id gnl|my_center|LOCUS_14860 >Feature sequence0473 448 735 gene locus_tag LOCUS_14870 448 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 960 1475 gene locus_tag LOCUS_14880 gene luxS 960 1475 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0E0XVR3 protein_id gnl|my_center|LOCUS_14880 1476 1919 gene locus_tag LOCUS_14890 1476 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence0474 1156 224 gene locus_tag LOCUS_14900 1156 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1804 1268 gene locus_tag LOCUS_14910 1804 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1996 1920 gene locus_tag LOCUS_t00070 1996 1920 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0475 680 1216 gene locus_tag LOCUS_14920 680 1216 CDS product NAD(P)H oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000986479.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0476 170 757 gene locus_tag LOCUS_14930 170 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0477 1677 49 gene locus_tag LOCUS_14940 1677 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence0478 98 865 gene locus_tag LOCUS_14950 98 865 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_207528.1 protein_id gnl|my_center|LOCUS_14950 1015 1761 gene locus_tag LOCUS_14960 1015 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0479 410 1540 gene locus_tag LOCUS_14970 410 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14970 >Feature sequence0480 316 663 gene locus_tag LOCUS_14980 316 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence0481 >Feature sequence0482 920 1210 gene locus_tag LOCUS_14990 920 1210 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393575.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence0483 743 1414 gene locus_tag LOCUS_15000 743 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence0484 1713 460 gene locus_tag LOCUS_15010 1713 460 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707070.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence0485 829 428 gene locus_tag LOCUS_15020 829 428 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852609.1 protein_id gnl|my_center|LOCUS_15020 1223 951 gene locus_tag LOCUS_15030 gene rpsO 1223 951 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56022 protein_id gnl|my_center|LOCUS_15030 >Feature sequence0486 389 1240 gene locus_tag LOCUS_15040 gene speB 389 1240 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_15040 1308 1775 gene locus_tag LOCUS_15050 1308 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence0487 175 420 gene locus_tag LOCUS_15060 175 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_15060 447 1430 gene locus_tag LOCUS_15070 gene trpD 447 1430 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y6Q3 protein_id gnl|my_center|LOCUS_15070 1437 1853 gene locus_tag LOCUS_15080 1437 1853 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence0488 437 84 gene locus_tag LOCUS_15090 437 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 889 626 gene locus_tag LOCUS_15100 889 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1381 980 gene locus_tag LOCUS_15110 1381 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 <2008 1403 gene locus_tag LOCUS_15120 <2008 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PHT9:S-adenosylmethionine:tRNA ribosyltransferase-isomerase >Feature sequence0489 898 188 gene locus_tag LOCUS_15130 gene rtn 898 188 CDS product signal transduction protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000665700.1 protein_id gnl|my_center|LOCUS_15130 <2003 1379 gene locus_tag LOCUS_15140 <2003 1379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PI30:DNA-directed RNA polymerase subunit beta' >Feature sequence0490 801 1574 gene locus_tag LOCUS_15150 801 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence0491 <1 778 gene locus_tag LOCUS_15160 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098251.1:myo-inosose-2 dehydratase 788 1150 gene locus_tag LOCUS_15170 788 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15170 1172 1939 gene locus_tag LOCUS_15180 1172 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15180 >Feature sequence0492 1387 467 gene locus_tag LOCUS_15190 gene oppB 1387 467 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_15190 <1995 1452 gene locus_tag LOCUS_15200 <1995 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706430.1:peptide ABC transporter substrate-binding protein >Feature sequence0493 <1 506 gene locus_tag LOCUS_15210 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9KL62:L-threonine 3-dehydrogenase 729 1484 gene locus_tag LOCUS_15220 729 1484 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938683.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0494 <1 1088 gene locus_tag LOCUS_15230 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000896388.1:methyl-accepting chemotaxis protein 1195 1953 gene locus_tag LOCUS_15240 1195 1953 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001219484.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence0495 1517 468 gene locus_tag LOCUS_15250 gene nrdB 1517 468 CDS product ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBS3 protein_id gnl|my_center|LOCUS_15250 >Feature sequence0496 <1 597 gene locus_tag LOCUS_15260 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390393.1:glycerophosphoryl diester phosphodiesterase 1123 680 gene locus_tag LOCUS_15270 1123 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence0497 <1 624 gene locus_tag LOCUS_15280 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RX92:MEMO1 family protein 1067 675 gene locus_tag LOCUS_15290 1067 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1819 1106 gene locus_tag LOCUS_15300 gene guaA 1819 1106 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039158.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence0498 1297 134 gene locus_tag LOCUS_15310 1297 134 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence0499 1307 486 gene locus_tag LOCUS_15320 1307 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 <1975 1408 gene locus_tag LOCUS_15330 <1975 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25551:putative lipid II flippase MurJ >Feature sequence0500 >Feature sequence0501 247 1257 gene locus_tag LOCUS_15340 247 1257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208544.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence0502 51 392 gene locus_tag LOCUS_15350 51 392 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852534.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence0503 610 1272 gene locus_tag LOCUS_15360 610 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence0504 <1 1562 gene locus_tag LOCUS_15370 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001252901.1:signaling protein >Feature sequence0505 <1 1419 gene locus_tag LOCUS_15380 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000611139.1:Fis family transcriptional regulator >Feature sequence0506 1729 1043 gene locus_tag LOCUS_15390 1729 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence0507 <1 530 gene locus_tag LOCUS_15400 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337642.1:ABC transporter substrate-binding protein >Feature sequence0508 315 869 gene locus_tag LOCUS_15410 315 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 856 1386 gene locus_tag LOCUS_15420 856 1386 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853058.1 protein_id gnl|my_center|LOCUS_15420 1558 1394 gene locus_tag LOCUS_15430 1558 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence0509 296 147 gene locus_tag LOCUS_15440 296 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 736 437 gene locus_tag LOCUS_15450 736 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 1419 859 gene locus_tag LOCUS_15460 1419 859 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_15460 1857 1555 gene locus_tag LOCUS_15470 1857 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 >Feature sequence0510 1158 607 gene locus_tag LOCUS_15480 1158 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000788231.1 protein_id gnl|my_center|LOCUS_15480 <1951 1158 gene locus_tag LOCUS_15490 <1951 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0PAT5:aspartokinase >Feature sequence0511 458 1303 gene locus_tag LOCUS_15500 458 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0512 324 1574 gene locus_tag LOCUS_15510 324 1574 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403176.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0513 1810 305 gene locus_tag LOCUS_15520 1810 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence0514 802 1728 gene locus_tag LOCUS_15530 802 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15530 >Feature sequence0515 <1 646 gene locus_tag LOCUS_15540 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388962.1:exopolyphosphatase 1062 691 gene locus_tag LOCUS_15550 1062 691 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_15550 <1944 1076 gene locus_tag LOCUS_15560 <1944 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000836895.1:HD family phosphohydrolase >Feature sequence0516 <1 1352 gene locus_tag LOCUS_15570 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262771.1:cyclic nucleotide-binding protein >Feature sequence0517 1521 1228 gene locus_tag LOCUS_15580 1521 1228 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953396.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence0518 431 1051 gene locus_tag LOCUS_15590 431 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15590 >Feature sequence0519 480 1340 gene locus_tag LOCUS_15600 480 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 >Feature sequence0520 >Feature sequence0521 <1 990 gene locus_tag LOCUS_15610 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PIL7:carbamoyl-phosphate synthase large chain 983 1426 gene locus_tag LOCUS_15620 983 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001229996.1 protein_id gnl|my_center|LOCUS_15620 1479 1892 gene locus_tag LOCUS_15630 1479 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence0522 242 1741 gene locus_tag LOCUS_15640 gene metC 242 1741 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000910561.