>Feature sequence001 110 1540 gene locus_tag LOCUS_00010 110 1540 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_00010 1659 3107 gene locus_tag LOCUS_00020 1659 3107 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_00020 3145 3780 gene locus_tag LOCUS_00030 3145 3780 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392722.1 protein_id gnl|my_center|LOCUS_00030 3858 5318 gene locus_tag LOCUS_00040 3858 5318 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_00040 5355 5996 gene locus_tag LOCUS_00050 5355 5996 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_00050 6013 6711 gene locus_tag LOCUS_00060 6013 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392826.1 protein_id gnl|my_center|LOCUS_00060 6790 8292 gene locus_tag LOCUS_00070 6790 8292 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_00070 8411 10414 gene locus_tag LOCUS_00080 8411 10414 CDS product hydantoinase/oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809377.1 protein_id gnl|my_center|LOCUS_00080 10569 11216 gene locus_tag LOCUS_00090 10569 11216 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_00090 11702 13288 gene locus_tag LOCUS_00100 11702 13288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 13285 14208 gene locus_tag LOCUS_00110 13285 14208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14205 16178 gene locus_tag LOCUS_00120 14205 16178 CDS product hydantoinase/oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809377.1 protein_id gnl|my_center|LOCUS_00120 16337 17437 gene locus_tag LOCUS_00130 16337 17437 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887230.1 protein_id gnl|my_center|LOCUS_00130 17605 18366 gene locus_tag LOCUS_00140 gene parA 17605 18366 CDS product chromosome partitioning protein ParA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227804.1 protein_id gnl|my_center|LOCUS_00140 18356 19672 gene locus_tag LOCUS_00150 18356 19672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 20839 19715 gene locus_tag LOCUS_00160 gene fabH 20839 19715 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E194 protein_id gnl|my_center|LOCUS_00160 22098 20836 gene locus_tag LOCUS_00170 22098 20836 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_00170 23501 22344 gene locus_tag LOCUS_00180 23501 22344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 24970 23822 gene locus_tag LOCUS_00190 24970 23822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 26556 24991 gene locus_tag LOCUS_00200 26556 24991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence002 2731 158 gene locus_tag LOCUS_00210 2731 158 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257621.1 protein_id gnl|my_center|LOCUS_00210 3099 2779 gene locus_tag LOCUS_00220 3099 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 4676 3579 gene locus_tag LOCUS_00230 4676 3579 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_00230 6085 4850 gene locus_tag LOCUS_00240 gene ftsA 6085 4850 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG66 protein_id gnl|my_center|LOCUS_00240 7077 6088 gene locus_tag LOCUS_00250 7077 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 8201 7083 gene locus_tag LOCUS_00260 gene ddl 8201 7083 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG68 protein_id gnl|my_center|LOCUS_00260 9102 8206 gene locus_tag LOCUS_00270 gene murB 9102 8206 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG69 protein_id gnl|my_center|LOCUS_00270 9392 9207 gene locus_tag LOCUS_00280 9392 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 10771 9395 gene locus_tag LOCUS_00290 gene murC 10771 9395 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S527 protein_id gnl|my_center|LOCUS_00290 11289 10771 gene locus_tag LOCUS_00300 11289 10771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 12408 11314 gene locus_tag LOCUS_00310 gene murG 12408 11314 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG72 protein_id gnl|my_center|LOCUS_00310 13597 12320 gene locus_tag LOCUS_00320 gene ftsW 13597 12320 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949037.1 protein_id gnl|my_center|LOCUS_00320 14973 13576 gene locus_tag LOCUS_00330 gene murD 14973 13576 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK81 protein_id gnl|my_center|LOCUS_00330 15980 14973 gene locus_tag LOCUS_00340 gene mraY 15980 14973 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG76 protein_id gnl|my_center|LOCUS_00340 17398 15977 gene locus_tag LOCUS_00350 gene murF 17398 15977 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG77 protein_id gnl|my_center|LOCUS_00350 19165 17408 gene locus_tag LOCUS_00360 19165 17408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 19665 19162 gene locus_tag LOCUS_00370 19665 19162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 20679 19705 gene locus_tag LOCUS_00380 gene rsmH 20679 19705 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P60396 protein_id gnl|my_center|LOCUS_00380 21116 20688 gene locus_tag LOCUS_00390 gene mraZ 21116 20688 CDS product transcriptional regulator MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG81 protein_id gnl|my_center|LOCUS_00390 21373 22779 gene locus_tag LOCUS_00400 21373 22779 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001252906.1 protein_id gnl|my_center|LOCUS_00400 23887 22829 gene locus_tag LOCUS_00410 23887 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 25162 23927 gene locus_tag LOCUS_00420 25162 23927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 26006 25155 gene locus_tag LOCUS_00430 26006 25155 CDS product fructosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403507.1 protein_id gnl|my_center|LOCUS_00430 26644 26159 gene locus_tag LOCUS_00440 gene ptpA 26644 26159 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P53433 protein_id gnl|my_center|LOCUS_00440 >Feature sequence003 916 212 gene locus_tag LOCUS_00450 gene nfi 916 212 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDJ2 protein_id gnl|my_center|LOCUS_00450 1899 922 gene locus_tag LOCUS_00460 1899 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 2092 3630 gene locus_tag LOCUS_00470 2092 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 4008 4520 gene locus_tag LOCUS_00480 4008 4520 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_00480 5339 4581 gene locus_tag LOCUS_00490 5339 4581 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403975.1 protein_id gnl|my_center|LOCUS_00490 6898 5468 gene locus_tag LOCUS_00500 6898 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 7829 6888 gene locus_tag LOCUS_00510 7829 6888 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257461.1 protein_id gnl|my_center|LOCUS_00510 8772 7981 gene locus_tag LOCUS_00520 gene lgt 8772 7981 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T6 protein_id gnl|my_center|LOCUS_00520 9711 9085 gene locus_tag LOCUS_00530 9711 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67456 protein_id gnl|my_center|LOCUS_00530 12104 9870 gene locus_tag LOCUS_00540 12104 9870 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_00540 13097 12180 gene locus_tag LOCUS_00550 13097 12180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_00550 13605 13159 gene locus_tag LOCUS_00560 13605 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 14124 13636 gene locus_tag LOCUS_00570 14124 13636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 14420 15136 gene locus_tag LOCUS_00580 14420 15136 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258204.1 protein_id gnl|my_center|LOCUS_00580 15342 15809 gene locus_tag LOCUS_00590 gene greA 15342 15809 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK05 protein_id gnl|my_center|LOCUS_00590 15999 17516 gene locus_tag LOCUS_00600 gene lysS 15999 17516 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK04 protein_id gnl|my_center|LOCUS_00600 18296 17622 gene locus_tag LOCUS_00610 18296 17622 CDS product deoxyguanosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_00610 20620 18293 gene locus_tag LOCUS_00620 20620 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 21813 20680 gene locus_tag LOCUS_00630 21813 20680 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIW8 protein_id gnl|my_center|LOCUS_00630 22201 22016 gene locus_tag LOCUS_00640 22201 22016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 22799 22395 gene locus_tag LOCUS_00650 22799 22395 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788296.1 protein_id gnl|my_center|LOCUS_00650 24994 23096 gene locus_tag LOCUS_00660 gene uvrC 24994 23096 CDS product UvrABC system protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEI3 protein_id gnl|my_center|LOCUS_00660 26438 25095 gene locus_tag LOCUS_00670 26438 25095 CDS product macrolide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227654.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence004 97 669 gene locus_tag LOCUS_00680 97 669 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437759.1 protein_id gnl|my_center|LOCUS_00680 682 1698 gene locus_tag LOCUS_00690 682 1698 CDS product glycine/betaine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029893.1 protein_id gnl|my_center|LOCUS_00690 1701 3812 gene locus_tag LOCUS_00700 1701 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4016 4939 gene locus_tag LOCUS_00710 4016 4939 CDS product glycine/betaine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029895.1 protein_id gnl|my_center|LOCUS_00710 7541 5055 gene locus_tag LOCUS_00720 7541 5055 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_00720 8433 7642 gene locus_tag LOCUS_00730 8433 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 9256 8483 gene locus_tag LOCUS_00740 gene paaF 9256 8483 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186913.1 protein_id gnl|my_center|LOCUS_00740 9864 9256 gene locus_tag LOCUS_00750 9864 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 10628 9894 gene locus_tag LOCUS_00760 10628 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 11142 10810 gene locus_tag LOCUS_00770 11142 10810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11621 11139 gene locus_tag LOCUS_00780 11621 11139 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975651.1 protein_id gnl|my_center|LOCUS_00780 11961 11605 gene locus_tag LOCUS_00790 11961 11605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 12160 12705 gene locus_tag LOCUS_00800 12160 12705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 12710 13705 gene locus_tag LOCUS_00810 12710 13705 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_00810 14147 13914 gene locus_tag LOCUS_00820 14147 13914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 15600 14374 gene locus_tag LOCUS_00830 gene rumA 15600 14374 CDS product 23S rRNA (uracil-5-)-methyltransferase RumA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_00830 16943 15876 gene locus_tag LOCUS_00840 16943 15876 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_00840 17024 18733 gene locus_tag LOCUS_00850 17024 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 19012 18812 gene locus_tag LOCUS_00860 19012 18812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 19192 19800 gene locus_tag LOCUS_00870 19192 19800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 19803 20828 gene locus_tag LOCUS_00880 gene moaA 19803 20828 CDS product cyclic pyranopterin monophosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VVG3 protein_id gnl|my_center|LOCUS_00880 >Feature sequence005 99 407 gene locus_tag LOCUS_00890 gene rpsJ 99 407 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH65 protein_id gnl|my_center|LOCUS_00890 661 1290 gene locus_tag LOCUS_00900 gene rplC 661 1290 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH66 protein_id gnl|my_center|LOCUS_00900 1310 1939 gene locus_tag LOCUS_00910 gene rplD 1310 1939 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH67 protein_id gnl|my_center|LOCUS_00910 1953 2258 gene locus_tag LOCUS_00920 gene rplW 1953 2258 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6GZ97 protein_id gnl|my_center|LOCUS_00920 2261 3097 gene locus_tag LOCUS_00930 gene rplB 2261 3097 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH69 protein_id gnl|my_center|LOCUS_00930 3195 3467 gene locus_tag LOCUS_00940 gene rpsS 3195 3467 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH70 protein_id gnl|my_center|LOCUS_00940 3476 3820 gene locus_tag LOCUS_00950 gene rplV 3476 3820 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CK68 protein_id gnl|my_center|LOCUS_00950 3834 4511 gene locus_tag LOCUS_00960 gene rpsC 3834 4511 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH72 protein_id gnl|my_center|LOCUS_00960 4564 4989 gene locus_tag LOCUS_00970 gene rplP 4564 4989 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 protein_id gnl|my_center|LOCUS_00970 4992 5204 gene locus_tag LOCUS_00980 gene rpmC 4992 5204 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FM82 protein_id gnl|my_center|LOCUS_00980 5201 5479 gene locus_tag LOCUS_00990 gene rpsQ 5201 5479 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5W6 protein_id gnl|my_center|LOCUS_00990 5482 5853 gene locus_tag LOCUS_01000 gene rplN 5482 5853 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9A1W4 protein_id gnl|my_center|LOCUS_01000 5882 6211 gene locus_tag LOCUS_01010 gene rplX 5882 6211 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_01010 6231 6770 gene locus_tag LOCUS_01020 6231 6770 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_01020 6976 7389 gene locus_tag LOCUS_01030 gene rpsH 6976 7389 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q62GL9 protein_id gnl|my_center|LOCUS_01030 7440 7982 gene locus_tag LOCUS_01040 gene rplF 7440 7982 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR2 protein_id gnl|my_center|LOCUS_01040 7985 8353 gene locus_tag LOCUS_01050 gene rplR 7985 8353 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9ZAE3 protein_id gnl|my_center|LOCUS_01050 8370 8882 gene locus_tag LOCUS_01060 8370 8882 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_01060 8888 9085 gene locus_tag LOCUS_01070 gene rpmD 8888 9085 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X1J1 protein_id gnl|my_center|LOCUS_01070 9094 9546 gene locus_tag LOCUS_01080 gene rplO 9094 9546 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HPN9 protein_id gnl|my_center|LOCUS_01080 9648 10982 gene locus_tag LOCUS_01090 gene secY 9648 10982 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH86 protein_id gnl|my_center|LOCUS_01090 10992 11645 gene locus_tag LOCUS_01100 gene adk 10992 11645 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7I5 protein_id gnl|my_center|LOCUS_01100 11652 12437 gene locus_tag LOCUS_01110 11652 12437 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_01110 12635 13024 gene locus_tag LOCUS_01120 gene rpsM 12635 13024 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFS3 protein_id gnl|my_center|LOCUS_01120 13214 13615 gene locus_tag LOCUS_01130 gene rpsK 13214 13615 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH91 protein_id gnl|my_center|LOCUS_01130 13917 14339 gene locus_tag LOCUS_01140 13917 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 14401 15381 gene locus_tag LOCUS_01150 gene rpoA 14401 15381 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J18 protein_id gnl|my_center|LOCUS_01150 15388 15765 gene locus_tag LOCUS_01160 15388 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 15846 16577 gene locus_tag LOCUS_01170 gene truA2 15846 16577 CDS product tRNA pseudouridine synthase A 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q813Z9 protein_id gnl|my_center|LOCUS_01170 16647 17099 gene locus_tag LOCUS_01180 gene rplM 16647 17099 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZNX2 protein_id gnl|my_center|LOCUS_01180 17102 17497 gene locus_tag LOCUS_01190 gene rpsI 17102 17497 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40828 protein_id gnl|my_center|LOCUS_01190 17608 19062 gene locus_tag LOCUS_01200 gene yabN 17608 19062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P37556 protein_id gnl|my_center|LOCUS_01200 19902 19138 gene locus_tag LOCUS_01210 19902 19138 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence006 1669 917 gene locus_tag LOCUS_01220 1669 917 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002303986.1 protein_id gnl|my_center|LOCUS_01220 2444 1683 gene locus_tag LOCUS_01230 gene oxaA1 2444 1683 CDS product sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429300.1 protein_id gnl|my_center|LOCUS_01230 3582 2494 gene locus_tag LOCUS_01240 3582 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3915 3604 gene locus_tag LOCUS_01250 3915 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 4262 3915 gene locus_tag LOCUS_01260 4262 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 4506 4351 gene locus_tag LOCUS_01270 4506 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 6931 4592 gene locus_tag LOCUS_01280 6931 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 8589 6952 gene locus_tag LOCUS_01290 8589 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 10730 8613 gene locus_tag LOCUS_01300 10730 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 12322 10727 gene locus_tag LOCUS_01310 12322 10727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259597.1 protein_id gnl|my_center|LOCUS_01310 12422 13123 gene locus_tag LOCUS_01320 12422 13123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091835.1 protein_id gnl|my_center|LOCUS_01320 13163 15664 gene locus_tag LOCUS_01330 13163 15664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 15731 16417 gene locus_tag LOCUS_01340 15731 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979847.1 protein_id gnl|my_center|LOCUS_01340 16846 16535 gene locus_tag LOCUS_01350 16846 16535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 17190 16933 gene locus_tag LOCUS_01360 17190 16933 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_01360 17937 17209 gene locus_tag LOCUS_01370 17937 17209 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_01370 18589 17930 gene locus_tag LOCUS_01380 18589 17930 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H10 protein_id gnl|my_center|LOCUS_01380 19740 18727 gene locus_tag LOCUS_01390 19740 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 >Feature sequence007 5161 3266 gene locus_tag LOCUS_01400 5161 3266 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_01400 6071 5589 gene locus_tag LOCUS_01410 6071 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 8247 6055 gene locus_tag LOCUS_01420 8247 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 10403 8409 gene locus_tag LOCUS_01430 10403 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11587 10679 gene locus_tag LOCUS_01440 11587 10679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 13180 11696 gene locus_tag LOCUS_01450 13180 11696 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862025.1 protein_id gnl|my_center|LOCUS_01450 13292 13933 gene locus_tag LOCUS_01460 13292 13933 CDS product Zn-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_01460 13993 14295 gene locus_tag LOCUS_01470 13993 14295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 14326 15438 gene locus_tag LOCUS_01480 14326 15438 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_01480 15435 16511 gene locus_tag LOCUS_01490 15435 16511 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228754.1 protein_id gnl|my_center|LOCUS_01490 16517 17002 gene locus_tag LOCUS_01500 16517 17002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 18436 17096 gene locus_tag LOCUS_01510 18436 17096 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015351.1 protein_id gnl|my_center|LOCUS_01510 18924 19610 gene locus_tag LOCUS_01520 18924 19610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 >Feature sequence008 582 1532 gene locus_tag LOCUS_01530 582 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_01530 1548 2219 gene locus_tag LOCUS_01540 1548 2219 CDS product acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143764.1 protein_id gnl|my_center|LOCUS_01540 2285 3247 gene locus_tag LOCUS_01550 2285 3247 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_01550 3252 4013 gene locus_tag LOCUS_01560 3252 4013 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820134.1 protein_id gnl|my_center|LOCUS_01560 4041 4868 gene locus_tag LOCUS_01570 4041 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_01570 4895 6385 gene locus_tag LOCUS_01580 4895 6385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 6382 7893 gene locus_tag LOCUS_01590 6382 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7967 9889 gene locus_tag LOCUS_01600 7967 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 9871 10647 gene locus_tag LOCUS_01610 9871 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 10905 14495 gene locus_tag LOCUS_01620 10905 14495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 14586 16754 gene locus_tag LOCUS_01630 14586 16754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17061 17873 gene locus_tag LOCUS_01640 17061 17873 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_01640 18069 18800 gene locus_tag LOCUS_01650 18069 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 >Feature sequence009 2135 522 gene locus_tag LOCUS_01660 gene guaA 2135 522 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHT7 protein_id gnl|my_center|LOCUS_01660 2792 2223 gene locus_tag LOCUS_01670 gene xpt 2792 2223 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RTY2 protein_id gnl|my_center|LOCUS_01670 3212 3790 gene locus_tag LOCUS_01680 3212 3790 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74A46 protein_id gnl|my_center|LOCUS_01680 3787 6048 gene locus_tag LOCUS_01690 3787 6048 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_01690 6118 7032 gene locus_tag LOCUS_01700 gene rsgA 6118 7032 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK24 protein_id gnl|my_center|LOCUS_01700 7787 8368 gene locus_tag LOCUS_01710 gene sigW 7787 8368 CDS product ECF RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45585 protein_id gnl|my_center|LOCUS_01710 8355 8618 gene locus_tag LOCUS_01720 8355 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 8679 10616 gene locus_tag LOCUS_01730 8679 10616 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258101.1 protein_id gnl|my_center|LOCUS_01730 10861 12951 gene locus_tag LOCUS_01740 10861 12951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 13150 14313 gene locus_tag LOCUS_01750 gene appB 13150 14313 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_01750 14324 15274 gene locus_tag LOCUS_01760 14324 15274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 15307 16278 gene locus_tag LOCUS_01770 15307 16278 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_01770 16278 17273 gene locus_tag LOCUS_01780 16278 17273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence010 1190 228 gene locus_tag LOCUS_01790 gene ispB 1190 228 CDS product octaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094763.1 protein_id gnl|my_center|LOCUS_01790 1991 1191 gene locus_tag LOCUS_01800 gene tatD 1991 1191 CDS product hydrolase TatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_01800 3459 2038 gene locus_tag LOCUS_01810 3459 2038 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_01810 3682 4845 gene locus_tag LOCUS_01820 gene iscS 3682 4845 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B843 protein_id gnl|my_center|LOCUS_01820 4924 6018 gene locus_tag LOCUS_01830 gene mnmA 4924 6018 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHY7 protein_id gnl|my_center|LOCUS_01830 6025 6477 gene locus_tag LOCUS_01840 6025 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 6558 6830 gene locus_tag LOCUS_01850 6558 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6844 8739 gene locus_tag LOCUS_01860 6844 8739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 8909 9397 gene locus_tag LOCUS_01870 8909 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 9408 10037 gene locus_tag LOCUS_01880 9408 10037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 10646 10044 gene locus_tag LOCUS_01890 10646 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 11364 10702 gene locus_tag LOCUS_01900 gene rplY 11364 10702 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73N16 protein_id gnl|my_center|LOCUS_01900 12112 11513 gene locus_tag LOCUS_01910 12112 11513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 12265 12447 gene locus_tag LOCUS_01920 12265 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 12688 13410 gene locus_tag LOCUS_01930 12688 13410 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_01930 13407 14075 gene locus_tag LOCUS_01940 13407 14075 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_01940 14072 15148 gene locus_tag LOCUS_01950 14072 15148 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393322.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence011 1981 398 gene locus_tag LOCUS_01960 1981 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 3363 2047 gene locus_tag LOCUS_01970 3363 2047 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_01970 3722 3360 gene locus_tag LOCUS_01980 3722 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 4680 3757 gene locus_tag LOCUS_01990 4680 3757 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF03 protein_id gnl|my_center|LOCUS_01990 5665 4694 gene locus_tag LOCUS_02000 gene fcl 5665 4694 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF18 protein_id gnl|my_center|LOCUS_02000 6735 5668 gene locus_tag LOCUS_02010 gene gmd 6735 5668 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_02010 7962 6952 gene locus_tag LOCUS_02020 7962 6952 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257986.1 protein_id gnl|my_center|LOCUS_02020 8441 7959 gene locus_tag LOCUS_02030 8441 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 8621 9658 gene locus_tag LOCUS_02040 8621 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 11160 9748 gene locus_tag LOCUS_02050 11160 9748 CDS product amine oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937602.1 protein_id gnl|my_center|LOCUS_02050 12200 11259 gene locus_tag LOCUS_02060 12200 11259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 13186 12290 gene locus_tag LOCUS_02070 13186 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 14751 13264 gene locus_tag LOCUS_02080 14751 13264 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence012 1696 3198 gene locus_tag LOCUS_02090 1696 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 3201 3884 gene locus_tag LOCUS_02100 gene macB 3201 3884 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF1 protein_id gnl|my_center|LOCUS_02100 3900 5123 gene locus_tag LOCUS_02110 3900 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_02110 5191 5892 gene locus_tag LOCUS_02120 5191 5892 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_02120 5889 7025 gene locus_tag LOCUS_02130 5889 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 8611 7160 gene locus_tag LOCUS_02140 gene gnd 8611 7160 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E0A6 protein_id gnl|my_center|LOCUS_02140 8855 9085 gene locus_tag LOCUS_02150 8855 9085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 9234 9557 gene locus_tag LOCUS_02160 9234 9557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 9665 10219 gene locus_tag LOCUS_02170 9665 10219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 10191 10631 gene locus_tag LOCUS_02180 10191 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 10650 10988 gene locus_tag LOCUS_02190 10650 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11156 11914 gene locus_tag LOCUS_02200 11156 11914 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_02200 11911 13017 gene locus_tag LOCUS_02210 11911 13017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 13125 13547 gene locus_tag LOCUS_02220 13125 13547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_02220 13715 14800 gene locus_tag LOCUS_02230 13715 14800 CDS product phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_02230 14899 15225 gene locus_tag LOCUS_02240 14899 15225 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403747.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence013 >Feature sequence014 1240 284 gene locus_tag LOCUS_02250 1240 284 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_02250 2875 1304 gene locus_tag LOCUS_02260 2875 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3017 3598 gene locus_tag LOCUS_02270 3017 3598 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDJ2 protein_id gnl|my_center|LOCUS_02270 3677 4864 gene locus_tag LOCUS_02280 3677 4864 CDS product glutathione ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867267.1 protein_id gnl|my_center|LOCUS_02280 5478 6326 gene locus_tag LOCUS_02290 5478 6326 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_02290 6706 6347 gene locus_tag LOCUS_02300 6706 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 7257 6892 gene locus_tag LOCUS_02310 7257 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 7608 8501 gene locus_tag LOCUS_02320 7608 8501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 8517 9185 gene locus_tag LOCUS_02330 8517 9185 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_02330 9355 9437 gene locus_tag LOCUS_t00010 9355 9437 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9580 11049 gene locus_tag LOCUS_02340 gene tig 9580 11049 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6W2 protein_id gnl|my_center|LOCUS_02340 11046 11651 gene locus_tag LOCUS_02350 gene clpP2 11046 11651 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RZ59 protein_id gnl|my_center|LOCUS_02350 11782 12582 gene locus_tag LOCUS_02360 11782 12582 CDS product acid sugar phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEH9 protein_id gnl|my_center|LOCUS_02360 12586 13677 gene locus_tag LOCUS_02370 gene rlmN 12586 13677 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFY6 protein_id gnl|my_center|LOCUS_02370 13821 14048 gene locus_tag LOCUS_02380 13821 14048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 14074 15441 gene locus_tag LOCUS_02390 14074 15441 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CMA9 protein_id gnl|my_center|LOCUS_02390 15457 16362 gene locus_tag LOCUS_02400 15457 16362 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence015 315 1157 gene locus_tag LOCUS_02410 315 1157 CDS product fatty acid-binding protein DegV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_02410 1169 1510 gene locus_tag LOCUS_02420 1169 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 2417 1647 gene locus_tag LOCUS_02430 2417 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3610 2570 gene locus_tag LOCUS_02440 3610 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 4990 3770 gene locus_tag LOCUS_02450 4990 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5404 5075 gene locus_tag LOCUS_02460 5404 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6970 5465 gene locus_tag LOCUS_02470 6970 5465 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD3 protein_id gnl|my_center|LOCUS_02470 9210 6976 gene locus_tag LOCUS_02480 9210 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 9396 9905 gene locus_tag LOCUS_02490 gene rfaH 9396 9905 CDS product transcription antitermination protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZRG4 protein_id gnl|my_center|LOCUS_02490 10010 10825 gene locus_tag LOCUS_02500 10010 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 10828 11547 gene locus_tag LOCUS_02510 gene neuA 10828 11547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_02510 11525 12577 gene locus_tag LOCUS_02520 11525 12577 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_02520 12574 13749 gene locus_tag LOCUS_02530 12574 13749 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_02530 13816 14457 gene locus_tag LOCUS_02540 gene perB 13816 14457 CDS product hexapeptide transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918895.1 protein_id gnl|my_center|LOCUS_02540 14462 15547 gene locus_tag LOCUS_02550 14462 15547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence016 373 1668 gene locus_tag LOCUS_02560 373 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02560 1675 2319 gene locus_tag LOCUS_02570 1675 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 2376 2744 gene locus_tag LOCUS_02580 gene acpS 2376 2744 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGI1 protein_id gnl|my_center|LOCUS_02580 2811 5321 gene locus_tag LOCUS_02590 2811 5321 CDS product penicillin amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259579.1 protein_id gnl|my_center|LOCUS_02590 6284 5370 gene locus_tag LOCUS_02600 6284 5370 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000009279.1 protein_id gnl|my_center|LOCUS_02600 7113 6451 gene locus_tag LOCUS_02610 7113 6451 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_02610 8197 7262 gene locus_tag LOCUS_02620 8197 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 8581 8225 gene locus_tag LOCUS_02630 8581 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10036 8741 gene locus_tag LOCUS_02640 10036 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 10233 11600 gene locus_tag LOCUS_02650 10233 11600 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_02650 11656 12360 gene locus_tag LOCUS_02660 gene menG 11656 12360 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB34 protein_id gnl|my_center|LOCUS_02660 12357 12983 gene locus_tag LOCUS_02670 gene ubiX 12357 12983 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RSP2 protein_id gnl|my_center|LOCUS_02670 13014 13244 gene locus_tag LOCUS_02680 13014 13244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 13195 13539 gene locus_tag LOCUS_02690 13195 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 13541 14275 gene locus_tag LOCUS_02700 13541 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 14857 14351 gene locus_tag LOCUS_02710 14857 14351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 15868 14858 gene locus_tag LOCUS_02720 15868 14858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 >Feature sequence017 63 329 gene locus_tag LOCUS_02730 63 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 396 866 gene locus_tag LOCUS_02740 396 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 882 2801 gene locus_tag LOCUS_02750 882 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 6695 2862 gene locus_tag LOCUS_02760 6695 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 7181 6702 gene locus_tag LOCUS_02770 7181 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02770 8302 7208 gene locus_tag LOCUS_02780 8302 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02780 8404 9171 gene locus_tag LOCUS_02790 8404 9171 CDS product S-adenosylmethionine-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_02790 10394 9297 gene locus_tag LOCUS_02800 10394 9297 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681105.1 protein_id gnl|my_center|LOCUS_02800 12097 10469 gene locus_tag LOCUS_02810 12097 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 13021 12101 gene locus_tag LOCUS_02820 13021 12101 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_02820 13800 13033 gene locus_tag LOCUS_02830 13800 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 14037 14441 gene locus_tag LOCUS_02840 14037 14441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 14601 15383 gene locus_tag LOCUS_02850 gene paaG 14601 15383 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528003.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence018 326 27 gene locus_tag LOCUS_02860 326 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 671 357 gene locus_tag LOCUS_02870 671 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 1147 1440 gene locus_tag LOCUS_02880 1147 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1437 1757 gene locus_tag LOCUS_02890 1437 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2329 4230 gene locus_tag LOCUS_02900 2329 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 4241 5722 gene locus_tag LOCUS_02910 4241 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 5722 6054 gene locus_tag LOCUS_02920 5722 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 6045 6527 gene locus_tag LOCUS_02930 6045 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6564 6866 gene locus_tag LOCUS_02940 6564 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 6890 7360 gene locus_tag LOCUS_02950 6890 7360 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458338.1 protein_id gnl|my_center|LOCUS_02950 7398 10145 gene locus_tag LOCUS_02960 7398 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 10373 12952 gene locus_tag LOCUS_02970 10373 12952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 12949 14481 gene locus_tag LOCUS_02980 12949 14481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 14469 14669 gene locus_tag LOCUS_02990 14469 14669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14656 15054 gene locus_tag LOCUS_03000 14656 15054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 >Feature sequence019 167 2269 gene locus_tag LOCUS_03010 167 2269 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_03010 2281 3348 gene locus_tag LOCUS_03020 2281 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259751.1 protein_id gnl|my_center|LOCUS_03020 3577 4098 gene locus_tag LOCUS_03030 3577 4098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4148 5833 gene locus_tag LOCUS_03040 4148 5833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144164.1 protein_id gnl|my_center|LOCUS_03040 6131 5919 gene locus_tag LOCUS_03050 6131 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 7566 6241 gene locus_tag LOCUS_03060 7566 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8606 7611 gene locus_tag LOCUS_03070 8606 7611 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393400.1 protein_id gnl|my_center|LOCUS_03070 9743 8619 gene locus_tag LOCUS_03080 9743 8619 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97E48 protein_id gnl|my_center|LOCUS_03080 10957 9824 gene locus_tag LOCUS_03090 gene ybhR 10957 9824 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749B8 protein_id gnl|my_center|LOCUS_03090 12033 11047 gene locus_tag LOCUS_03100 gene ybhF-N 12033 11047 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_03100 12275 12003 gene locus_tag LOCUS_03110 12275 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 12559 12972 gene locus_tag LOCUS_03120 12559 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 14740 13115 gene locus_tag LOCUS_03130 gene hyuB 14740 13115 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence020 1836 190 gene locus_tag LOCUS_03140 gene ggt 1836 190 CDS product gamma-glutamyltranspeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038421.1 protein_id gnl|my_center|LOCUS_03140 1727 2059 gene locus_tag LOCUS_03150 1727 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2259 2056 gene locus_tag LOCUS_03160 2259 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 3334 2432 gene locus_tag LOCUS_03170 gene selD 3334 2432 CDS product selenide, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI12 protein_id gnl|my_center|LOCUS_03170 4674 3574 gene locus_tag LOCUS_03180 4674 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4741 5424 gene locus_tag LOCUS_03190 4741 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258197.1 protein_id gnl|my_center|LOCUS_03190 5431 6444 gene locus_tag LOCUS_03200 5431 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6437 7174 gene locus_tag LOCUS_03210 6437 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7225 8013 gene locus_tag LOCUS_03220 7225 8013 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258201.1 protein_id gnl|my_center|LOCUS_03220 9253 8027 gene locus_tag LOCUS_03230 9253 8027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 10576 9263 gene locus_tag LOCUS_03240 10576 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 11616 10669 gene locus_tag LOCUS_03250 gene yfiL 11616 10669 CDS product putative ABC transporter ATP-binding protein YfiL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94440 protein_id gnl|my_center|LOCUS_03250 11902 13065 gene locus_tag LOCUS_03260 gene ydfH 11902 13065 CDS product sensor histidine kinase YdfH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96685 protein_id gnl|my_center|LOCUS_03260 13058 13714 gene locus_tag LOCUS_03270 13058 13714 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966699.1 protein_id gnl|my_center|LOCUS_03270 14153 13716 gene locus_tag LOCUS_03280 gene dtd 14153 13716 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I6D9 protein_id gnl|my_center|LOCUS_03280 14852 14214 gene locus_tag LOCUS_03290 14852 14214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 >Feature sequence021 1671 625 gene locus_tag LOCUS_03300 1671 625 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_03300 2006 3175 gene locus_tag LOCUS_03310 2006 3175 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530559.1 protein_id gnl|my_center|LOCUS_03310 4100 3231 gene locus_tag LOCUS_03320 4100 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228982.1 protein_id gnl|my_center|LOCUS_03320 4704 4150 gene locus_tag LOCUS_03330 gene dcd 4704 4150 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63W86 protein_id gnl|my_center|LOCUS_03330 6232 4868 gene locus_tag LOCUS_03340 6232 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6324 6446 gene locus_tag LOCUS_03350 6324 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 7544 6543 gene locus_tag LOCUS_03360 7544 6543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 9145 7604 gene locus_tag LOCUS_03370 9145 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 9401 9192 gene locus_tag LOCUS_03380 9401 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 9480 11837 gene locus_tag LOCUS_03390 9480 11837 CDS product peptidase S45 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258185.1 protein_id gnl|my_center|LOCUS_03390 11910 12749 gene locus_tag LOCUS_03400 11910 12749 CDS product phosphoserine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958400.1 protein_id gnl|my_center|LOCUS_03400 12872 14461 gene locus_tag LOCUS_03410 12872 14461 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCW3 protein_id gnl|my_center|LOCUS_03410 >Feature sequence022 425 901 gene locus_tag LOCUS_03420 425 901 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_03420 1185 1544 gene locus_tag LOCUS_03430 1185 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1751 1554 gene locus_tag LOCUS_03440 1751 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 1838 2260 gene locus_tag LOCUS_03450 1838 2260 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_03450 2299 2616 gene locus_tag LOCUS_03460 2299 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 2780 3070 gene locus_tag LOCUS_03470 2780 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4113 