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence0523 448 29 gene locus_tag LOCUS_15650 448 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 992 456 gene locus_tag LOCUS_15660 992 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1482 1006 gene locus_tag LOCUS_15670 1482 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1895 1491 gene locus_tag LOCUS_15680 1895 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence0524 832 416 gene locus_tag LOCUS_15690 832 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1067 945 gene locus_tag LOCUS_15700 1067 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence0525 25 171 gene locus_tag LOCUS_15710 25 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 280 1215 gene locus_tag LOCUS_15720 280 1215 CDS product amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533364.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence0526 1189 1677 gene locus_tag LOCUS_15730 1189 1677 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001003091.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence0527 393 154 gene locus_tag LOCUS_15740 393 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 592 1653 gene locus_tag LOCUS_15750 gene rbsB 592 1653 CDS product D-ribose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548215.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence0528 >Feature sequence0529 314 622 gene locus_tag LOCUS_15760 gene cutA 314 622 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933271.1 protein_id gnl|my_center|LOCUS_15760 699 1478 gene locus_tag LOCUS_15770 gene thiG 699 1478 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67926 protein_id gnl|my_center|LOCUS_15770 1726 1802 gene locus_tag LOCUS_t00080 1726 1802 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1813 1889 gene locus_tag LOCUS_t00090 1813 1889 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0530 1547 660 gene locus_tag LOCUS_15780 1547 660 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_15780 1798 1580 gene locus_tag LOCUS_15790 1798 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0531 389 1846 gene locus_tag LOCUS_15800 389 1846 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806915.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence0532 <1 1423 gene locus_tag LOCUS_15810 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858743.1:ATP-binding protein >Feature sequence0533 253 1632 gene locus_tag LOCUS_15820 253 1632 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence0534 719 459 gene locus_tag LOCUS_15830 719 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1085 723 gene locus_tag LOCUS_15840 1085 723 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704967.1 protein_id gnl|my_center|LOCUS_15840 <1896 1235 gene locus_tag LOCUS_15850 <1896 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948256.1:two-component system response regulator >Feature sequence0535 1219 635 gene locus_tag LOCUS_15860 1219 635 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516588.1 protein_id gnl|my_center|LOCUS_15860 <1895 1213 gene locus_tag LOCUS_15870 <1895 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202419.1:aminotransferase DegT >Feature sequence0536 <1 562 gene locus_tag LOCUS_15880 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532461.1:Zn-dependent hydrolase 1895 792 gene locus_tag LOCUS_15890 1895 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence0537 241 1614 gene locus_tag LOCUS_15900 gene gltD 241 1614 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461217.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence0538 938 1855 gene locus_tag LOCUS_15910 938 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 >Feature sequence0539 <1 973 gene locus_tag LOCUS_15920 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230064.1:methylase <1888 1073 gene locus_tag LOCUS_15930 <1888 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812234.1:oxidoreductase >Feature sequence0540 259 1029 gene locus_tag LOCUS_15940 259 1029 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948304.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0541 <1881 313 gene locus_tag LOCUS_15950 <1881 313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0PA07:D-3-phosphoglycerate dehydrogenase >Feature sequence0542 <1879 120 gene locus_tag LOCUS_15960 <1879 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263656.1:ATPase >Feature sequence0543 107 691 gene locus_tag LOCUS_15970 107 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 704 1816 gene locus_tag LOCUS_15980 704 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence0544 1113 595 gene locus_tag LOCUS_15990 gene tpx 1113 595 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66780 protein_id gnl|my_center|LOCUS_15990 <1867 1211 gene locus_tag LOCUS_16000 <1867 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108322.1:GntR family transcriptional regulator >Feature sequence0545 <1 520 gene locus_tag LOCUS_16010 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852976.1:transcriptional regulator 828 610 gene locus_tag LOCUS_16020 828 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16020 1656 1048 gene locus_tag LOCUS_16030 1656 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16030 >Feature sequence0546 <1 1386 gene locus_tag LOCUS_16040 <1 1386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260958.1:sensor domain-containing phosphodiesterase >Feature sequence0547 872 231 gene locus_tag LOCUS_16050 gene napB 872 231 CDS product periplasmic nitrate reductase, electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAA7 protein_id gnl|my_center|LOCUS_16050 <1860 907 gene locus_tag LOCUS_16060 <1860 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PPD9:periplasmic nitrate reductase >Feature sequence0548 >Feature sequence0549 <1 1234 gene locus_tag LOCUS_16070 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase 1273 1788 gene locus_tag LOCUS_16080 1273 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence0550 <1 880 gene locus_tag LOCUS_16090 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002198156.1:GGDEF domain-containing protein >Feature sequence0551 <1 639 gene locus_tag LOCUS_16100 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460903.1:aspartate ammonia-lyase >Feature sequence0552 48 1766 gene locus_tag LOCUS_16110 gene pif1 48 1766 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence0553 84 1370 gene locus_tag LOCUS_16120 84 1370 CDS product C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence0554 >Feature sequence0555 <1 663 gene locus_tag LOCUS_16130 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence0556 >Feature sequence0557 959 102 gene locus_tag LOCUS_16140 959 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1522 1076 gene locus_tag LOCUS_16150 1522 1076 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_16150 1766 1533 gene locus_tag LOCUS_16160 1766 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16160 >Feature sequence0558 191 1240 gene locus_tag LOCUS_16170 191 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16170 1292 1492 gene locus_tag LOCUS_16180 1292 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16180 >Feature sequence0559 1501 800 gene locus_tag LOCUS_16190 1501 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399305.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence0560 585 779 gene locus_tag LOCUS_16200 585 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 779 1042 gene locus_tag LOCUS_16210 779 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 >Feature sequence0561 1500 529 gene locus_tag LOCUS_16220 gene oppD 1500 529 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889269.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence0562 1077 217 gene locus_tag LOCUS_16230 1077 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965075.1 protein_id gnl|my_center|LOCUS_16230 1364 1143 gene locus_tag LOCUS_16240 1364 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1749 1459 gene locus_tag LOCUS_16250 1749 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0563 875 330 gene locus_tag LOCUS_16260 875 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence0564 843 220 gene locus_tag LOCUS_16270 843 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 <1816 1124 gene locus_tag LOCUS_16280 <1816 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387853.1:sugar ABC transporter substrate-binding protein >Feature sequence0565 <1 1445 gene locus_tag LOCUS_16290 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FMQ4:autoinducer-2 kinase >Feature sequence0566 <1814 1261 gene locus_tag LOCUS_16300 <1814 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858609.1:peptidase M16 >Feature sequence0567 688 1242 gene locus_tag LOCUS_16310 688 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124788.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0568 >Feature sequence0569 463 855 gene locus_tag LOCUS_16320 463 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 836 1699 gene locus_tag LOCUS_16330 gene mcpC 836 1699 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495008.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence0570 <1806 692 gene locus_tag LOCUS_16340 <1806 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O85213:chaperone protein DnaJ >Feature sequence0571 650 21 gene locus_tag LOCUS_16350 gene dccR 650 21 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_16350 <1803 732 gene locus_tag LOCUS_16360 <1803 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066177.1:MATE family efflux transporter >Feature sequence0572 739 425 gene locus_tag LOCUS_16370 739 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 909 1247 gene locus_tag LOCUS_16380 909 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence0573 912 127 gene locus_tag LOCUS_16390 912 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1738 953 gene locus_tag LOCUS_16400 1738 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence0574 <1 617 gene locus_tag LOCUS_16410 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851096.1:transcriptional regulator 879 658 gene locus_tag LOCUS_16420 879 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16420 1386 1054 gene locus_tag LOCUS_16430 1386 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16430 >Feature sequence0575 >Feature sequence0576 306 1364 gene locus_tag LOCUS_16440 306 1364 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0577 764 345 gene locus_tag LOCUS_16450 gene rplM 764 345 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56038 protein_id gnl|my_center|LOCUS_16450 <1784 868 gene locus_tag LOCUS_16460 <1784 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852536.1:two-component sensor histidine kinase >Feature sequence0578 >Feature sequence0579 175 519 gene locus_tag LOCUS_16470 175 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence0580 >Feature sequence0581 >Feature sequence0582 793 407 gene locus_tag LOCUS_16480 793 407 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932430.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence0583 422 1651 gene locus_tag LOCUS_16490 422 1651 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337262.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0584 203 829 gene locus_tag LOCUS_16500 203 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_16500 810 1310 gene locus_tag LOCUS_16510 810 1310 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851150.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0585 540 1193 gene locus_tag LOCUS_16520 540 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence0586 105 470 gene locus_tag LOCUS_16530 105 470 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143803.1 protein_id gnl|my_center|LOCUS_16530 482 874 gene locus_tag LOCUS_16540 gene panD 482 874 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56065 protein_id gnl|my_center|LOCUS_16540 903 1178 gene locus_tag LOCUS_16550 903 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 >Feature sequence0587 352 173 gene locus_tag LOCUS_16560 352 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 754 389 gene locus_tag LOCUS_16570 754 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 863 1540 gene locus_tag LOCUS_16580 gene vncR 863 1540 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697956.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0588 1492 26 gene locus_tag LOCUS_16590 gene ccoN 1492 26 CDS product cytochrome c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0589 444 1493 gene locus_tag LOCUS_16600 444 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence0590 120 542 gene locus_tag LOCUS_16610 gene sufE 120 542 CDS product Fe-S metabolism protein SufE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_16610 535 900 gene locus_tag LOCUS_16620 535 900 CDS product Fe-S assembly SUF system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence0591 >Feature sequence0592 <1 514 gene locus_tag LOCUS_16630 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864474.1:CheY-P-specific phosphatase CheX 1339 518 gene locus_tag LOCUS_16640 1339 518 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002819467.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0593 173 724 gene locus_tag LOCUS_16650 gene thiJ 173 724 CDS product 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852508.1 protein_id gnl|my_center|LOCUS_16650 873 754 gene locus_tag LOCUS_16660 873 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 1335 949 gene locus_tag LOCUS_16670 1335 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence0594 1197 289 gene locus_tag LOCUS_16680 1197 289 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence0595 >Feature sequence0596 >Feature sequence0597 <1 874 gene locus_tag LOCUS_16690 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNY2:bifunctional purine biosynthesis protein PurH >Feature sequence0598 <1 550 gene locus_tag LOCUS_16700 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930332.1:methyl-accepting chemotaxis protein <1736 600 gene locus_tag LOCUS_16710 <1736 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545276.1:MFS transporter >Feature sequence0599 <1 556 gene locus_tag LOCUS_16720 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971922.1:lysine transporter LysE 1437 619 gene locus_tag LOCUS_16730 1437 619 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886674.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence0600 117 1085 gene locus_tag LOCUS_16740 gene hemB 117 1085 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P9Q7 protein_id gnl|my_center|LOCUS_16740 >Feature sequence0601 1728 601 gene locus_tag LOCUS_16750 1728 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence0602 393 1304 gene locus_tag LOCUS_16760 393 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence0603 <1 904 gene locus_tag LOCUS_16770 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464586.1:C4-dicarboxylate ABC transporter substrate-binding protein >Feature sequence0604 109 879 gene locus_tag LOCUS_16780 109 879 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence0605 480 1322 gene locus_tag LOCUS_16790 480 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence0606 1209 1484 gene locus_tag LOCUS_16800 gene fdxA 1209 1484 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0607 <1 1181 gene locus_tag LOCUS_16810 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267221.1:ABC transporter substrate-binding protein note possible pseudo, internal stop codon >Feature sequence0608 759 133 gene locus_tag LOCUS_16820 759 133 CDS product threonine transporter RhtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072049.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence0609 649 146 gene locus_tag LOCUS_16830 649 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16830 1228 665 gene locus_tag LOCUS_16840 gene ruvA 1228 665 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PPC1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence0610 <1 768 gene locus_tag LOCUS_16850 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O67368:lipoyl synthase 804 1355 gene locus_tag LOCUS_16860 804 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16860 >Feature sequence0611 <1712 998 gene locus_tag LOCUS_16870 <1712 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003439548.1:amino acid ABC transporter substrate-binding protein >Feature sequence0612 203 1534 gene locus_tag LOCUS_16880 203 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence0613 <1 642 gene locus_tag LOCUS_16890 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25427:putative tRNA-dihydrouridine synthase 686 1507 gene locus_tag LOCUS_16900 gene prmA 686 1507 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNH7 protein_id gnl|my_center|LOCUS_16900 >Feature sequence0614 >Feature sequence0615 <1 575 gene locus_tag LOCUS_16910 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891889.1:oxidoreductase 575 1117 gene locus_tag LOCUS_16920 gene pgsA 575 1117 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence0616 >Feature sequence0617 <1 1009 gene locus_tag LOCUS_16930 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007246223.1:peptidase >Feature sequence0618 631 1161 gene locus_tag LOCUS_16940 gene ywqN 631 1161 CDS product putative NAD(P)H-dependent FMN-containing oxidoreductase YwqN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96726 protein_id gnl|my_center|LOCUS_16940 1179 1484 gene locus_tag LOCUS_16950 1179 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1582 1506 gene locus_tag LOCUS_t00100 1582 1506 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0619 >Feature sequence0620 591 292 gene locus_tag LOCUS_16960 591 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 <1689 645 gene locus_tag LOCUS_16970 <1689 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PHL0:ATP-dependent protease ATPase subunit HslU >Feature sequence0621 901 47 gene locus_tag LOCUS_16980 901 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1308 928 gene locus_tag LOCUS_16990 1308 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083913.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence0622 >Feature sequence0623 417 52 gene locus_tag LOCUS_17000 417 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 780 1097 gene locus_tag LOCUS_17010 gene trxA 780 1097 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBZ0 protein_id gnl|my_center|LOCUS_17010 >Feature sequence0624 238 1035 gene locus_tag LOCUS_17020 238 1035 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193469.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence0625 <1 1139 gene locus_tag LOCUS_17030 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PN47:phosphoribosylamine--glycine ligase 1140 1583 gene locus_tag LOCUS_17040 1140 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence0626 >Feature sequence0627 8 1213 gene locus_tag LOCUS_17050 8 1213 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_17050 1245 1406 gene locus_tag LOCUS_17060 1245 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence0628 <1679 286 gene locus_tag LOCUS_17070 <1679 286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HUE6:UPF0061 protein >Feature sequence0629 >Feature sequence0630 >Feature sequence0631 532 1647 gene locus_tag LOCUS_17080 532 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence0632 353 1543 gene locus_tag LOCUS_17090 gene argJ 353 1543 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJS0 protein_id gnl|my_center|LOCUS_17090 >Feature sequence0633 >Feature sequence0634 1152 895 gene locus_tag LOCUS_17100 1152 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 <1671 1154 gene locus_tag LOCUS_17110 <1671 1154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337951.1:chemotaxis protein >Feature sequence0635 <1 1050 gene locus_tag LOCUS_17120 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262597.1:ammonium transporter 1249 1587 gene locus_tag LOCUS_17130 gene glnB 1249 1587 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66513 protein_id gnl|my_center|LOCUS_17130 >Feature sequence0636 55 771 gene locus_tag LOCUS_17140 55 771 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989854.1 protein_id gnl|my_center|LOCUS_17140 1616 768 gene locus_tag LOCUS_17150 1616 768 CDS product LACX protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562113.