3151 gene locus_tag LOCUS_03480 4113 3151 CDS product voltage-gated potassium channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584156.1 protein_id gnl|my_center|LOCUS_03480 4522 5883 gene locus_tag LOCUS_03490 gene hyuA 4522 5883 CDS product D-hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O69809 protein_id gnl|my_center|LOCUS_03490 6059 5986 gene locus_tag LOCUS_t00020 6059 5986 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6108 6866 gene locus_tag LOCUS_03500 6108 6866 CDS product type 12 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_03500 7049 7468 gene locus_tag LOCUS_03510 7049 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 7580 8350 gene locus_tag LOCUS_03520 7580 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 8428 9147 gene locus_tag LOCUS_03530 8428 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 10921 9218 gene locus_tag LOCUS_03540 10921 9218 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_03540 10989 11162 gene locus_tag LOCUS_03550 10989 11162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 11309 11085 gene locus_tag LOCUS_03560 11309 11085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 11415 12482 gene locus_tag LOCUS_03570 11415 12482 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_03570 12628 13386 gene locus_tag LOCUS_03580 gene recO 12628 13386 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFW9 protein_id gnl|my_center|LOCUS_03580 13446 13940 gene locus_tag LOCUS_03590 13446 13940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 13943 14185 gene locus_tag LOCUS_03600 13943 14185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence023 1630 1280 gene locus_tag LOCUS_03610 1630 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2188 1658 gene locus_tag LOCUS_03620 2188 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2793 2386 gene locus_tag LOCUS_03630 2793 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 4068 2887 gene locus_tag LOCUS_03640 4068 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 5583 4129 gene locus_tag LOCUS_03650 5583 4129 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_03650 6005 5613 gene locus_tag LOCUS_03660 6005 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 6991 6032 gene locus_tag LOCUS_03670 6991 6032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 7275 8339 gene locus_tag LOCUS_03680 7275 8339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 9182 8583 gene locus_tag LOCUS_03690 9182 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 9660 9175 gene locus_tag LOCUS_03700 9660 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 10104 9703 gene locus_tag LOCUS_03710 10104 9703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 10400 10131 gene locus_tag LOCUS_03720 10400 10131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 10885 10400 gene locus_tag LOCUS_03730 10885 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 11525 10965 gene locus_tag LOCUS_03740 11525 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 11743 11525 gene locus_tag LOCUS_03750 11743 11525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 11760 12083 gene locus_tag LOCUS_03760 11760 12083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P44190 protein_id gnl|my_center|LOCUS_03760 12089 12367 gene locus_tag LOCUS_03770 12089 12367 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_03770 13630 12440 gene locus_tag LOCUS_03780 13630 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 14151 13627 gene locus_tag LOCUS_03790 14151 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence024 623 249 gene locus_tag LOCUS_03800 623 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1092 637 gene locus_tag LOCUS_03810 gene ybeY 1092 637 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ51 protein_id gnl|my_center|LOCUS_03810 3191 1095 gene locus_tag LOCUS_03820 3191 1095 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257430.1 protein_id gnl|my_center|LOCUS_03820 3663 3217 gene locus_tag LOCUS_03830 3663 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392728.1 protein_id gnl|my_center|LOCUS_03830 4046 3699 gene locus_tag LOCUS_03840 gene hinT 4046 3699 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261764.1 protein_id gnl|my_center|LOCUS_03840 5370 4096 gene locus_tag LOCUS_03850 gene mtaB 5370 4096 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03850 6085 5441 gene locus_tag LOCUS_03860 6085 5441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 7656 6232 gene locus_tag LOCUS_03870 7656 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7835 9028 gene locus_tag LOCUS_03880 7835 9028 CDS product butyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_03880 9105 9878 gene locus_tag LOCUS_03890 9105 9878 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259383.1 protein_id gnl|my_center|LOCUS_03890 9878 10921 gene locus_tag LOCUS_03900 gene etfA2 9878 10921 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_03900 11385 10951 gene locus_tag LOCUS_03910 gene rnhA 11385 10951 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92RG0 protein_id gnl|my_center|LOCUS_03910 <14062 11606 gene locus_tag LOCUS_03920 <14062 11606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258588.1:ABC transporter substrate-binding protein >Feature sequence025 133 1110 gene locus_tag LOCUS_03930 133 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1156 1737 gene locus_tag LOCUS_03940 1156 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2072 2494 gene locus_tag LOCUS_03950 2072 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 2615 3445 gene locus_tag LOCUS_03960 2615 3445 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_03960 3486 4436 gene locus_tag LOCUS_03970 3486 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 4604 8566 gene locus_tag LOCUS_03980 4604 8566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 8713 9162 gene locus_tag LOCUS_03990 8713 9162 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_03990 9596 9201 gene locus_tag LOCUS_04000 9596 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 9837 10427 gene locus_tag LOCUS_04010 9837 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10313 10789 gene locus_tag LOCUS_04020 10313 10789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 10866 11465 gene locus_tag LOCUS_04030 10866 11465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 11526 13454 gene locus_tag LOCUS_04040 11526 13454 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392091.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence026 1379 444 gene locus_tag LOCUS_04050 1379 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 2256 1384 gene locus_tag LOCUS_04060 2256 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 3207 2314 gene locus_tag LOCUS_04070 3207 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 4097 3264 gene locus_tag LOCUS_04080 4097 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_04080 5556 4231 gene locus_tag LOCUS_04090 5556 4231 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_04090 6399 5647 gene locus_tag LOCUS_04100 6399 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7591 6431 gene locus_tag LOCUS_04110 7591 6431 CDS product capsular polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_04110 8707 7625 gene locus_tag LOCUS_04120 8707 7625 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_04120 10971 8800 gene locus_tag LOCUS_04130 10971 8800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 11960 11025 gene locus_tag LOCUS_04140 11960 11025 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015755.1 protein_id gnl|my_center|LOCUS_04140 13034 12027 gene locus_tag LOCUS_04150 gene pseB 13034 12027 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O25511 protein_id gnl|my_center|LOCUS_04150 >Feature sequence027 200 1252 gene locus_tag LOCUS_04160 200 1252 CDS product DNA recombination/repair protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812939.1 protein_id gnl|my_center|LOCUS_04160 1259 1789 gene locus_tag LOCUS_04170 1259 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 1993 2472 gene locus_tag LOCUS_04180 1993 2472 CDS product cys-tRNA(pro)/cys-tRNA(cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929250.1 protein_id gnl|my_center|LOCUS_04180 2523 3392 gene locus_tag LOCUS_04190 2523 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 3385 4302 gene locus_tag LOCUS_04200 3385 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 5751 4363 gene locus_tag LOCUS_04210 5751 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 7858 5903 gene locus_tag LOCUS_04220 7858 5903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031376.1 protein_id gnl|my_center|LOCUS_04220 9422 8166 gene locus_tag LOCUS_04230 gene ahcY 9422 8166 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ4 protein_id gnl|my_center|LOCUS_04230 10593 9637 gene locus_tag LOCUS_04240 10593 9637 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_04240 11751 10645 gene locus_tag LOCUS_04250 gene mtnA 11751 10645 CDS product methylthioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ8 protein_id gnl|my_center|LOCUS_04250 12830 11895 gene locus_tag LOCUS_04260 12830 11895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 13373 12906 gene locus_tag LOCUS_04270 13373 12906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence028 183 608 gene locus_tag LOCUS_04280 183 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 702 1502 gene locus_tag LOCUS_04290 702 1502 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816773.1 protein_id gnl|my_center|LOCUS_04290 1664 2335 gene locus_tag LOCUS_04300 1664 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 2476 2703 gene locus_tag LOCUS_04310 2476 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707213.1 protein_id gnl|my_center|LOCUS_04310 3406 3170 gene locus_tag LOCUS_04320 3406 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04320 3497 3775 gene locus_tag LOCUS_04330 3497 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 4367 3837 gene locus_tag LOCUS_04340 gene msrA 4367 3837 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS2 protein_id gnl|my_center|LOCUS_04340 5160 4372 gene locus_tag LOCUS_04350 5160 4372 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_04350 5986 5201 gene locus_tag LOCUS_04360 5986 5201 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888532.1 protein_id gnl|my_center|LOCUS_04360 6763 6098 gene locus_tag LOCUS_04370 6763 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 7121 6888 gene locus_tag LOCUS_04380 7121 6888 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250282.1 protein_id gnl|my_center|LOCUS_04380 7984 7145 gene locus_tag LOCUS_04390 7984 7145 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462425.1 protein_id gnl|my_center|LOCUS_04390 9170 8247 gene locus_tag LOCUS_04400 9170 8247 CDS product 5-methyltetrahydrofolate corrinoid/iron sulfur protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546439.1 protein_id gnl|my_center|LOCUS_04400 11197 9278 gene locus_tag LOCUS_04410 11197 9278 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811724.1 protein_id gnl|my_center|LOCUS_04410 12619 11288 gene locus_tag LOCUS_04420 12619 11288 CDS product acetyl-CoA synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_04420 <13574 12709 gene locus_tag LOCUS_04430 <13574 12709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392712.1:corrinoid/iron-sulfur protein small subunit >Feature sequence029 233 1051 gene locus_tag LOCUS_04440 233 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1064 2704 gene locus_tag LOCUS_04450 1064 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 3789 2974 gene locus_tag LOCUS_04460 gene pstB 3789 2974 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM86 protein_id gnl|my_center|LOCUS_04460 3799 4716 gene locus_tag LOCUS_04470 3799 4716 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064991.1 protein_id gnl|my_center|LOCUS_04470 4768 5664 gene locus_tag LOCUS_04480 gene pstC 4768 5664 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020932.1 protein_id gnl|my_center|LOCUS_04480 5676 6542 gene locus_tag LOCUS_04490 5676 6542 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A852 protein_id gnl|my_center|LOCUS_04490 6549 7304 gene locus_tag LOCUS_04500 gene pstB 6549 7304 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72D46 protein_id gnl|my_center|LOCUS_04500 7326 8000 gene locus_tag LOCUS_04510 7326 8000 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM85 protein_id gnl|my_center|LOCUS_04510 8197 8565 gene locus_tag LOCUS_04520 8197 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 8608 10266 gene locus_tag LOCUS_04530 8608 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 10302 11699 gene locus_tag LOCUS_04540 10302 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 11845 12438 gene locus_tag LOCUS_04550 11845 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence030 1943 1272 gene locus_tag LOCUS_04560 1943 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256163.1 protein_id gnl|my_center|LOCUS_04560 2725 1940 gene locus_tag LOCUS_04570 2725 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256164.1 protein_id gnl|my_center|LOCUS_04570 3012 2755 gene locus_tag LOCUS_04580 3012 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3322 3098 gene locus_tag LOCUS_04590 3322 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3630 4625 gene locus_tag LOCUS_04600 3630 4625 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_04600 4839 8180 gene locus_tag LOCUS_04610 4839 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 8235 9533 gene locus_tag LOCUS_04620 8235 9533 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_04620 9658 11880 gene locus_tag LOCUS_04630 9658 11880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 11870 12289 gene locus_tag LOCUS_04640 11870 12289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12286 12987 gene locus_tag LOCUS_04650 12286 12987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence031 92 1864 gene locus_tag LOCUS_04660 gene pepF 92 1864 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_04660 2871 1993 gene locus_tag LOCUS_04670 2871 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4011 2983 gene locus_tag LOCUS_04680 4011 2983 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_04680 4777 4058 gene locus_tag LOCUS_04690 4777 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_04690 5407 4826 gene locus_tag LOCUS_04700 5407 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257527.1 protein_id gnl|my_center|LOCUS_04700 6108 5494 gene locus_tag LOCUS_04710 6108 5494 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257526.1 protein_id gnl|my_center|LOCUS_04710 6301 7458 gene locus_tag LOCUS_04720 6301 7458 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405503.1 protein_id gnl|my_center|LOCUS_04720 7476 8237 gene locus_tag LOCUS_04730 7476 8237 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392464.1 protein_id gnl|my_center|LOCUS_04730 8320 9504 gene locus_tag LOCUS_04740 8320 9504 CDS product L-methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RDT4 protein_id gnl|my_center|LOCUS_04740 11063 9648 gene locus_tag LOCUS_04750 11063 9648 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403748.1 protein_id gnl|my_center|LOCUS_04750 12525 11134 gene locus_tag LOCUS_04760 12525 11134 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259364.1 protein_id gnl|my_center|LOCUS_04760 13192 12509 gene locus_tag LOCUS_04770 13192 12509 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259363.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence032 1151 777 gene locus_tag LOCUS_04780 1151 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2828 1233 gene locus_tag LOCUS_04790 2828 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3123 4559 gene locus_tag LOCUS_04800 3123 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4607 6691 gene locus_tag LOCUS_04810 4607 6691 CDS product methylamine inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967138.1 protein_id gnl|my_center|LOCUS_04810 6932 9328 gene locus_tag LOCUS_04820 6932 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 9659 10000 gene locus_tag LOCUS_04830 9659 10000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 10112 10384 gene locus_tag LOCUS_04840 10112 10384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 10467 10820 gene locus_tag LOCUS_04850 10467 10820 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808209.1 protein_id gnl|my_center|LOCUS_04850 11088 11873 gene locus_tag LOCUS_04860 11088 11873 CDS product rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_04860 11878 13128 gene locus_tag LOCUS_04870 11878 13128 CDS product UPF0210 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y9J3 protein_id gnl|my_center|LOCUS_04870 >Feature sequence033 2257 1436 gene locus_tag LOCUS_04880 2257 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3296 2310 gene locus_tag LOCUS_04890 3296 2310 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8FA29 protein_id gnl|my_center|LOCUS_04890 4255 3371 gene locus_tag LOCUS_04900 4255 3371 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814117.1 protein_id gnl|my_center|LOCUS_04900 5117 4263 gene locus_tag LOCUS_04910 5117 4263 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086912.1 protein_id gnl|my_center|LOCUS_04910 6012 5119 gene locus_tag LOCUS_04920 6012 5119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940421.1 protein_id gnl|my_center|LOCUS_04920 7467 6163 gene locus_tag LOCUS_04930 7467 6163 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_04930 8276 7503 gene locus_tag LOCUS_04940 8276 7503 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114176.1 protein_id gnl|my_center|LOCUS_04940 9874 8504 gene locus_tag LOCUS_04950 gene radA 9874 8504 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE37 protein_id gnl|my_center|LOCUS_04950 12626 10095 gene locus_tag LOCUS_04960 12626 10095 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence034 <1 877 gene locus_tag LOCUS_04970 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013527999.1:methyltransferase 898 2352 gene locus_tag LOCUS_04980 898 2352 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_04980 3110 2451 gene locus_tag LOCUS_04990 3110 2451 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080265.1 protein_id gnl|my_center|LOCUS_04990 5218 3113 gene locus_tag LOCUS_05000 5218 3113 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530885.1 protein_id gnl|my_center|LOCUS_05000 6152 5229 gene locus_tag LOCUS_05010 6152 5229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967159.1 protein_id gnl|my_center|LOCUS_05010 7464 6166 gene locus_tag LOCUS_05020 7464 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9219 7540 gene locus_tag LOCUS_05030 9219 7540 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532331.1 protein_id gnl|my_center|LOCUS_05030 10616 9588 gene locus_tag LOCUS_05040 gene adhP 10616 9588 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002067912.1 protein_id gnl|my_center|LOCUS_05040 12133 10685 gene locus_tag LOCUS_05050 12133 10685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461267.1 protein_id gnl|my_center|LOCUS_05050 12930 12145 gene locus_tag LOCUS_05060 12930 12145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 >Feature sequence035 520 2499 gene locus_tag LOCUS_05070 520 2499 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256059.1 protein_id gnl|my_center|LOCUS_05070 3270 2521 gene locus_tag LOCUS_05080 3270 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849665.1 protein_id gnl|my_center|LOCUS_05080 4707 3286 gene locus_tag LOCUS_05090 4707 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 6178 4970 gene locus_tag LOCUS_05100 gene apgM 6178 4970 CDS product putative 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SM27 protein_id gnl|my_center|LOCUS_05100 7423 6323 gene locus_tag LOCUS_05110 7423 6323 CDS product glycerol-3-phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_05110 7579 10155 gene locus_tag LOCUS_05120 gene mutS 7579 10155 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61667 protein_id gnl|my_center|LOCUS_05120 10576 10217 gene locus_tag LOCUS_05130 10576 10217 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227906.1 protein_id gnl|my_center|LOCUS_05130 12900 10723 gene locus_tag LOCUS_05140 12900 10723 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence036 5036 2235 gene locus_tag LOCUS_05150 gene polA 5036 2235 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O08307 protein_id gnl|my_center|LOCUS_05150 6709 5054 gene locus_tag LOCUS_05160 6709 5054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 7111 6920 gene locus_tag LOCUS_05170 7111 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 8282 7224 gene locus_tag LOCUS_05180 8282 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9585 8314 gene locus_tag LOCUS_05190 gene rho 9585 8314 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCV8 protein_id gnl|my_center|LOCUS_05190 9936 11006 gene locus_tag LOCUS_05200 gene prfA 9936 11006 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180Y2 protein_id gnl|my_center|LOCUS_05200 11003 11893 gene locus_tag LOCUS_05210 gene prmC 11003 11893 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBM9 protein_id gnl|my_center|LOCUS_05210 11916 12545 gene locus_tag LOCUS_05220 11916 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 12744 12944 gene locus_tag LOCUS_05230 12744 12944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 >Feature sequence037 382 1428 gene locus_tag LOCUS_05240 gene ltaA 382 1428 CDS product threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943783.1 protein_id gnl|my_center|LOCUS_05240 1537 2373 gene locus_tag LOCUS_05250 1537 2373 CDS product purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X259 protein_id gnl|my_center|LOCUS_05250 2408 3106 gene locus_tag LOCUS_05260 2408 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 3110 3649 gene locus_tag LOCUS_05270 3110 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3727 5646 gene locus_tag LOCUS_05280 3727 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_05280 5719 6669 gene locus_tag LOCUS_05290 5719 6669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 6666 7244 gene locus_tag LOCUS_05300 6666 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 7274 10024 gene locus_tag LOCUS_05310 7274 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 10279 10521 gene locus_tag LOCUS_05320 gene pspC 10279 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957794.1 protein_id gnl|my_center|LOCUS_05320 11056 10583 gene locus_tag LOCUS_05330 11056 10583 CDS product Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZPI9 protein_id gnl|my_center|LOCUS_05330 11697 11062 gene locus_tag LOCUS_05340 11697 11062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_05340 12285 11713 gene locus_tag LOCUS_05350 12285 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 12682 12305 gene locus_tag LOCUS_05360 12682 12305 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence038 1902 1030 gene locus_tag LOCUS_05370 1902 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 2146 2844 gene locus_tag LOCUS_05380 2146 2844 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029201.1 protein_id gnl|my_center|LOCUS_05380 2868 4127 gene locus_tag LOCUS_05390 2868 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4124 4393 gene locus_tag LOCUS_05400 4124 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 4421 4723 gene locus_tag LOCUS_05410 4421 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05410 4778 5740 gene locus_tag LOCUS_05420 gene msrP 4778 5740 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEF2 protein_id gnl|my_center|LOCUS_05420 5777 6388 gene locus_tag LOCUS_05430 gene msrQ 5777 6388 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEF3 protein_id gnl|my_center|LOCUS_05430 6486 7631 gene locus_tag LOCUS_05440 gene sucC 6486 7631 CDS product succinate--CoA ligase [ADP-forming] subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ74 protein_id gnl|my_center|LOCUS_05440 7628 8494 gene locus_tag LOCUS_05450 7628 8494 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFK3 protein_id gnl|my_center|LOCUS_05450 8806 8567 gene locus_tag LOCUS_05460 gene acpP 8806 8567 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9R0 protein_id gnl|my_center|LOCUS_05460 8965 9999 gene locus_tag LOCUS_05470 gene fni 8965 9999 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD5 protein_id gnl|my_center|LOCUS_05470 10003 11016 gene locus_tag LOCUS_05480 10003 11016 CDS product polyprenyl synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_05480 12244 11048 gene locus_tag LOCUS_05490 12244 11048 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256118.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence039 <1 965 gene locus_tag LOCUS_05500 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024256.1:histidine kinase 962 3670 gene locus_tag LOCUS_05510 962 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3743 5767 gene locus_tag LOCUS_05520 3743 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5878 7164 gene locus_tag LOCUS_05530 5878 7164 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903098.1 protein_id gnl|my_center|LOCUS_05530 7168 8238 gene locus_tag LOCUS_05540 7168 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 8238 9329 gene locus_tag LOCUS_05550 8238 9329 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_05550 9331 10434 gene locus_tag LOCUS_05560 9331 10434 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_05560 10431 11126 gene locus_tag LOCUS_05570 10431 11126 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_05570 11694 12041 gene locus_tag LOCUS_05580 11694 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05580 >Feature sequence040 2611 179 gene locus_tag LOCUS_05590 2611 179 CDS product sarcosine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229304.1 protein_id gnl|my_center|LOCUS_05590 4085 2706 gene locus_tag LOCUS_05600 gene solA 4085 2706 CDS product N-methyltryptophan oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259547.1 protein_id gnl|my_center|LOCUS_05600 5383 4163 gene locus_tag LOCUS_05610 5383 4163 CDS product glycine cleavage system protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528560.1 protein_id gnl|my_center|LOCUS_05610 7043 5532 gene locus_tag LOCUS_05620 7043 5532 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531176.1 protein_id gnl|my_center|LOCUS_05620 8616 7144 gene locus_tag LOCUS_05630 8616 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 9049 9948 gene locus_tag LOCUS_05640 9049 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 9952 11187 gene locus_tag LOCUS_05650 9952 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 <12432 11330 gene locus_tag LOCUS_05660 <12432 11330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WAN1:chromosomal replication initiator protein DnaA >Feature sequence041 2842 2135 gene locus_tag LOCUS_05670 2842 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2990 4465 gene locus_tag LOCUS_05680 2990 4465 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783193.1 protein_id gnl|my_center|LOCUS_05680 5012 4716 gene locus_tag LOCUS_05690 5012 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05690 5863 5009 gene locus_tag LOCUS_05700 5863 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6324 5959 gene locus_tag LOCUS_05710 6324 5959 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_05710 7704 6406 gene locus_tag LOCUS_05720 7704 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 10292 7734 gene locus_tag LOCUS_05730 10292 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 10880 10308 gene locus_tag LOCUS_05740 10880 10308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 11646 10861 gene locus_tag LOCUS_05750 11646 10861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 11981 11643 gene locus_tag LOCUS_05760 11981 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence042 1510 629 gene locus_tag LOCUS_05770 1510 629 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_05770 2789 1662 gene locus_tag LOCUS_05780 2789 1662 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259270.1 protein_id gnl|my_center|LOCUS_05780 3243 2797 gene locus_tag LOCUS_05790 3243 2797 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259271.1 protein_id gnl|my_center|LOCUS_05790 3606 3247 gene locus_tag LOCUS_05800 3606 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 5186 3630 gene locus_tag LOCUS_05810 5186 3630 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903114.1 protein_id gnl|my_center|LOCUS_05810 6238 5363 gene locus_tag LOCUS_05820 6238 5363 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878389.1 protein_id gnl|my_center|LOCUS_05820 7352 6240 gene locus_tag LOCUS_05830 7352 6240 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878388.1 protein_id gnl|my_center|LOCUS_05830 8896 7349 gene locus_tag LOCUS_05840 8896 7349 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_05840 11379 9121 gene locus_tag LOCUS_05850 11379 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence043 390 169 gene locus_tag LOCUS_05860 390 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1500 2864 gene locus_tag LOCUS_05870 gene trpB 1500 2864 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E092 protein_id gnl|my_center|LOCUS_05870 3404 2910 gene locus_tag LOCUS_05880 gene moaB 3404 2910 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_05880 5152 3410 gene locus_tag LOCUS_05890 5152 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5673 5305 gene locus_tag LOCUS_05900 5673 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8281 5684 gene locus_tag LOCUS_05910 gene lon 8281 5684 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2J0 protein_id gnl|my_center|LOCUS_05910 8708 8286 gene locus_tag LOCUS_05920 8708 8286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 9255 8731 gene locus_tag LOCUS_05930 gene tpX 9255 8731 CDS product putative thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72CQ5 protein_id gnl|my_center|LOCUS_05930 9464 10882 gene locus_tag LOCUS_05940 9464 10882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence044 <1 676 gene locus_tag LOCUS_05950 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9WZ40:signal recognition particle receptor FtsY 676 1398 gene locus_tag LOCUS_05960 676 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 1498 2559 gene locus_tag LOCUS_05970 gene prfB 1498 2559 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P28367 protein_id gnl|my_center|LOCUS_05970 2700 2879 gene locus_tag LOCUS_05980 gene rpmF 2700 2879 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RTT0 protein_id gnl|my_center|LOCUS_05980 2984 3940 gene locus_tag LOCUS_05990 2984 3940 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHA4 protein_id gnl|my_center|LOCUS_05990 3994 4755 gene locus_tag LOCUS_06000 gene fabG 3994 4755 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_06000 4949 5230 gene locus_tag LOCUS_06010 4949 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 5227 5670 gene locus_tag LOCUS_06020 gene nusB 5227 5670 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKH7 protein_id gnl|my_center|LOCUS_06020 5748 6152 gene locus_tag LOCUS_06030 5748 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 6157 7011 gene locus_tag LOCUS_06040 gene tatC 6157 7011 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLA6 protein_id gnl|my_center|LOCUS_06040 7234 8595 gene locus_tag LOCUS_06050 7234 8595 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_06050 8609 9157 gene locus_tag LOCUS_06060 8609 9157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 9320 10054 gene locus_tag LOCUS_06070 9320 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence045 65 1372 gene locus_tag LOCUS_06080 gene hemL 65 1372 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SJS4 protein_id gnl|my_center|LOCUS_06080 1430 3304 gene locus_tag LOCUS_06090 1430 3304 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_06090 3368 3751 gene locus_tag LOCUS_06100 3368 3751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_06100 3885 5060 gene locus_tag LOCUS_06110 3885 5060 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764762.1 protein_id gnl|my_center|LOCUS_06110 5297 6766 gene locus_tag LOCUS_06120 5297 6766 CDS product methylmalonate-semialdehyde dehydrogenase (CoA acylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979130.1 protein_id gnl|my_center|LOCUS_06120 6864 8030 gene locus_tag LOCUS_06130 gene thrC 6864 8030 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_06130 9005 8118 gene locus_tag LOCUS_06140 9005 8118 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943314.1 protein_id gnl|my_center|LOCUS_06140 9236 9430 gene locus_tag LOCUS_06150 9236 9430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 9449 9964 gene locus_tag LOCUS_06160 9449 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence046 954 1625 gene locus_tag LOCUS_06170 954 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1625 3376 gene locus_tag LOCUS_06180 1625 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_06180 3409 4467 gene locus_tag LOCUS_06190 3409 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4494 5069 gene locus_tag LOCUS_06200 4494 5069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 6644 5184 gene locus_tag LOCUS_06210 6644 5184 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_06210 6791 8449 gene locus_tag LOCUS_06220 6791 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 8525 9022 gene locus_tag LOCUS_06230 gene def 8525 9022 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92SH6 protein_id gnl|my_center|LOCUS_06230 9149 10354 gene locus_tag LOCUS_06240 gene recF 9149 10354 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDD4 protein_id gnl|my_center|LOCUS_06240 10465 10845 gene locus_tag LOCUS_06250 10465 10845 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531287.1 protein_id gnl|my_center|LOCUS_06250 11166 10840 gene locus_tag LOCUS_06260 11166 10840 CDS product branched-chain amino acid ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392756.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence047 979 29 gene locus_tag LOCUS_06270 979 29 CDS product phosphoesterase RecJ-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392566.1 protein_id gnl|my_center|LOCUS_06270 1367 966 gene locus_tag LOCUS_06280 gene rbfA 1367 966 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYY2 protein_id gnl|my_center|LOCUS_06280 3175 1382 gene locus_tag LOCUS_06290 3175 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3573 3352 gene locus_tag LOCUS_06300 3573 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 5653 3686 gene locus_tag LOCUS_06310 5653 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8546 5955 gene locus_tag LOCUS_06320 8546 5955 CDS product tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081021.1 protein_id gnl|my_center|LOCUS_06320 8661 8957 gene locus_tag LOCUS_06330 8661 8957 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222125.1 protein_id gnl|my_center|LOCUS_06330 8958 9506 gene locus_tag LOCUS_06340 8958 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 9506 10321 gene locus_tag LOCUS_06350 9506 10321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 11087 10374 gene locus_tag LOCUS_06360 gene lexA 11087 10374 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE65 protein_id gnl|my_center|LOCUS_06360 >Feature sequence048 420 971 gene locus_tag LOCUS_06370 420 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 999 1451 gene locus_tag LOCUS_06380 999 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1472 2800 gene locus_tag LOCUS_06390 1472 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2793 4817 gene locus_tag LOCUS_06400 2793 4817 CDS product disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_06400 4814 5119 gene locus_tag LOCUS_06410 4814 5119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 5122 6300 gene locus_tag LOCUS_06420 5122 6300 CDS product QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_06420 6333 6695 gene locus_tag LOCUS_06430 6333 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 7866 6940 gene locus_tag LOCUS_06440 7866 6940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_06440 8142 8486 gene locus_tag LOCUS_06450 8142 8486 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975218.1 protein_id gnl|my_center|LOCUS_06450 8629 9861 gene locus_tag LOCUS_06460 8629 9861 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_06460 9874 10548 gene locus_tag LOCUS_06470 9874 10548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 10574 10882 gene locus_tag LOCUS_06480 10574 10882 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence049 <1 815 gene locus_tag LOCUS_06490 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257500.1:ABC transporter ATP-binding protein 972 2105 gene locus_tag LOCUS_06500 972 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 2153 3010 gene locus_tag LOCUS_06510 2153 3010 CDS product TIGR00159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257450.1 protein_id gnl|my_center|LOCUS_06510 3007 4260 gene locus_tag LOCUS_06520 3007 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4322 5710 gene locus_tag LOCUS_06530 gene der 4322 5710 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y5W8 protein_id gnl|my_center|LOCUS_06530 5796 6542 gene locus_tag LOCUS_06540 gene deoC 5796 6542 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFK2 protein_id gnl|my_center|LOCUS_06540 6622 7230 gene locus_tag LOCUS_06550 6622 7230 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK59 protein_id gnl|my_center|LOCUS_06550 7248 7550 gene locus_tag LOCUS_06560 7248 7550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7615 7688 gene locus_tag LOCUS_t00030 7615 7688 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8935 7757 gene locus_tag LOCUS_06570 8935 7757 CDS product glycine/D-amino acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337746.1 protein_id gnl|my_center|LOCUS_06570 9419 9066 gene locus_tag LOCUS_06580 9419 9066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_06580 10526 9528 gene locus_tag LOCUS_06590 10526 9528 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933107.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence050 <1 1110 gene locus_tag LOCUS_06600 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256851.1:dynamin 1207 2358 gene locus_tag LOCUS_06610 1207 2358 CDS product deoxyguanosinetriphosphate triphosphohydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DR9 protein_id gnl|my_center|LOCUS_06610 2439 2900 gene locus_tag LOCUS_06620 gene greA 2439 2900 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WTY5 protein_id gnl|my_center|LOCUS_06620 4129 3092 gene locus_tag LOCUS_06630 4129 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 6673 4355 gene locus_tag LOCUS_06640 gene topA 6673 4355 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP9 protein_id gnl|my_center|LOCUS_06640 7791 6697 gene locus_tag LOCUS_06650 gene manC 7791 6697 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_06650 8906 7791 gene locus_tag LOCUS_06660 8906 7791 CDS product DNA processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_06660 9617 9048 gene locus_tag LOCUS_06670 gene rimM 9617 9048 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q819W5 protein_id gnl|my_center|LOCUS_06670 9850 9614 gene locus_tag LOCUS_06680 9850 9614 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460446.1 protein_id gnl|my_center|LOCUS_06680 10349 9927 gene locus_tag LOCUS_06690 10349 9927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence051 2151 2501 gene locus_tag LOCUS_06700 2151 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_06700 2517 2765 gene locus_tag LOCUS_06710 2517 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2849 3418 gene locus_tag LOCUS_06720 2849 3418 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973782.1 protein_id gnl|my_center|LOCUS_06720 3579 3779 gene locus_tag LOCUS_06730 3579 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3911 5965 gene locus_tag LOCUS_06740 3911 5965 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140683.1 protein_id gnl|my_center|LOCUS_06740 6029 6745 gene locus_tag LOCUS_06750 6029 6745 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8X8E6 protein_id gnl|my_center|LOCUS_06750 6745 7779 gene locus_tag LOCUS_06760 6745 7779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 7874 8059 gene locus_tag LOCUS_06770 7874 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 8056 8652 gene locus_tag LOCUS_06780 gene tag 8056 8652 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_06780 8673 9194 gene locus_tag LOCUS_06790 8673 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 9196 10086 gene locus_tag LOCUS_06800 9196 10086 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WYG3 protein_id gnl|my_center|LOCUS_06800 10083 10697 gene locus_tag LOCUS_06810 10083 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence052 1026 343 gene locus_tag LOCUS_06820 1026 343 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256019.1 protein_id gnl|my_center|LOCUS_06820 2704 1160 gene locus_tag LOCUS_06830 2704 1160 CDS product bilirubin oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_06830 3687 2776 gene locus_tag LOCUS_06840 3687 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228874.1 protein_id gnl|my_center|LOCUS_06840 5972 4200 gene locus_tag LOCUS_06850 5972 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 6643 5975 gene locus_tag LOCUS_06860 6643 5975 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_06860 7399 6725 gene locus_tag LOCUS_06870 7399 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 8081 7485 gene locus_tag LOCUS_06880 8081 7485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 8592 8209 gene locus_tag LOCUS_06890 8592 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 9036 9356 gene locus_tag LOCUS_06900 9036 9356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 9622 10119 gene locus_tag LOCUS_06910 9622 10119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence053 741 214 gene locus_tag LOCUS_06920 741 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1508 732 gene locus_tag LOCUS_06930 1508 732 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810400.1 protein_id gnl|my_center|LOCUS_06930 2533 1505 gene locus_tag LOCUS_06940 2533 1505 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_06940 3609 2533 gene locus_tag LOCUS_06950 3609 2533 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887218.1 protein_id gnl|my_center|LOCUS_06950 4521 3841 gene locus_tag LOCUS_06960 4521 3841 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_06960 4887 4552 gene locus_tag LOCUS_06970 4887 4552 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_06970 5313 4900 gene locus_tag LOCUS_06980 5313 4900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 6536 5319 gene locus_tag LOCUS_06990 6536 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 7587 6556 gene locus_tag LOCUS_07000 7587 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 8929 7739 gene locus_tag LOCUS_07010 gene fdnI 8929 7739 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941443.1 protein_id gnl|my_center|LOCUS_07010 9705 8926 gene locus_tag LOCUS_07020 gene fdnH 9705 8926 CDS product formate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941442.1 protein_id gnl|my_center|LOCUS_07020 <10693 9716 gene locus_tag LOCUS_07030 <10693 9716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546592.1:nitrate reductase >Feature sequence054 964 293 gene locus_tag LOCUS_07040 964 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 1810 1205 gene locus_tag LOCUS_07050 1810 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 2720 1866 gene locus_tag LOCUS_07060 2720 1866 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_07060 3766 2846 gene locus_tag LOCUS_07070 3766 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5268 3763 gene locus_tag LOCUS_07080 5268 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 6060 5416 gene locus_tag LOCUS_07090 6060 5416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 7067 6396 gene locus_tag LOCUS_07100 7067 6396 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010908817.1 protein_id gnl|my_center|LOCUS_07100 8032 7235 gene locus_tag LOCUS_07110 8032 7235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 8951 8106 gene locus_tag LOCUS_07120 8951 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 10294 9161 gene locus_tag LOCUS_07130 10294 9161 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460048.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence055 <1 965 gene locus_tag LOCUS_07140 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258760.1:NADH:ubiquinone oxidoreductase subunit M 1016 2506 gene locus_tag LOCUS_07150 1016 2506 CDS product NADH dehydrogenase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257846.1 protein_id gnl|my_center|LOCUS_07150 2506 3957 gene locus_tag LOCUS_07160 gene nuoN 2506 3957 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJT7 protein_id gnl|my_center|LOCUS_07160 4052 4279 gene locus_tag LOCUS_07170 4052 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 4284 5282 gene locus_tag LOCUS_07180 gene atpB 4284 5282 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGT0 protein_id gnl|my_center|LOCUS_07180 5374 5613 gene locus_tag LOCUS_07190 5374 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 5639 6376 gene locus_tag LOCUS_07200 5639 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 6562 8130 gene locus_tag LOCUS_07210 gene murE 6562 8130 CDS product UDP-N-acetylmuramyl-tripeptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGL6 protein_id gnl|my_center|LOCUS_07210 >Feature sequence056 <1 961 gene locus_tag LOCUS_07220 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582437.1:ABC transporter 954 1799 gene locus_tag LOCUS_07230 954 1799 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_07230 1880 2767 gene locus_tag LOCUS_07240 1880 2767 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250096.1 protein_id gnl|my_center|LOCUS_07240 2828 3367 gene locus_tag LOCUS_07250 2828 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 3750 3388 gene locus_tag LOCUS_07260 3750 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07260 3902 4531 gene locus_tag LOCUS_07270 3902 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 4587 5591 gene locus_tag LOCUS_07280 4587 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 6811 5588 gene locus_tag LOCUS_07290 6811 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 7612 6827 gene locus_tag LOCUS_07300 7612 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8444 7635 gene locus_tag LOCUS_07310 8444 7635 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256180.1 protein_id gnl|my_center|LOCUS_07310 9577 8663 gene locus_tag LOCUS_07320 9577 8663 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_07320 10444 9581 gene locus_tag LOCUS_07330 10444 9581 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence057 <1 1978 gene locus_tag LOCUS_07340 <1 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256758.1:6-phosphofructokinase 3940 1994 gene locus_tag LOCUS_07350 3940 1994 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_07350 4088 5710 gene locus_tag LOCUS_07360 4088 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 5877 5665 gene locus_tag LOCUS_07370 5877 5665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 5876 7069 gene locus_tag LOCUS_07380 5876 7069 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_07380 7282 7977 gene locus_tag LOCUS_07390 7282 7977 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_07390 8043 9443 gene locus_tag LOCUS_07400 8043 9443 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_07400 9440 10423 gene locus_tag LOCUS_07410 9440 10423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence058 1 354 gene locus_tag LOCUS_07420 1 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 384 1376 gene locus_tag LOCUS_07430 384 1376 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886851.1 protein_id gnl|my_center|LOCUS_07430 1504 2265 gene locus_tag LOCUS_07440 1504 2265 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_07440 2352 2861 gene locus_tag LOCUS_07450 2352 2861 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_07450 2946 4067 gene locus_tag LOCUS_07460 2946 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_07460 4028 4219 gene locus_tag LOCUS_07470 4028 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 4280 4672 gene locus_tag LOCUS_07480 4280 4672 CDS product 3-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265597.1 protein_id gnl|my_center|LOCUS_07480 4691 5425 gene locus_tag LOCUS_07490 4691 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 5444 6223 gene locus_tag LOCUS_07500 5444 6223 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_07500 7338 6226 gene locus_tag LOCUS_07510 7338 6226 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202512.1 protein_id gnl|my_center|LOCUS_07510 8396 7338 gene locus_tag LOCUS_07520 8396 7338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 8555 9799 gene locus_tag LOCUS_07530 8555 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 9792 10439 gene locus_tag LOCUS_07540 9792 10439 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence059 1434 982 gene locus_tag LOCUS_07550 1434 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2845 1451 gene locus_tag LOCUS_07560 gene atpD 2845 1451 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFX9 protein_id gnl|my_center|LOCUS_07560 3790 2897 gene locus_tag LOCUS_07570 gene atpG 3790 2897 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGS5 protein_id gnl|my_center|LOCUS_07570 5467 3806 gene locus_tag LOCUS_07580 gene atpA 5467 3806 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q64UA4 protein_id gnl|my_center|LOCUS_07580 6694 5900 gene locus_tag LOCUS_07590 gene proC 6694 5900 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFV0 protein_id gnl|my_center|LOCUS_07590 7395 6820 gene locus_tag LOCUS_07600 gene ruvA 7395 6820 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA87 protein_id gnl|my_center|LOCUS_07600 7920 7420 gene locus_tag LOCUS_07610 7920 7420 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_07610 8679 7927 gene locus_tag LOCUS_07620 8679 7927 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62036 protein_id gnl|my_center|LOCUS_07620 9941 8946 gene locus_tag LOCUS_07630 9941 8946 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_07630 10037 10112 gene locus_tag LOCUS_t00040 10037 10112 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10397 10176 gene locus_tag LOCUS_07640 10397 10176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence060 1348 167 gene locus_tag LOCUS_07650 1348 167 CDS product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_07650 3454 1391 gene locus_tag LOCUS_07660 3454 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 4382 3441 gene locus_tag LOCUS_07670 4382 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5412 4462 gene locus_tag LOCUS_07680 5412 4462 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_07680 5669 6265 gene locus_tag LOCUS_07690 5669 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 6353 7024 gene locus_tag LOCUS_07700 6353 7024 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_07700 8195 7095 gene locus_tag LOCUS_07710 8195 7095 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870080.1 protein_id gnl|my_center|LOCUS_07710 9194 8286 gene locus_tag LOCUS_07720 gene rbsK 9194 8286 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224444.1 protein_id gnl|my_center|LOCUS_07720 <10265 9212 gene locus_tag LOCUS_07730 <10265 9212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257089.1:acetyl-lysine deacetylase >Feature sequence061 1726 545 gene locus_tag LOCUS_07740 1726 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081526.1 protein_id gnl|my_center|LOCUS_07740 2648 1803 gene locus_tag LOCUS_07750 2648 1803 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776379.1 protein_id gnl|my_center|LOCUS_07750 3546 2650 gene locus_tag LOCUS_07760 3546 2650 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_07760 4343 3543 gene locus_tag LOCUS_07770 gene nagB 4343 3543 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762537.1 protein_id gnl|my_center|LOCUS_07770 5143 4340 gene locus_tag LOCUS_07780 5143 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 6575 5217 gene locus_tag LOCUS_07790 6575 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 7619 6693 gene locus_tag LOCUS_07800 7619 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 8305 7616 gene locus_tag LOCUS_07810 8305 7616 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011862000.1 protein_id gnl|my_center|LOCUS_07810 8625 9092 gene locus_tag LOCUS_07820 8625 9092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 9182 9781 gene locus_tag LOCUS_07830 9182 9781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence062 1327 68 gene locus_tag LOCUS_07840 gene moeA 1327 68 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_07840 3544 1331 gene locus_tag LOCUS_07850 3544 1331 CDS product (p)ppGpp synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393182.1 protein_id gnl|my_center|LOCUS_07850 3968 3612 gene locus_tag LOCUS_07860 3968 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 4127 5128 gene locus_tag LOCUS_07870 4127 5128 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_07870 5128 6135 gene locus_tag LOCUS_07880 5128 6135 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_07880 7187 6198 gene locus_tag LOCUS_07890 7187 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 8235 7300 gene locus_tag LOCUS_07900 8235 7300 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461580.1 protein_id gnl|my_center|LOCUS_07900 9551 8232 gene locus_tag LOCUS_07910 9551 8232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence063 154 2958 gene locus_tag LOCUS_07920 154 2958 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_07920 5047 3167 gene locus_tag LOCUS_07930 5047 3167 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_07930 5780 5109 gene locus_tag LOCUS_07940 gene rnhB 5780 5109 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIH1 protein_id gnl|my_center|LOCUS_07940 6498 5767 gene locus_tag LOCUS_07950 6498 5767 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_07950 7389 6583 gene locus_tag LOCUS_07960 7389 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 8077 7763 gene locus_tag LOCUS_07970 8077 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 9816 8371 gene locus_tag LOCUS_07980 gene gltA 9816 8371 CDS product glutamate synthase (NADPH), homotetrameric inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence064 1698 109 gene locus_tag LOCUS_07990 1698 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1868 2215 gene locus_tag LOCUS_08000 1868 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 2311 3390 gene locus_tag LOCUS_08010 2311 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3438 4568 gene locus_tag LOCUS_08020 3438 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809015.1 protein_id gnl|my_center|LOCUS_08020 6954 4639 gene locus_tag LOCUS_08030 6954 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 8158 6965 gene locus_tag LOCUS_08040 8158 6965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9539 8205 gene locus_tag LOCUS_08050 9539 8205 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810594.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence065 800 225 gene locus_tag LOCUS_08060 800 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 1296 2555 gene locus_tag LOCUS_08070 1296 2555 CDS product cysteine desulfurase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257673.1 protein_id gnl|my_center|LOCUS_08070 2908 2702 gene locus_tag LOCUS_08080 gene cspG 2908 2702 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126912.1 protein_id gnl|my_center|LOCUS_08080 3380 4072 gene locus_tag LOCUS_08090 3380 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5240 4089 gene locus_tag LOCUS_08100 5240 4089 CDS product aminotransferase class V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257531.1 protein_id gnl|my_center|LOCUS_08100 6427 5333 gene locus_tag LOCUS_08110 6427 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 7392 6721 gene locus_tag LOCUS_08120 gene yhcW 7392 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54607 protein_id gnl|my_center|LOCUS_08120 7674 8051 gene locus_tag LOCUS_08130 7674 8051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 8055 9320 gene locus_tag LOCUS_08140 8055 9320 CDS product glucose dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_08140 9520 9972 gene locus_tag LOCUS_08150 9520 9972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence066 405 1466 gene locus_tag LOCUS_08160 gene pheS 405 1466 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDN0 protein_id gnl|my_center|LOCUS_08160 1807 2151 gene locus_tag LOCUS_08170 1807 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2245 4917 gene locus_tag LOCUS_08180 gene pheT 2245 4917 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH19 protein_id gnl|my_center|LOCUS_08180 5148 6674 gene locus_tag LOCUS_08190 5148 6674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 6685 8349 gene locus_tag LOCUS_08200 6685 8349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 8420 9817 gene locus_tag LOCUS_08210 8420 9817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence067 650 2569 gene locus_tag LOCUS_08220 650 2569 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941439.1 protein_id gnl|my_center|LOCUS_08220 2562 3668 gene locus_tag LOCUS_08230 2562 3668 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_08230 3701 4120 gene locus_tag LOCUS_08240 3701 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 4131 4694 gene locus_tag LOCUS_08250 gene hdrC 4131 4694 CDS product Fe-S oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940769.1 protein_id gnl|my_center|LOCUS_08250 4691 5575 gene locus_tag LOCUS_08260 4691 5575 CDS product heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_08260 5638 7671 gene locus_tag LOCUS_08270 gene hdrA-2 5638 7671 CDS product heterodisulfide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932915.1 protein_id gnl|my_center|LOCUS_08270 7753 8229 gene locus_tag LOCUS_08280 gene mvhD 7753 8229 CDS product hydrogenase methyl-viologen-reducing type delta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932916.1 protein_id gnl|my_center|LOCUS_08280 8231 9265 gene locus_tag LOCUS_08290 8231 9265 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence068 3323 3117 gene locus_tag LOCUS_08300 3323 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 3854 3588 gene locus_tag LOCUS_08310 3854 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4149 3841 gene locus_tag LOCUS_08320 4149 3841 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942689.1 protein_id gnl|my_center|LOCUS_08320 4950 6560 gene locus_tag LOCUS_08330 4950 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence069 2407 1907 gene locus_tag LOCUS_08340 2407 1907 CDS product cyclic nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310720.1 protein_id gnl|my_center|LOCUS_08340 4422 2596 gene locus_tag LOCUS_08350 4422 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5183 4443 gene locus_tag LOCUS_08360 5183 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 5995 5240 gene locus_tag LOCUS_08370 5995 5240 CDS product CDP-3, 6-dideoxy-D-glycero-L-glycero-4-hexulose-4-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056807.1 protein_id gnl|my_center|LOCUS_08370 7478 6111 gene locus_tag LOCUS_08380 7478 6111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 >Feature sequence070 91 1641 gene locus_tag LOCUS_08390 91 1641 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_08390 1671 2414 gene locus_tag LOCUS_08400 1671 2414 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390489.1 protein_id gnl|my_center|LOCUS_08400 2465 3979 gene locus_tag LOCUS_08410 2465 3979 CDS product biotin carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_08410 3992 4489 gene locus_tag LOCUS_08420 gene pycA 3992 4489 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403592.1 protein_id gnl|my_center|LOCUS_08420 4632 5186 gene locus_tag LOCUS_08430 4632 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_08430 5226 6659 gene locus_tag LOCUS_08440 gene dnaC 5226 6659 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181Q8 protein_id gnl|my_center|LOCUS_08440 6662 7342 gene locus_tag LOCUS_08450 6662 7342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 7275 8666 gene locus_tag LOCUS_08460 7275 8666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8700 9518 gene locus_tag LOCUS_08470 8700 9518 CDS product iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097186.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence071 <1 2409 gene locus_tag LOCUS_08480 <1 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057169.1:ABC transporter ATP-binding protein 2946 3350 gene locus_tag LOCUS_08490 2946 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3343 3948 gene locus_tag LOCUS_08500 3343 3948 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_08500 3945 4721 gene locus_tag LOCUS_08510 3945 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4718 4972 gene locus_tag LOCUS_08520 4718 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 5192 6838 gene locus_tag LOCUS_08530 5192 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 8087 6990 gene locus_tag LOCUS_08540 8087 6990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9371 8151 gene locus_tag LOCUS_08550 9371 8151 CDS product drug:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974386.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence072 123 1517 gene locus_tag LOCUS_08560 123 1517 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A3P5 protein_id gnl|my_center|LOCUS_08560 1631 2143 gene locus_tag LOCUS_08570 1631 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2223 3032 gene locus_tag LOCUS_08580 2223 3032 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720512.1 protein_id gnl|my_center|LOCUS_08580 3029 3874 gene locus_tag LOCUS_08590 3029 3874 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263896.1 protein_id gnl|my_center|LOCUS_08590 3877 4980 gene locus_tag LOCUS_08600 3877 4980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708677.1 protein_id gnl|my_center|LOCUS_08600 5107 6210 gene locus_tag LOCUS_08610 5107 6210 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479781.1 protein_id gnl|my_center|LOCUS_08610 6440 7237 gene locus_tag LOCUS_08620 6440 7237 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256693.1 protein_id gnl|my_center|LOCUS_08620 7903 8190 gene locus_tag LOCUS_08630 7903 8190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 8351 9121 gene locus_tag LOCUS_08640 gene hpcH 8351 9121 CDS product 2,4-dihydroxyhept-2-ene-1,7-dioic acid aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205448.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence073 2066 1278 gene locus_tag LOCUS_08650 gene hisF 2066 1278 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P62450 protein_id gnl|my_center|LOCUS_08650 2752 2141 gene locus_tag LOCUS_08660 gene hisH 2752 2141 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61779 protein_id gnl|my_center|LOCUS_08660 3538 2804 gene locus_tag LOCUS_08670 gene hisA 3538 2804 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW1 protein_id gnl|my_center|LOCUS_08670 4197 3610 gene locus_tag LOCUS_08680 gene hisB 4197 3610 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDZ1 protein_id gnl|my_center|LOCUS_08680 5344 4178 gene locus_tag LOCUS_08690 gene hisC 5344 4178 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDY8 protein_id gnl|my_center|LOCUS_08690 6667 5360 gene locus_tag LOCUS_08700 gene hisD 6667 5360 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJJ5 protein_id gnl|my_center|LOCUS_08700 7738 6728 gene locus_tag LOCUS_08710 gene hisG 7738 6728 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK40 protein_id gnl|my_center|LOCUS_08710 7960 8145 gene locus_tag LOCUS_08720 7960 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 9192 8227 gene locus_tag LOCUS_08730 9192 8227 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence074 383 1792 gene locus_tag LOCUS_08740 383 1792 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_08740 2031 3842 gene locus_tag LOCUS_08750 gene ade 2031 3842 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TKE3 protein_id gnl|my_center|LOCUS_08750 3895 4596 gene locus_tag LOCUS_08760 gene ymfC 3895 4596 CDS product putative HTH-type transcriptional regulator YmfC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31761 protein_id gnl|my_center|LOCUS_08760 4707 5660 gene locus_tag LOCUS_08770 4707 5660 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_08770 5786 6766 gene locus_tag LOCUS_08780 5786 6766 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_08780 6771 7715 gene locus_tag LOCUS_08790 6771 7715 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGN0 protein_id gnl|my_center|LOCUS_08790 7924 9195 gene locus_tag LOCUS_08800 7924 9195 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393451.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence075 1282 203 gene locus_tag LOCUS_08810 1282 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 2341 1409 gene locus_tag LOCUS_08820 2341 1409 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_08820 3489 2338 gene locus_tag LOCUS_08830 3489 2338 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975045.1 protein_id gnl|my_center|LOCUS_08830 5776 3527 gene locus_tag LOCUS_08840 5776 3527 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_08840 6248 5769 gene locus_tag LOCUS_08850 6248 5769 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530647.1 protein_id gnl|my_center|LOCUS_08850 7114 6245 gene locus_tag LOCUS_08860 7114 6245 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_08860 8915 7155 gene locus_tag LOCUS_08870 gene ade 8915 7155 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL95 protein_id gnl|my_center|LOCUS_08870 >Feature sequence076 1617 226 gene locus_tag LOCUS_08880 1617 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2210 1614 gene locus_tag LOCUS_08890 2210 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 3782 2214 gene locus_tag LOCUS_08900 3782 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 4365 3820 gene locus_tag LOCUS_08910 gene folK 4365 3820 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_08910 4469 5794 gene locus_tag LOCUS_08920 4469 5794 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_08920 5850 5937 gene locus_tag LOCUS_t00050 5850 5937 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6207 7373 gene locus_tag LOCUS_08930 6207 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 8024 7392 gene locus_tag LOCUS_08940 8024 7392 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453954.1 protein_id gnl|my_center|LOCUS_08940 <9297 8507 gene locus_tag LOCUS_08950 <9297 8507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WE57:glutamine--fructose-6-phosphate aminotransferase [isomerizing] >Feature sequence077 457 32 gene locus_tag LOCUS_08960 457 32 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 protein_id gnl|my_center|LOCUS_08960 4197 454 gene locus_tag LOCUS_08970 4197 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 4763 4551 gene locus_tag LOCUS_08980 4763 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence078 105 1025 gene locus_tag LOCUS_08990 105 1025 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258562.1 protein_id gnl|my_center|LOCUS_08990 1022 1705 gene locus_tag LOCUS_09000 1022 1705 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_09000 1806 1991 gene locus_tag LOCUS_09010 1806 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2013 2426 gene locus_tag LOCUS_09020 2013 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 2867 6409 gene locus_tag LOCUS_09030 gene ileS 2867 6409 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9S2X5 protein_id gnl|my_center|LOCUS_09030 6688 6873 gene locus_tag LOCUS_09040 6688 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7167 7340 gene locus_tag LOCUS_09050 7167 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7312 8622 gene locus_tag LOCUS_09060 7312 8622 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257200.1 protein_id gnl|my_center|LOCUS_09060 8932 8693 gene locus_tag LOCUS_09070 8932 8693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence079 188 2317 gene locus_tag LOCUS_09080 188 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2347 3369 gene locus_tag LOCUS_09090 2347 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3386 4543 gene locus_tag LOCUS_09100 3386 4543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4556 5584 gene locus_tag LOCUS_09110 4556 5584 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_09110 5674 7206 gene locus_tag LOCUS_09120 5674 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 7203 7850 gene locus_tag LOCUS_09130 7203 7850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 7847 8899 gene locus_tag LOCUS_09140 7847 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence080 5680 5015 gene locus_tag LOCUS_09150 5680 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 7997 5766 gene locus_tag LOCUS_09160 gene recD2 7997 5766 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RDI9 protein_id gnl|my_center|LOCUS_09160 <9051 8026 gene locus_tag LOCUS_09170 <9051 8026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057595.1:transcriptional regulator >Feature sequence081 1511 171 gene locus_tag LOCUS_09180 1511 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2837 1605 gene locus_tag LOCUS_09190 2837 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3014 3742 gene locus_tag LOCUS_09200 gene trmD 3014 3742 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FG3 protein_id gnl|my_center|LOCUS_09200 3836 5083 gene locus_tag LOCUS_09210 3836 5083 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_09210 5531 6583 gene locus_tag LOCUS_09220 gene hrcA 5531 6583 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEX3 protein_id gnl|my_center|LOCUS_09220 6606 7193 gene locus_tag LOCUS_09230 6606 7193 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence082 450 1340 gene locus_tag LOCUS_09240 gene folD 450 1340 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TM48 protein_id gnl|my_center|LOCUS_09240 1482 3410 gene locus_tag LOCUS_09250 gene fhs 1482 3410 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM91 protein_id gnl|my_center|LOCUS_09250 3604 5325 gene locus_tag LOCUS_09260 gene nuoF 3604 5325 CDS product NADH dehydrogenase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_09260 5369 6145 gene locus_tag LOCUS_09270 5369 6145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6306 7082 gene locus_tag LOCUS_09280 6306 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence083 822 118 gene locus_tag LOCUS_09290 822 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1311 874 gene locus_tag LOCUS_09300 gene aroQ 1311 874 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_09300 2997 1384 gene locus_tag LOCUS_09310 2997 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 4243 2990 gene locus_tag LOCUS_09320 gene aroC 4243 2990 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74BL4 protein_id gnl|my_center|LOCUS_09320 5436 4246 gene locus_tag LOCUS_09330 gene dapL 5436 4246 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK33 protein_id gnl|my_center|LOCUS_09330 6398 5472 gene locus_tag LOCUS_09340 gene aroE 6398 5472 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0A0 protein_id gnl|my_center|LOCUS_09340 7663 6395 gene locus_tag LOCUS_09350 gene aroA 7663 6395 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EEH8 protein_id gnl|my_center|LOCUS_09350 8748 7894 gene locus_tag LOCUS_09360 8748 7894 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence084 125 496 gene locus_tag LOCUS_09370 gene fdx 125 496 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404634.1 protein_id gnl|my_center|LOCUS_09370 2942 549 gene locus_tag LOCUS_09380 2942 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 3953 3075 gene locus_tag LOCUS_09390 3953 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 5598 4177 gene locus_tag LOCUS_09400 5598 4177 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_09400 5729 6382 gene locus_tag LOCUS_09410 5729 6382 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_09410 6379 6906 gene locus_tag LOCUS_09420 6379 6906 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812954.1 protein_id gnl|my_center|LOCUS_09420 6973 7911 gene locus_tag LOCUS_09430 6973 7911 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_09430 7913 8176 gene locus_tag LOCUS_09440 7913 8176 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQU1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence085 164 1690 gene locus_tag LOCUS_09450 164 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1799 2455 gene locus_tag LOCUS_09460 1799 2455 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976332.1 protein_id gnl|my_center|LOCUS_09460 2552 3115 gene locus_tag LOCUS_09470 2552 3115 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889047.1 protein_id gnl|my_center|LOCUS_09470 3239 4114 gene locus_tag LOCUS_09480 3239 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4126 5103 gene locus_tag LOCUS_09490 gene fmt 4126 5103 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM71 protein_id gnl|my_center|LOCUS_09490 5100 6386 gene locus_tag LOCUS_09500 5100 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 6389 7414 gene locus_tag LOCUS_09510 6389 7414 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MCL6 protein_id gnl|my_center|LOCUS_09510 8783 7479 gene locus_tag LOCUS_09520 8783 7479 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence086 880 203 gene locus_tag LOCUS_09530 880 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 965 2608 gene locus_tag LOCUS_09540 965 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 3798 2632 gene locus_tag LOCUS_09550 3798 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4210 5409 gene locus_tag LOCUS_09560 4210 5409 CDS product iron-sulfur-binding reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_09560 5552 6319 gene locus_tag LOCUS_09570 5552 6319 CDS product electron transfer flavoprotein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903589.1 protein_id gnl|my_center|LOCUS_09570 6333 7289 gene locus_tag LOCUS_09580 6333 7289 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence087 2 292 gene locus_tag LOCUS_09590 2 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 330 701 gene locus_tag LOCUS_09600 330 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880217.1 protein_id gnl|my_center|LOCUS_09600 798 1244 gene locus_tag LOCUS_09610 gene gcvH2 798 1244 CDS product glycine cleavage system H protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67573 protein_id gnl|my_center|LOCUS_09610 1267 2379 gene locus_tag LOCUS_09620 gene mbhS2 1267 2379 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880596.1 protein_id gnl|my_center|LOCUS_09620 2398 3075 gene locus_tag LOCUS_09630 2398 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3087 4346 gene locus_tag LOCUS_09640 gene hdrD 3087 4346 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880594.1 protein_id gnl|my_center|LOCUS_09640 4358 4681 gene locus_tag LOCUS_09650 4358 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4691 6430 gene locus_tag LOCUS_09660 gene mbhL2 4691 6430 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880593.1 protein_id gnl|my_center|LOCUS_09660 6535 7017 gene locus_tag LOCUS_09670 gene hupD 6535 7017 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880396.1 protein_id gnl|my_center|LOCUS_09670 7080 8126 gene locus_tag LOCUS_09680 7080 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881270.1 protein_id gnl|my_center|LOCUS_09680 8253 8618 gene locus_tag LOCUS_09690 gene hypA 8253 8618 CDS product putative hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KL76 protein_id gnl|my_center|LOCUS_09690 >Feature sequence088 1100 429 gene locus_tag LOCUS_09700 1100 429 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_09700 3237 1534 gene locus_tag LOCUS_09710 3237 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4469 3291 gene locus_tag LOCUS_09720 4469 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 4844 4479 gene locus_tag LOCUS_09730 4844 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 5061 5978 gene locus_tag LOCUS_09740 5061 5978 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_09740 6202 7122 gene locus_tag LOCUS_09750 6202 7122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 7100 7942 gene locus_tag LOCUS_09760 7100 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence089 491 419 gene locus_tag LOCUS_t00060 491 419 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 566 494 gene locus_tag LOCUS_t00070 566 494 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 708 1535 gene locus_tag LOCUS_09770 708 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1532 1954 gene locus_tag LOCUS_09780 1532 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1951 3306 gene locus_tag LOCUS_09790 1951 3306 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_09790 3441 4385 gene locus_tag LOCUS_09800 gene lipA 3441 4385 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZN84 protein_id gnl|my_center|LOCUS_09800 4663 6534 gene locus_tag LOCUS_09810 gene napA 4663 6534 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000399994.1 protein_id gnl|my_center|LOCUS_09810 6800 7756 gene locus_tag LOCUS_09820 6800 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence090 141 1157 gene locus_tag LOCUS_09830 141 1157 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902730.1 protein_id gnl|my_center|LOCUS_09830 1170 1547 gene locus_tag LOCUS_09840 1170 1547 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404257.1 protein_id gnl|my_center|LOCUS_09840 1644 2777 gene locus_tag LOCUS_09850 1644 2777 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_09850 3778 3368 gene locus_tag LOCUS_09860 3778 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 4380 3775 gene locus_tag LOCUS_09870 4380 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4451 5137 gene locus_tag LOCUS_09880 4451 5137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813120.1 protein_id gnl|my_center|LOCUS_09880 5315 5390 gene locus_tag LOCUS_t00080 5315 5390 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5614 6651 gene locus_tag LOCUS_09890 5614 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 6845 7435 gene locus_tag LOCUS_09900 gene ydeI 6845 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96666 protein_id gnl|my_center|LOCUS_09900 7766 8074 gene locus_tag LOCUS_09910 7766 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence091 <1 891 gene locus_tag LOCUS_09920 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114088.1:hydrolase 1220 2773 gene locus_tag LOCUS_09930 1220 2773 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_09930 2941 4203 gene locus_tag LOCUS_09940 2941 4203 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_09940 4210 4629 gene locus_tag LOCUS_09950 4210 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 4687 5484 gene locus_tag LOCUS_09960 gene catD2 4687 5484 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064642.1 protein_id gnl|my_center|LOCUS_09960 5723 7258 gene locus_tag LOCUS_09970 5723 7258 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259464.1 protein_id gnl|my_center|LOCUS_09970 7272 8327 gene locus_tag LOCUS_09980 7272 8327 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259465.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence092 1907 198 gene locus_tag LOCUS_09990 1907 198 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389949.1 protein_id gnl|my_center|LOCUS_09990 3349 1997 gene locus_tag LOCUS_10000 3349 1997 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9F3B7 protein_id gnl|my_center|LOCUS_10000 3819 3352 gene locus_tag LOCUS_10010 3819 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 5178 4066 gene locus_tag LOCUS_10020 5178 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 6374 5178 gene locus_tag LOCUS_10030 6374 5178 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258587.1 protein_id gnl|my_center|LOCUS_10030 7390 6416 gene locus_tag LOCUS_10040 gene ydjE 7390 6416 CDS product putative sugar kinase YdjE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34768 protein_id gnl|my_center|LOCUS_10040 8401 7397 gene locus_tag LOCUS_10050 8401 7397 CDS product LacI family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582579.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence093 <1 906 gene locus_tag LOCUS_10060 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256869.1:lytic transglycosylase 2148 967 gene locus_tag LOCUS_10070 2148 967 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258551.1 protein_id gnl|my_center|LOCUS_10070 2457 3644 gene locus_tag LOCUS_10080 2457 3644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3656 5575 gene locus_tag LOCUS_10090 3656 5575 CDS product signal transduction histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257267.1 protein_id gnl|my_center|LOCUS_10090 7766 5940 gene locus_tag LOCUS_10100 7766 5940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 8218 7805 gene locus_tag LOCUS_10110 8218 7805 CDS product Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240265.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence094 <1 778 gene locus_tag LOCUS_10120 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118886.1:methyltransferase 768 1907 gene locus_tag LOCUS_10130 768 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1974 3170 gene locus_tag LOCUS_10140 1974 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 3860 3153 gene locus_tag LOCUS_10150 3860 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4871 3888 gene locus_tag LOCUS_10160 4871 3888 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_10160 6160 4946 gene locus_tag LOCUS_10170 6160 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence095 1204 2178 gene locus_tag LOCUS_10180 1204 2178 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_10180 2183 2950 gene locus_tag LOCUS_10190 gene gctB 2183 2950 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_10190 2953 5025 gene locus_tag LOCUS_10200 2953 5025 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_10200 5161 6024 gene locus_tag LOCUS_10210 5161 6024 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258883.1 protein_id gnl|my_center|LOCUS_10210 6038 7084 gene locus_tag LOCUS_10220 6038 7084 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258884.1 protein_id gnl|my_center|LOCUS_10220 7081 8157 gene locus_tag LOCUS_10230 7081 8157 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258885.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence096 >Feature sequence097 592 497 gene locus_tag LOCUS_t00090 592 497 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 821 1012 gene locus_tag LOCUS_10240 821 1012 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390530.1 protein_id gnl|my_center|LOCUS_10240 1480 2817 gene locus_tag LOCUS_10250 1480 2817 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIX8 protein_id gnl|my_center|LOCUS_10250 3219 4478 gene locus_tag LOCUS_10260 3219 4478 CDS product aminoacetone oxidase family FAD-binding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_10260 4561 4764 gene locus_tag LOCUS_10270 4561 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 5038 5925 gene locus_tag LOCUS_10280 5038 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 5922 6149 gene locus_tag LOCUS_10290 5922 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 6226 6873 gene locus_tag LOCUS_10300 6226 6873 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_10300 6866 8134 gene locus_tag LOCUS_10310 6866 8134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence098 1 1845 gene locus_tag LOCUS_10320 1 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1842 4130 gene locus_tag LOCUS_10330 1842 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 5856 4207 gene locus_tag LOCUS_10340 5856 4207 CDS product cholesterol oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893009.1 protein_id gnl|my_center|LOCUS_10340 6349 5924 gene locus_tag LOCUS_10350 6349 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7575 6370 gene locus_tag LOCUS_10360 7575 6370 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257413.