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence0637 >Feature sequence0638 <1 929 gene locus_tag LOCUS_17160 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SLS7:alanine dehydrogenase >Feature sequence0639 528 127 gene locus_tag LOCUS_17170 528 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 816 1289 gene locus_tag LOCUS_17180 816 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0640 142 789 gene locus_tag LOCUS_17190 142 789 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_17190 1030 1623 gene locus_tag LOCUS_17200 1030 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence0641 <1 595 gene locus_tag LOCUS_17210 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852328.1:hemolysin 567 1415 gene locus_tag LOCUS_17220 567 1415 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25719 protein_id gnl|my_center|LOCUS_17220 >Feature sequence0642 1197 670 gene locus_tag LOCUS_17230 1197 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence0643 289 699 gene locus_tag LOCUS_17240 289 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 1355 651 gene locus_tag LOCUS_17250 1355 651 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0644 120 431 gene locus_tag LOCUS_17260 120 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 1183 494 gene locus_tag LOCUS_17270 1183 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510899.1 protein_id gnl|my_center|LOCUS_17270 1385 1173 gene locus_tag LOCUS_17280 1385 1173 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223905.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0645 1527 433 gene locus_tag LOCUS_17290 1527 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence0646 >Feature sequence0647 >Feature sequence0648 <1625 344 gene locus_tag LOCUS_17300 <1625 344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005495889.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence0649 235 615 gene locus_tag LOCUS_17310 235 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence0650 >Feature sequence0651 <1 846 gene locus_tag LOCUS_17320 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YJS7:2-isopropylmalate synthase >Feature sequence0652 1076 243 gene locus_tag LOCUS_17330 1076 243 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001883971.1 protein_id gnl|my_center|LOCUS_17330 <1618 1102 gene locus_tag LOCUS_17340 <1618 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073783.1:ABC transporter substrate-binding protein >Feature sequence0653 >Feature sequence0654 90 227 gene locus_tag LOCUS_17350 90 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 378 824 gene locus_tag LOCUS_17360 378 824 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000606669.1 protein_id gnl|my_center|LOCUS_17360 1202 930 gene locus_tag LOCUS_17370 1202 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0655 15 1088 gene locus_tag LOCUS_17380 gene leuB 15 1088 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66607 protein_id gnl|my_center|LOCUS_17380 >Feature sequence0656 513 229 gene locus_tag LOCUS_17390 513 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1424 543 gene locus_tag LOCUS_17400 gene thrB 1424 543 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25690 protein_id gnl|my_center|LOCUS_17400 >Feature sequence0657 1176 28 gene locus_tag LOCUS_17410 1176 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence0658 >Feature sequence0659 855 271 gene locus_tag LOCUS_17420 855 271 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_17420 1022 894 gene locus_tag LOCUS_17430 1022 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 <1598 1040 gene locus_tag LOCUS_17440 <1598 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967600.1:universal stress protein >Feature sequence0660 147 617 gene locus_tag LOCUS_17450 147 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17450 >Feature sequence0661 >Feature sequence0662 371 108 gene locus_tag LOCUS_17460 371 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1590 427 gene locus_tag LOCUS_17470 1590 427 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387846.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence0663 611 402 gene locus_tag LOCUS_17480 611 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 801 583 gene locus_tag LOCUS_17490 801 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1288 890 gene locus_tag LOCUS_17500 1288 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence0664 449 1405 gene locus_tag LOCUS_17510 449 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence0665 776 1429 gene locus_tag LOCUS_17520 776 1429 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185732.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence0666 842 399 gene locus_tag LOCUS_17530 842 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence0667 16 1473 gene locus_tag LOCUS_17540 gene eutP 16 1473 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206269.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence0668 >Feature sequence0669 570 163 gene locus_tag LOCUS_17550 570 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1041 1319 gene locus_tag LOCUS_17560 1041 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence0670 916 257 gene locus_tag LOCUS_17570 916 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17570 1337 918 gene locus_tag LOCUS_17580 gene ybeY 1337 918 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25775 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0671 <1 1211 gene locus_tag LOCUS_17590 <1 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405109.1:mercuric reductase >Feature sequence0672 241 756 gene locus_tag LOCUS_17600 gene nuoB 241 756 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7Q0 protein_id gnl|my_center|LOCUS_17600 >Feature sequence0673 588 959 gene locus_tag LOCUS_17610 588 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 976 1341 gene locus_tag LOCUS_17620 976 1341 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence0674 <1 737 gene locus_tag LOCUS_17630 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857930.1:selenocysteine-specific translation elongation factor <1559 820 gene locus_tag LOCUS_17640 <1559 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56149:aspartate ammonia-lyase >Feature sequence0675 1022 639 gene locus_tag LOCUS_17650 gene ygdD 1022 639 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261343.1 protein_id gnl|my_center|LOCUS_17650 1146 1523 gene locus_tag LOCUS_17660 1146 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392777.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence0676 >Feature sequence0677 6 338 gene locus_tag LOCUS_17670 6 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 335 634 gene locus_tag LOCUS_17680 gene nuoK 335 634 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25860 protein_id gnl|my_center|LOCUS_17680 >Feature sequence0678 381 1307 gene locus_tag LOCUS_17690 381 1307 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence0679 <1 700 gene locus_tag LOCUS_17700 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888268.1:GTP pyrophosphokinase 777 1187 gene locus_tag LOCUS_17710 777 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 >Feature sequence0680 2 523 gene locus_tag LOCUS_17720 2 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 954 529 gene locus_tag LOCUS_17730 954 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0681 1082 1480 gene locus_tag LOCUS_17740 1082 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 >Feature sequence0682 1148 381 gene locus_tag LOCUS_17750 1148 381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082944.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0683 >Feature sequence0684 190 684 gene locus_tag LOCUS_17760 190 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1316 1441 gene locus_tag LOCUS_17770 1316 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 >Feature sequence0685 665 285 gene locus_tag LOCUS_17780 665 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 804 1466 gene locus_tag LOCUS_17790 804 1466 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_17790 >Feature sequence0686 >Feature sequence0687 >Feature sequence0688 >Feature sequence0689 991 1344 gene locus_tag LOCUS_17800 gene yoaB 991 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262907.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence0690 <1530 1017 gene locus_tag LOCUS_17810 <1530 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185577.1:ABC transporter permease >Feature sequence0691 67 375 gene locus_tag LOCUS_17820 67 375 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261433.1 protein_id gnl|my_center|LOCUS_17820 >Feature sequence0692 >Feature sequence0693 24 1067 gene locus_tag LOCUS_17830 gene lpxB 24 1067 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25537 protein_id gnl|my_center|LOCUS_17830 >Feature sequence0694 178 29 gene locus_tag LOCUS_17840 178 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence0695 >Feature sequence0696 334 639 gene locus_tag LOCUS_17850 gene cyf 334 639 CDS product cytochrome c-553 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P04032 protein_id gnl|my_center|LOCUS_17850 664 1206 gene locus_tag LOCUS_17860 664 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence0697 1144 47 gene locus_tag LOCUS_17870 1144 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 >Feature sequence0698 <1 665 gene locus_tag LOCUS_17880 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9CEB5:phenylalanine--tRNA ligase beta subunit >Feature sequence0699 <1516 418 gene locus_tag LOCUS_17890 <1516 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267913.1:glucarate dehydratase >Feature sequence0700 <1 536 gene locus_tag LOCUS_17900 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106349.1:glutamate synthase 643 1092 gene locus_tag LOCUS_17910 643 1092 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002900138.1 protein_id gnl|my_center|LOCUS_17910 >Feature sequence0701 1105 32 gene locus_tag LOCUS_17920 gene aroC 1105 32 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56122 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0702 <1511 966 gene locus_tag LOCUS_17930 <1511 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3J5A4:polyamine-transporting ATPase >Feature sequence0703 >Feature sequence0704 >Feature sequence0705 1329 430 gene locus_tag LOCUS_17940 1329 430 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence0706 131 760 gene locus_tag LOCUS_17950 131 760 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence0707 1467 652 gene locus_tag LOCUS_17960 1467 