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence099 1619 24 gene locus_tag LOCUS_10370 1619 24 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_10370 2811 1807 gene locus_tag LOCUS_10380 2811 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 3399 2815 gene locus_tag LOCUS_10390 gene pdxT 3399 2815 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFU0 protein_id gnl|my_center|LOCUS_10390 4480 3593 gene locus_tag LOCUS_10400 gene pdxS 4480 3593 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ0 protein_id gnl|my_center|LOCUS_10400 5066 4776 gene locus_tag LOCUS_10410 5066 4776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5736 5182 gene locus_tag LOCUS_10420 5736 5182 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJ09 protein_id gnl|my_center|LOCUS_10420 5945 5751 gene locus_tag LOCUS_10430 5945 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 <8271 6014 gene locus_tag LOCUS_10440 <8271 6014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259578.1:ATPase P >Feature sequence100 <1 649 gene locus_tag LOCUS_10450 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCU7:phosphate import ATP-binding protein PstB 667 1371 gene locus_tag LOCUS_10460 gene phoU 667 1371 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YH75 protein_id gnl|my_center|LOCUS_10460 1328 1783 gene locus_tag LOCUS_10470 1328 1783 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_10470 1906 2382 gene locus_tag LOCUS_10480 1906 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2386 3459 gene locus_tag LOCUS_10490 2386 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_10490 3464 4507 gene locus_tag LOCUS_10500 3464 4507 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811665.1 protein_id gnl|my_center|LOCUS_10500 4587 5588 gene locus_tag LOCUS_10510 4587 5588 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_10510 5588 6943 gene locus_tag LOCUS_10520 5588 6943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence101 2112 403 gene locus_tag LOCUS_10530 2112 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 2355 4034 gene locus_tag LOCUS_10540 gene glnS 2355 4034 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727A5 protein_id gnl|my_center|LOCUS_10540 4093 5424 gene locus_tag LOCUS_10550 4093 5424 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000717669.1 protein_id gnl|my_center|LOCUS_10550 5484 6584 gene locus_tag LOCUS_10560 gene wecB 5484 6584 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FM43 protein_id gnl|my_center|LOCUS_10560 6600 7037 gene locus_tag LOCUS_10570 gene cysE 6600 7037 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001103738.1 protein_id gnl|my_center|LOCUS_10570 7079 8068 gene locus_tag LOCUS_10580 7079 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence102 571 1416 gene locus_tag LOCUS_10590 571 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875685.1 protein_id gnl|my_center|LOCUS_10590 1419 2762 gene locus_tag LOCUS_10600 1419 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888807.1 protein_id gnl|my_center|LOCUS_10600 2820 5411 gene locus_tag LOCUS_10610 gene priA 2820 5411 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCQ7 protein_id gnl|my_center|LOCUS_10610 5515 6021 gene locus_tag LOCUS_10620 5515 6021 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_10620 6870 6022 gene locus_tag LOCUS_10630 6870 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence103 131 2188 gene locus_tag LOCUS_10640 131 2188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 2266 3225 gene locus_tag LOCUS_10650 2266 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3321 4172 gene locus_tag LOCUS_10660 3321 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 4241 5677 gene locus_tag LOCUS_10670 4241 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 5770 6822 gene locus_tag LOCUS_10680 5770 6822 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_10680 6891 7889 gene locus_tag LOCUS_10690 6891 7889 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731485.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence104 558 322 gene locus_tag LOCUS_10700 558 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1205 558 gene locus_tag LOCUS_10710 1205 558 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_10710 1558 1244 gene locus_tag LOCUS_10720 1558 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2345 1932 gene locus_tag LOCUS_10730 2345 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3605 2628 gene locus_tag LOCUS_10740 3605 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 4448 3615 gene locus_tag LOCUS_10750 4448 3615 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH02 protein_id gnl|my_center|LOCUS_10750 5277 4576 gene locus_tag LOCUS_10760 5277 4576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 6806 5520 gene locus_tag LOCUS_10770 gene purA 6806 5520 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG43 protein_id gnl|my_center|LOCUS_10770 7052 8065 gene locus_tag LOCUS_10780 7052 8065 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403161.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence105 1251 208 gene locus_tag LOCUS_10790 1251 208 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_10790 1283 3436 gene locus_tag LOCUS_10800 1283 3436 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9P7 protein_id gnl|my_center|LOCUS_10800 3498 3884 gene locus_tag LOCUS_10810 3498 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10810 3998 4666 gene locus_tag LOCUS_10820 3998 4666 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_10820 4680 5306 gene locus_tag LOCUS_10830 4680 5306 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_10830 5496 6812 gene locus_tag LOCUS_10840 5496 6812 CDS product UDP-N-acetyl-D-glucosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_10840 7037 8020 gene locus_tag LOCUS_10850 7037 8020 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence106 369 788 gene locus_tag LOCUS_10860 369 788 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974790.1 protein_id gnl|my_center|LOCUS_10860 845 1795 gene locus_tag LOCUS_10870 845 1795 CDS product cobalamin biosynthesis protein CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259515.1 protein_id gnl|my_center|LOCUS_10870 1798 2592 gene locus_tag LOCUS_10880 1798 2592 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259516.1 protein_id gnl|my_center|LOCUS_10880 2592 3347 gene locus_tag LOCUS_10890 2592 3347 CDS product cobalt ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259517.1 protein_id gnl|my_center|LOCUS_10890 3431 4354 gene locus_tag LOCUS_10900 3431 4354 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257862.1 protein_id gnl|my_center|LOCUS_10900 4401 5252 gene locus_tag LOCUS_10910 4401 5252 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_10910 5245 6081 gene locus_tag LOCUS_10920 5245 6081 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_10920 7307 6165 gene locus_tag LOCUS_10930 gene pgsA 7307 6165 CDS product poly-gamma-glutamate biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223416.1 protein_id gnl|my_center|LOCUS_10930 <8011 7345 gene locus_tag LOCUS_10940 <8011 7345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120810.1:epoxyqueuosine reductase >Feature sequence107 1977 76 gene locus_tag LOCUS_10950 1977 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2430 2257 gene locus_tag LOCUS_10960 2430 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 3037 2486 gene locus_tag LOCUS_10970 3037 2486 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965770.1 protein_id gnl|my_center|LOCUS_10970 4723 3197 gene locus_tag LOCUS_10980 4723 3197 CDS product lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808649.1 protein_id gnl|my_center|LOCUS_10980 5687 4791 gene locus_tag LOCUS_10990 5687 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6010 5789 gene locus_tag LOCUS_11000 6010 5789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 7647 6076 gene locus_tag LOCUS_11010 7647 6076 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence108 2715 1048 gene locus_tag LOCUS_11020 gene ilvD 2715 1048 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51785 protein_id gnl|my_center|LOCUS_11020 4297 3059 gene locus_tag LOCUS_11030 4297 3059 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257342.1 protein_id gnl|my_center|LOCUS_11030 4742 4491 gene locus_tag LOCUS_11040 4742 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 5879 4812 gene locus_tag LOCUS_11050 5879 4812 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256131.1 protein_id gnl|my_center|LOCUS_11050 6136 7812 gene locus_tag LOCUS_11060 6136 7812 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence109 270 1334 gene locus_tag LOCUS_11070 270 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1376 2455 gene locus_tag LOCUS_11080 1376 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2633 2845 gene locus_tag LOCUS_11090 gene cspLB 2633 2845 CDS product cold shock-like protein CspLB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A357 protein_id gnl|my_center|LOCUS_11090 3439 3071 gene locus_tag LOCUS_11100 3439 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 5430 3442 gene locus_tag LOCUS_11110 5430 3442 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_11110 5719 6087 gene locus_tag LOCUS_11120 5719 6087 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255926.1 protein_id gnl|my_center|LOCUS_11120 6146 6388 gene locus_tag LOCUS_11130 6146 6388 CDS product redox-active disulfide protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393126.1 protein_id gnl|my_center|LOCUS_11130 6398 7867 gene locus_tag LOCUS_11140 6398 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence110 438 1211 gene locus_tag LOCUS_11150 438 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1234 3102 gene locus_tag LOCUS_11160 1234 3102 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887222.1 protein_id gnl|my_center|LOCUS_11160 3099 3749 gene locus_tag LOCUS_11170 3099 3749 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_11170 4206 4652 gene locus_tag LOCUS_11180 4206 4652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 4726 5736 gene locus_tag LOCUS_11190 gene coxB1 4726 5736 CDS product cytochrome c oxidase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0S5 protein_id gnl|my_center|LOCUS_11190 5824 7695 gene locus_tag LOCUS_11200 gene ctaD 5824 7695 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_11200 >Feature sequence111 334 98 gene locus_tag LOCUS_11210 334 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 576 3476 gene locus_tag LOCUS_11220 576 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 3837 4928 gene locus_tag LOCUS_11230 3837 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_11230 4925 5257 gene locus_tag LOCUS_11240 4925 5257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5283 5588 gene locus_tag LOCUS_11250 5283 5588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 6216 5989 gene locus_tag LOCUS_11260 6216 5989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 6581 6324 gene locus_tag LOCUS_11270 6581 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 6465 7031 gene locus_tag LOCUS_11280 6465 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11280 6995 7753 gene locus_tag LOCUS_11290 6995 7753 CDS product protein NirV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261708.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence112 1344 919 gene locus_tag LOCUS_11300 1344 919 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876084.1 protein_id gnl|my_center|LOCUS_11300 3978 1489 gene locus_tag LOCUS_11310 3978 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 5039 4014 gene locus_tag LOCUS_11320 gene queA 5039 4014 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHU2 protein_id gnl|my_center|LOCUS_11320 6064 5036 gene locus_tag LOCUS_11330 gene ruvB 6064 5036 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHF8 protein_id gnl|my_center|LOCUS_11330 6325 6951 gene locus_tag LOCUS_11340 gene upp 6325 6951 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAW8 protein_id gnl|my_center|LOCUS_11340 7718 6954 gene locus_tag LOCUS_11350 7718 6954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence113 2125 1646 gene locus_tag LOCUS_11360 2125 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2731 2156 gene locus_tag LOCUS_11370 2731 2156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 3277 2771 gene locus_tag LOCUS_11380 3277 2771 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228652.1 protein_id gnl|my_center|LOCUS_11380 5402 3348 gene locus_tag LOCUS_11390 gene ccmF 5402 3348 CDS product cytochrome c-type biogenesis protein CcmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45037 protein_id gnl|my_center|LOCUS_11390 6014 5499 gene locus_tag LOCUS_11400 6014 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 6419 7666 gene locus_tag LOCUS_11410 6419 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence114 1450 236 gene locus_tag LOCUS_11420 1450 236 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_11420 1708 2421 gene locus_tag LOCUS_11430 1708 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2507 3034 gene locus_tag LOCUS_11440 2507 3034 CDS product ADP-ribose pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_11440 3380 3727 gene locus_tag LOCUS_11450 gene rplS 3380 3727 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD8 protein_id gnl|my_center|LOCUS_11450 3812 4549 gene locus_tag LOCUS_11460 3812 4549 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_11460 4570 5451 gene locus_tag LOCUS_11470 gene murI 4570 5451 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVD0 protein_id gnl|my_center|LOCUS_11470 7168 5414 gene locus_tag LOCUS_11480 7168 5414 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence115 2398 1436 gene locus_tag LOCUS_11490 2398 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3490 2399 gene locus_tag LOCUS_11500 3490 2399 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943647.1 protein_id gnl|my_center|LOCUS_11500 5480 3516 gene locus_tag LOCUS_11510 5480 3516 CDS product dehydrogenase E1 protein subunits alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943646.1 protein_id gnl|my_center|LOCUS_11510 6495 5608 gene locus_tag LOCUS_11520 6495 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 7720 6524 gene locus_tag LOCUS_11530 7720 6524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence116 154 2568 gene locus_tag LOCUS_11540 154 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2575 3318 gene locus_tag LOCUS_11550 2575 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 4012 3335 gene locus_tag LOCUS_11560 4012 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 5151 4084 gene locus_tag LOCUS_11570 5151 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 5592 5167 gene locus_tag LOCUS_11580 5592 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 5760 6248 gene locus_tag LOCUS_11590 5760 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence117 2483 1998 gene locus_tag LOCUS_11600 2483 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 3586 2669 gene locus_tag LOCUS_11610 3586 2669 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114566.1 protein_id gnl|my_center|LOCUS_11610 3808 4269 gene locus_tag LOCUS_11620 3808 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 4266 5687 gene locus_tag LOCUS_11630 4266 5687 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337346.1 protein_id gnl|my_center|LOCUS_11630 6102 5743 gene locus_tag LOCUS_11640 6102 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_11640 6263 6742 gene locus_tag LOCUS_11650 6263 6742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6755 7222 gene locus_tag LOCUS_11660 6755 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120329.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence118 1764 691 gene locus_tag LOCUS_11670 1764 691 CDS product D-aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727711.1 protein_id gnl|my_center|LOCUS_11670 2836 1793 gene locus_tag LOCUS_11680 2836 1793 CDS product oligopeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_11680 3924 2947 gene locus_tag LOCUS_11690 3924 2947 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_11690 4862 3921 gene locus_tag LOCUS_11700 4862 3921 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226494.1 protein_id gnl|my_center|LOCUS_11700 5966 4953 gene locus_tag LOCUS_11710 5966 4953 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226493.1 protein_id gnl|my_center|LOCUS_11710 7648 6020 gene locus_tag LOCUS_11720 7648 6020 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226492.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence119 1154 21 gene locus_tag LOCUS_11730 gene phnW 1154 21 CDS product 2-aminoethylphosphonate--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87JL4 protein_id gnl|my_center|LOCUS_11730 2544 1183 gene locus_tag LOCUS_11740 2544 1183 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533037.1 protein_id gnl|my_center|LOCUS_11740 3378 2647 gene locus_tag LOCUS_11750 3378 2647 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868993.1 protein_id gnl|my_center|LOCUS_11750 4088 6826 gene locus_tag LOCUS_11760 4088 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 6837 7490 gene locus_tag LOCUS_11770 6837 7490 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence120 2184 2420 gene locus_tag LOCUS_11780 gene infA 2184 2420 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH88 protein_id gnl|my_center|LOCUS_11780 2448 3689 gene locus_tag LOCUS_11790 gene sigA 2448 3689 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGV1 protein_id gnl|my_center|LOCUS_11790 3848 4777 gene locus_tag LOCUS_11800 3848 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 4816 5715 gene locus_tag LOCUS_11810 4816 5715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 5789 6232 gene locus_tag LOCUS_11820 5789 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence121 770 6724 gene locus_tag LOCUS_11830 770 6724 CDS product peptidase inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015947.1 protein_id gnl|my_center|LOCUS_11830 7674 6787 gene locus_tag LOCUS_11840 7674 6787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence122 1051 221 gene locus_tag LOCUS_11850 1051 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_11850 1902 1225 gene locus_tag LOCUS_11860 1902 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 2478 2026 gene locus_tag LOCUS_11870 2478 2026 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259680.1 protein_id gnl|my_center|LOCUS_11870 2908 2480 gene locus_tag LOCUS_11880 2908 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3623 3012 gene locus_tag LOCUS_11890 3623 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 4473 3703 gene locus_tag LOCUS_11900 gene coaX 4473 3703 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM55 protein_id gnl|my_center|LOCUS_11900 5703 4870 gene locus_tag LOCUS_11910 gene panC 5703 4870 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFR6 protein_id gnl|my_center|LOCUS_11910 6678 5725 gene locus_tag LOCUS_11920 6678 5725 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WF76 protein_id gnl|my_center|LOCUS_11920 7553 6675 gene locus_tag LOCUS_11930 gene panB 7553 6675 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM79 protein_id gnl|my_center|LOCUS_11930 >Feature sequence123 1989 685 gene locus_tag LOCUS_11940 gene gltA 1989 685 CDS product type I citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_11940 2989 2063 gene locus_tag LOCUS_11950 gene mdh 2989 2063 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80040 protein_id gnl|my_center|LOCUS_11950 4116 3184 gene locus_tag LOCUS_11960 4116 3184 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEL6 protein_id gnl|my_center|LOCUS_11960 6795 4603 gene locus_tag LOCUS_11970 gene pnp 6795 4603 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEJ7 protein_id gnl|my_center|LOCUS_11970 7446 7174 gene locus_tag LOCUS_11980 gene rpsO 7446 7174 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8G448 protein_id gnl|my_center|LOCUS_11980 >Feature sequence124 1023 1454 gene locus_tag LOCUS_11990 1023 1454 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHZ7 protein_id gnl|my_center|LOCUS_11990 1451 2545 gene locus_tag LOCUS_12000 1451 2545 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_12000 2565 3386 gene locus_tag LOCUS_12010 2565 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 4867 3470 gene locus_tag LOCUS_12020 4867 3470 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259398.1 protein_id gnl|my_center|LOCUS_12020 7415 4926 gene locus_tag LOCUS_12030 gene lon 7415 4926 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBD3 protein_id gnl|my_center|LOCUS_12030 >Feature sequence125 <1 2970 gene locus_tag LOCUS_12040 <1 2970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021295.1:sensor histidine kinase 2967 3620 gene locus_tag LOCUS_12050 2967 3620 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_12050 4023 4424 gene locus_tag LOCUS_12060 4023 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 4593 7391 gene locus_tag LOCUS_12070 4593 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence126 858 139 gene locus_tag LOCUS_12080 gene pyrH 858 139 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP1 protein_id gnl|my_center|LOCUS_12080 1543 941 gene locus_tag LOCUS_12090 gene tsf 1543 941 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP2 protein_id gnl|my_center|LOCUS_12090 2458 1547 gene locus_tag LOCUS_12100 gene rpsB 2458 1547 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP3 protein_id gnl|my_center|LOCUS_12100 4540 2723 gene locus_tag LOCUS_12110 gene thrS 4540 2723 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJX4 protein_id gnl|my_center|LOCUS_12110 5380 6567 gene locus_tag LOCUS_12120 5380 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 7465 6578 gene locus_tag LOCUS_12130 7465 6578 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256476.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence127 1099 416 gene locus_tag LOCUS_12140 gene minC 1099 416 CDS product putative septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAN9 protein_id gnl|my_center|LOCUS_12140 3243 1153 gene locus_tag LOCUS_12150 gene mrdA 3243 1153 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_12150 3743 3240 gene locus_tag LOCUS_12160 3743 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4623 3772 gene locus_tag LOCUS_12170 4623 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 5696 4635 gene locus_tag LOCUS_12180 5696 4635 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256026.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence128 1517 3271 gene locus_tag LOCUS_12190 1517 3271 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259648.1 protein_id gnl|my_center|LOCUS_12190 3368 4315 gene locus_tag LOCUS_12200 3368 4315 CDS product protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259647.1 protein_id gnl|my_center|LOCUS_12200 4424 5908 gene locus_tag LOCUS_12210 4424 5908 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259646.1 protein_id gnl|my_center|LOCUS_12210 5905 6423 gene locus_tag LOCUS_12220 5905 6423 CDS product forkhead-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259645.1 protein_id gnl|my_center|LOCUS_12220 6428 6670 gene locus_tag LOCUS_12230 6428 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6673 7401 gene locus_tag LOCUS_12240 6673 7401 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence129 1179 73 gene locus_tag LOCUS_12250 1179 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2072 1176 gene locus_tag LOCUS_12260 2072 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 3587 2379 gene locus_tag LOCUS_12270 3587 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 3808 5901 gene locus_tag LOCUS_12280 3808 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 6006 6536 gene locus_tag LOCUS_12290 6006 6536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 7279 6647 gene locus_tag LOCUS_12300 7279 6647 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888197.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence130 702 406 gene locus_tag LOCUS_12310 702 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1484 726 gene locus_tag LOCUS_12320 1484 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 2237 1491 gene locus_tag LOCUS_12330 2237 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4380 2311 gene locus_tag LOCUS_12340 4380 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4493 4927 gene locus_tag LOCUS_12350 4493 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 5346 4981 gene locus_tag LOCUS_12360 5346 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 <7432 5500 gene locus_tag LOCUS_12370 <7432 5500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932548.1:heterodisulfide reductase subunit A >Feature sequence131 2613 469 gene locus_tag LOCUS_12380 2613 469 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG52 protein_id gnl|my_center|LOCUS_12380 2900 3676 gene locus_tag LOCUS_12390 gene lutA 2900 3676 CDS product lactate utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07020 protein_id gnl|my_center|LOCUS_12390 3820 5913 gene locus_tag LOCUS_12400 3820 5913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 6625 5903 gene locus_tag LOCUS_12410 6625 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 7383 6940 gene locus_tag LOCUS_12420 7383 6940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence132 2 2626 gene locus_tag LOCUS_12430 2 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2623 3645 gene locus_tag LOCUS_12440 2623 3645 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_12440 3642 4403 gene locus_tag LOCUS_12450 3642 4403 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021607.1 protein_id gnl|my_center|LOCUS_12450 4744 5172 gene locus_tag LOCUS_12460 4744 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 5659 5811 gene locus_tag LOCUS_12470 5659 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 6400 6684 gene locus_tag LOCUS_12480 6400 6684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 6681 6959 gene locus_tag LOCUS_12490 6681 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810370.1 protein_id gnl|my_center|LOCUS_12490 7059 7277 gene locus_tag LOCUS_12500 7059 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence133 <1 1130 gene locus_tag LOCUS_12510 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870985.1:threonine synthase 1139 2089 gene locus_tag LOCUS_12520 1139 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3222 2437 gene locus_tag LOCUS_12530 3222 2437 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142663.1 protein_id gnl|my_center|LOCUS_12530 3831 4748 gene locus_tag LOCUS_12540 3831 4748 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_12540 4830 5924 gene locus_tag LOCUS_12550 gene ald 4830 5924 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQB1 protein_id gnl|my_center|LOCUS_12550 5929 7224 gene locus_tag LOCUS_12560 5929 7224 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence134 2492 810 gene locus_tag LOCUS_12570 2492 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 <7364 2501 gene locus_tag LOCUS_12580 <7364 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258505.1:histidine kinase >Feature sequence135 916 1134 gene locus_tag LOCUS_12590 916 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1561 1172 gene locus_tag LOCUS_12600 1561 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1934 1647 gene locus_tag LOCUS_12610 1934 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 2450 2106 gene locus_tag LOCUS_12620 2450 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3097 2468 gene locus_tag LOCUS_12630 3097 2468 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259317.1 protein_id gnl|my_center|LOCUS_12630 3279 4052 gene locus_tag LOCUS_12640 3279 4052 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_12640 4124 5530 gene locus_tag LOCUS_12650 4124 5530 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_12650 5677 6960 gene locus_tag LOCUS_12660 5677 6960 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122564.1 protein_id gnl|my_center|LOCUS_12660 7022 7303 gene locus_tag LOCUS_12670 7022 7303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence136 2 1087 gene locus_tag LOCUS_12680 2 1087 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_12680 1142 2554 gene locus_tag LOCUS_12690 1142 2554 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945170.1 protein_id gnl|my_center|LOCUS_12690 2663 2935 gene locus_tag LOCUS_12700 2663 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2922 4280 gene locus_tag LOCUS_12710 2922 4280 CDS product oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030798.1 protein_id gnl|my_center|LOCUS_12710 4277 5458 gene locus_tag LOCUS_12720 4277 5458 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030796.1 protein_id gnl|my_center|LOCUS_12720 5652 6527 gene locus_tag LOCUS_12730 5652 6527 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_12730 6558 7187 gene locus_tag LOCUS_12740 6558 7187 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229311.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence137 <1 2727 gene locus_tag LOCUS_12750 <1 2727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258505.1:histidine kinase 2741 3130 gene locus_tag LOCUS_12760 2741 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3140 3928 gene locus_tag LOCUS_12770 3140 3928 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258506.1 protein_id gnl|my_center|LOCUS_12770 3951 4745 gene locus_tag LOCUS_12780 gene thyA 3951 4745 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5F732 protein_id gnl|my_center|LOCUS_12780 4745 5242 gene locus_tag LOCUS_12790 gene folA 4745 5242 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0KNL5 protein_id gnl|my_center|LOCUS_12790 6206 5295 gene locus_tag LOCUS_12800 gene menA 6206 5295 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBE2 protein_id gnl|my_center|LOCUS_12800 7139 6270 gene locus_tag LOCUS_12810 7139 6270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence138 5203 1553 gene locus_tag LOCUS_12820 5203 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 6399 5218 gene locus_tag LOCUS_12830 6399 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12830 >Feature sequence139 <1 2214 gene locus_tag LOCUS_12840 <1 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940820.1:histidine kinase 6387 2266 gene locus_tag LOCUS_12850 6387 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence140 1441 248 gene locus_tag LOCUS_12860 1441 248 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_12860 3567 1468 gene locus_tag LOCUS_12870 3567 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 4397 3756 gene locus_tag LOCUS_12880 4397 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 5025 4402 gene locus_tag LOCUS_12890 5025 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 <7219 5085 gene locus_tag LOCUS_12900 <7219 5085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775498.1:ATP-binding protein >Feature sequence141 4871 2130 gene locus_tag LOCUS_12910 gene citB 4871 2130 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD2 protein_id gnl|my_center|LOCUS_12910 5979 5068 gene locus_tag LOCUS_12920 5979 5068 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81J75 protein_id gnl|my_center|LOCUS_12920 6405 5983 gene locus_tag LOCUS_12930 6405 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 6988 6458 gene locus_tag LOCUS_12940 6988 6458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence142 <1 1000 gene locus_tag LOCUS_12950 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017112.1:citrate lyase subunit beta 1089 2645 gene locus_tag LOCUS_12960 1089 2645 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_12960 2739 3929 gene locus_tag LOCUS_12970 2739 3929 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104435.1 protein_id gnl|my_center|LOCUS_12970 4051 4599 gene locus_tag LOCUS_12980 4051 4599 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_12980 4680 5933 gene locus_tag LOCUS_12990 gene leuC 4680 5933 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F6 protein_id gnl|my_center|LOCUS_12990 6062 6568 gene locus_tag LOCUS_13000 gene leuD 6062 6568 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6F7 protein_id gnl|my_center|LOCUS_13000 >Feature sequence143 145 1470 gene locus_tag LOCUS_13010 145 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 1474 2334 gene locus_tag LOCUS_13020 1474 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 2702 2382 gene locus_tag LOCUS_13030 2702 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809368.1 protein_id gnl|my_center|LOCUS_13030 3088 3016 gene locus_tag LOCUS_t00100 3088 3016 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4123 3107 gene locus_tag LOCUS_13040 4123 3107 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_13040 5367 4120 gene locus_tag LOCUS_13050 gene coaBC 5367 4120 CDS product putative coenzyme A biosynthesis bifunctional protein CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O35033 protein_id gnl|my_center|LOCUS_13050 5484 6203 gene locus_tag LOCUS_13060 5484 6203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7086 6130 gene locus_tag LOCUS_13070 gene uspA 7086 6130 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123122.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence144 711 76 gene locus_tag LOCUS_13080 711 76 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_13080 1865 762 gene locus_tag LOCUS_13090 gene menC 1865 762 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGZ9 protein_id gnl|my_center|LOCUS_13090 2812 1946 gene locus_tag LOCUS_13100 2812 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257044.1 protein_id gnl|my_center|LOCUS_13100 3752 2814 gene locus_tag LOCUS_13110 3752 2814 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_13110 3962 5209 gene locus_tag LOCUS_13120 3962 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5229 6398 gene locus_tag LOCUS_13130 gene ftsZ 5229 6398 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4W6 protein_id gnl|my_center|LOCUS_13130 6401 6637 gene locus_tag LOCUS_13140 6401 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 6655 6858 gene locus_tag LOCUS_13150 6655 6858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence145 1203 2063 gene locus_tag LOCUS_13160 1203 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2833 2147 gene locus_tag LOCUS_13170 gene plsY 2833 2147 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2T9 protein_id gnl|my_center|LOCUS_13170 3253 3077 gene locus_tag LOCUS_13180 3253 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3933 3181 gene locus_tag LOCUS_13190 3933 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4096 5304 gene locus_tag LOCUS_13200 4096 5304 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583970.1 protein_id gnl|my_center|LOCUS_13200 5297 5650 gene locus_tag LOCUS_13210 5297 5650 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF9 protein_id gnl|my_center|LOCUS_13210 5659 6606 gene locus_tag LOCUS_13220 gene miaA 5659 6606 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDJ6 protein_id gnl|my_center|LOCUS_13220 >Feature sequence146 2274 427 gene locus_tag LOCUS_13230 2274 427 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_13230 3254 2526 gene locus_tag LOCUS_13240 3254 2526 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_13240 4560 3442 gene locus_tag LOCUS_13250 4560 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_13250 4974 4681 gene locus_tag LOCUS_13260 4974 4681 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946556.1 protein_id gnl|my_center|LOCUS_13260 6022 5096 gene locus_tag LOCUS_13270 6022 5096 CDS product transketolase, C-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228761.1 protein_id gnl|my_center|LOCUS_13270 6967 6146 gene locus_tag LOCUS_13280 6967 6146 CDS product transketolase, N-terminal subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_228762.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence147 962 312 gene locus_tag LOCUS_13290 962 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1501 1091 gene locus_tag LOCUS_13300 1501 1091 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582651.1 protein_id gnl|my_center|LOCUS_13300 2546 1875 gene locus_tag LOCUS_13310 2546 1875 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_13310 3619 2543 gene locus_tag LOCUS_13320 3619 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5581 3677 gene locus_tag LOCUS_13330 5581 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 7002 5653 gene locus_tag LOCUS_13340 7002 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence148 1778 90 gene locus_tag LOCUS_13350 1778 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1923 4022 gene locus_tag LOCUS_13360 1923 4022 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_13360 4374 4640 gene locus_tag LOCUS_13370 gene rpsT 4374 4640 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZS83 protein_id gnl|my_center|LOCUS_13370 5132 6934 gene locus_tag LOCUS_13380 gene argS 5132 6934 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q189Q7 protein_id gnl|my_center|LOCUS_13380 >Feature sequence149 1551 922 gene locus_tag LOCUS_13390 gene recX 1551 922 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ77 protein_id gnl|my_center|LOCUS_13390 3031 2042 gene locus_tag LOCUS_13400 gene recA 3031 2042 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4H9 protein_id gnl|my_center|LOCUS_13400 3370 4269 gene locus_tag LOCUS_13410 3370 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 4504 4223 gene locus_tag LOCUS_13420 4504 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5443 4784 gene locus_tag LOCUS_13430 5443 4784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence150 <1 1044 gene locus_tag LOCUS_13440 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NMM6:cytochrome c oxidase subunit 2 2328 1429 gene locus_tag LOCUS_13450 gene speB 2328 1429 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187785.1 protein_id gnl|my_center|LOCUS_13450 3704 2349 gene locus_tag LOCUS_13460 3704 2349 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113030.1 protein_id gnl|my_center|LOCUS_13460 5352 4213 gene locus_tag LOCUS_13470 5352 4213 CDS product periplasmic spermidine/putrescine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141359.1 protein_id gnl|my_center|LOCUS_13470 6393 5512 gene locus_tag LOCUS_13480 6393 5512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141402.1 protein_id gnl|my_center|LOCUS_13480 <7028 6390 gene locus_tag LOCUS_13490 <7028 6390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141403.1:ABC transporter permease >Feature sequence151 1004 141 gene locus_tag LOCUS_13500 1004 141 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949071.1 protein_id gnl|my_center|LOCUS_13500 2788 1127 gene locus_tag LOCUS_13510 2788 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2860 4146 gene locus_tag LOCUS_13520 2860 4146 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_13520 4282 4686 gene locus_tag LOCUS_13530 4282 4686 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_13530 4698 5102 gene locus_tag LOCUS_13540 4698 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 <6991 5443 gene locus_tag LOCUS_13550 <6991 5443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CP17:chaperone protein DnaK >Feature sequence152 4201 3725 gene locus_tag LOCUS_13560 4201 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5751 4195 gene locus_tag LOCUS_13570 5751 4195 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727568.1 protein_id gnl|my_center|LOCUS_13570 6900 6205 gene locus_tag LOCUS_13580 6900 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_13580 >Feature sequence153 1939 1091 gene locus_tag LOCUS_13590 1939 1091 CDS product fatty acid-binding protein DegV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_13590 2053 3594 gene locus_tag LOCUS_13600 2053 3594 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZYJ6 protein_id gnl|my_center|LOCUS_13600 3606 3749 gene locus_tag LOCUS_13610 3606 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 3907 5070 gene locus_tag LOCUS_13620 3907 5070 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459735.1 protein_id gnl|my_center|LOCUS_13620 6363 5110 gene locus_tag LOCUS_13630 6363 5110 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776141.1 protein_id gnl|my_center|LOCUS_13630 <6938 6366 gene locus_tag LOCUS_13640 <6938 6366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256434.1:ABC transporter permease >Feature sequence154 3137 756 gene locus_tag LOCUS_13650 3137 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3241 3711 gene locus_tag LOCUS_13660 3241 3711 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence155 145 867 gene locus_tag LOCUS_13670 145 867 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG3 protein_id gnl|my_center|LOCUS_13670 874 1707 gene locus_tag LOCUS_13680 874 1707 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG4 protein_id gnl|my_center|LOCUS_13680 1745 2731 gene locus_tag LOCUS_13690 1745 2731 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5F4 protein_id gnl|my_center|LOCUS_13690 3107 4318 gene locus_tag LOCUS_13700 gene metK 3107 4318 CDS product S-adenosylmethionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ3 protein_id gnl|my_center|LOCUS_13700 4701 4375 gene locus_tag LOCUS_13710 4701 4375 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MMM4 protein_id gnl|my_center|LOCUS_13710 4811 4883 gene locus_tag LOCUS_t00110 4811 4883 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5009 5470 gene locus_tag LOCUS_13720 5009 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 5743 5964 gene locus_tag LOCUS_13730 5743 5964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 6033 6290 gene locus_tag LOCUS_13740 6033 6290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 6386 6649 gene locus_tag LOCUS_13750 6386 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence156 596 1894 gene locus_tag LOCUS_13760 gene rbcL 596 1894 CDS product ribulose-bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024428.1 protein_id gnl|my_center|LOCUS_13760 1971 2948 gene locus_tag LOCUS_13770 gene prk 1971 2948 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND12 protein_id gnl|my_center|LOCUS_13770 2977 4971 gene locus_tag LOCUS_13780 2977 4971 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257698.1 protein_id gnl|my_center|LOCUS_13780 4980 5675 gene locus_tag LOCUS_13790 4980 5675 CDS product ribose-5-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250377.1 protein_id gnl|my_center|LOCUS_13790 5675 6346 gene locus_tag LOCUS_13800 gene rpe 5675 6346 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q6HEV5 protein_id gnl|my_center|LOCUS_13800 <6906 6380 gene locus_tag LOCUS_13810 <6906 6380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946887.1:amine oxidase >Feature sequence157 1756 812 gene locus_tag LOCUS_13820 1756 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2087 2812 gene locus_tag LOCUS_13830 2087 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 2947 4674 gene locus_tag LOCUS_13840 2947 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_13840 4687 5928 gene locus_tag LOCUS_13850 4687 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence158 861 118 gene locus_tag LOCUS_13860 861 118 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_13860 1415 858 gene locus_tag LOCUS_13870 1415 858 CDS product ATP--cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404046.1 protein_id gnl|my_center|LOCUS_13870 1664 3727 gene locus_tag LOCUS_13880 gene fusA 1664 3727 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_13880 4409 3879 gene locus_tag LOCUS_13890 4409 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 4659 4985 gene locus_tag LOCUS_13900 4659 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 5000 5752 gene locus_tag LOCUS_13910 5000 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 6634 5927 gene locus_tag LOCUS_13920 6634 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence159 304 230 gene locus_tag LOCUS_t00120 304 230 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 482 1243 gene locus_tag LOCUS_13930 482 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877117.1 protein_id gnl|my_center|LOCUS_13930 1256 2386 gene locus_tag LOCUS_13940 1256 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 3375 2443 gene locus_tag LOCUS_13950 3375 2443 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000002071.1 protein_id gnl|my_center|LOCUS_13950 4215 3463 gene locus_tag LOCUS_13960 4215 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 4830 4342 gene locus_tag LOCUS_13970 4830 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 5365 4841 gene locus_tag LOCUS_13980 5365 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 6651 5374 gene locus_tag LOCUS_13990 6651 5374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence160 362 1366 gene locus_tag LOCUS_14000 362 1366 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_14000 1559 1356 gene locus_tag LOCUS_14010 1559 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1464 3017 gene locus_tag LOCUS_14020 1464 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3987 3046 gene locus_tag LOCUS_14030 3987 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 5373 4048 gene locus_tag LOCUS_14040 5373 4048 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258704.1 protein_id gnl|my_center|LOCUS_14040 5689 6108 gene locus_tag LOCUS_14050 5689 6108 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence161 3374 1314 gene locus_tag LOCUS_14060 3374 1314 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546064.1 protein_id gnl|my_center|LOCUS_14060 3836 4945 gene locus_tag LOCUS_14070 3836 4945 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887230.1 protein_id gnl|my_center|LOCUS_14070 5477 4950 gene locus_tag LOCUS_14080 5477 4950 CDS product UPF0316 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:I3U190 protein_id gnl|my_center|LOCUS_14080 6509 5481 gene locus_tag LOCUS_14090 gene tsaD 6509 5481 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHP1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence162 3931 443 gene locus_tag LOCUS_14100 3931 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 5102 4377 gene locus_tag LOCUS_14110 5102 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14110 6603 5131 gene locus_tag LOCUS_14120 6603 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence163 3250 983 gene locus_tag LOCUS_14130 3250 983 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_14130 3400 4341 gene locus_tag LOCUS_14140 gene rnz 3400 4341 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89NF8 protein_id gnl|my_center|LOCUS_14140 4370 5908 gene locus_tag LOCUS_14150 4370 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 6295 5930 gene locus_tag LOCUS_14160 6295 5930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence164 1990 764 gene locus_tag LOCUS_14170 1990 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016083.1 protein_id gnl|my_center|LOCUS_14170 2214 1987 gene locus_tag LOCUS_14180 2214 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 3840 2377 gene locus_tag LOCUS_14190 3840 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4539 3841 gene locus_tag LOCUS_14200 4539 3841 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_14200 5081 6301 gene locus_tag LOCUS_14210 5081 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence165 1152 274 gene locus_tag LOCUS_14220 1152 274 CDS product tungsten ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_14220 2185 1190 gene locus_tag LOCUS_14230 2185 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3624 2245 gene locus_tag LOCUS_14240 gene tilS 3624 2245 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM96 protein_id gnl|my_center|LOCUS_14240 3856 5010 gene locus_tag LOCUS_14250 3856 5010 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259630.1 protein_id gnl|my_center|LOCUS_14250 5023 5802 gene locus_tag LOCUS_14260 5023 5802 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence166 228 5060 gene locus_tag LOCUS_14270 228 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6646 5225 gene locus_tag LOCUS_14280 6646 5225 CDS product LytR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257636.