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 >Feature sequence0708 <1 722 gene locus_tag LOCUS_17970 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258316.1:acetyltransferase <1504 805 gene locus_tag LOCUS_17980 <1504 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000590871.1:ABC transporter ATP-binding protein >Feature sequence0709 >Feature sequence0710 1260 379 gene locus_tag LOCUS_17990 1260 379 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_17990 >Feature sequence0711 381 1022 gene locus_tag LOCUS_18000 gene yflK 381 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34542 protein_id gnl|my_center|LOCUS_18000 >Feature sequence0712 349 729 gene locus_tag LOCUS_18010 349 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence0713 115 873 gene locus_tag LOCUS_18020 115 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096075.1 protein_id gnl|my_center|LOCUS_18020 <1500 931 gene locus_tag LOCUS_18030 <1500 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005464586.1:C4-dicarboxylate ABC transporter substrate-binding protein >Feature sequence0714 645 1415 gene locus_tag LOCUS_18040 645 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence0715 683 186 gene locus_tag LOCUS_18050 683 186 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 protein_id gnl|my_center|LOCUS_18050 1297 686 gene locus_tag LOCUS_18060 gene pyrE 1297 686 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIR1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0716 767 240 gene locus_tag LOCUS_18070 767 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence0717 >Feature sequence0718 <1 1365 gene locus_tag LOCUS_18080 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000661373.1:ABC transporter ATP-binding protein >Feature sequence0719 1113 415 gene locus_tag LOCUS_18090 gene ygeA 1113 415 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263461.1 protein_id gnl|my_center|LOCUS_18090 >Feature sequence0720 182 988 gene locus_tag LOCUS_18100 gene lgt 182 988 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI98 protein_id gnl|my_center|LOCUS_18100 1453 1043 gene locus_tag LOCUS_18110 1453 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence0721 109 510 gene locus_tag LOCUS_18120 109 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence0722 <1 1223 gene locus_tag LOCUS_18130 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388311.1:ATPase >Feature sequence0723 1356 727 gene locus_tag LOCUS_18140 1356 727 CDS product ketohydroxyglutarate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001152804.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence0724 <1485 762 gene locus_tag LOCUS_18150 <1485 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326458.1:flagellar motor protein MotP >Feature sequence0725 292 1248 gene locus_tag LOCUS_18160 292 1248 CDS product putative PabA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q57527 protein_id gnl|my_center|LOCUS_18160 >Feature sequence0726 <1485 389 gene locus_tag LOCUS_18170 <1485 389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005419738.1:amino acid ABC transporter permease >Feature sequence0727 <1484 752 gene locus_tag LOCUS_18180 <1484 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000528391.1:REC domain-containing phosphodiesterase >Feature sequence0728 897 67 gene locus_tag LOCUS_18190 gene galU 897 67 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I291 protein_id gnl|my_center|LOCUS_18190 >Feature sequence0729 >Feature sequence0730 <1 681 gene locus_tag LOCUS_18200 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0731 >Feature sequence0732 >Feature sequence0733 515 30 gene locus_tag LOCUS_18210 515 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 1329 1448 gene locus_tag LOCUS_18220 1329 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence0734 >Feature sequence0735 >Feature sequence0736 607 299 gene locus_tag LOCUS_18230 607 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 807 1094 gene locus_tag LOCUS_18240 807 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073494.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence0737 859 278 gene locus_tag LOCUS_18250 859 278 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938908.1 protein_id gnl|my_center|LOCUS_18250 >Feature sequence0738 1407 538 gene locus_tag LOCUS_18260 1407 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence0739 1028 264 gene locus_tag LOCUS_18270 1028 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1369 1025 gene locus_tag LOCUS_18280 1369 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0740 223 1347 gene locus_tag LOCUS_18290 gene tgt 223 1347 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNT0 protein_id gnl|my_center|LOCUS_18290 >Feature sequence0741 >Feature sequence0742 >Feature sequence0743 <1457 505 gene locus_tag LOCUS_18300 <1457 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase >Feature sequence0744 1188 805 gene locus_tag LOCUS_18310 1188 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18310 >Feature sequence0745 128 787 gene locus_tag LOCUS_18320 gene dccR 128 787 CDS product two-component response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_18320 860 1060 gene locus_tag LOCUS_18330 860 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 1068 1400 gene locus_tag LOCUS_18340 1068 1400 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25499 protein_id gnl|my_center|LOCUS_18340 >Feature sequence0746 <1454 781 gene locus_tag LOCUS_18350 <1454 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003019314.1:short-chain dehydrogenase/reductase >Feature sequence0747 229 1110 gene locus_tag LOCUS_18360 229 1110 CDS product gluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846818.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence0748 >Feature sequence0749 229 59 gene locus_tag LOCUS_18370 229 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 422 718 gene locus_tag LOCUS_18380 422 718 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213107.1 protein_id gnl|my_center|LOCUS_18380 778 1407 gene locus_tag LOCUS_18390 778 1407 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000185713.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence0750 <1450 415 gene locus_tag LOCUS_18400 <1450 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O26024:putative phosphate permease >Feature sequence0751 <1 524 gene locus_tag LOCUS_18410 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PIS3:threonine--tRNA ligase 521 1063 gene locus_tag LOCUS_18420 gene infC 521 1063 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIS2 protein_id gnl|my_center|LOCUS_18420 1227 1424 gene locus_tag LOCUS_18430 gene rpmI 1227 1424 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P66269 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0752 <1447 517 gene locus_tag LOCUS_18440 <1447 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q87G09:2-amino-3-ketobutyrate coenzyme A ligase >Feature sequence0753 <1 676 gene locus_tag LOCUS_18450 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005170821.1:membrane protein >Feature sequence0754 610 374 gene locus_tag LOCUS_18460 610 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1106 750 gene locus_tag LOCUS_18470 1106 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence0755 >Feature sequence0756 133 57 gene locus_tag LOCUS_t00110 133 57 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 276 200 gene locus_tag LOCUS_t00120 276 200 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 374 298 gene locus_tag LOCUS_t00130 374 298 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 458 384 gene locus_tag LOCUS_t00140 458 384 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0757 1160 504 gene locus_tag LOCUS_18480 1160 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence0758 1 915 gene locus_tag LOCUS_18490 gene soxA 1 915 CDS product SoxAX cytochrome complex subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDM7 protein_id gnl|my_center|LOCUS_18490 927 1376 gene locus_tag LOCUS_18500 927 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 >Feature sequence0759 >Feature sequence0760 <1 1260 gene locus_tag LOCUS_18510 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5E6Y5:tRNA sulfurtransferase >Feature sequence0761 >Feature sequence0762 <1428 194 gene locus_tag LOCUS_18520 <1428 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P9J4:inosine-5'-monophosphate dehydrogenase >Feature sequence0763 1200 1021 gene locus_tag LOCUS_18530 1200 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 >Feature sequence0764 <1424 713 gene locus_tag LOCUS_18540 <1424 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PN27:tyrosine--tRNA ligase >Feature sequence0765 <1 576 gene locus_tag LOCUS_18550 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971083.1:2-dehydro-3-deoxy-6-phosphogalactonate aldolase >Feature sequence0766 1 1302 gene locus_tag LOCUS_18560 gene purB 1 1302 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PCA2 protein_id gnl|my_center|LOCUS_18560 >Feature sequence0767 <1421 739 gene locus_tag LOCUS_18570 <1421 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015405.1:sulfite reductase >Feature sequence0768 <1 702 gene locus_tag LOCUS_18580 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001292936.1:DEAD/DEAH box helicase 1126 752 gene locus_tag LOCUS_18590 1126 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0769 496 1236 gene locus_tag LOCUS_18600 496 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18600 >Feature sequence0770 147 914 gene locus_tag LOCUS_18610 147 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 904 1116 gene locus_tag LOCUS_18620 904 1116 CDS product cytochrome oxidase maturation protein, cbb3-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090949.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence0771 <1419 317 gene locus_tag LOCUS_18630 <1419 317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:ATPase >Feature sequence0772 30 872 gene locus_tag LOCUS_18640 gene ada 30 872 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020273.1 protein_id gnl|my_center|LOCUS_18640 1176 901 gene locus_tag LOCUS_18650 1176 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1327 1169 gene locus_tag LOCUS_18660 1327 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 >Feature sequence0773 1322 393 gene locus_tag LOCUS_18670 1322 393 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938246.