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence167 2788 647 gene locus_tag LOCUS_14290 2788 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4798 2792 gene locus_tag LOCUS_14300 4798 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5429 4938 gene locus_tag LOCUS_14310 5429 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 6393 5395 gene locus_tag LOCUS_14320 6393 5395 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545648.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence168 493 1155 gene locus_tag LOCUS_14330 493 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 1221 1550 gene locus_tag LOCUS_14340 1221 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064307.1 protein_id gnl|my_center|LOCUS_14340 1572 2576 gene locus_tag LOCUS_14350 1572 2576 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089280.1 protein_id gnl|my_center|LOCUS_14350 2631 3113 gene locus_tag LOCUS_14360 2631 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4383 3139 gene locus_tag LOCUS_14370 4383 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4539 5702 gene locus_tag LOCUS_14380 4539 5702 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH36 protein_id gnl|my_center|LOCUS_14380 >Feature sequence169 292 104 gene locus_tag LOCUS_14390 292 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 341 754 gene locus_tag LOCUS_14400 341 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 751 1764 gene locus_tag LOCUS_14410 751 1764 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948215.1 protein_id gnl|my_center|LOCUS_14410 1754 2479 gene locus_tag LOCUS_14420 1754 2479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931472.1 protein_id gnl|my_center|LOCUS_14420 2472 3173 gene locus_tag LOCUS_14430 2472 3173 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819071.1 protein_id gnl|my_center|LOCUS_14430 3176 4261 gene locus_tag LOCUS_14440 3176 4261 CDS product proline racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q17ZY4 protein_id gnl|my_center|LOCUS_14440 4258 5712 gene locus_tag LOCUS_14450 4258 5712 CDS product trimethylamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530987.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence170 650 24 gene locus_tag LOCUS_14460 650 24 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095879.1 protein_id gnl|my_center|LOCUS_14460 2061 787 gene locus_tag LOCUS_14470 2061 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_14470 2773 2084 gene locus_tag LOCUS_14480 gene macB 2773 2084 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF1 protein_id gnl|my_center|LOCUS_14480 4356 2788 gene locus_tag LOCUS_14490 4356 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 6051 4408 gene locus_tag LOCUS_14500 6051 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 6491 6039 gene locus_tag LOCUS_14510 6491 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence171 <1 3246 gene locus_tag LOCUS_14520 <1 3246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256431.1:histidine kinase >Feature sequence172 1032 346 gene locus_tag LOCUS_14530 1032 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2096 1113 gene locus_tag LOCUS_14540 2096 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2346 2960 gene locus_tag LOCUS_14550 2346 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256340.1 protein_id gnl|my_center|LOCUS_14550 3047 4741 gene locus_tag LOCUS_14560 3047 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258660.1 protein_id gnl|my_center|LOCUS_14560 5009 5497 gene locus_tag LOCUS_14570 5009 5497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 5499 5756 gene locus_tag LOCUS_14580 5499 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 5768 6049 gene locus_tag LOCUS_14590 5768 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence173 3730 2912 gene locus_tag LOCUS_14600 gene gctB 3730 2912 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_14600 4506 3736 gene locus_tag LOCUS_14610 gene glpQ 4506 3736 CDS product glycerophosphoryl diester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_14610 5858 4518 gene locus_tag LOCUS_14620 5858 4518 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258274.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence174 239 1951 gene locus_tag LOCUS_14630 239 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3363 1990 gene locus_tag LOCUS_14640 3363 1990 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_14640 4642 3431 gene locus_tag LOCUS_14650 4642 3431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103770.1 protein_id gnl|my_center|LOCUS_14650 5912 4677 gene locus_tag LOCUS_14660 5912 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence175 1829 612 gene locus_tag LOCUS_14670 1829 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3252 1912 gene locus_tag LOCUS_14680 gene miaB 3252 1912 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHB1 protein_id gnl|my_center|LOCUS_14680 3627 5306 gene locus_tag LOCUS_14690 3627 5306 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_14690 5397 6002 gene locus_tag LOCUS_14700 5397 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence176 272 1141 gene locus_tag LOCUS_14710 gene nadK 272 1141 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIJ8 protein_id gnl|my_center|LOCUS_14710 1138 1674 gene locus_tag LOCUS_14720 1138 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1735 3459 gene locus_tag LOCUS_14730 1735 3459 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEU1 protein_id gnl|my_center|LOCUS_14730 3557 6439 gene locus_tag LOCUS_14740 3557 6439 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence177 112 474 gene locus_tag LOCUS_14750 112 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 521 700 gene locus_tag LOCUS_14760 521 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 722 2761 gene locus_tag LOCUS_14770 722 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2788 3960 gene locus_tag LOCUS_14780 2788 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 3957 4937 gene locus_tag LOCUS_14790 3957 4937 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020843.1 protein_id gnl|my_center|LOCUS_14790 4970 5611 gene locus_tag LOCUS_14800 4970 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14800 5598 6293 gene locus_tag LOCUS_14810 5598 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14810 >Feature sequence178 375 3413 gene locus_tag LOCUS_14820 gene glyQS 375 3413 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0CE22 protein_id gnl|my_center|LOCUS_14820 3763 5682 gene locus_tag LOCUS_14830 gene dnaG 3763 5682 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFC9 protein_id gnl|my_center|LOCUS_14830 >Feature sequence179 1613 924 gene locus_tag LOCUS_14840 1613 924 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_14840 2250 1804 gene locus_tag LOCUS_14850 2250 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2507 2358 gene locus_tag LOCUS_14860 2507 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2894 2685 gene locus_tag LOCUS_14870 gene cspA 2894 2685 CDS product cold shock protein CspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CP90 protein_id gnl|my_center|LOCUS_14870 3254 3670 gene locus_tag LOCUS_14880 3254 3670 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_14880 3672 4697 gene locus_tag LOCUS_14890 3672 4697 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_14890 4694 5242 gene locus_tag LOCUS_14900 4694 5242 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_14900 5313 6302 gene locus_tag LOCUS_14910 5313 6302 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence180 218 1447 gene locus_tag LOCUS_14920 218 1447 CDS product NDP-hexose 3-C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975517.1 protein_id gnl|my_center|LOCUS_14920 1475 1702 gene locus_tag LOCUS_14930 1475 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1699 2793 gene locus_tag LOCUS_14940 1699 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 2800 3912 gene locus_tag LOCUS_14950 2800 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 3909 5129 gene locus_tag LOCUS_14960 3909 5129 CDS product NDP-hexose methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975523.1 protein_id gnl|my_center|LOCUS_14960 5404 5159 gene locus_tag LOCUS_14970 5404 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 5366 6325 gene locus_tag LOCUS_14980 5366 6325 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975518.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence181 220 1563 gene locus_tag LOCUS_14990 gene glmU 220 1563 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC5 protein_id gnl|my_center|LOCUS_14990 1565 2833 gene locus_tag LOCUS_15000 1565 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2835 3224 gene locus_tag LOCUS_15010 gene cdd 2835 3224 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P19079 protein_id gnl|my_center|LOCUS_15010 4503 3298 gene locus_tag LOCUS_15020 4503 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 5037 4846 gene locus_tag LOCUS_15030 5037 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 4981 5853 gene locus_tag LOCUS_15040 4981 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence182 181 1581 gene locus_tag LOCUS_15050 181 1581 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MIH9 protein_id gnl|my_center|LOCUS_15050 1587 2915 gene locus_tag LOCUS_15060 1587 2915 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_15060 4127 3120 gene locus_tag LOCUS_15070 4127 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 6041 4698 gene locus_tag LOCUS_15080 gene asnS 6041 4698 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA97 protein_id gnl|my_center|LOCUS_15080 >Feature sequence183 491 1255 gene locus_tag LOCUS_15090 gene ribX 491 1255 CDS product riboflavin transport system permease protein RibX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGD1 protein_id gnl|my_center|LOCUS_15090 1338 2333 gene locus_tag LOCUS_15100 gene ribY 1338 2333 CDS product riboflavin-binding protein RibY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGD2 protein_id gnl|my_center|LOCUS_15100 2314 3102 gene locus_tag LOCUS_15110 2314 3102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064578.1 protein_id gnl|my_center|LOCUS_15110 3195 4109 gene locus_tag LOCUS_15120 3195 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 4144 5637 gene locus_tag LOCUS_15130 4144 5637 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461603.1 protein_id gnl|my_center|LOCUS_15130 5640 6281 gene locus_tag LOCUS_15140 5640 6281 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975804.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence184 2375 309 gene locus_tag LOCUS_15150 2375 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3679 2522 gene locus_tag LOCUS_15160 3679 2522 CDS product glycosyl transferase group 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_15160 4727 3786 gene locus_tag LOCUS_15170 4727 3786 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_15170 6126 4795 gene locus_tag LOCUS_15180 6126 4795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence185 <1 951 gene locus_tag LOCUS_15190 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257979.1:adenylyl-sulfate kinase 1002 1859 gene locus_tag LOCUS_15200 1002 1859 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_15200 1935 2678 gene locus_tag LOCUS_15210 gene rkpN 1935 2678 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887052.1 protein_id gnl|my_center|LOCUS_15210 2753 4639 gene locus_tag LOCUS_15220 2753 4639 CDS product acetylneuraminic acid synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088712.1 protein_id gnl|my_center|LOCUS_15220 4705 6327 gene locus_tag LOCUS_15230 4705 6327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence186 <1 579 gene locus_tag LOCUS_15240 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067310.1:amino acid ABC transporter 572 1321 gene locus_tag LOCUS_15250 gene glnQ 572 1321 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878183.1 protein_id gnl|my_center|LOCUS_15250 1484 1402 gene locus_tag LOCUS_t00130 1484 1402 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1587 2600 gene locus_tag LOCUS_15260 gene plsX 1587 2600 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67186 protein_id gnl|my_center|LOCUS_15260 2597 3844 gene locus_tag LOCUS_15270 2597 3844 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_15270 3855 4547 gene locus_tag LOCUS_15280 3855 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5711 4656 gene locus_tag LOCUS_15290 5711 4656 CDS product virion core protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_15290 6275 5760 gene locus_tag LOCUS_15300 6275 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence187 1942 500 gene locus_tag LOCUS_15310 1942 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 2244 4253 gene locus_tag LOCUS_15320 2244 4253 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434478.1 protein_id gnl|my_center|LOCUS_15320 4246 5856 gene locus_tag LOCUS_15330 gene amyA 4246 5856 CDS product oligo-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202103.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence188 1601 372 gene locus_tag LOCUS_15340 1601 372 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_15340 2332 1640 gene locus_tag LOCUS_15350 2332 1640 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531971.1 protein_id gnl|my_center|LOCUS_15350 2653 3084 gene locus_tag LOCUS_15360 2653 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 3081 3764 gene locus_tag LOCUS_15370 3081 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4362 3742 gene locus_tag LOCUS_15380 4362 3742 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_15380 4408 5097 gene locus_tag LOCUS_15390 4408 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_15390 5543 5141 gene locus_tag LOCUS_tm00010 5543 5141 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence189 252 1823 gene locus_tag LOCUS_15400 252 1823 CDS product binding-protein-dependent transport system inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583081.1 protein_id gnl|my_center|LOCUS_15400 1816 2718 gene locus_tag LOCUS_15410 1816 2718 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583080.1 protein_id gnl|my_center|LOCUS_15410 2999 4654 gene locus_tag LOCUS_15420 2999 4654 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256397.1 protein_id gnl|my_center|LOCUS_15420 4698 6143 gene locus_tag LOCUS_15430 4698 6143 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405447.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence190 1043 69 gene locus_tag LOCUS_15440 1043 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 1515 1036 gene locus_tag LOCUS_15450 1515 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 2670 1696 gene locus_tag LOCUS_15460 2670 1696 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_15460 3402 2995 gene locus_tag LOCUS_15470 3402 2995 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706151.1 protein_id gnl|my_center|LOCUS_15470 3855 3421 gene locus_tag LOCUS_15480 gene hsp20 3855 3421 CDS product molecular chaperone Hsp20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122700.1 protein_id gnl|my_center|LOCUS_15480 6090 3961 gene locus_tag LOCUS_15490 6090 3961 CDS product RNA-binding transcriptional accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461496.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence191 529 445 gene locus_tag LOCUS_t00140 529 445 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 630 3050 gene locus_tag LOCUS_15500 630 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 3474 3226 gene locus_tag LOCUS_15510 3474 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 3927 3670 gene locus_tag LOCUS_15520 3927 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 3937 4998 gene locus_tag LOCUS_15530 3937 4998 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256386.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence192 859 1542 gene locus_tag LOCUS_15540 859 1542 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392988.1 protein_id gnl|my_center|LOCUS_15540 1535 2935 gene locus_tag LOCUS_15550 1535 2935 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_15550 3227 3952 gene locus_tag LOCUS_15560 3227 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 3994 4890 gene locus_tag LOCUS_15570 3994 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 4892 5935 gene locus_tag LOCUS_15580 4892 5935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence193 <1 792 gene locus_tag LOCUS_15590 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058076.1:serine/threonine phosphatase 3148 836 gene locus_tag LOCUS_15600 3148 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 3291 4298 gene locus_tag LOCUS_15610 3291 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 5526 4441 gene locus_tag LOCUS_15620 5526 4441 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence194 783 205 gene locus_tag LOCUS_15630 783 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 1128 871 gene locus_tag LOCUS_15640 1128 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1329 1138 gene locus_tag LOCUS_15650 1329 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1599 1342 gene locus_tag LOCUS_15660 1599 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2013 1810 gene locus_tag LOCUS_15670 2013 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2625 2029 gene locus_tag LOCUS_15680 2625 2029 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_15680 2891 2634 gene locus_tag LOCUS_15690 2891 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 3403 3098 gene locus_tag LOCUS_15700 3403 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 4211 3396 gene locus_tag LOCUS_15710 4211 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 5126 4215 gene locus_tag LOCUS_15720 5126 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 5270 5407 gene locus_tag LOCUS_15730 5270 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 6026 5568 gene locus_tag LOCUS_15740 6026 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence195 857 366 gene locus_tag LOCUS_15750 857 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1732 986 gene locus_tag LOCUS_15760 1732 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1973 5935 gene locus_tag LOCUS_15770 1973 5935 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_15770 >Feature sequence196 2056 281 gene locus_tag LOCUS_15780 gene mutL 2056 281 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ86 protein_id gnl|my_center|LOCUS_15780 2113 2790 gene locus_tag LOCUS_15790 2113 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 2781 3569 gene locus_tag LOCUS_15800 2781 3569 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_15800 3703 5241 gene locus_tag LOCUS_15810 3703 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 5319 6014 gene locus_tag LOCUS_15820 5319 6014 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence197 358 2640 gene locus_tag LOCUS_15830 358 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2643 3482 gene locus_tag LOCUS_15840 2643 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3485 4750 gene locus_tag LOCUS_15850 gene qrcD 3485 4750 CDS product menaquinone reductase, integral membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72E86 protein_id gnl|my_center|LOCUS_15850 5014 5361 gene locus_tag LOCUS_15860 5014 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence198 123 860 gene locus_tag LOCUS_15870 123 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4107 850 gene locus_tag LOCUS_15880 4107 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 5926 4133 gene locus_tag LOCUS_15890 5926 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence199 1516 431 gene locus_tag LOCUS_15900 1516 431 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259474.1 protein_id gnl|my_center|LOCUS_15900 3127 1520 gene locus_tag LOCUS_15910 3127 1520 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259473.1 protein_id gnl|my_center|LOCUS_15910 3862 3140 gene locus_tag LOCUS_15920 3862 3140 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259472.1 protein_id gnl|my_center|LOCUS_15920 4644 3859 gene locus_tag LOCUS_15930 4644 3859 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_15930 <6077 4701 gene locus_tag LOCUS_15940 <6077 4701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259470.1:ABC transporter substrate-binding protein >Feature sequence200 396 1274 gene locus_tag LOCUS_15950 396 1274 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_15950 1758 2636 gene locus_tag LOCUS_15960 1758 2636 CDS product carbon monoxide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707175.1 protein_id gnl|my_center|LOCUS_15960 2646 3122 gene locus_tag LOCUS_15970 2646 3122 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707174.1 protein_id gnl|my_center|LOCUS_15970 3136 5478 gene locus_tag LOCUS_15980 3136 5478 CDS product dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807632.1 protein_id gnl|my_center|LOCUS_15980 5484 5939 gene locus_tag LOCUS_15990 5484 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence201 <1 729 gene locus_tag LOCUS_16000 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q3V892:acetolactate synthase 851 1387 gene locus_tag LOCUS_16010 gene ilvH 851 1387 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_16010 1406 2419 gene locus_tag LOCUS_16020 gene ilvC 1406 2419 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC26 protein_id gnl|my_center|LOCUS_16020 2486 4132 gene locus_tag LOCUS_16030 gene leuA 2486 4132 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC27 protein_id gnl|my_center|LOCUS_16030 4230 4433 gene locus_tag LOCUS_16040 4230 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 4539 5960 gene locus_tag LOCUS_16050 gene leuC 4539 5960 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC29 protein_id gnl|my_center|LOCUS_16050 >Feature sequence202 1139 441 gene locus_tag LOCUS_16060 1139 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849665.1 protein_id gnl|my_center|LOCUS_16060 1427 2077 gene locus_tag LOCUS_16070 1427 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 2178 3140 gene locus_tag LOCUS_16080 2178 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4441 3197 gene locus_tag LOCUS_16090 4441 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 5656 4922 gene locus_tag LOCUS_16100 gene mtrA 5656 4922 CDS product DNA-binding response regulator MtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QTK2 protein_id gnl|my_center|LOCUS_16100 >Feature sequence203 780 64 gene locus_tag LOCUS_16110 780 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1694 987 gene locus_tag LOCUS_16120 1694 987 CDS product abortive infection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259274.1 protein_id gnl|my_center|LOCUS_16120 2533 1691 gene locus_tag LOCUS_16130 2533 1691 CDS product lysophospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_16130 2898 2647 gene locus_tag LOCUS_16140 2898 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3605 2985 gene locus_tag LOCUS_16150 3605 2985 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256303.1 protein_id gnl|my_center|LOCUS_16150 4548 3682 gene locus_tag LOCUS_16160 4548 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 5129 4572 gene locus_tag LOCUS_16170 5129 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 5895 5305 gene locus_tag LOCUS_16180 5895 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence204 3049 2288 gene locus_tag LOCUS_16190 3049 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 3542 3075 gene locus_tag LOCUS_16200 3542 3075 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941659.1 protein_id gnl|my_center|LOCUS_16200 4537 3539 gene locus_tag LOCUS_16210 4537 3539 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871058.1 protein_id gnl|my_center|LOCUS_16210 5167 4556 gene locus_tag LOCUS_16220 5167 4556 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876252.1 protein_id gnl|my_center|LOCUS_16220 <5953 5284 gene locus_tag LOCUS_16230 <5953 5284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256113.1:LPPG--FO 2-phospho-L-lactate transferase >Feature sequence205 1326 2180 gene locus_tag LOCUS_16240 1326 2180 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_16240 2391 2993 gene locus_tag LOCUS_16250 2391 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 3109 4368 gene locus_tag LOCUS_16260 3109 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4379 5728 gene locus_tag LOCUS_16270 gene rimO 4379 5728 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDA3 protein_id gnl|my_center|LOCUS_16270 >Feature sequence206 376 110 gene locus_tag LOCUS_16280 376 110 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_16280 583 404 gene locus_tag LOCUS_16290 583 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1069 626 gene locus_tag LOCUS_16300 1069 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16300 1298 1113 gene locus_tag LOCUS_16310 1298 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1761 1483 gene locus_tag LOCUS_16320 1761 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2385 1777 gene locus_tag LOCUS_16330 2385 1777 CDS product RNA polymerase subunit sigma-24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_16330 3025 3417 gene locus_tag LOCUS_16340 3025 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 3421 5442 gene locus_tag LOCUS_16350 gene cooS 3421 5442 CDS product carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence207 2185 2403 gene locus_tag LOCUS_16360 2185 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 3119 2445 gene locus_tag LOCUS_16370 3119 2445 CDS product catabolite gene activator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_16370 3517 3167 gene locus_tag LOCUS_16380 gene phhB 3517 3167 CDS product pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q885L1 protein_id gnl|my_center|LOCUS_16380 3722 3510 gene locus_tag LOCUS_16390 3722 3510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4213 3779 gene locus_tag LOCUS_16400 4213 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 >Feature sequence208 <1 681 gene locus_tag LOCUS_16410 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258910.1:diguanylate cyclase response regulator 678 3698 gene locus_tag LOCUS_16420 678 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 3812 5758 gene locus_tag LOCUS_16430 3812 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence209 <1 2556 gene locus_tag LOCUS_16440 <1 2556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970163.1:hemolysin 2879 2718 gene locus_tag LOCUS_16450 2879 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 3598 3104 gene locus_tag LOCUS_16460 3598 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 4417 3764 gene locus_tag LOCUS_16470 4417 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 4898 4314 gene locus_tag LOCUS_16480 4898 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5083 4928 gene locus_tag LOCUS_16490 5083 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 >Feature sequence210 164 355 gene locus_tag LOCUS_16500 164 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 377 883 gene locus_tag LOCUS_16510 377 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 1091 1837 gene locus_tag LOCUS_16520 1091 1837 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970955.1 protein_id gnl|my_center|LOCUS_16520 1963 3963 gene locus_tag LOCUS_16530 gene nirS 1963 3963 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P24474 protein_id gnl|my_center|LOCUS_16530 4135 4353 gene locus_tag LOCUS_16540 4135 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 4354 4671 gene locus_tag LOCUS_16550 4354 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203854.1 protein_id gnl|my_center|LOCUS_16550 4685 5002 gene locus_tag LOCUS_16560 4685 5002 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256234.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence211 1730 45 gene locus_tag LOCUS_16570 1730 45 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030361.1 protein_id gnl|my_center|LOCUS_16570 2817 1786 gene locus_tag LOCUS_16580 2817 1786 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030360.1 protein_id gnl|my_center|LOCUS_16580 3521 2886 gene locus_tag LOCUS_16590 3521 2886 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_16590 4622 3699 gene locus_tag LOCUS_16600 4622 3699 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG00 protein_id gnl|my_center|LOCUS_16600 5654 4737 gene locus_tag LOCUS_16610 gene truB 5654 4737 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ0 protein_id gnl|my_center|LOCUS_16610 >Feature sequence212 312 1019 gene locus_tag LOCUS_16620 312 1019 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SIC1 protein_id gnl|my_center|LOCUS_16620 1433 2509 gene locus_tag LOCUS_16630 1433 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2674 2748 gene locus_tag LOCUS_t00150 2674 2748 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2847 4703 gene locus_tag LOCUS_16640 2847 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 5589 4987 gene locus_tag LOCUS_16650 5589 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence213 3306 2944 gene locus_tag LOCUS_16660 3306 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 4591 3422 gene locus_tag LOCUS_16670 4591 3422 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_16670 <5773 4588 gene locus_tag LOCUS_16680 <5773 4588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001296244.1:two-component system sensor histidine kinase AtoS >Feature sequence214 1134 121 gene locus_tag LOCUS_16690 gene cydB 1134 121 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_16690 2609 1215 gene locus_tag LOCUS_16700 2609 1215 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393585.1 protein_id gnl|my_center|LOCUS_16700 4838 2751 gene locus_tag LOCUS_16710 4838 2751 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010482.1 protein_id gnl|my_center|LOCUS_16710 5623 4913 gene locus_tag LOCUS_16720 5623 4913 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660871.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence215 <1 1421 gene locus_tag LOCUS_16730 <1 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NCW4:nuclease SbcCD subunit C 1421 2578 gene locus_tag LOCUS_16740 1421 2578 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259674.1 protein_id gnl|my_center|LOCUS_16740 3372 2575 gene locus_tag LOCUS_16750 3372 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257179.1 protein_id gnl|my_center|LOCUS_16750 4367 3453 gene locus_tag LOCUS_16760 4367 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 4482 5645 gene locus_tag LOCUS_16770 4482 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256341.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence216 482 1213 gene locus_tag LOCUS_16780 482 1213 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257637.1 protein_id gnl|my_center|LOCUS_16780 1210 2259 gene locus_tag LOCUS_16790 1210 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 2441 2788 gene locus_tag LOCUS_16800 2441 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 3576 2797 gene locus_tag LOCUS_16810 3576 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 3669 4514 gene locus_tag LOCUS_16820 3669 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933215.1 protein_id gnl|my_center|LOCUS_16820 >Feature sequence217 138 1487 gene locus_tag LOCUS_16830 138 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 1574 2518 gene locus_tag LOCUS_16840 1574 2518 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031697.1 protein_id gnl|my_center|LOCUS_16840 2521 3420 gene locus_tag LOCUS_16850 gene ycjP 2521 3420 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224665.1 protein_id gnl|my_center|LOCUS_16850 3493 4857 gene locus_tag LOCUS_16860 gene mggS 3493 4857 CDS product mannosylglucosylglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0V7 protein_id gnl|my_center|LOCUS_16860 >Feature sequence218 657 58 gene locus_tag LOCUS_16870 657 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 921 1667 gene locus_tag LOCUS_16880 921 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1870 2733 gene locus_tag LOCUS_16890 1870 2733 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_16890 2730 3554 gene locus_tag LOCUS_16900 gene nadE 2730 3554 CDS product NH(3)-dependent NAD(+) synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF7 protein_id gnl|my_center|LOCUS_16900 3678 4922 gene locus_tag LOCUS_16910 3678 4922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259400.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence219 246 1130 gene locus_tag LOCUS_16920 246 1130 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706035.1 protein_id gnl|my_center|LOCUS_16920 1132 3948 gene locus_tag LOCUS_16930 1132 3948 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393495.1 protein_id gnl|my_center|LOCUS_16930 4023 4505 gene locus_tag LOCUS_16940 4023 4505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 >Feature sequence220 144 572 gene locus_tag LOCUS_16950 144 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 781 3156 gene locus_tag LOCUS_16960 781 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 5595 3184 gene locus_tag LOCUS_16970 5595 3184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence221 183 1007 gene locus_tag LOCUS_16980 183 1007 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000202612.1 protein_id gnl|my_center|LOCUS_16980 1646 1050 gene locus_tag LOCUS_16990 1646 1050 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE78 protein_id gnl|my_center|LOCUS_16990 1758 2276 gene locus_tag LOCUS_17000 1758 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2816 4597 gene locus_tag LOCUS_17010 gene metG 2816 4597 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKM1 protein_id gnl|my_center|LOCUS_17010 5452 4709 gene locus_tag LOCUS_17020 5452 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence222 1766 2692 gene locus_tag LOCUS_17030 1766 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2711 2965 gene locus_tag LOCUS_17040 2711 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2972 3874 gene locus_tag LOCUS_17050 2972 3874 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72FR4 protein_id gnl|my_center|LOCUS_17050 3900 4724 gene locus_tag LOCUS_17060 3900 4724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence223 236 2362 gene locus_tag LOCUS_17070 236 2362 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257118.1 protein_id gnl|my_center|LOCUS_17070 2368 3336 gene locus_tag LOCUS_17080 2368 3336 CDS product fructose-1,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK12 protein_id gnl|my_center|LOCUS_17080 4736 3333 gene locus_tag LOCUS_17090 4736 3333 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_17090 <5659 4831 gene locus_tag LOCUS_17100 <5659 4831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJD6:endonuclease MutS2 >Feature sequence224 1475 1182 gene locus_tag LOCUS_17110 1475 1182 CDS product toxin RelE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_17110 2112 1642 gene locus_tag LOCUS_17120 2112 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2338 2084 gene locus_tag LOCUS_17130 2338 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 2954 5368 gene locus_tag LOCUS_17140 2954 5368 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence225 1955 363 gene locus_tag LOCUS_17150 1955 363 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529813.1 protein_id gnl|my_center|LOCUS_17150 2107 2625 gene locus_tag LOCUS_17160 2107 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2639 3724 gene locus_tag LOCUS_17170 gene potA 2639 3724 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_17170 3733 4674 gene locus_tag LOCUS_17180 3733 4674 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112953.1 protein_id gnl|my_center|LOCUS_17180 4667 5506 gene locus_tag LOCUS_17190 4667 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence226 997 2925 gene locus_tag LOCUS_17200 997 2925 CDS product selenocysteine-specific translation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_17200 3074 3385 gene locus_tag LOCUS_17210 3074 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 3403 4077 gene locus_tag LOCUS_17220 3403 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 4121 5173 gene locus_tag LOCUS_17230 4121 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_17230 5191 5472 gene locus_tag LOCUS_17240 5191 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence227 1338 64 gene locus_tag LOCUS_17250 gene kynU 1338 64 CDS product kynureninase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK35 protein_id gnl|my_center|LOCUS_17250 1450 2208 gene locus_tag LOCUS_17260 gene mta 1450 2208 CDS product HTH-type transcriptional activator mta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P71039 protein_id gnl|my_center|LOCUS_17260 3046 2297 gene locus_tag LOCUS_17270 3046 2297 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TMZ5 protein_id gnl|my_center|LOCUS_17270 4346 3132 gene locus_tag LOCUS_17280 gene tyrS 4346 3132 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHS8 protein_id gnl|my_center|LOCUS_17280 4937 4485 gene locus_tag LOCUS_17290 4937 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5402 5157 gene locus_tag LOCUS_17300 5402 5157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence228 235 1533 gene locus_tag LOCUS_17310 gene glpC 235 1533 CDS product sn-glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 protein_id gnl|my_center|LOCUS_17310 1612 3249 gene locus_tag LOCUS_17320 1612 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3254 4744 gene locus_tag LOCUS_17330 gene zwf 3254 4744 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE89 protein_id gnl|my_center|LOCUS_17330 4830 5567 gene locus_tag LOCUS_17340 gene pgl 4830 5567 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939587.