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence0774 530 24 gene locus_tag LOCUS_18680 530 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18680 833 1204 gene locus_tag LOCUS_18690 833 1204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_18690 >Feature sequence0775 <1 1049 gene locus_tag LOCUS_18700 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048348.1:Na/Pi cotransporter >Feature sequence0776 582 1295 gene locus_tag LOCUS_18710 gene flgG2 582 1295 CDS product flagellar basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAI2 protein_id gnl|my_center|LOCUS_18710 >Feature sequence0777 1 210 gene locus_tag LOCUS_18720 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence0778 1278 463 gene locus_tag LOCUS_18730 1278 463 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence0779 >Feature sequence0780 <1 1269 gene locus_tag LOCUS_18740 <1 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PMS2:L-seryl-tRNA(Sec) selenium transferase >Feature sequence0781 1270 593 gene locus_tag LOCUS_18750 1270 593 CDS product dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378111.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence0782 >Feature sequence0783 744 58 gene locus_tag LOCUS_18760 gene atpB 744 58 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0P952 protein_id gnl|my_center|LOCUS_18760 <1402 835 gene locus_tag LOCUS_18770 <1402 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858758.1:threonine ammonia-lyase >Feature sequence0784 >Feature sequence0785 1121 84 gene locus_tag LOCUS_18780 1121 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1358 1131 gene locus_tag LOCUS_18790 1358 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence0786 89 868 gene locus_tag LOCUS_18800 89 868 CDS product putative isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I073 protein_id gnl|my_center|LOCUS_18800 >Feature sequence0787 185 1327 gene locus_tag LOCUS_18810 185 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_18810 >Feature sequence0788 <1 634 gene locus_tag LOCUS_18820 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000913908.1:4-hydroxybenzoate octaprenyltransferase 635 1348 gene locus_tag LOCUS_18830 635 1348 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947427.1 protein_id gnl|my_center|LOCUS_18830 >Feature sequence0789 >Feature sequence0790 >Feature sequence0791 <1 648 gene locus_tag LOCUS_18840 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001881385.1:ABC transporter substrate-binding protein <1383 811 gene locus_tag LOCUS_18850 <1383 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964491.1:transporter >Feature sequence0792 22 1233 gene locus_tag LOCUS_18860 22 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence0793 140 490 gene locus_tag LOCUS_18870 140 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18870 491 763 gene locus_tag LOCUS_18880 491 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18880 1333 818 gene locus_tag LOCUS_18890 1333 818 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633782.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence0794 <1 652 gene locus_tag LOCUS_18900 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852645.1:hydrolase >Feature sequence0795 257 547 gene locus_tag LOCUS_18910 257 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 <1382 563 gene locus_tag LOCUS_18920 <1382 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001256047.1:SAM-dependent methyltransferase >Feature sequence0796 91 522 gene locus_tag LOCUS_18930 gene trxC 91 522 CDS product thiol disulfide reductase thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001098717.1 protein_id gnl|my_center|LOCUS_18930 <1381 606 gene locus_tag LOCUS_18940 <1381 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56474:UvrABC system protein A >Feature sequence0797 <1380 824 gene locus_tag LOCUS_18950 <1380 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PJB0:chromosomal replication initiator protein DnaA >Feature sequence0798 787 599 gene locus_tag LOCUS_18960 gene rpmB 787 599 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PI58 protein_id gnl|my_center|LOCUS_18960 <1380 837 gene locus_tag LOCUS_18970 <1380 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545557.1:WabG >Feature sequence0799 173 1267 gene locus_tag LOCUS_18980 173 1267 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954183.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence0800 119 646 gene locus_tag LOCUS_18990 gene mobB 119 646 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence0801 <1 1281 gene locus_tag LOCUS_19000 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545380.1:two-component sensor histidine kinase >Feature sequence0802 654 73 gene locus_tag LOCUS_19010 654 73 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095727.1 protein_id gnl|my_center|LOCUS_19010 >Feature sequence0803 767 174 gene locus_tag LOCUS_19020 767 174 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858827.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence0804 >Feature sequence0805 <1 555 gene locus_tag LOCUS_19030 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNM6:putative zinc metalloprotease 567 1247 gene locus_tag LOCUS_19040 567 1247 CDS product UPF0001 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25156 protein_id gnl|my_center|LOCUS_19040 >Feature sequence0806 261 743 gene locus_tag LOCUS_19050 261 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 740 1135 gene locus_tag LOCUS_19060 740 1135 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_19060 >Feature sequence0807 213 1142 gene locus_tag LOCUS_19070 gene argF 213 1142 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNU6 protein_id gnl|my_center|LOCUS_19070 >Feature sequence0808 <1371 780 gene locus_tag LOCUS_19080 <1371 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000785454.1:chemotaxis protein CheV >Feature sequence0809 >Feature sequence0810 <1368 495 gene locus_tag LOCUS_19090 <1368 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385088.1:multidrug DMT transporter permease >Feature sequence0811 1190 18 gene locus_tag LOCUS_19100 1190 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence0812 >Feature sequence0813 670 230 gene locus_tag LOCUS_19110 gene fur 670 230 CDS product ferric uptake regulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C631 protein_id gnl|my_center|LOCUS_19110 1067 837 gene locus_tag LOCUS_19120 1067 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence0814 <1362 695 gene locus_tag LOCUS_19130 <1362 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356525.1:two-component system response regulator >Feature sequence0815 1243 617 gene locus_tag LOCUS_19140 gene rpsD 1243 617 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56011 protein_id gnl|my_center|LOCUS_19140 >Feature sequence0816 >Feature sequence0817 590 33 gene locus_tag LOCUS_19150 590 33 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119119.1 protein_id gnl|my_center|LOCUS_19150 <1359 638 gene locus_tag LOCUS_19160 <1359 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072057.1:4-hydroxyphenylpyruvate dioxygenase >Feature sequence0818 >Feature sequence0819 335 1348 gene locus_tag LOCUS_19170 335 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701669.1 protein_id gnl|my_center|LOCUS_19170 >Feature sequence0820 636 1346 gene locus_tag LOCUS_19180 636 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 >Feature sequence0821 <1 514 gene locus_tag LOCUS_19190 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000045822.1:DnaJ family protein 525 908 gene locus_tag LOCUS_19200 gene hspR 525 908 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence0822 >Feature sequence0823 <1352 548 gene locus_tag LOCUS_19210 <1352 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72AQ6:phosphonates import ATP-binding protein PhnC >Feature sequence0824 >Feature sequence0825 >Feature sequence0826 <1 1120 gene locus_tag LOCUS_19220 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853329.1:permease >Feature sequence0827 1199 540 gene locus_tag LOCUS_19230 gene cynT 1199 540 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PBR7 protein_id gnl|my_center|LOCUS_19230 >Feature sequence0828 719 21 gene locus_tag LOCUS_19240 719 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence0829 >Feature sequence0830 275 583 gene locus_tag LOCUS_19250 275 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence0831 >Feature sequence0832 <1 832 gene locus_tag LOCUS_19260 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261091.1:transporter 855 1136 gene locus_tag LOCUS_19270 855 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0833 <1 617 gene locus_tag LOCUS_19280 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25597:D-amino acid dehydrogenase <1341 688 gene locus_tag LOCUS_19290 <1341 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706606.1:ABC transporter permease >Feature sequence0834 >Feature sequence0835 >Feature sequence0836 <1 513 gene locus_tag LOCUS_19300 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948298.1:spermidine/putrescine ABC transporter permease >Feature sequence0837 <1332 430 gene locus_tag LOCUS_19310 <1332 430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P48370:DNA gyrase subunit A >Feature sequence0838 220 537 gene locus_tag LOCUS_19320 220 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence0839 >Feature sequence0840 >Feature sequence0841 >Feature sequence0842 >Feature sequence0843 50 397 gene locus_tag LOCUS_19330 50 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 399 731 gene locus_tag LOCUS_19340 399 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 772 972 gene locus_tag LOCUS_19350 772 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 >Feature sequence0844 >Feature sequence0845 851 375 gene locus_tag LOCUS_19360 851 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence0846 598 44 gene locus_tag LOCUS_19370 598 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence0847 1287 31 gene locus_tag LOCUS_19380 1287 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence0848 >Feature sequence0849 98 616 gene locus_tag LOCUS_19390 98 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 620 1072 gene locus_tag LOCUS_19400 620 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence0850 >Feature sequence0851 449 1300 gene locus_tag LOCUS_19410 449 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence0852 445 1203 gene locus_tag LOCUS_19420 445 1203 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198755.