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence229 1144 704 gene locus_tag LOCUS_17350 1144 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 1548 1147 gene locus_tag LOCUS_17360 1548 1147 CDS product cytochrome b subunit of the bc complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942627.1 protein_id gnl|my_center|LOCUS_17360 2556 1558 gene locus_tag LOCUS_17370 2556 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3838 2909 gene locus_tag LOCUS_17380 3838 2909 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404093.1 protein_id gnl|my_center|LOCUS_17380 4350 3862 gene locus_tag LOCUS_17390 4350 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5303 4401 gene locus_tag LOCUS_17400 5303 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence230 1168 215 gene locus_tag LOCUS_17410 1168 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 2179 1271 gene locus_tag LOCUS_17420 2179 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 2445 3998 gene locus_tag LOCUS_17430 2445 3998 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_17430 4041 4727 gene locus_tag LOCUS_17440 4041 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67827 protein_id gnl|my_center|LOCUS_17440 4720 5523 gene locus_tag LOCUS_17450 4720 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence231 >Feature sequence232 960 3008 gene locus_tag LOCUS_17460 960 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 3029 3682 gene locus_tag LOCUS_17470 3029 3682 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_17470 4055 5398 gene locus_tag LOCUS_17480 4055 5398 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258472.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence233 370 738 gene locus_tag LOCUS_17490 gene cheY34H-1 370 738 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941944.1 protein_id gnl|my_center|LOCUS_17490 807 2456 gene locus_tag LOCUS_17500 gene cheA 807 2456 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037070.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence234 1454 837 gene locus_tag LOCUS_17510 1454 837 CDS product 4-vinyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257557.1 protein_id gnl|my_center|LOCUS_17510 1977 3611 gene locus_tag LOCUS_17520 gene rnj 1977 3611 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK6 protein_id gnl|my_center|LOCUS_17520 4316 3651 gene locus_tag LOCUS_17530 gene pcm 4316 3651 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YG96 protein_id gnl|my_center|LOCUS_17530 5396 4395 gene locus_tag LOCUS_17540 5396 4395 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_17540 >Feature sequence235 1832 855 gene locus_tag LOCUS_17550 1832 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 2276 1848 gene locus_tag LOCUS_17560 2276 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 3401 2376 gene locus_tag LOCUS_17570 3401 2376 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_17570 3705 4427 gene locus_tag LOCUS_17580 3705 4427 CDS product alanyl-tRNA editing protein AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence236 459 1607 gene locus_tag LOCUS_17590 459 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 2152 1574 gene locus_tag LOCUS_17600 2152 1574 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258421.1 protein_id gnl|my_center|LOCUS_17600 3725 2205 gene locus_tag LOCUS_17610 gene cobQ 3725 2205 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIN9 protein_id gnl|my_center|LOCUS_17610 4417 3809 gene locus_tag LOCUS_17620 4417 3809 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392619.1 protein_id gnl|my_center|LOCUS_17620 5001 4507 gene locus_tag LOCUS_17630 5001 4507 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence237 477 944 gene locus_tag LOCUS_17640 gene rpsG 477 944 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 protein_id gnl|my_center|LOCUS_17640 962 3040 gene locus_tag LOCUS_17650 gene fusA 962 3040 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP4 protein_id gnl|my_center|LOCUS_17650 3085 4287 gene locus_tag LOCUS_17660 gene tuf1 3085 4287 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFW5 protein_id gnl|my_center|LOCUS_17660 4532 4607 gene locus_tag LOCUS_t00160 4532 4607 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4666 4875 gene locus_tag LOCUS_17670 4666 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence238 1175 24 gene locus_tag LOCUS_17680 1175 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_17680 1541 2971 gene locus_tag LOCUS_17690 1541 2971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence239 394 792 gene locus_tag LOCUS_17700 394 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020302.1 protein_id gnl|my_center|LOCUS_17700 793 1908 gene locus_tag LOCUS_17710 793 1908 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J6H4 protein_id gnl|my_center|LOCUS_17710 1941 2159 gene locus_tag LOCUS_17720 1941 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 2156 3196 gene locus_tag LOCUS_17730 2156 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4340 3612 gene locus_tag LOCUS_17740 4340 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228944.1 protein_id gnl|my_center|LOCUS_17740 4561 4364 gene locus_tag LOCUS_17750 4561 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 5122 4682 gene locus_tag LOCUS_17760 5122 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 >Feature sequence240 2472 640 gene locus_tag LOCUS_17770 2472 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3493 2753 gene locus_tag LOCUS_17780 3493 2753 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877600.1 protein_id gnl|my_center|LOCUS_17780 4251 3490 gene locus_tag LOCUS_17790 4251 3490 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391646.1 protein_id gnl|my_center|LOCUS_17790 4754 4299 gene locus_tag LOCUS_17800 4754 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 5047 4772 gene locus_tag LOCUS_17810 5047 4772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17810 5262 4960 gene locus_tag LOCUS_17820 5262 4960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17820 >Feature sequence241 557 3208 gene locus_tag LOCUS_17830 557 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3264 3980 gene locus_tag LOCUS_17840 3264 3980 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_17840 >Feature sequence242 1835 1581 gene locus_tag LOCUS_17850 1835 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546008.1 protein_id gnl|my_center|LOCUS_17850 2850 2086 gene locus_tag LOCUS_17860 2850 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 3025 3381 gene locus_tag LOCUS_17870 3025 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 3441 4730 gene locus_tag LOCUS_17880 gene hisS 3441 4730 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F9Y3 protein_id gnl|my_center|LOCUS_17880 4750 4824 gene locus_tag LOCUS_t00170 4750 4824 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 5278 4901 gene locus_tag LOCUS_17890 5278 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence243 198 1172 gene locus_tag LOCUS_17900 198 1172 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140767.1 protein_id gnl|my_center|LOCUS_17900 1227 1661 gene locus_tag LOCUS_17910 1227 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881100.1 protein_id gnl|my_center|LOCUS_17910 1722 2003 gene locus_tag LOCUS_17920 1722 2003 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143402.1 protein_id gnl|my_center|LOCUS_17920 2021 3229 gene locus_tag LOCUS_17930 2021 3229 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_17930 3307 4119 gene locus_tag LOCUS_17940 3307 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4163 4375 gene locus_tag LOCUS_17950 4163 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 <5282 4464 gene locus_tag LOCUS_17960 <5282 4464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WK19:DNA gyrase subunit A >Feature sequence244 2025 1240 gene locus_tag LOCUS_17970 2025 1240 CDS product enoyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723876.1 protein_id gnl|my_center|LOCUS_17970 2127 2324 gene locus_tag LOCUS_17980 2127 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3655 2432 gene locus_tag LOCUS_17990 3655 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 3968 3627 gene locus_tag LOCUS_18000 3968 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 4232 4456 gene locus_tag LOCUS_18010 4232 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5069 4512 gene locus_tag LOCUS_18020 gene efp 5069 4512 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI92 protein_id gnl|my_center|LOCUS_18020 >Feature sequence245 3641 3021 gene locus_tag LOCUS_18030 3641 3021 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_18030 5087 3780 gene locus_tag LOCUS_18040 5087 3780 CDS product PUCC protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258451.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence246 1119 514 gene locus_tag LOCUS_18050 gene recR 1119 514 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_18050 1492 1160 gene locus_tag LOCUS_18060 1492 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 3079 1526 gene locus_tag LOCUS_18070 3079 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 3895 3191 gene locus_tag LOCUS_18080 3895 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 4184 4612 gene locus_tag LOCUS_18090 4184 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 >Feature sequence247 134 511 gene locus_tag LOCUS_18100 134 511 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544974.1 protein_id gnl|my_center|LOCUS_18100 514 975 gene locus_tag LOCUS_18110 514 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 1152 4010 gene locus_tag LOCUS_18120 1152 4010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence248 433 1131 gene locus_tag LOCUS_18130 433 1131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021446.1 protein_id gnl|my_center|LOCUS_18130 1171 1854 gene locus_tag LOCUS_18140 1171 1854 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065118.1 protein_id gnl|my_center|LOCUS_18140 1951 2649 gene locus_tag LOCUS_18150 gene ccmC 1951 2649 CDS product cytochrome C biogenesis protein CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938346.1 protein_id gnl|my_center|LOCUS_18150 2669 2824 gene locus_tag LOCUS_18160 2669 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2957 3871 gene locus_tag LOCUS_18170 2957 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_18170 4061 4384 gene locus_tag LOCUS_18180 4061 4384 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071043.1 protein_id gnl|my_center|LOCUS_18180 >Feature sequence249 <1 682 gene locus_tag LOCUS_18190 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259080.1:polar amino acid ABC transporter permease 685 1890 gene locus_tag LOCUS_18200 685 1890 CDS product polar amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_18200 1924 2679 gene locus_tag LOCUS_18210 1924 2679 CDS product arginine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_18210 2893 2645 gene locus_tag LOCUS_18220 2893 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 2892 3356 gene locus_tag LOCUS_18230 2892 3356 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446103.1 protein_id gnl|my_center|LOCUS_18230 3450 4862 gene locus_tag LOCUS_18240 gene tpl 3450 4862 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WER0 protein_id gnl|my_center|LOCUS_18240 >Feature sequence250 223 849 gene locus_tag LOCUS_18250 223 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3310 884 gene locus_tag LOCUS_18260 3310 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256715.1 protein_id gnl|my_center|LOCUS_18260 4881 3307 gene locus_tag LOCUS_18270 4881 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence251 2413 971 gene locus_tag LOCUS_18280 gene nuoN 2413 971 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFC4 protein_id gnl|my_center|LOCUS_18280 4036 2498 gene locus_tag LOCUS_18290 gene nuoM-1 4036 2498 CDS product NADH:ubiquinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_18290 <5148 4100 gene locus_tag LOCUS_18300 <5148 4100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L >Feature sequence252 845 1780 gene locus_tag LOCUS_18310 845 1780 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259143.1 protein_id gnl|my_center|LOCUS_18310 1929 4997 gene locus_tag LOCUS_18320 1929 4997 CDS product 4-aminobutyrate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975932.1 protein_id gnl|my_center|LOCUS_18320 >Feature sequence253 817 44 gene locus_tag LOCUS_18330 817 44 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460483.1 protein_id gnl|my_center|LOCUS_18330 1405 980 gene locus_tag LOCUS_18340 1405 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 2808 1402 gene locus_tag LOCUS_18350 2808 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4555 3149 gene locus_tag LOCUS_18360 gene icd 4555 3149 CDS product isocitrate dehydrogenase [NADP] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P39126 protein_id gnl|my_center|LOCUS_18360 4880 4716 gene locus_tag LOCUS_18370 4880 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence254 904 2133 gene locus_tag LOCUS_18380 904 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 2212 3171 gene locus_tag LOCUS_18390 2212 3171 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_18390 3274 4641 gene locus_tag LOCUS_18400 3274 4641 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence255 384 2093 gene locus_tag LOCUS_18410 384 2093 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026923.1 protein_id gnl|my_center|LOCUS_18410 4407 2323 gene locus_tag LOCUS_18420 4407 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 4868 4434 gene locus_tag LOCUS_18430 4868 4434 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006316403.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence256 1561 179 gene locus_tag LOCUS_18440 1561 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 2116 1904 gene locus_tag LOCUS_18450 2116 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 2841 2113 gene locus_tag LOCUS_18460 gene tatC 2841 2113 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLA6 protein_id gnl|my_center|LOCUS_18460 4702 2927 gene locus_tag LOCUS_18470 4702 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 >Feature sequence257 1063 74 gene locus_tag LOCUS_18480 1063 74 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_18480 4709 1131 gene locus_tag LOCUS_18490 4709 1131 CDS product pyruvate-flavodoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6M5 protein_id gnl|my_center|LOCUS_18490 >Feature sequence258 841 80 gene locus_tag LOCUS_18500 gene tpiA 841 80 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P96744 protein_id gnl|my_center|LOCUS_18500 3337 938 gene locus_tag LOCUS_18510 3337 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 4966 3794 gene locus_tag LOCUS_18520 gene pgk 4966 3794 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence259 359 1207 gene locus_tag LOCUS_18530 359 1207 CDS product fatty acid-binding protein DegV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_18530 1402 2244 gene locus_tag LOCUS_18540 1402 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 2520 2912 gene locus_tag LOCUS_18550 2520 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 3134 4510 gene locus_tag LOCUS_18560 gene rsmF 3134 4510 CDS product ribosomal RNA small subunit methyltransferase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SII2 protein_id gnl|my_center|LOCUS_18560 >Feature sequence260 959 180 gene locus_tag LOCUS_18570 gene surE 959 180 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJI2 protein_id gnl|my_center|LOCUS_18570 1104 2315 gene locus_tag LOCUS_18580 1104 2315 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676812.1 protein_id gnl|my_center|LOCUS_18580 <5041 2301 gene locus_tag LOCUS_18590 <5041 2301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256431.1:histidine kinase >Feature sequence261 241 738 gene locus_tag LOCUS_18600 241 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 842 1345 gene locus_tag LOCUS_18610 842 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 1501 2724 gene locus_tag LOCUS_18620 1501 2724 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480156.1 protein_id gnl|my_center|LOCUS_18620 2805 4298 gene locus_tag LOCUS_18630 gene glpK 2805 4298 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ21 protein_id gnl|my_center|LOCUS_18630 <5038 4323 gene locus_tag LOCUS_18640 <5038 4323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72B29:L-aspartate oxidase >Feature sequence262 1826 609 gene locus_tag LOCUS_18650 1826 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4294 1904 gene locus_tag LOCUS_18660 4294 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256715.1 protein_id gnl|my_center|LOCUS_18660 4992 4291 gene locus_tag LOCUS_18670 4992 4291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256714.1 protein_id gnl|my_center|LOCUS_18670 >Feature sequence263 <1 1047 gene locus_tag LOCUS_18680 <1 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546515.1:glycosyl transferase group 1 1047 2195 gene locus_tag LOCUS_18690 1047 2195 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_18690 2394 2221 gene locus_tag LOCUS_18700 2394 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2375 4645 gene locus_tag LOCUS_18710 2375 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence264 534 67 gene locus_tag LOCUS_18720 534 67 CDS product 7,8-dihydro-8-oxoguanine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_18720 700 613 gene locus_tag LOCUS_t00180 700 613 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2146 749 gene locus_tag LOCUS_18730 2146 749 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_18730 3475 2336 gene locus_tag LOCUS_18740 3475 2336 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_18740 3963 3490 gene locus_tag LOCUS_18750 3963 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 4950 4021 gene locus_tag LOCUS_18760 4950 4021 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147080.1 protein_id gnl|my_center|LOCUS_18760 >Feature sequence265 303 770 gene locus_tag LOCUS_18770 303 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18770 >Feature sequence266 <1 643 gene locus_tag LOCUS_18780 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WK24:putative ribosome biogenesis GTPase RsgA note possible pseudo, frameshifted 640 861 gene locus_tag LOCUS_18790 640 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18790 1487 939 gene locus_tag LOCUS_18800 1487 939 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393596.1 protein_id gnl|my_center|LOCUS_18800 1855 3576 gene locus_tag LOCUS_18810 1855 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4960 3833 gene locus_tag LOCUS_18820 4960 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence267 464 3280 gene locus_tag LOCUS_18830 464 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 3338 4126 gene locus_tag LOCUS_18840 3338 4126 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888571.1 protein_id gnl|my_center|LOCUS_18840 4686 4168 gene locus_tag LOCUS_18850 4686 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence268 <1 611 gene locus_tag LOCUS_18860 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257930.1:histidine kinase 724 2100 gene locus_tag LOCUS_18870 724 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_18870 3490 2393 gene locus_tag LOCUS_18880 gene ychF 3490 2393 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72C55 protein_id gnl|my_center|LOCUS_18880 3943 3497 gene locus_tag LOCUS_18890 gene mscL 3943 3497 CDS product large-conductance mechanosensitive channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KD14 protein_id gnl|my_center|LOCUS_18890 4826 4161 gene locus_tag LOCUS_18900 4826 4161 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence269 879 499 gene locus_tag LOCUS_18910 879 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1252 884 gene locus_tag LOCUS_18920 1252 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2584 1310 gene locus_tag LOCUS_18930 2584 1310 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117040.1 protein_id gnl|my_center|LOCUS_18930 2696 3352 gene locus_tag LOCUS_18940 2696 3352 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255949.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence270 <1 2783 gene locus_tag LOCUS_18950 <1 2783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q5SIW3:protein translocase subunit SecA 3019 4059 gene locus_tag LOCUS_18960 3019 4059 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_18960 4789 4166 gene locus_tag LOCUS_18970 4789 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence271 470 2056 gene locus_tag LOCUS_18980 470 2056 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257797.1 protein_id gnl|my_center|LOCUS_18980 3061 2162 gene locus_tag LOCUS_18990 3061 2162 CDS product putative DapA-like lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE23 protein_id gnl|my_center|LOCUS_18990 3367 4614 gene locus_tag LOCUS_19000 3367 4614 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225823.1 protein_id gnl|my_center|LOCUS_19000 >Feature sequence272 150 548 gene locus_tag LOCUS_19010 150 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 771 2582 gene locus_tag LOCUS_19020 771 2582 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_19020 2882 4693 gene locus_tag LOCUS_19030 2882 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4752 4886 gene locus_tag LOCUS_19040 4752 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence273 429 1574 gene locus_tag LOCUS_19050 429 1574 CDS product 1,2-diacylglycerol 3-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_19050 1751 3448 gene locus_tag LOCUS_19060 1751 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 3598 4527 gene locus_tag LOCUS_19070 3598 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence274 212 1828 gene locus_tag LOCUS_19080 212 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 1923 2639 gene locus_tag LOCUS_19090 gene macB 1923 2639 CDS product macrolide export ATP-binding/permease protein MacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJF1 protein_id gnl|my_center|LOCUS_19090 2718 3947 gene locus_tag LOCUS_19100 2718 3947 CDS product multidrug ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393833.1 protein_id gnl|my_center|LOCUS_19100 4023 4685 gene locus_tag LOCUS_19110 4023 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence275 110 1162 gene locus_tag LOCUS_19120 gene acr3 110 1162 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_19120 2097 1225 gene locus_tag LOCUS_19130 2097 1225 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425940.1 protein_id gnl|my_center|LOCUS_19130 2489 2094 gene locus_tag LOCUS_19140 2489 2094 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_19140 3785 2541 gene locus_tag LOCUS_19150 3785 2541 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_19150 4691 3825 gene locus_tag LOCUS_19160 4691 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 >Feature sequence276 316 1245 gene locus_tag LOCUS_19170 316 1245 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_19170 1242 3179 gene locus_tag LOCUS_19180 1242 3179 CDS product polysaccharide biosynthesis protein CapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256833.1 protein_id gnl|my_center|LOCUS_19180 3208 4200 gene locus_tag LOCUS_19190 3208 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_19190 4740 4213 gene locus_tag LOCUS_19200 4740 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 >Feature sequence277 475 1173 gene locus_tag LOCUS_19210 475 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 2468 1218 gene locus_tag LOCUS_19220 2468 1218 CDS product acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S152 protein_id gnl|my_center|LOCUS_19220 3451 2468 gene locus_tag LOCUS_19230 3451 2468 CDS product pyruvate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257842.1 protein_id gnl|my_center|LOCUS_19230 4496 3540 gene locus_tag LOCUS_19240 gene pdhAa 4496 3540 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3J3I9 protein_id gnl|my_center|LOCUS_19240 >Feature sequence278 <1 543 gene locus_tag LOCUS_19250 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HHN3:foldase protein PrsA 1350 628 gene locus_tag LOCUS_19260 gene rph 1350 628 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCA5 protein_id gnl|my_center|LOCUS_19260 <4832 1354 gene locus_tag LOCUS_19270 <4832 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFD8:chromosome partition protein Smc >Feature sequence279 630 181 gene locus_tag LOCUS_19280 630 181 CDS product protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173310.1 protein_id gnl|my_center|LOCUS_19280 1031 696 gene locus_tag LOCUS_19290 1031 696 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257803.1 protein_id gnl|my_center|LOCUS_19290 1615 1028 gene locus_tag LOCUS_19300 1615 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_19300 2651 1737 gene locus_tag LOCUS_19310 2651 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 3213 2674 gene locus_tag LOCUS_19320 3213 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 4659 3307 gene locus_tag LOCUS_19330 4659 3307 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHK0 protein_id gnl|my_center|LOCUS_19330 >Feature sequence280 28 327 gene locus_tag LOCUS_19340 28 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 2201 351 gene locus_tag LOCUS_19350 gene metF-2 2201 351 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_19350 3521 2280 gene locus_tag LOCUS_19360 3521 2280 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787705.1 protein_id gnl|my_center|LOCUS_19360 4535 3552 gene locus_tag LOCUS_19370 4535 3552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256256.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence281 156 1907 gene locus_tag LOCUS_19380 156 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 1922 2617 gene locus_tag LOCUS_19390 gene cmk 1922 2617 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHT6 protein_id gnl|my_center|LOCUS_19390 2698 3315 gene locus_tag LOCUS_19400 2698 3315 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_19400 3296 4066 gene locus_tag LOCUS_19410 3296 4066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence282 277 1932 gene locus_tag LOCUS_19420 277 1932 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_19420 2003 2410 gene locus_tag LOCUS_19430 2003 2410 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_19430 2480 3340 gene locus_tag LOCUS_19440 2480 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4681 3485 gene locus_tag LOCUS_19450 4681 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence283 498 1034 gene locus_tag LOCUS_19460 gene rplJ 498 1034 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q727C9 protein_id gnl|my_center|LOCUS_19460 1214 1588 gene locus_tag LOCUS_19470 gene rplL 1214 1588 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RQV2 protein_id gnl|my_center|LOCUS_19470 1732 2412 gene locus_tag LOCUS_19480 1732 2412 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_19480 2412 3794 gene locus_tag LOCUS_19490 2412 3794 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_19490 4429 3818 gene locus_tag LOCUS_19500 4429 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence284 2688 3737 gene locus_tag LOCUS_19510 2688 3737 CDS product LuxR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257796.1 protein_id gnl|my_center|LOCUS_19510 3734 4558 gene locus_tag LOCUS_19520 gene lipM 3734 4558 CDS product octanoyltransferase LipM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RH52 protein_id gnl|my_center|LOCUS_19520 >Feature sequence285 <1 2706 gene locus_tag LOCUS_19530 <1 2706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259456.1:transcriptional activator 2787 3002 gene locus_tag LOCUS_19540 2787 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 2986 3744 gene locus_tag LOCUS_19550 2986 3744 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence286 516 34 gene locus_tag LOCUS_19560 516 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 1103 519 gene locus_tag LOCUS_19570 1103 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2277 1105 gene locus_tag LOCUS_19580 gene yerB 2277 1105 CDS product putative lipoprotein YerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34968 protein_id gnl|my_center|LOCUS_19580 3598 2291 gene locus_tag LOCUS_19590 3598 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 >Feature sequence287 2057 918 gene locus_tag LOCUS_19600 2057 918 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973627.1 protein_id gnl|my_center|LOCUS_19600 4296 2242 gene locus_tag LOCUS_19610 4296 2242 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582700.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence288 171 1994 gene locus_tag LOCUS_19620 171 1994 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259439.1 protein_id gnl|my_center|LOCUS_19620 2110 3849 gene locus_tag LOCUS_19630 2110 3849 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259439.1 protein_id gnl|my_center|LOCUS_19630 4489 3836 gene locus_tag LOCUS_19640 4489 3836 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_19640 >Feature sequence289 705 385 gene locus_tag LOCUS_19650 705 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 881 702 gene locus_tag LOCUS_19660 881 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2439 823 gene locus_tag LOCUS_19670 2439 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 4080 2488 gene locus_tag LOCUS_19680 4080 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681812.1 protein_id gnl|my_center|LOCUS_19680 4546 4091 gene locus_tag LOCUS_19690 4546 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence290 1365 37 gene locus_tag LOCUS_19700 1365 37 CDS product MoeA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393499.1 protein_id gnl|my_center|LOCUS_19700 2243 1356 gene locus_tag LOCUS_19710 2243 1356 CDS product molybdenum hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459388.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence291 530 2878 gene locus_tag LOCUS_19720 530 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 >Feature sequence292 <1 525 gene locus_tag LOCUS_19730 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680283.1:ABC transporter ATP-binding protein 667 1314 gene locus_tag LOCUS_19740 667 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_19740 1672 4503 gene locus_tag LOCUS_19750 1672 4503 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence293 7 84 gene locus_tag LOCUS_t00190 7 84 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 314 153 gene locus_tag LOCUS_19760 314 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 1690 323 gene locus_tag LOCUS_19770 1690 323 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256515.1 protein_id gnl|my_center|LOCUS_19770 2400 1714 gene locus_tag LOCUS_19780 2400 1714 CDS product DUF159 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence294 <1 1424 gene locus_tag LOCUS_19790 <1 1424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583555.1:citramalate synthase 1580 2668 gene locus_tag LOCUS_19800 gene leuB 1580 2668 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAR7 protein_id gnl|my_center|LOCUS_19800 2671 3501 gene locus_tag LOCUS_19810 gene pheA 2671 3501 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBW6 protein_id gnl|my_center|LOCUS_19810 3543 4535 gene locus_tag LOCUS_19820 3543 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 >Feature sequence295 674 105 gene locus_tag LOCUS_19830 674 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19830 918 664 gene locus_tag LOCUS_19840 918 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 3884 1053 gene locus_tag LOCUS_19850 3884 1053 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387994.1 protein_id gnl|my_center|LOCUS_19850 <4587 3915 gene locus_tag LOCUS_19860 <4587 3915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036267.1:restriction endonuclease >Feature sequence296 104 1264 gene locus_tag LOCUS_19870 104 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1334 3373 gene locus_tag LOCUS_19880 1334 3373 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_19880 3828 4331 gene locus_tag LOCUS_19890 3828 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence297 444 61 gene locus_tag LOCUS_19900 444 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1319 678 gene locus_tag LOCUS_19910 1319 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 2562 1324 gene locus_tag LOCUS_19920 2562 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19920 2950 2564 gene locus_tag LOCUS_19930 2950 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_19930 3220 3038 gene locus_tag LOCUS_19940 3220 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence298 2165 729 gene locus_tag LOCUS_19950 2165 729 CDS product iron transporter FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_19950 3071 2232 gene locus_tag LOCUS_19960 3071 2232 CDS product iron transporter FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_19960 4134 3073 gene locus_tag LOCUS_19970 4134 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence299 861 64 gene locus_tag LOCUS_19980 861 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 1461 865 gene locus_tag LOCUS_19990 1461 865 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545597.1 protein_id gnl|my_center|LOCUS_19990 2488 1613 gene locus_tag LOCUS_20000 gene lgt 2488 1613 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9W9T6 protein_id gnl|my_center|LOCUS_20000 4183 2603 gene locus_tag LOCUS_20010 4183 2603 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence300 2559 1243 gene locus_tag LOCUS_20020 gene argD 2559 1243 CDS product acetylornithine/acetyl-lysine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RZC5 protein_id gnl|my_center|LOCUS_20020 2639 3736 gene locus_tag LOCUS_20030 gene tgt 2639 3736 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183P1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence301 519 1982 gene locus_tag LOCUS_20040 gene argH 519 1982 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RWJ0 protein_id gnl|my_center|LOCUS_20040 2012 2182 gene locus_tag LOCUS_20050 2012 2182 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256240.1 protein_id gnl|my_center|LOCUS_20050 2242 3060 gene locus_tag LOCUS_20060 2242 3060 CDS product lysine biosynthesis enzyme LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256241.1 protein_id gnl|my_center|LOCUS_20060 3152 4186 gene locus_tag LOCUS_20070 gene argC 3152 4186 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD17 protein_id gnl|my_center|LOCUS_20070 >Feature sequence302 133 1059 gene locus_tag LOCUS_20080 133 1059 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_20080 2520 1186 gene locus_tag LOCUS_20090 2520 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 3376 2570 gene locus_tag LOCUS_20100 3376 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 4365 3436 gene locus_tag LOCUS_20110 4365 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 >Feature sequence303 2 2575 gene locus_tag LOCUS_20120 2 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 3127 2624 gene locus_tag LOCUS_20130 3127 2624 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_20130 3268 4419 gene locus_tag LOCUS_20140 gene ctpA 3268 4419 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_20140 >Feature sequence304 391 95 gene locus_tag LOCUS_20150 391 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 806 3079 gene locus_tag LOCUS_20160 806 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 >Feature sequence305 2226 790 gene locus_tag LOCUS_20170 2226 790 CDS product aminotransferase AlaT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973993.1 protein_id gnl|my_center|LOCUS_20170 2445 3149 gene locus_tag LOCUS_20180 2445 3149 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence306 973 560 gene locus_tag LOCUS_20190 973 560 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255939.1 protein_id gnl|my_center|LOCUS_20190 1767 1060 gene locus_tag LOCUS_20200 gene SEC59 1767 1060 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126013.1 protein_id gnl|my_center|LOCUS_20200 2610 1825 gene locus_tag LOCUS_20210 2610 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941880.1 protein_id gnl|my_center|LOCUS_20210 3152 2694 gene locus_tag LOCUS_20220 gene smpB 3152 2694 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q1WSY8 protein_id gnl|my_center|LOCUS_20220 4245 3172 gene locus_tag LOCUS_20230 4245 3172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 >Feature sequence307 106 933 gene locus_tag LOCUS_20240 106 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 2229 1021 gene locus_tag LOCUS_20250 2229 1021 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583336.1 protein_id gnl|my_center|LOCUS_20250 3516 2527 gene locus_tag LOCUS_20260 gene xerC 3516 2527 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q73NE4 protein_id gnl|my_center|LOCUS_20260 >Feature sequence308 2550 2083 gene locus_tag LOCUS_20270 2550 2083 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_20270 3447 2554 gene locus_tag LOCUS_20280 3447 2554 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_20280 <4420 3500 gene locus_tag LOCUS_20290 <4420 3500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869167.1:cyclase >Feature sequence309 35 607 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgctccccgcgagggggagcgac 1064 774 gene locus_tag LOCUS_20300 gene cas2 1064 774 CDS product CRISPR-associated endoribonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF4 protein_id gnl|my_center|LOCUS_20300 2106 1075 gene locus_tag LOCUS_20310 gene cas1 2106 1075 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q72WF5 protein_id gnl|my_center|LOCUS_20310 2870 2202 gene locus_tag LOCUS_20320 2870 2202 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003060901.1 protein_id gnl|my_center|LOCUS_20320 2898 3218 gene locus_tag LOCUS_20330 2898 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393084.1 protein_id gnl|my_center|LOCUS_20330 3202 3591 gene locus_tag LOCUS_20340 3202 3591 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403363.1 protein_id gnl|my_center|LOCUS_20340 <4410 3681 gene locus_tag LOCUS_20350 <4410 3681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922510.1:type I-C CRISPR-associated protein Cas7/Csd2 >Feature sequence310 1671 328 gene locus_tag LOCUS_20360 gene gcvPA 1671 328 CDS product putative glycine dehydrogenase (decarboxylating) subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA01 protein_id gnl|my_center|LOCUS_20360 2152 1769 gene locus_tag LOCUS_20370 gene gcvH 2152 1769 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WGD7 protein_id gnl|my_center|LOCUS_20370 3002 2691 gene locus_tag LOCUS_20380 3002 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 3952 3140 gene locus_tag LOCUS_20390 3952 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 >Feature sequence311 299 3199 gene locus_tag LOCUS_20400 299 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 3196 3534 gene locus_tag LOCUS_20410 3196 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20410 3592 3894 gene locus_tag LOCUS_20420 3592 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20420 3896 4312 gene locus_tag LOCUS_20430 3896 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 >Feature sequence312 2904 1876 gene locus_tag LOCUS_20440 2904 1876 CDS product TIGR00374 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_20440 <4382 2901 gene locus_tag LOCUS_20450 <4382 2901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011069703.1:haloacid dehalogenase >Feature sequence313 498 902 gene locus_tag LOCUS_20460 498 902 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389994.1 protein_id gnl|my_center|LOCUS_20460 899 2461 gene locus_tag LOCUS_20470 899 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2918 3955 gene locus_tag LOCUS_20480 2918 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence314 <1 1599 gene locus_tag LOCUS_20490 <1 1599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977171.1:DNA-binding response regulator 1865 2170 gene locus_tag LOCUS_20500 1865 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 >Feature sequence315 <1 753 gene locus_tag LOCUS_20510 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877362.1:trehalose-phosphatase 769 1401 gene locus_tag LOCUS_20520 769 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 1533 3017 gene locus_tag LOCUS_20530 1533 3017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 4026 3100 gene locus_tag LOCUS_20540 4026 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence316 3622 524 gene locus_tag LOCUS_20550 3622 524 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB7 protein_id gnl|my_center|LOCUS_20550 >Feature sequence317 209 574 gene locus_tag LOCUS_20560 209 574 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707050.1 protein_id gnl|my_center|LOCUS_20560 797 1861 gene locus_tag LOCUS_20570 797 1861 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098369.1 protein_id gnl|my_center|LOCUS_20570 2308 1841 gene locus_tag LOCUS_20580 2308 1841 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_20580 2538 2305 gene locus_tag LOCUS_20590 2538 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2969 2547 gene locus_tag LOCUS_20600 2969 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 4177 2966 gene locus_tag LOCUS_20610 4177 2966 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272417.1 protein_id gnl|my_center|LOCUS_20610 >Feature sequence318 225 776 gene locus_tag LOCUS_20620 225 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 908 1267 gene locus_tag LOCUS_20630 908 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 1270 2190 gene locus_tag LOCUS_20640 1270 2190 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WA24 protein_id gnl|my_center|LOCUS_20640 2196 2915 gene locus_tag LOCUS_20650 2196 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259358.1 protein_id gnl|my_center|LOCUS_20650 3111 2962 gene locus_tag LOCUS_20660 3111 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 4071 3112 gene locus_tag LOCUS_20670 4071 3112 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_20670 >Feature sequence319 131 202 gene locus_tag LOCUS_t00200 131 202 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 447 1151 gene locus_tag LOCUS_20680 447 1151 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_20680 1169 2926 gene locus_tag LOCUS_20690 gene phoR 1169 2926 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_20690 3116 4159 gene locus_tag LOCUS_20700 3116 4159 CDS product protein sphX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140018.1 protein_id gnl|my_center|LOCUS_20700 >Feature sequence320 620 1270 gene locus_tag LOCUS_20710 620 1270 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256836.1 protein_id gnl|my_center|LOCUS_20710 1304 2194 gene locus_tag LOCUS_20720 1304 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_20720 2271 3656 gene locus_tag LOCUS_20730 2271 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 4200 3703 gene locus_tag LOCUS_20740 4200 3703 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RRM4 protein_id gnl|my_center|LOCUS_20740 >Feature sequence321 189 116 gene locus_tag LOCUS_t00210 189 116 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 329 245 gene locus_tag LOCUS_t00220 329 245 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 485 411 gene locus_tag LOCUS_t00230 485 411 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1360 623 gene locus_tag LOCUS_20750 1360 623 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_20750 2808 1417 gene locus_tag LOCUS_20760 gene cysS 2808 1417 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD90 protein_id gnl|my_center|LOCUS_20760 3869 2805 gene locus_tag LOCUS_20770 3869 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence322 702 1301 gene locus_tag LOCUS_20780 702 1301 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907825.1 protein_id gnl|my_center|LOCUS_20780 1673 2455 gene locus_tag LOCUS_20790 1673 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 >Feature sequence323 242 1225 gene locus_tag LOCUS_20800 242 1225 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257134.1 protein_id gnl|my_center|LOCUS_20800 1291 2253 gene locus_tag LOCUS_20810 1291 2253 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812829.1 protein_id gnl|my_center|LOCUS_20810 2322 4025 gene locus_tag LOCUS_20820 2322 4025 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889465.