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence0853 >Feature sequence0854 181 945 gene locus_tag LOCUS_19430 181 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19430 >Feature sequence0855 >Feature sequence0856 >Feature sequence0857 299 637 gene locus_tag LOCUS_19440 299 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 <1291 648 gene locus_tag LOCUS_19450 <1291 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037493.1:transcriptional regulator >Feature sequence0858 <1290 763 gene locus_tag LOCUS_19460 <1290 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CX40:tRNA-specific 2-thiouridylase MnmA >Feature sequence0859 <1 1067 gene locus_tag LOCUS_19470 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000896388.1:methyl-accepting chemotaxis protein >Feature sequence0860 >Feature sequence0861 >Feature sequence0862 <1 831 gene locus_tag LOCUS_19480 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H3FY79:ATP-dependent RNA helicase RhlE >Feature sequence0863 70 873 gene locus_tag LOCUS_19490 70 873 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261705.1 protein_id gnl|my_center|LOCUS_19490 >Feature sequence0864 >Feature sequence0865 413 15 gene locus_tag LOCUS_19500 413 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence0866 1115 240 gene locus_tag LOCUS_19510 1115 240 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016960.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence0867 >Feature sequence0868 1253 177 gene locus_tag LOCUS_19520 1253 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence0869 492 91 gene locus_tag LOCUS_19530 gene perR 492 91 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence0870 <1 847 gene locus_tag LOCUS_19540 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PPF4:histidine--tRNA ligase >Feature sequence0871 665 69 gene locus_tag LOCUS_19550 gene ahpC 665 69 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_19550 1002 847 gene locus_tag LOCUS_19560 1002 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence0872 353 1096 gene locus_tag LOCUS_19570 353 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 >Feature sequence0873 <1268 706 gene locus_tag LOCUS_19580 <1268 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266628.1:methyl-accepting chemotaxis protein >Feature sequence0874 676 329 gene locus_tag LOCUS_19590 676 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 980 669 gene locus_tag LOCUS_19600 980 669 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920916.1 protein_id gnl|my_center|LOCUS_19600 >Feature sequence0875 <1 1015 gene locus_tag LOCUS_19610 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PHY1:succinate--CoA ligase [ADP-forming] subunit beta >Feature sequence0876 128 994 gene locus_tag LOCUS_19620 128 994 CDS product transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464103.1 protein_id gnl|my_center|LOCUS_19620 1229 1154 gene locus_tag LOCUS_t00150 1229 1154 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0877 >Feature sequence0878 <1262 325 gene locus_tag LOCUS_19630 <1262 325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A5HZA6:spermidine/putrescine import ATP-binding protein PotA >Feature sequence0879 >Feature sequence0880 >Feature sequence0881 <1 1028 gene locus_tag LOCUS_19640 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853239.1:potassium transporter >Feature sequence0882 >Feature sequence0883 >Feature sequence0884 862 23 gene locus_tag LOCUS_19650 gene prpB 862 23 CDS product 2-methylisocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028204.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence0885 <1 892 gene locus_tag LOCUS_19660 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25176:arginine decarboxylase >Feature sequence0886 1066 149 gene locus_tag LOCUS_19670 1066 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 >Feature sequence0887 1149 367 gene locus_tag LOCUS_19680 gene lpxA 1149 367 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KPW4 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0888 <1 547 gene locus_tag LOCUS_19690 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q4ZQB8:phospho-2-dehydro-3-deoxyheptonate aldolase 785 600 gene locus_tag LOCUS_19700 785 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1239 949 gene locus_tag LOCUS_19710 gene gatC 1239 949 CDS product glutamyl-tRNA(Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIA5 protein_id gnl|my_center|LOCUS_19710 >Feature sequence0889 327 1247 gene locus_tag LOCUS_19720 327 1247 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263293.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0890 963 151 gene locus_tag LOCUS_19730 gene phhA 963 151 CDS product phenylalanine-4-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43334 protein_id gnl|my_center|LOCUS_19730 >Feature sequence0891 399 1247 gene locus_tag LOCUS_19740 399 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence0892 <1 890 gene locus_tag LOCUS_19750 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891850.1:rod shape-determining protein >Feature sequence0893 >Feature sequence0894 >Feature sequence0895 141 440 gene locus_tag LOCUS_19760 141 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 464 1087 gene locus_tag LOCUS_19770 gene rhtB 464 1087 CDS product homoserine/homoserine lactone efflux protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351233.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence0896 898 80 gene locus_tag LOCUS_19780 898 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 >Feature sequence0897 1200 328 gene locus_tag LOCUS_19790 1200 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence0898 143 460 gene locus_tag LOCUS_19800 143 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 >Feature sequence0899 <1238 332 gene locus_tag LOCUS_19810 <1238 332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O25009:nitrogen fixation protein NifU >Feature sequence0900 1004 483 gene locus_tag LOCUS_19820 1004 483 CDS product reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence0901 <1234 360 gene locus_tag LOCUS_19830 <1234 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PHM7:aspartate--tRNA(Asp/Asn) ligase >Feature sequence0902 914 117 gene locus_tag LOCUS_19840 gene phhA 914 117 CDS product phenylalanine 4-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071817.1 protein_id gnl|my_center|LOCUS_19840 1204 1022 gene locus_tag LOCUS_19850 1204 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence0903 280 1167 gene locus_tag LOCUS_19860 gene atpG 280 1167 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PJ20 protein_id gnl|my_center|LOCUS_19860 >Feature sequence0904 35 964 gene locus_tag LOCUS_19870 35 964 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390930.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence0905 1022 519 gene locus_tag LOCUS_19880 gene yitK 1022 519 CDS product UPF0234 protein yitk inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O06746 protein_id gnl|my_center|LOCUS_19880 >Feature sequence0906 >Feature sequence0907 1216 716 gene locus_tag LOCUS_19890 1216 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence0908 394 819 gene locus_tag LOCUS_19900 gene rplP 394 819 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P56041 protein_id gnl|my_center|LOCUS_19900 806 994 gene locus_tag LOCUS_19910 gene rpmC 806 994 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PLX9 protein_id gnl|my_center|LOCUS_19910 >Feature sequence0909 1145 516 gene locus_tag LOCUS_19920 1145 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 >Feature sequence0910 <1 950 gene locus_tag LOCUS_19930 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853125.1:hydrolase 950 1138 gene locus_tag LOCUS_19940 950 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence0911 259 639 gene locus_tag LOCUS_19950 259 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 626 1036 gene locus_tag LOCUS_19960 626 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 >Feature sequence0912 <1 930 gene locus_tag LOCUS_19970 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P07363:chemotaxis protein CheA >Feature sequence0913 <1210 602 gene locus_tag LOCUS_19980 <1210 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000842701.1:thiol oxidoreductase >Feature sequence0914 >Feature sequence0915 >Feature sequence0916 861 367 gene locus_tag LOCUS_19990 gene purE 861 367 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q0PAH7 protein_id gnl|my_center|LOCUS_19990 >Feature sequence0917 247 801 gene locus_tag LOCUS_20000 gene pnuT 247 801 CDS product nicotinamide mononucleotide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence0918 <1 650 gene locus_tag LOCUS_20010 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000893345.1:GGDEF domain-containing protein >Feature sequence0919 561 376 gene locus_tag LOCUS_20020 561 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 833 699 gene locus_tag LOCUS_20030 gene rpmH 833 699 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PNX4 protein_id gnl|my_center|LOCUS_20030 1196 912 gene locus_tag LOCUS_20040 1196 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 >Feature sequence0920 75 605 gene locus_tag LOCUS_20050 gene yaeQ 75 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073003.