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence324 527 820 gene locus_tag LOCUS_20830 527 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 3619 875 gene locus_tag LOCUS_20840 3619 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 >Feature sequence325 1112 219 gene locus_tag LOCUS_20850 1112 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 1259 1113 gene locus_tag LOCUS_20860 1259 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 1817 1299 gene locus_tag LOCUS_20870 1817 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20870 2834 1866 gene locus_tag LOCUS_20880 2834 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3463 2840 gene locus_tag LOCUS_20890 3463 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence326 520 1014 gene locus_tag LOCUS_20900 520 1014 CDS product osmotically inducible protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_20900 1082 1780 gene locus_tag LOCUS_20910 gene bshB2 1082 1780 CDS product bacillithiol biosynthesis deacetylase BshB2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000129068.1 protein_id gnl|my_center|LOCUS_20910 1780 2676 gene locus_tag LOCUS_20920 gene dmeF 1780 2676 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941155.1 protein_id gnl|my_center|LOCUS_20920 2694 3050 gene locus_tag LOCUS_20930 2694 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 3058 3336 gene locus_tag LOCUS_20940 3058 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 3329 4054 gene locus_tag LOCUS_20950 3329 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876976.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence327 3647 477 gene locus_tag LOCUS_20960 3647 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4179 3658 gene locus_tag LOCUS_20970 4179 3658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 >Feature sequence328 1919 297 gene locus_tag LOCUS_20980 1919 297 CDS product bifunctional ADP-dependent (S)-NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256378.1 protein_id gnl|my_center|LOCUS_20980 3901 2027 gene locus_tag LOCUS_20990 3901 2027 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941578.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence329 223 735 gene locus_tag LOCUS_21000 223 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 775 2013 gene locus_tag LOCUS_21010 gene nuoD2 775 2013 CDS product NADH-quinone oxidoreductase subunit D 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFB4 protein_id gnl|my_center|LOCUS_21010 2010 2513 gene locus_tag LOCUS_21020 2010 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 2506 3756 gene locus_tag LOCUS_21030 2506 3756 CDS product NADH-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258753.1 protein_id gnl|my_center|LOCUS_21030 >Feature sequence330 2008 1238 gene locus_tag LOCUS_21040 2008 1238 CDS product putative ATP-binding protein in insertion sequence inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50701 protein_id gnl|my_center|LOCUS_21040 3558 1999 gene locus_tag LOCUS_21050 3558 1999 CDS product putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q50700 protein_id gnl|my_center|LOCUS_21050 >Feature sequence331 2211 1393 gene locus_tag LOCUS_21060 2211 1393 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980434.1 protein_id gnl|my_center|LOCUS_21060 3028 3840 gene locus_tag LOCUS_21070 3028 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence332 1179 184 gene locus_tag LOCUS_21080 1179 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1994 1185 gene locus_tag LOCUS_21090 1994 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2222 2539 gene locus_tag LOCUS_21100 2222 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 4023 2575 gene locus_tag LOCUS_21110 4023 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 >Feature sequence333 810 145 gene locus_tag LOCUS_21120 810 145 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257281.1 protein_id gnl|my_center|LOCUS_21120 2699 813 gene locus_tag LOCUS_21130 2699 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 2978 4072 gene locus_tag LOCUS_21140 2978 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 >Feature sequence334 341 162 gene locus_tag LOCUS_21150 341 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 636 343 gene locus_tag LOCUS_21160 636 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 1307 672 gene locus_tag LOCUS_21170 1307 672 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708800.1 protein_id gnl|my_center|LOCUS_21170 1792 3168 gene locus_tag LOCUS_21180 gene tnaA 1792 3168 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S1V4 protein_id gnl|my_center|LOCUS_21180 3669 3358 gene locus_tag LOCUS_21190 3669 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 3669 4037 gene locus_tag LOCUS_21200 3669 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence335 1762 695 gene locus_tag LOCUS_21210 1762 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2334 1759 gene locus_tag LOCUS_21220 2334 1759 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889002.1 protein_id gnl|my_center|LOCUS_21220 <4131 2398 gene locus_tag LOCUS_21230 <4131 2398 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256431.1:histidine kinase >Feature sequence336 66 1532 gene locus_tag LOCUS_21240 66 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 1693 2058 gene locus_tag LOCUS_21250 1693 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 2092 3855 gene locus_tag LOCUS_21260 2092 3855 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence337 119 1129 gene locus_tag LOCUS_21270 119 1129 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_21270 1156 2640 gene locus_tag LOCUS_21280 gene gatB 1156 2640 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YL60 protein_id gnl|my_center|LOCUS_21280 >Feature sequence338 198 1472 gene locus_tag LOCUS_21290 198 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 1480 2910 gene locus_tag LOCUS_21300 1480 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2922 3923 gene locus_tag LOCUS_21310 gene add 2922 3923 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87TF3 protein_id gnl|my_center|LOCUS_21310 >Feature sequence339 >Feature sequence340 205 1467 gene locus_tag LOCUS_21320 205 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 1488 3947 gene locus_tag LOCUS_21330 1488 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 >Feature sequence341 163 1536 gene locus_tag LOCUS_21340 163 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 1551 2414 gene locus_tag LOCUS_21350 1551 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 3696 2461 gene locus_tag LOCUS_21360 3696 2461 CDS product putative multi-drug resistance efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_268780.1 protein_id gnl|my_center|LOCUS_21360 >Feature sequence342 425 45 gene locus_tag LOCUS_21370 425 45 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 1846 428 gene locus_tag LOCUS_21380 1846 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 2683 1892 gene locus_tag LOCUS_21390 2683 1892 CDS product xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870123.1 protein_id gnl|my_center|LOCUS_21390 4035 2689 gene locus_tag LOCUS_21400 4035 2689 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393891.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence343 2742 1600 gene locus_tag LOCUS_21410 2742 1600 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_21410 3457 2735 gene locus_tag LOCUS_21420 3457 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 >Feature sequence344 682 1362 gene locus_tag LOCUS_21430 682 1362 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021737.1 protein_id gnl|my_center|LOCUS_21430 1392 3062 gene locus_tag LOCUS_21440 1392 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 >Feature sequence345 >Feature sequence346 >Feature sequence347 1966 554 gene locus_tag LOCUS_21450 gene mttB 1966 554 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:P0C0W7 protein_id gnl|my_center|LOCUS_21450 3254 1968 gene locus_tag LOCUS_21460 gene kamA 3254 1968 CDS product L-lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RHX4 protein_id gnl|my_center|LOCUS_21460 >Feature sequence348 3 2675 gene locus_tag LOCUS_21470 3 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 >Feature sequence349 240 479 gene locus_tag LOCUS_21480 240 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 485 1267 gene locus_tag LOCUS_21490 485 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 1342 1662 gene locus_tag LOCUS_21500 1342 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 1684 2337 gene locus_tag LOCUS_21510 1684 2337 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259074.1 protein_id gnl|my_center|LOCUS_21510 2442 3593 gene locus_tag LOCUS_21520 2442 3593 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_21520 >Feature sequence350 414 1916 gene locus_tag LOCUS_21530 414 1916 CDS product carboxypeptidase Taq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_21530 2271 2633 gene locus_tag LOCUS_21540 2271 2633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2636 3550 gene locus_tag LOCUS_21550 2636 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 >Feature sequence351 1513 824 gene locus_tag LOCUS_21560 1513 824 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_21560 <3969 1576 gene locus_tag LOCUS_21570 <3969 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9HVT2:UPF0192 protein >Feature sequence352 717 13 gene locus_tag LOCUS_21580 gene livF 717 13 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_21580 1444 710 gene locus_tag LOCUS_21590 1444 710 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089218.1 protein_id gnl|my_center|LOCUS_21590 2873 1518 gene locus_tag LOCUS_21600 2873 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence353 2 610 gene locus_tag LOCUS_21610 gene nadD 2 610 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE64 protein_id gnl|my_center|LOCUS_21610 2655 607 gene locus_tag LOCUS_21620 2655 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 >Feature sequence354 1045 3249 gene locus_tag LOCUS_21630 1045 3249 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF84 protein_id gnl|my_center|LOCUS_21630 >Feature sequence355 230 2134 gene locus_tag LOCUS_21640 230 2134 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_21640 2539 2243 gene locus_tag LOCUS_21650 2539 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_21650 3651 2536 gene locus_tag LOCUS_21660 3651 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence356 1177 563 gene locus_tag LOCUS_21670 1177 563 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257441.1 protein_id gnl|my_center|LOCUS_21670 2078 1296 gene locus_tag LOCUS_21680 2078 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3125 2328 gene locus_tag LOCUS_21690 3125 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3525 3184 gene locus_tag LOCUS_21700 3525 3184 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023100.1 protein_id gnl|my_center|LOCUS_21700 >Feature sequence357 525 25 gene locus_tag LOCUS_21710 525 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1879 530 gene locus_tag LOCUS_21720 gene mleA 1879 530 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942945.1 protein_id gnl|my_center|LOCUS_21720 3619 1907 gene locus_tag LOCUS_21730 3619 1907 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_21730 >Feature sequence358 631 1740 gene locus_tag LOCUS_21740 631 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 1747 3036 gene locus_tag LOCUS_21750 1747 3036 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_21750 >Feature sequence359 2719 2534 gene locus_tag LOCUS_21760 2719 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 3646 2945 gene locus_tag LOCUS_21770 3646 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679004.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence360 1290 664 gene locus_tag LOCUS_21780 gene gmk 1290 664 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAZ3 protein_id gnl|my_center|LOCUS_21780 1347 1742 gene locus_tag LOCUS_21790 1347 1742 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_21790 3136 1817 gene locus_tag LOCUS_21800 3136 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3821 3216 gene locus_tag LOCUS_21810 gene tmk 3821 3216 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFU3 protein_id gnl|my_center|LOCUS_21810 >Feature sequence361 <1 1253 gene locus_tag LOCUS_21820 <1 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393418.1:DEAD/DEAH box helicase 1243 1452 gene locus_tag LOCUS_21830 1243 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1459 3669 gene locus_tag LOCUS_21840 1459 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence362 1147 2283 gene locus_tag LOCUS_21850 1147 2283 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187228.1 protein_id gnl|my_center|LOCUS_21850 3708 2293 gene locus_tag LOCUS_21860 3708 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089877.1 protein_id gnl|my_center|LOCUS_21860 >Feature sequence363 732 580 gene locus_tag LOCUS_21870 732 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 1127 2269 gene locus_tag LOCUS_21880 1127 2269 CDS product vitamin K epoxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256200.1 protein_id gnl|my_center|LOCUS_21880 2758 2375 gene locus_tag LOCUS_21890 2758 2375 CDS product dinitrogenase iron-molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082362.1 protein_id gnl|my_center|LOCUS_21890 2911 3672 gene locus_tag LOCUS_21900 2911 3672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence364 3680 744 gene locus_tag LOCUS_21910 3680 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence365 1730 867 gene locus_tag LOCUS_21920 1730 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 <3816 1740 gene locus_tag LOCUS_21930 <3816 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258670.1:histidine kinase >Feature sequence366 317 1873 gene locus_tag LOCUS_21940 317 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 1870 2298 gene locus_tag LOCUS_21950 1870 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 2312 3655 gene locus_tag LOCUS_21960 2312 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970015.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence367 136 1044 gene locus_tag LOCUS_21970 136 1044 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_21970 1061 2047 gene locus_tag LOCUS_21980 1061 2047 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_21980 2083 2766 gene locus_tag LOCUS_21990 2083 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3059 3706 gene locus_tag LOCUS_22000 3059 3706 CDS product hemolysin III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence368 208 136 gene locus_tag LOCUS_t00240 208 136 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1761 250 gene locus_tag LOCUS_22010 gene gltX 1761 250 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAX3 protein_id gnl|my_center|LOCUS_22010 2944 1802 gene locus_tag LOCUS_22020 2944 1802 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_22020 3322 3059 gene locus_tag LOCUS_22030 3322 3059 CDS product cell division topological specificity factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816777.1 protein_id gnl|my_center|LOCUS_22030 >Feature sequence369 336 893 gene locus_tag LOCUS_22040 336 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence370 <1 825 gene locus_tag LOCUS_22050 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258461.1:amidohydrolase 2761 929 gene locus_tag LOCUS_22060 2761 929 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392243.1 protein_id gnl|my_center|LOCUS_22060 3070 2783 gene locus_tag LOCUS_22070 3070 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3498 3034 gene locus_tag LOCUS_22080 3498 3034 CDS product putative transcriptional regulator, AsnC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001704057.1 protein_id gnl|my_center|LOCUS_22080 >Feature sequence371 133 396 gene locus_tag LOCUS_22090 133 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 393 1361 gene locus_tag LOCUS_22100 393 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 1366 2691 gene locus_tag LOCUS_22110 1366 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 2688 3716 gene locus_tag LOCUS_22120 2688 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 >Feature sequence372 400 672 gene locus_tag LOCUS_22130 gene hisE 400 672 CDS product phosphoribosyl-ATP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97KH6 protein_id gnl|my_center|LOCUS_22130 669 1793 gene locus_tag LOCUS_22140 669 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 1904 2356 gene locus_tag LOCUS_22150 1904 2356 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_22150 2380 2823 gene locus_tag LOCUS_22160 2380 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2855 3268 gene locus_tag LOCUS_22170 2855 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence373 1202 96 gene locus_tag LOCUS_22180 1202 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3585 1282 gene locus_tag LOCUS_22190 3585 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence374 2709 994 gene locus_tag LOCUS_22200 2709 994 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_22200 3571 2882 gene locus_tag LOCUS_22210 3571 2882 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727258.1 protein_id gnl|my_center|LOCUS_22210 >Feature sequence375 360 1424 gene locus_tag LOCUS_22220 360 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3457 1421 gene locus_tag LOCUS_22230 gene uvrB 3457 1421 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIJ6 protein_id gnl|my_center|LOCUS_22230 >Feature sequence376 70 1200 gene locus_tag LOCUS_22240 70 1200 CDS product peptidase M24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259193.1 protein_id gnl|my_center|LOCUS_22240 1203 1964 gene locus_tag LOCUS_22250 1203 1964 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256946.1 protein_id gnl|my_center|LOCUS_22250 2169 3545 gene locus_tag LOCUS_22260 2169 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence377 <1 921 gene locus_tag LOCUS_22270 <1 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256842.1:aldehyde dehydrogenase 992 2263 gene locus_tag LOCUS_22280 992 2263 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103048.1 protein_id gnl|my_center|LOCUS_22280 2290 3624 gene locus_tag LOCUS_22290 gene gabT 2290 3624 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229620.1 protein_id gnl|my_center|LOCUS_22290 >Feature sequence378 615 382 gene locus_tag LOCUS_22300 615 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 1283 666 gene locus_tag LOCUS_22310 1283 666 CDS product DNA-directed RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731458.1 protein_id gnl|my_center|LOCUS_22310 2637 1411 gene locus_tag LOCUS_22320 2637 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_22320 3625 2765 gene locus_tag LOCUS_22330 3625 2765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024060.1 protein_id gnl|my_center|LOCUS_22330 >Feature sequence379 273 1742 gene locus_tag LOCUS_22340 273 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1845 3455 gene locus_tag LOCUS_22350 1845 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 >Feature sequence380 3 326 gene locus_tag LOCUS_22360 3 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 >Feature sequence381 293 691 gene locus_tag LOCUS_22370 293 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 1933 1145 gene locus_tag LOCUS_22380 gene fecE 1933 1145 CDS product Fe(3+) dicitrate transport ATP-binding protein FecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P15031 protein_id gnl|my_center|LOCUS_22380 2928 1933 gene locus_tag LOCUS_22390 2928 1933 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889213.1 protein_id gnl|my_center|LOCUS_22390 >Feature sequence382 1978 1529 gene locus_tag LOCUS_22400 1978 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 3205 2882 gene locus_tag LOCUS_22410 3205 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 >Feature sequence383 <1 683 gene locus_tag LOCUS_22420 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893450.1:acyl-CoA dehydrogenase 807 2051 gene locus_tag LOCUS_22430 807 2051 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095742.1 protein_id gnl|my_center|LOCUS_22430 2166 3341 gene locus_tag LOCUS_22440 gene pfk-2 2166 3341 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KFS2 protein_id gnl|my_center|LOCUS_22440 >Feature sequence384 337 1899 gene locus_tag LOCUS_22450 337 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 >Feature sequence385 1161 157 gene locus_tag LOCUS_22460 1161 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 1942 1154 gene locus_tag LOCUS_22470 1942 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2046 2618 gene locus_tag LOCUS_22480 2046 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 2784 3512 gene locus_tag LOCUS_22490 2784 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence386 169 654 gene locus_tag LOCUS_22500 169 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 660 1919 gene locus_tag LOCUS_22510 660 1919 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531232.1 protein_id gnl|my_center|LOCUS_22510 3625 2495 gene locus_tag LOCUS_22520 3625 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence387 917 423 gene locus_tag LOCUS_22530 917 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 1333 1722 gene locus_tag LOCUS_22540 1333 1722 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173507.1 protein_id gnl|my_center|LOCUS_22540 1741 2160 gene locus_tag LOCUS_22550 1741 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 >Feature sequence388 221 1357 gene locus_tag LOCUS_22560 221 1357 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583905.1 protein_id gnl|my_center|LOCUS_22560 3209 1401 gene locus_tag LOCUS_22570 3209 1401 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_22570 >Feature sequence389 1090 29 gene locus_tag LOCUS_22580 gene ychF 1090 29 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEV1 protein_id gnl|my_center|LOCUS_22580 1712 1485 gene locus_tag LOCUS_22590 1712 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 1961 1713 gene locus_tag LOCUS_22600 1961 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 2025 2109 gene locus_tag LOCUS_t00250 2025 2109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence390 751 65 gene locus_tag LOCUS_22610 751 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968146.1 protein_id gnl|my_center|LOCUS_22610 1989 748 gene locus_tag LOCUS_22620 1989 748 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_22620 3446 1992 gene locus_tag LOCUS_22630 gene mttB 3446 1992 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_22630 >Feature sequence391 330 1082 gene locus_tag LOCUS_22640 330 1082 CDS product diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258357.1 protein_id gnl|my_center|LOCUS_22640 1066 1791 gene locus_tag LOCUS_22650 1066 1791 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_22650 1807 2160 gene locus_tag LOCUS_22660 gene folB 1807 2160 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P495 protein_id gnl|my_center|LOCUS_22660 2141 2644 gene locus_tag LOCUS_22670 2141 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 3349 2714 gene locus_tag LOCUS_22680 gene folE 3349 2714 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIX0 protein_id gnl|my_center|LOCUS_22680 >Feature sequence392 370 1200 gene locus_tag LOCUS_22690 370 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 1204 1749 gene locus_tag LOCUS_22700 1204 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086306.1 protein_id gnl|my_center|LOCUS_22700 1768 2049 gene locus_tag LOCUS_22710 1768 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22710 >Feature sequence393 368 790 gene locus_tag LOCUS_22720 368 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 2036 918 gene locus_tag LOCUS_22730 2036 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence394 160 2619 gene locus_tag LOCUS_22740 160 2619 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057085.1 protein_id gnl|my_center|LOCUS_22740 >Feature sequence395 609 85 gene locus_tag LOCUS_22750 609 85 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_22750 3129 619 gene locus_tag LOCUS_22760 gene recG 3129 619 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU5 protein_id gnl|my_center|LOCUS_22760 >Feature sequence396 <1 773 gene locus_tag LOCUS_22770 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257679.1:glycosyl transferase 839 1234 gene locus_tag LOCUS_22780 839 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 1695 1273 gene locus_tag LOCUS_22790 1695 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3218 1707 gene locus_tag LOCUS_22800 3218 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 >Feature sequence397 <1 1177 gene locus_tag LOCUS_22810 <1 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940403.1:cytochrome b561 1179 1748 gene locus_tag LOCUS_22820 1179 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 1761 2996 gene locus_tag LOCUS_22830 1761 2996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 >Feature sequence398 79 819 gene locus_tag LOCUS_22840 79 819 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAJ7 protein_id gnl|my_center|LOCUS_22840 1324 1031 gene locus_tag LOCUS_22850 gene acyP 1324 1031 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2S0V7 protein_id gnl|my_center|LOCUS_22850 2600 1374 gene locus_tag LOCUS_22860 2600 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 <3512 2602 gene locus_tag LOCUS_22870 <3512 2602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257625.1:transporter >Feature sequence399 1 660 gene locus_tag LOCUS_22880 1 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 829 1767 gene locus_tag LOCUS_22890 829 1767 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865348.1 protein_id gnl|my_center|LOCUS_22890 1764 3461 gene locus_tag LOCUS_22900 1764 3461 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_22900 >Feature sequence400 179 517 gene locus_tag LOCUS_22910 179 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 751 2889 gene locus_tag LOCUS_22920 751 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence401 1123 386 gene locus_tag LOCUS_22930 1123 386 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_22930 2418 1126 gene locus_tag LOCUS_22940 2418 1126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933005.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence402 <1 548 gene locus_tag LOCUS_22950 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256740.1:transcriptional regulator 553 1599 gene locus_tag LOCUS_22960 gene cheB 553 1599 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGY6 protein_id gnl|my_center|LOCUS_22960 1621 2505 gene locus_tag LOCUS_22970 1621 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2559 2942 gene locus_tag LOCUS_22980 2559 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 >Feature sequence403 390 1340 gene locus_tag LOCUS_22990 390 1340 CDS product fructose-1,6-bisphosphate aldolase, class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_22990 2661 1477 gene locus_tag LOCUS_23000 2661 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 3234 2674 gene locus_tag LOCUS_23010 3234 2674 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence404 <1 554 gene locus_tag LOCUS_23020 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861868.1:chlorohydrolase 604 1260 gene locus_tag LOCUS_23030 604 1260 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_23030 1334 2122 gene locus_tag LOCUS_23040 1334 2122 CDS product F420-0--gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_23040 2292 2675 gene locus_tag LOCUS_23050 2292 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2676 3278 gene locus_tag LOCUS_23060 2676 3278 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259451.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence405 1859 1284 gene locus_tag LOCUS_23070 1859 1284 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259416.1 protein_id gnl|my_center|LOCUS_23070 3310 1997 gene locus_tag LOCUS_23080 3310 1997 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147002.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence406 175 978 gene locus_tag LOCUS_23090 175 978 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257281.1 protein_id gnl|my_center|LOCUS_23090 1128 3368 gene locus_tag LOCUS_23100 1128 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 >Feature sequence407 >Feature sequence408 1771 860 gene locus_tag LOCUS_23110 1771 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2127 1768 gene locus_tag LOCUS_23120 2127 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 3320 2202 gene locus_tag LOCUS_23130 3320 2202 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 protein_id gnl|my_center|LOCUS_23130 >Feature sequence409 70 1050 gene locus_tag LOCUS_23140 gene mvaD 70 1050 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_23140 1291 2358 gene locus_tag LOCUS_23150 1291 2358 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_23150 2355 3332 gene locus_tag LOCUS_23160 2355 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence410 <3373 296 gene locus_tag LOCUS_23170 <3373 296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WH11:DNA-directed RNA polymerase subunit beta' >Feature sequence411 2693 297 gene locus_tag LOCUS_23180 2693 297 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX2 protein_id gnl|my_center|LOCUS_23180 >Feature sequence412 <1 1809 gene locus_tag LOCUS_23190 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337730.1:drug:proton antiporter 1856 2536 gene locus_tag LOCUS_23200 1856 2536 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708366.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence413 2257 1325 gene locus_tag LOCUS_23210 2257 1325 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_23210 <3343 2267 gene locus_tag LOCUS_23220 <3343 2267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225205.1:AI-2E family transporter >Feature sequence414 900 418 gene locus_tag LOCUS_23230 900 418 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_23230 1322 2050 gene locus_tag LOCUS_23240 1322 2050 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258641.1 protein_id gnl|my_center|LOCUS_23240 >Feature sequence415 308 592 gene locus_tag LOCUS_23250 308 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 785 2191 gene locus_tag LOCUS_23260 785 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 3320 2340 gene locus_tag LOCUS_23270 3320 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435528.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence416 2130 931 gene locus_tag LOCUS_23280 2130 931 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257139.1 protein_id gnl|my_center|LOCUS_23280 2632 2138 gene locus_tag LOCUS_23290 2632 2138 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958447.1 protein_id gnl|my_center|LOCUS_23290 3006 2629 gene locus_tag LOCUS_23300 3006 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 >Feature sequence417 >Feature sequence418 <1 1313 gene locus_tag LOCUS_23310 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878349.1:Na+/H+ antiporter 1315 1575 gene locus_tag LOCUS_23320 1315 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 1684 1956 gene locus_tag LOCUS_23330 1684 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_23330 2399 1953 gene locus_tag LOCUS_23340 2399 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 3027 2416 gene locus_tag LOCUS_23350 3027 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 >Feature sequence419 864 2264 gene locus_tag LOCUS_23360 864 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2261 2683 gene locus_tag LOCUS_23370 2261 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 2696 2917 gene locus_tag LOCUS_23380 2696 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence420 3 1274 gene locus_tag LOCUS_23390 3 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2656 1382 gene locus_tag LOCUS_23400 2656 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence421 1813 431 gene locus_tag LOCUS_23410 1813 431 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_23410 2502 1813 gene locus_tag LOCUS_23420 2502 1813 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_23420 3299 2499 gene locus_tag LOCUS_23430 3299 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 >Feature sequence422 1871 786 gene locus_tag LOCUS_23440 gene hypE 1871 786 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_23440 2959 1868 gene locus_tag LOCUS_23450 2959 1868 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_23450 3234 2956 gene locus_tag LOCUS_23460 3234 2956 CDS product hydrogenase assembly protein HypC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258619.1 protein_id gnl|my_center|LOCUS_23460 >Feature sequence423 59 1615 gene locus_tag LOCUS_23470 59 1615 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_23470 1617 2750 gene locus_tag LOCUS_23480 1617 2750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_23480 >Feature sequence424 758 1363 gene locus_tag LOCUS_23490 758 1363 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842287.1 protein_id gnl|my_center|LOCUS_23490 2198 1416 gene locus_tag LOCUS_23500 2198 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 3117 2224 gene locus_tag LOCUS_23510 3117 2224 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFC7 protein_id gnl|my_center|LOCUS_23510 >Feature sequence425 >Feature sequence426 823 1509 gene locus_tag LOCUS_23520 823 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 3138 1528 gene locus_tag LOCUS_23530 gene pyrG 3138 1528 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ75 protein_id gnl|my_center|LOCUS_23530 >Feature sequence427 54 182 gene locus_tag LOCUS_23540 54 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1560 241 gene locus_tag LOCUS_23550 1560 241 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110007.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence428 <1 912 gene locus_tag LOCUS_23560 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEX0:chaperone protein DnaJ 909 1826 gene locus_tag LOCUS_23570 gene prmA 909 1826 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD89 protein_id gnl|my_center|LOCUS_23570 2460 1978 gene locus_tag LOCUS_23580 2460 1978 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867778.1 protein_id gnl|my_center|LOCUS_23580 <3226 2513 gene locus_tag LOCUS_23590 <3226 2513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583008.1:GTP-binding protein >Feature sequence429 <1 1095 gene locus_tag LOCUS_23600 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8NSE1:DNA helicase 1178 1819 gene locus_tag LOCUS_23610 1178 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 1807 2646 gene locus_tag LOCUS_23620 1807 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 >Feature sequence430 <1 777 gene locus_tag LOCUS_23630 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258637.1:peptide ABC transporter permease 837 1571 gene locus_tag LOCUS_23640 837 1571 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_23640 1641 2582 gene locus_tag LOCUS_23650 1641 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 >Feature sequence431 1611 730 gene locus_tag LOCUS_23660 1611 730 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_23660 2993 1611 gene locus_tag LOCUS_23670 2993 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227990.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence432 2544 364 gene locus_tag LOCUS_23680 2544 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 >Feature sequence433 <1 1264 gene locus_tag LOCUS_23690 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257654.1:sugar transporter 1405 1854 gene locus_tag LOCUS_23700 1405 1854 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941998.1 protein_id gnl|my_center|LOCUS_23700 1940 2680 gene locus_tag LOCUS_23710 1940 2680 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HUE5 protein_id gnl|my_center|LOCUS_23710 <3184 2683 gene locus_tag LOCUS_23720 <3184 2683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393400.1:multidrug ABC transporter ATP-binding protein >Feature sequence434 1846 1995 gene locus_tag LOCUS_23730 1846 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 <3161 2027 gene locus_tag LOCUS_23740 <3161 2027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEA4:alpha-amylase >Feature sequence435 1474 719 gene locus_tag LOCUS_23750 1474 719 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888239.1 protein_id gnl|my_center|LOCUS_23750 <3161 1545 gene locus_tag LOCUS_23760 <3161 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256757.1:ATPase P >Feature sequence436 1222 2985 gene locus_tag LOCUS_23770 1222 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence437 365 3121 gene locus_tag LOCUS_23780 gene recQ 365 3121 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence438 108 509 gene locus_tag LOCUS_23790 108 509 CDS product iron-sulfur cluster scaffold-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_23790 512 853 gene locus_tag LOCUS_23800 512 853 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976896.1 protein_id gnl|my_center|LOCUS_23800 1609 854 gene locus_tag LOCUS_23810 1609 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2208 1606 gene locus_tag LOCUS_23820 2208 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 2314 3045 gene locus_tag LOCUS_23830 2314 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence439 <1 1293 gene locus_tag LOCUS_23840 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939361.1:peptide-binding protein 1379 2413 gene locus_tag LOCUS_23850 1379 2413 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258638.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence440 <1 1432 gene locus_tag LOCUS_23860 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74H67:protein TolB 1429 2568 gene locus_tag LOCUS_23870 1429 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 2689 3057 gene locus_tag LOCUS_23880 2689 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence441 186 542 gene locus_tag LOCUS_23890 186 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 539 1360 gene locus_tag LOCUS_23900 539 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 1580 1738 gene locus_tag LOCUS_23910 1580 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 1979 2854 gene locus_tag LOCUS_23920 1979 2854 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_23920 >Feature sequence442 <1 894 gene locus_tag LOCUS_23930 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001046594.1:D-cysteine desulfhydrase 1175 2821 gene locus_tag LOCUS_23940 1175 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence443 123 680 gene locus_tag LOCUS_23950 123 680 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_23950 693 1031 gene locus_tag LOCUS_23960 693 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1215 1418 gene locus_tag LOCUS_23970 1215 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1934 1470 gene locus_tag LOCUS_23980 1934 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 2982 1927 gene locus_tag LOCUS_23990 gene fbpC 2982 1927 CDS product Fe(3+) ions import ATP-binding protein FbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O86751 protein_id gnl|my_center|LOCUS_23990 >Feature sequence444 83 757 gene locus_tag LOCUS_24000 gene hypB 83 757 CDS product hydrogenase accessory protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence445 1485 577 gene locus_tag LOCUS_24010 1485 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 <3061 1494 gene locus_tag LOCUS_24020 <3061 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A0QNG1:serine/threonine-protein kinase PknB >Feature sequence446 <1 508 gene locus_tag LOCUS_24030 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WK84:leucine--tRNA ligase 548 1246 gene locus_tag LOCUS_24040 548 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1384 1773 gene locus_tag LOCUS_24050 1384 1773 CDS product endoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_24050 1965 2978 gene locus_tag LOCUS_24060 gene exoA 1965 2978 CDS product succinoglycan biosynthesis protein exoa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337572.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence447 >Feature sequence448 312 1232 gene locus_tag LOCUS_24070 312 1232 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_24070 1329 2096 gene locus_tag LOCUS_24080 1329 2096 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406327.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence449 <1 2914 gene locus_tag LOCUS_24090 <1 2914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932984.1:beta-phosphoglucomutase >Feature sequence450 2077 494 gene locus_tag LOCUS_24100 2077 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 2639 2088 gene locus_tag LOCUS_24110 2639 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 3041 2781 gene locus_tag LOCUS_24120 3041 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence451 2796 25 gene locus_tag LOCUS_24130 2796 25 CDS product selenium-dependent xanthine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891588.