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence0921 >Feature sequence0922 163 1029 gene locus_tag LOCUS_20060 163 1029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000599885.1 protein_id gnl|my_center|LOCUS_20060 >Feature sequence0923 >Feature sequence0924 >Feature sequence0925 <1188 535 gene locus_tag LOCUS_20070 <1188 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706606.1:ABC transporter permease >Feature sequence0926 >Feature sequence0927 <1 631 gene locus_tag LOCUS_20080 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0P9F3:DNA helicase >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 88 912 gene locus_tag LOCUS_20090 88 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0931 >Feature sequence0932 <1 574 gene locus_tag LOCUS_20100 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P44039:tRNA pseudouridine synthase D 1171 611 gene locus_tag LOCUS_20110 1171 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence0933 >Feature sequence0934 <1155 340 gene locus_tag LOCUS_20120 <1155 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0935 <1154 174 gene locus_tag LOCUS_20130 <1154 174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012706102.1:ABC transporter substrate-binding protein >Feature sequence0936 >Feature sequence0937 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 <1 753 gene locus_tag LOCUS_20140 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to YP_001705072.1:methylmalonate-semialdehyde dehydrogenasE (MmsA) >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 910 53 gene locus_tag LOCUS_20150 910 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 >Feature sequence0944 <1142 232 gene locus_tag LOCUS_20160 <1142 232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525171.1:multidrug MFS transporter >Feature sequence0945 400 1002 gene locus_tag LOCUS_20170 gene fdhB 400 1002 CDS product formate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 protein_id gnl|my_center|LOCUS_20170 >Feature sequence0946 >Feature sequence0947 <1 815 gene locus_tag LOCUS_20180 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028151.1:esterase >Feature sequence0948 >Feature sequence0949 >Feature sequence0950 >Feature sequence0951 >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 >Feature sequence0955 <1129 398 gene locus_tag LOCUS_20190 <1129 398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938022.1:PAS domain-containing sensor histidine kinase note possible pseudo, internal stop codon >Feature sequence0956 993 328 gene locus_tag LOCUS_20200 gene phnE 993 328 CDS product phosphate/phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125172.1 protein_id gnl|my_center|LOCUS_20200 >Feature sequence0957 >Feature sequence0958 >Feature sequence0959 <1 626 gene locus_tag LOCUS_20210 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0A0H2WGN6:chemotaxis protein methyltransferase >Feature sequence0960 <1 683 gene locus_tag LOCUS_20220 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972690.1:GntR family transcriptional regulator >Feature sequence0961 >Feature sequence0962 <1119 429 gene locus_tag LOCUS_20230 <1119 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P55986:putative RNA pseudouridine synthase >Feature sequence0963 <1 555 gene locus_tag LOCUS_20240 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940954.1:two-component sensor histidine kinase >Feature sequence0964 >Feature sequence0965 >Feature sequence0966 >Feature sequence0967 153 596 gene locus_tag LOCUS_20250 153 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0968 444 241 gene locus_tag LOCUS_20260 444 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 718 509 gene locus_tag LOCUS_20270 718 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 >Feature sequence0969 80 547 gene locus_tag LOCUS_20280 gene ribH 80 547 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIB9 protein_id gnl|my_center|LOCUS_20280 547 942 gene locus_tag LOCUS_20290 gene nusB 547 942 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9PIC0 protein_id gnl|my_center|LOCUS_20290 >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 822 460 gene locus_tag LOCUS_20300 822 460 CDS product DOPA 4,5-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263290.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 604 227 gene locus_tag LOCUS_20310 604 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 1091 585 gene locus_tag LOCUS_20320 1091 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 >Feature sequence0979 <1090 67 gene locus_tag LOCUS_20330 <1090 67 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853219.1:two-component sensor histidine kinase >Feature sequence0980 >Feature sequence0981 <1 664 gene locus_tag LOCUS_20340 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211638.1:autotransporter >Feature sequence0982 >Feature sequence0983 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 >Feature sequence0987 <1 638 gene locus_tag LOCUS_20350 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NDM3:histidine kinase 1082 645 gene locus_tag LOCUS_20360 1082 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 >Feature sequence0988 923 366 gene locus_tag LOCUS_20370 923 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20370 >Feature sequence0989 >Feature sequence0990 >Feature sequence0991 542 243 gene locus_tag LOCUS_20380 542 243 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115414.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence0992 297 61 gene locus_tag LOCUS_20390 297 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence0993 <1 749 gene locus_tag LOCUS_20400 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096062.1:methyl-accepting chemotaxis protein >Feature sequence0994 <1 947 gene locus_tag LOCUS_20410 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56429:homoserine dehydrogenase >Feature sequence0995 >Feature sequence0996 <1066 48 gene locus_tag LOCUS_20420 <1066 48 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8KEY9:aconitate hydratase B >Feature sequence0997 365 39 gene locus_tag LOCUS_20430 365 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 <1065 418 gene locus_tag LOCUS_20440 <1065 418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PNQ6:putative arginyl-tRNA--protein transferase >Feature sequence0998 955 20 gene locus_tag LOCUS_20450 955 20 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479770.1 protein_id gnl|my_center|LOCUS_20450 >Feature sequence0999 >Feature sequence1000 <1 557 gene locus_tag LOCUS_20460 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964439.1:flavin reductase >Feature sequence1001 >Feature sequence1002 358 645 gene locus_tag LOCUS_20470 358 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence1003 >Feature sequence1004 <1 892 gene locus_tag LOCUS_20480 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9PIM0:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence1005 <1 873 gene locus_tag LOCUS_20490 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000167867.1:arginase >Feature sequence1006 <1 596 gene locus_tag LOCUS_20500 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072778.1:NAD(P)-dependent oxidoreductase >Feature sequence1007 >Feature sequence1008 >Feature sequence1009 3 797 gene locus_tag LOCUS_20510 3 797 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_20510 >Feature sequence1010 412 732 gene locus_tag LOCUS_20520 412 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence1011 756 538 gene locus_tag LOCUS_20530 756 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence1012 <1 610 gene locus_tag LOCUS_20540 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q0PAY2:succinate--CoA ligase [ADP-forming] subunit alpha >Feature sequence1013 >Feature sequence1014 180 1034 gene locus_tag LOCUS_20550 180 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 >Feature sequence1015 234 485 gene locus_tag LOCUS_20560 234 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence1016 >Feature sequence1017 >Feature sequence1018 >Feature sequence1019 >Feature sequence1020 <1 805 gene locus_tag LOCUS_20570 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260958.1:sensor domain-containing phosphodiesterase >Feature sequence1021 2 274 gene locus_tag LOCUS_20580 2 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 >Feature sequence1022 1 567 gene locus_tag LOCUS_20590 1 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 578 988 gene locus_tag LOCUS_20600 578 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence1023 >Feature sequence1024 <1036 185 gene locus_tag LOCUS_20610 <1036 185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002855678.1:sodium:proton antiporter >Feature sequence1025 >Feature sequence1026 <1 539 gene locus_tag LOCUS_20620 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001862414.1:uroporphyrinogen-III synthase >Feature sequence1027 >Feature sequence1028 <1 527 gene locus_tag LOCUS_20630 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066374.1:histidine kinase <1034 531 gene locus_tag LOCUS_20640 <1034 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000858827.1:phosphatase >Feature sequence1029 >Feature sequence1030 490 131 gene locus_tag LOCUS_20650 490 131 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966217.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence1031 472 948 gene locus_tag LOCUS_20660 472 948 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020097.1 protein_id gnl|my_center|LOCUS_20660 >Feature sequence1032 >Feature sequence1033 >Feature sequence1034 963 697 gene locus_tag LOCUS_20670 963 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 >Feature sequence1035 315 572 gene locus_tag LOCUS_20680 315 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence1036 <1024 435 gene locus_tag LOCUS_20690 <1024 435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147076.1:chemotaxis protein CheA >Feature sequence1037 <1023 102 gene locus_tag LOCUS_20700 <1023 102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O69289:60 kDa chaperonin >Feature sequence1038 >Feature sequence1039 >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 <1 640 gene locus_tag LOCUS_20710 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P56954:putative malate:quinone oxidoreductase >Feature sequence1045 1010 63 gene locus_tag LOCUS_20720 1010 63 CDS product muconate-lactonizing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532878.1 protein_id gnl|my_center|LOCUS_20720 >Feature sequence1046 <1 628 gene locus_tag LOCUS_20730 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003101357.1:acetolactate synthase >Feature sequence1047 >Feature sequence1048 <1009 88 gene locus_tag LOCUS_20740 <1009 88 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5FLW9:DNA polymerase IV >Feature sequence1049 >Feature sequence1050 >Feature sequence1051