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence452 777 79 gene locus_tag LOCUS_24140 777 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1584 802 gene locus_tag LOCUS_24150 1584 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1919 2254 gene locus_tag LOCUS_24160 1919 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 2387 2920 gene locus_tag LOCUS_24170 2387 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 >Feature sequence453 1879 1268 gene locus_tag LOCUS_24180 gene pth 1879 1268 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS1 protein_id gnl|my_center|LOCUS_24180 2534 1938 gene locus_tag LOCUS_24190 2534 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence454 <3011 627 gene locus_tag LOCUS_24200 <3011 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393588.1:thiol reductant ABC exporter subunit CydC >Feature sequence455 <1 558 gene locus_tag LOCUS_24210 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876526.1:tyrosine recombinase XerC 1031 570 gene locus_tag LOCUS_24220 1031 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1287 1009 gene locus_tag LOCUS_24230 1287 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence456 <1 944 gene locus_tag LOCUS_24240 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979803.1:acylaminoacyl-peptidase 1200 2363 gene locus_tag LOCUS_24250 1200 2363 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257433.1 protein_id gnl|my_center|LOCUS_24250 >Feature sequence457 1341 1859 gene locus_tag LOCUS_24260 1341 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 1856 2710 gene locus_tag LOCUS_24270 1856 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 >Feature sequence458 1 1062 gene locus_tag LOCUS_24280 1 1062 CDS product 3-hydroxy-3-methylglutaryl coenzyme A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC96 protein_id gnl|my_center|LOCUS_24280 1059 2177 gene locus_tag LOCUS_24290 1059 2177 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence459 134 589 gene locus_tag LOCUS_24300 134 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1161 667 gene locus_tag LOCUS_24310 1161 667 CDS product secondary thiamine-phosphate synthase enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003576695.1 protein_id gnl|my_center|LOCUS_24310 1885 1172 gene locus_tag LOCUS_24320 1885 1172 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674983.1 protein_id gnl|my_center|LOCUS_24320 2877 1906 gene locus_tag LOCUS_24330 2877 1906 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262028.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence460 456 1064 gene locus_tag LOCUS_24340 456 1064 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258019.1 protein_id gnl|my_center|LOCUS_24340 2846 1134 gene locus_tag LOCUS_24350 2846 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence461 2100 73 gene locus_tag LOCUS_24360 2100 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 2816 2151 gene locus_tag LOCUS_24370 2816 2151 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887630.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence462 51 863 gene locus_tag LOCUS_24380 51 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263894.1 protein_id gnl|my_center|LOCUS_24380 1835 903 gene locus_tag LOCUS_24390 1835 903 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_24390 <2930 2107 gene locus_tag LOCUS_24400 <2930 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F0KKD4:phosphonoacetaldehyde hydrolase >Feature sequence463 287 63 gene locus_tag LOCUS_24410 287 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 624 1553 gene locus_tag LOCUS_24420 624 1553 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901998.1 protein_id gnl|my_center|LOCUS_24420 1735 2526 gene locus_tag LOCUS_24430 1735 2526 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFC6 protein_id gnl|my_center|LOCUS_24430 >Feature sequence464 1359 403 gene locus_tag LOCUS_24440 1359 403 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_24440 1952 1356 gene locus_tag LOCUS_24450 1952 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 2827 1949 gene locus_tag LOCUS_24460 2827 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 >Feature sequence465 529 738 gene locus_tag LOCUS_24470 529 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 770 2062 gene locus_tag LOCUS_24480 770 2062 CDS product type II secretion system protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256416.1 protein_id gnl|my_center|LOCUS_24480 2180 2473 gene locus_tag LOCUS_24490 2180 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence466 632 99 gene locus_tag LOCUS_24500 632 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 2711 888 gene locus_tag LOCUS_24510 2711 888 CDS product collagenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108288.1 protein_id gnl|my_center|LOCUS_24510 >Feature sequence467 2594 849 gene locus_tag LOCUS_24520 2594 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence468 809 99 gene locus_tag LOCUS_24530 809 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(558..560),aa:Sec) note codon on position 84 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_24530 <2899 978 gene locus_tag LOCUS_24540 <2899 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8VNW3:K(+)-insensitive pyrophosphate-energized proton pump >Feature sequence469 181 1056 gene locus_tag LOCUS_24550 181 1056 CDS product chromosome partitioning protein ParB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_24550 1723 1073 gene locus_tag LOCUS_24560 1723 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 2783 1707 gene locus_tag LOCUS_24570 gene rfbB-1 2783 1707 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q888E5 protein_id gnl|my_center|LOCUS_24570 >Feature sequence470 2237 735 gene locus_tag LOCUS_24580 2237 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 <2881 2234 gene locus_tag LOCUS_24590 <2881 2234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256604.1:glycosyl transferase family 1 >Feature sequence471 86 1558 gene locus_tag LOCUS_24600 86 1558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2370 1630 gene locus_tag LOCUS_24610 2370 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence472 2340 1447 gene locus_tag LOCUS_24620 2340 1447 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228552.1 protein_id gnl|my_center|LOCUS_24620 2795 2370 gene locus_tag LOCUS_24630 2795 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140845.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence473 349 1527 gene locus_tag LOCUS_24640 349 1527 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_24640 1653 2585 gene locus_tag LOCUS_24650 gene livH 1653 2585 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence474 <1 922 gene locus_tag LOCUS_24660 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000436783.1:proline dehydrogenase 2445 982 gene locus_tag LOCUS_24670 2445 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence475 <1 900 gene locus_tag LOCUS_24680 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932107.1:xylose isomerase >Feature sequence476 2679 1432 gene locus_tag LOCUS_24690 2679 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 >Feature sequence477 1506 268 gene locus_tag LOCUS_24700 gene sbcD 1506 268 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBP0 protein_id gnl|my_center|LOCUS_24700 1946 1512 gene locus_tag LOCUS_24710 1946 1512 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141707.1 protein_id gnl|my_center|LOCUS_24710 2242 1943 gene locus_tag LOCUS_24720 2242 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2831 2343 gene locus_tag LOCUS_24730 2831 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence478 2490 499 gene locus_tag LOCUS_24740 gene mtaD 2490 499 CDS product 5-methylthioadenosine/S-adenosylhomocysteine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDV9 protein_id gnl|my_center|LOCUS_24740 >Feature sequence479 1858 944 gene locus_tag LOCUS_24750 1858 944 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082725.1 protein_id gnl|my_center|LOCUS_24750 2532 1969 gene locus_tag LOCUS_24760 2532 1969 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082723.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence480 384 1667 gene locus_tag LOCUS_24770 gene selA 384 1667 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF3 protein_id gnl|my_center|LOCUS_24770 >Feature sequence481 158 1918 gene locus_tag LOCUS_24780 158 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 >Feature sequence482 <1 1201 gene locus_tag LOCUS_24790 <1 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256431.1:histidine kinase 1489 2130 gene locus_tag LOCUS_24800 1489 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2184 2588 gene locus_tag LOCUS_24810 2184 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 >Feature sequence483 2748 586 gene locus_tag LOCUS_24820 2748 586 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257848.1 protein_id gnl|my_center|LOCUS_24820 >Feature sequence484 592 804 gene locus_tag LOCUS_24830 592 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence485 <1 773 gene locus_tag LOCUS_24840 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940008.1:branched-chain amino acid ABC transporter permease 754 1524 gene locus_tag LOCUS_24850 gene livG 754 1524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940007.1 protein_id gnl|my_center|LOCUS_24850 1521 2249 gene locus_tag LOCUS_24860 gene livF 1521 2249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_24860 >Feature sequence486 221 1198 gene locus_tag LOCUS_24870 221 1198 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255969.1 protein_id gnl|my_center|LOCUS_24870 2079 1300 gene locus_tag LOCUS_24880 2079 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 >Feature sequence487 293 1285 gene locus_tag LOCUS_24890 293 1285 CDS product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257805.1 protein_id gnl|my_center|LOCUS_24890 1329 1401 gene locus_tag LOCUS_t00260 1329 1401 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence488 2182 497 gene locus_tag LOCUS_24900 2182 497 CDS product serine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084759.1 protein_id gnl|my_center|LOCUS_24900 >Feature sequence489 2116 1478 gene locus_tag LOCUS_24910 2116 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence490 1140 79 gene locus_tag LOCUS_24920 1140 79 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_24920 1967 1137 gene locus_tag LOCUS_24930 gene rsmI 1967 1137 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMF4 protein_id gnl|my_center|LOCUS_24930 2761 1964 gene locus_tag LOCUS_24940 2761 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence491 1715 561 gene locus_tag LOCUS_24950 1715 561 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545909.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence492 <1 2595 gene locus_tag LOCUS_24960 <1 2595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257687.1:DEAD/DEAH box helicase >Feature sequence493 <1 1209 gene locus_tag LOCUS_24970 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878005.1:acyl-CoA dehydrogenase 1269 2423 gene locus_tag LOCUS_24980 1269 2423 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259419.1 protein_id gnl|my_center|LOCUS_24980 >Feature sequence494 526 1800 gene locus_tag LOCUS_24990 gene serS 526 1800 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE34 protein_id gnl|my_center|LOCUS_24990 1917 2414 gene locus_tag LOCUS_25000 1917 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence495 727 44 gene locus_tag LOCUS_25010 727 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 884 1675 gene locus_tag LOCUS_25020 884 1675 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence496 124 912 gene locus_tag LOCUS_25030 124 912 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584118.1 protein_id gnl|my_center|LOCUS_25030 974 2677 gene locus_tag LOCUS_25040 974 2677 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence497 >Feature sequence498 114 998 gene locus_tag LOCUS_25050 114 998 CDS product methyltetrahydrofolate--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719921.1 protein_id gnl|my_center|LOCUS_25050 1065 1652 gene locus_tag LOCUS_25060 1065 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708368.1 protein_id gnl|my_center|LOCUS_25060 >Feature sequence499 <1 1035 gene locus_tag LOCUS_25070 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014146.1:MFS transporter 1124 2380 gene locus_tag LOCUS_25080 1124 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 >Feature sequence500 1358 2560 gene locus_tag LOCUS_25090 1358 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877033.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence501 2096 1359 gene locus_tag LOCUS_25100 2096 1359 CDS product SURF1-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC66 protein_id gnl|my_center|LOCUS_25100 >Feature sequence502 >Feature sequence503 301 864 gene locus_tag LOCUS_25110 301 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2075 1023 gene locus_tag LOCUS_25120 gene yhfE 2075 1023 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000930034.1 protein_id gnl|my_center|LOCUS_25120 2516 2100 gene locus_tag LOCUS_25130 2516 2100 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_25130 >Feature sequence504 2341 1622 gene locus_tag LOCUS_25140 2341 1622 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence505 55 1293 gene locus_tag LOCUS_25150 55 1293 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJX3 protein_id gnl|my_center|LOCUS_25150 1656 2372 gene locus_tag LOCUS_25160 gene rnc 1656 2372 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51833 protein_id gnl|my_center|LOCUS_25160 >Feature sequence506 >Feature sequence507 98 1378 gene locus_tag LOCUS_25170 98 1378 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258503.1 protein_id gnl|my_center|LOCUS_25170 1382 2467 gene locus_tag LOCUS_25180 1382 2467 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391697.1 protein_id gnl|my_center|LOCUS_25180 >Feature sequence508 <1 1085 gene locus_tag LOCUS_25190 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022429.1:phosphoenolpyruvate synthase 1174 2394 gene locus_tag LOCUS_25200 gene dinB 1174 2394 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DXW9 protein_id gnl|my_center|LOCUS_25200 >Feature sequence509 631 29 gene locus_tag LOCUS_25210 631 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 899 681 gene locus_tag LOCUS_25220 899 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 1542 1036 gene locus_tag LOCUS_25230 1542 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 2425 1664 gene locus_tag LOCUS_25240 2425 1664 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence510 2557 110 gene locus_tag LOCUS_25250 gene gyrA 2557 110 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK19 protein_id gnl|my_center|LOCUS_25250 >Feature sequence511 2237 981 gene locus_tag LOCUS_25260 2237 981 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257201.1 protein_id gnl|my_center|LOCUS_25260 2420 2492 gene locus_tag LOCUS_t00270 2420 2492 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence512 1317 184 gene locus_tag LOCUS_25270 1317 184 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056097.1 protein_id gnl|my_center|LOCUS_25270 2252 1314 gene locus_tag LOCUS_25280 2252 1314 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065032.1 protein_id gnl|my_center|LOCUS_25280 >Feature sequence513 >Feature sequence514 66 635 gene locus_tag LOCUS_25290 66 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 679 1698 gene locus_tag LOCUS_25300 679 1698 CDS product putative acetyltransferase, GNAT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001705050.1 protein_id gnl|my_center|LOCUS_25300 1773 2375 gene locus_tag LOCUS_25310 1773 2375 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888340.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence515 146 27 gene locus_tag LOCUS_25320 146 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 914 195 gene locus_tag LOCUS_25330 914 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 >Feature sequence516 1454 225 gene locus_tag LOCUS_25340 1454 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 2421 1501 gene locus_tag LOCUS_25350 2421 1501 CDS product glutamine cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_25350 >Feature sequence517 53 1402 gene locus_tag LOCUS_25360 gene hflX 53 1402 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDT2 protein_id gnl|my_center|LOCUS_25360 1402 1611 gene locus_tag LOCUS_25370 1402 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 <2596 1729 gene locus_tag LOCUS_25380 <2596 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8UJ94:phosphoenolpyruvate carboxykinase [ATP] >Feature sequence518 <1 1125 gene locus_tag LOCUS_25390 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403889.1:D-alanine--D-alanine ligase 1118 2476 gene locus_tag LOCUS_25400 1118 2476 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889287.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence519 200 601 gene locus_tag LOCUS_25410 200 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 618 1862 gene locus_tag LOCUS_25420 618 1862 CDS product rRNA (guanine-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886697.1 protein_id gnl|my_center|LOCUS_25420 1917 2333 gene locus_tag LOCUS_25430 1917 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence520 1172 330 gene locus_tag LOCUS_25440 1172 330 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876335.1 protein_id gnl|my_center|LOCUS_25440 2426 1248 gene locus_tag LOCUS_25450 2426 1248 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256713.1 protein_id gnl|my_center|LOCUS_25450 >Feature sequence521 761 639 gene locus_tag LOCUS_25460 761 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1231 1004 gene locus_tag LOCUS_25470 1231 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272681.1 protein_id gnl|my_center|LOCUS_25470 1549 1289 gene locus_tag LOCUS_25480 1549 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272681.1 protein_id gnl|my_center|LOCUS_25480 <2581 1722 gene locus_tag LOCUS_25490 <2581 1722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029960.1:membrane protein >Feature sequence522 541 1176 gene locus_tag LOCUS_25500 gene udk 541 1176 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCC8 protein_id gnl|my_center|LOCUS_25500 1191 1736 gene locus_tag LOCUS_25510 1191 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence523 682 167 gene locus_tag LOCUS_25520 682 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 842 717 gene locus_tag LOCUS_25530 842 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence524 382 1245 gene locus_tag LOCUS_25540 382 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence525 1292 156 gene locus_tag LOCUS_25550 1292 156 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391405.1 protein_id gnl|my_center|LOCUS_25550 <2551 1312 gene locus_tag LOCUS_25560 <2551 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392195.1:glycosyltransferase WbuB >Feature sequence526 302 1753 gene locus_tag LOCUS_25570 302 1753 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_25570 1784 2101 gene locus_tag LOCUS_25580 1784 2101 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_25580 2098 2478 gene locus_tag LOCUS_25590 2098 2478 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869637.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence527 <1 819 gene locus_tag LOCUS_25600 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015945170.1:trimethylamine methyltransferase >Feature sequence528 871 101 gene locus_tag LOCUS_25610 871 101 CDS product type 11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259313.1 protein_id gnl|my_center|LOCUS_25610 997 1272 gene locus_tag LOCUS_25620 997 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 1259 1672 gene locus_tag LOCUS_25630 1259 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 <2544 1673 gene locus_tag LOCUS_25640 <2544 1673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259312.1:glycosyl transferase family 1 >Feature sequence529 809 318 gene locus_tag LOCUS_25650 809 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 1637 978 gene locus_tag LOCUS_25660 1637 978 CDS product peptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948859.1 protein_id gnl|my_center|LOCUS_25660 <2544 1630 gene locus_tag LOCUS_25670 <2544 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941993.1:ABC transporter permease >Feature sequence530 >Feature sequence531 1131 67 gene locus_tag LOCUS_25680 1131 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 1195 2133 gene locus_tag LOCUS_25690 1195 2133 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258345.1 protein_id gnl|my_center|LOCUS_25690 >Feature sequence532 1456 851 gene locus_tag LOCUS_25700 1456 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 2391 1609 gene locus_tag LOCUS_25710 2391 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 >Feature sequence533 3 605 gene locus_tag LOCUS_25720 3 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 605 1531 gene locus_tag LOCUS_25730 605 1531 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence534 <1 819 gene locus_tag LOCUS_25740 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546431.1:2-amino-3-ketobutyrate CoA ligase note possible pseudo, frameshifted 911 1144 gene locus_tag LOCUS_25750 911 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25750 1227 2438 gene locus_tag LOCUS_25760 gene rlmI 1227 2438 CDS product ribosomal RNA large subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CK07 protein_id gnl|my_center|LOCUS_25760 >Feature sequence535 1123 377 gene locus_tag LOCUS_25770 1123 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258597.1 protein_id gnl|my_center|LOCUS_25770 2365 1214 gene locus_tag LOCUS_25780 2365 1214 CDS product aminotransferase class I/II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence536 258 1535 gene locus_tag LOCUS_25790 gene yprB 258 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50837 protein_id gnl|my_center|LOCUS_25790 1545 2318 gene locus_tag LOCUS_25800 1545 2318 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_25800 2490 2299 gene locus_tag LOCUS_25810 2490 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence537 3 779 gene locus_tag LOCUS_25820 3 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 779 2242 gene locus_tag LOCUS_25830 779 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 >Feature sequence538 807 2060 gene locus_tag LOCUS_25840 807 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence539 933 481 gene locus_tag LOCUS_25850 933 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 1379 945 gene locus_tag LOCUS_25860 1379 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 2176 1376 gene locus_tag LOCUS_25870 2176 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_25870 >Feature sequence540 2043 1099 gene locus_tag LOCUS_25880 2043 1099 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066803.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence541 1079 174 gene locus_tag LOCUS_25890 1079 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25890 2212 1127 gene locus_tag LOCUS_25900 2212 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25900 >Feature sequence542 81 746 gene locus_tag LOCUS_25910 gene qcrB 81 746 CDS product menaquinol-cytochrome c reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P46912 protein_id gnl|my_center|LOCUS_25910 >Feature sequence543 >Feature sequence544 17 370 gene locus_tag LOCUS_25920 17 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 488 1822 gene locus_tag LOCUS_25930 488 1822 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM66 protein_id gnl|my_center|LOCUS_25930 >Feature sequence545 114 878 gene locus_tag LOCUS_25940 114 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1041 2402 gene locus_tag LOCUS_25950 1041 2402 CDS product sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_25950 >Feature sequence546 >Feature sequence547 <1 681 gene locus_tag LOCUS_25960 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIL8:acetylglutamate kinase 755 1117 gene locus_tag LOCUS_25970 755 1117 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_25970 1196 2356 gene locus_tag LOCUS_25980 gene argD 1196 2356 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB46 protein_id gnl|my_center|LOCUS_25980 >Feature sequence548 <2433 538 gene locus_tag LOCUS_25990 <2433 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390869.1:amidotransferase 1, exosortase A system-associated >Feature sequence549 >Feature sequence550 <1 914 gene locus_tag LOCUS_26000 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to O05511:putative mannose-6-phosphate isomerase GmuF 1795 932 gene locus_tag LOCUS_26010 1795 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence551 <2420 1690 gene locus_tag LOCUS_26020 <2420 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073841.1:cytochrome c >Feature sequence552 1605 907 gene locus_tag LOCUS_26030 1605 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2118 1618 gene locus_tag LOCUS_26040 2118 1618 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence553 286 732 gene locus_tag LOCUS_26050 286 732 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831103.1 protein_id gnl|my_center|LOCUS_26050 1524 838 gene locus_tag LOCUS_26060 1524 838 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9X0P5 protein_id gnl|my_center|LOCUS_26060 1812 2021 gene locus_tag LOCUS_26070 gene yyzM 1812 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3V8 protein_id gnl|my_center|LOCUS_26070 2005 2400 gene locus_tag LOCUS_26080 2005 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 >Feature sequence554 2268 241 gene locus_tag LOCUS_26090 2268 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 >Feature sequence555 664 1494 gene locus_tag LOCUS_26100 664 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1727 2353 gene locus_tag LOCUS_26110 1727 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 >Feature sequence556 564 2165 gene locus_tag LOCUS_26120 gene mviN 564 2165 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74DZ3 protein_id gnl|my_center|LOCUS_26120 >Feature sequence557 <1 507 gene locus_tag LOCUS_26130 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887604.1:peptide ABC transporter permease 519 1457 gene locus_tag LOCUS_26140 gene oppC 519 1457 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453817.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence558 <1 1451 gene locus_tag LOCUS_26150 <1 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256569.1:long-chain-fatty-acid--CoA ligase 1518 2234 gene locus_tag LOCUS_26160 1518 2234 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000926759.1 protein_id gnl|my_center|LOCUS_26160 >Feature sequence559 1720 62 gene locus_tag LOCUS_26170 gene groL1 1720 62 CDS product 60 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJN7 protein_id gnl|my_center|LOCUS_26170 2076 1744 gene locus_tag LOCUS_26180 gene groE 2076 1744 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CVA7 protein_id gnl|my_center|LOCUS_26180 >Feature sequence560 >Feature sequence561 <1 544 gene locus_tag LOCUS_26190 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003971606.1:TetR family transcriptional regulator 541 1872 gene locus_tag LOCUS_26200 541 1872 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184355.1 protein_id gnl|my_center|LOCUS_26200 1869 2342 gene locus_tag LOCUS_26210 1869 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence562 993 31 gene locus_tag LOCUS_26220 993 31 CDS product recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_26220 1230 1448 gene locus_tag LOCUS_26230 1230 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 1479 1898 gene locus_tag LOCUS_26240 1479 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 >Feature sequence563 <2329 1035 gene locus_tag LOCUS_26250 <2329 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257645.1:ABC transporter >Feature sequence564 163 423 gene locus_tag LOCUS_26260 163 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 426 2132 gene locus_tag LOCUS_26270 426 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 >Feature sequence565 679 116 gene locus_tag LOCUS_26280 679 116 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_26280 1488 706 gene locus_tag LOCUS_26290 1488 706 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_26290 <2304 1485 gene locus_tag LOCUS_26300 <2304 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865396.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence566 430 11 gene locus_tag LOCUS_26310 gene gntR 430 11 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121720.1 protein_id gnl|my_center|LOCUS_26310 2135 630 gene locus_tag LOCUS_26320 2135 630 CDS product peptidase S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257170.1 protein_id gnl|my_center|LOCUS_26320 >Feature sequence567 68 1990 gene locus_tag LOCUS_26330 68 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence568 159 1364 gene locus_tag LOCUS_26340 159 1364 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_26340 1450 1779 gene locus_tag LOCUS_26350 1450 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2292 1846 gene locus_tag LOCUS_26360 2292 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 >Feature sequence569 >Feature sequence570 1567 395 gene locus_tag LOCUS_26370 1567 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 2006 1638 gene locus_tag LOCUS_26380 2006 1638 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868673.1 protein_id gnl|my_center|LOCUS_26380 >Feature sequence571 678 1934 gene locus_tag LOCUS_26390 678 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence572 <1 825 gene locus_tag LOCUS_26400 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258106.1:GlcNAc-PI de-N-acetylase 903 2147 gene locus_tag LOCUS_26410 903 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence573 865 1245 gene locus_tag LOCUS_26420 gene crcB 865 1245 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0J1 protein_id gnl|my_center|LOCUS_26420 >Feature sequence574 158 490 gene locus_tag LOCUS_26430 158 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 543 1319 gene locus_tag LOCUS_26440 543 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 1463 1597 gene locus_tag LOCUS_26450 1463 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence575 1962 1474 gene locus_tag LOCUS_26460 1962 1474 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_26460 2101 1967 gene locus_tag LOCUS_26470 2101 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 >Feature sequence576 693 19 gene locus_tag LOCUS_26480 gene dsbD 693 19 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_26480 1160 699 gene locus_tag LOCUS_26490 1160 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 <2233 1160 gene locus_tag LOCUS_26500 <2233 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256200.1:vitamin K epoxide reductase >Feature sequence577 934 206 gene locus_tag LOCUS_26510 934 206 CDS product polyphosphate glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_26510 1387 995 gene locus_tag LOCUS_26520 1387 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886681.1 protein_id gnl|my_center|LOCUS_26520 <2227 1721 gene locus_tag LOCUS_26530 <2227 1721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531970.1:isoprenylcysteine carboxyl methyltransferase >Feature sequence578 1575 1994 gene locus_tag LOCUS_26540 1575 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 >Feature sequence579 544 1932 gene locus_tag LOCUS_26550 544 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence580 758 246 gene locus_tag LOCUS_26560 758 246 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704824.1 protein_id gnl|my_center|LOCUS_26560 1537 755 gene locus_tag LOCUS_26570 1537 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 >Feature sequence581 174 404 gene locus_tag LOCUS_26580 174 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_26580 401 535 gene locus_tag LOCUS_26590 401 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1640 1500 gene locus_tag LOCUS_26600 1640 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence582 1887 907 gene locus_tag LOCUS_26610 1887 907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_26610 >Feature sequence583 <1 614 gene locus_tag LOCUS_26620 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to D1BA45:histidine ammonia-lyase 929 1720 gene locus_tag LOCUS_26630 929 1720 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886849.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence584 700 224 gene locus_tag LOCUS_26640 700 224 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKF2 protein_id gnl|my_center|LOCUS_26640 1464 892 gene locus_tag LOCUS_26650 1464 892 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_26650 >Feature sequence585 681 31 gene locus_tag LOCUS_26660 681 31 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_26660 1269 760 gene locus_tag LOCUS_26670 1269 760 CDS product hydrogenase expression/formation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545540.1 protein_id gnl|my_center|LOCUS_26670 <2184 1342 gene locus_tag LOCUS_26680 <2184 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545782.1:F420-non-reducing hydrogenase subunit A, selenocysteine-containing >Feature sequence586 1048 152 gene locus_tag LOCUS_26690 1048 152 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_26690 1951 1052 gene locus_tag LOCUS_26700 1951 1052 CDS product tartronate semialdehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_26700 >Feature sequence587 119 973 gene locus_tag LOCUS_26710 119 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_26710 1770 1105 gene locus_tag LOCUS_26720 1770 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 >Feature sequence588 2012 336 gene locus_tag LOCUS_26730 2012 336 CDS product polynucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_26730 >Feature sequence589 <1 1044 gene locus_tag LOCUS_26740 <1 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74ED9:glycogen synthase 1 1217 2113 gene locus_tag LOCUS_26750 1217 2113 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence590 >Feature sequence591 1312 977 gene locus_tag LOCUS_26760 1312 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 1667 1338 gene locus_tag LOCUS_26770 1667 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 >Feature sequence592 120 314 gene locus_tag LOCUS_26780 120 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 336 620 gene locus_tag LOCUS_26790 336 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26790 1219 638 gene locus_tag LOCUS_26800 gene plsY 1219 638 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KG75 protein_id gnl|my_center|LOCUS_26800 1785 1222 gene locus_tag LOCUS_26810 1785 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 >Feature sequence593 172 639 gene locus_tag LOCUS_26820 172 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222365.1 protein_id gnl|my_center|LOCUS_26820 680 2074 gene locus_tag LOCUS_26830 680 2074 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence594 <1 877 gene locus_tag LOCUS_26840 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393402.1:secretion protein HlyD 926 1903 gene locus_tag LOCUS_26850 gene ybhF-N 926 1903 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence595 <1 1330 gene locus_tag LOCUS_26860 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875986.1:transporter >Feature sequence596 333 458 gene locus_tag LOCUS_26870 333 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence597 881 303 gene locus_tag LOCUS_26880 881 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1137 904 gene locus_tag LOCUS_26890 1137 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 >Feature sequence598 <2065 62 gene locus_tag LOCUS_26900 <2065 62 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHG9:transcription-repair-coupling factor >Feature sequence599 425 1951 gene locus_tag LOCUS_26910 425 1951 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256433.1 protein_id gnl|my_center|LOCUS_26910 >Feature sequence600 1207 290 gene locus_tag LOCUS_26920 1207 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 1918 1244 gene locus_tag LOCUS_26930 1918 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence601 485 871 gene locus_tag LOCUS_26940 485 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 945 1703 gene locus_tag LOCUS_26950 945 1703 CDS product UPF0721 transmembrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q500L8 protein_id gnl|my_center|LOCUS_26950 >Feature sequence602 334 62 gene locus_tag LOCUS_26960 334 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1920 610 gene locus_tag LOCUS_26970 1920 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 >Feature sequence603 1000 44 gene locus_tag LOCUS_26980 1000 44 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391645.1 protein_id gnl|my_center|LOCUS_26980 1835 1224 gene locus_tag LOCUS_26990 gene fadR 1835 1224 CDS product fatty acid metabolism regulator protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94548 protein_id gnl|my_center|LOCUS_26990 >Feature sequence604 96 752 gene locus_tag LOCUS_27000 96 752 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678955.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence605 <1 780 gene locus_tag LOCUS_27010 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257644.1:ABC transporter >Feature sequence606 1288 218 gene locus_tag LOCUS_27020 1288 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 >Feature sequence607 >Feature sequence608 >Feature sequence609 1334 666 gene locus_tag LOCUS_27030 1334 666 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080583.1 protein_id gnl|my_center|LOCUS_27030 >Feature sequence610 1909 71 gene locus_tag LOCUS_27040 1909 71 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_27040 >Feature sequence611 1715 417 gene locus_tag LOCUS_27050 1715 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 >Feature sequence612 1938 268 gene locus_tag LOCUS_27060 1938 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257600.1 protein_id gnl|my_center|LOCUS_27060 >Feature sequence613 1503 265 gene locus_tag LOCUS_27070 1503 265 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGZ5 protein_id gnl|my_center|LOCUS_27070 >Feature sequence614 418 152 gene locus_tag LOCUS_27080 418 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27080 <1959 462 gene locus_tag LOCUS_27090 <1959 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18TV3:trimethylamine methyltransferase MttB >Feature sequence615 >Feature sequence616 1635 862 gene locus_tag LOCUS_27100 1635 862 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391918.1 protein_id gnl|my_center|LOCUS_27100 >Feature sequence617 <1 566 gene locus_tag LOCUS_27110 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878966.1:macrolide ABC transporter ATP-binding protein 563 1768 gene locus_tag LOCUS_27120 563 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence618 929 93 gene locus_tag LOCUS_27130 929 93 CDS product multidrug ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867541.1 protein_id gnl|my_center|LOCUS_27130 1906 1025 gene locus_tag LOCUS_27140 1906 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence619 1795 782 gene locus_tag LOCUS_27150 1795 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence620 1662 205 gene locus_tag LOCUS_27160 1662 205 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_27160 >Feature sequence621 708 121 gene locus_tag LOCUS_27170 708 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 <1934 698 gene locus_tag LOCUS_27180 <1934 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257049.1:glycoside hydrolase >Feature sequence622 127 912 gene locus_tag LOCUS_27190 127 912 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110355.1 protein_id gnl|my_center|LOCUS_27190 >Feature sequence623 526 1440 gene locus_tag LOCUS_27200 gene secF 526 1440 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ9 protein_id gnl|my_center|LOCUS_27200 >Feature sequence624 132 542 gene locus_tag LOCUS_27210 132 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 569 1582 gene locus_tag LOCUS_27220 569 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 >Feature sequence625 <1897 870 gene locus_tag LOCUS_27230 <1897 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18TV3:trimethylamine methyltransferase MttB >Feature sequence626 350 1156 gene locus_tag LOCUS_27240 350 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 1172 1798 gene locus_tag LOCUS_27250 1172 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence627 624 478 gene locus_tag LOCUS_27260 624 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 <1889 621 gene locus_tag LOCUS_27270 <1889 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082399.1:glycosyl transferase >Feature sequence628 223 1350 gene locus_tag LOCUS_27280 223 1350 CDS product 2-alkenal reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258067.1 protein_id gnl|my_center|LOCUS_27280 >Feature sequence629 129 1535 gene locus_tag LOCUS_27290 129 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 >Feature sequence630 1697 39 gene locus_tag LOCUS_27300 gene betA 1697 39 CDS product choline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3DGN2 protein_id gnl|my_center|LOCUS_27300 >Feature sequence631 667 1812 gene locus_tag LOCUS_27310 667 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence632 197 412 gene locus_tag LOCUS_27320 197 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 402 980 gene locus_tag LOCUS_27330 gene ctaE 402 980 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_27330 1123 1731 gene locus_tag LOCUS_27340 1123 1731 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256468.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence633 <1 1236 gene locus_tag LOCUS_27350 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228677.1:long-chain-fatty-acid--CoA ligase >Feature sequence634 160 1743 gene locus_tag LOCUS_27360 160 1743 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_27360 >Feature sequence635 >Feature sequence636 113 364 gene locus_tag LOCUS_27370 113 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 361 777 gene locus_tag LOCUS_27380 361 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1283 864 gene locus_tag LOCUS_27390 1283 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 1691 1428 gene locus_tag LOCUS_27400 1691 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 >Feature sequence637 <1 1402 gene locus_tag LOCUS_27410 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109349.1:ATP-dependent helicase >Feature sequence638 9 464 gene locus_tag LOCUS_27420 9 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 689 567 gene locus_tag LOCUS_27430 689 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 931 761 gene locus_tag LOCUS_27440 931 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 <1812 984 gene locus_tag LOCUS_27450 <1812 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096407.1:sucrose phosphorylase >Feature sequence639 740 1021 gene locus_tag LOCUS_27460 740 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_27460 1005 1289 gene locus_tag LOCUS_27470 1005 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence640 440 1618 gene locus_tag LOCUS_27480 440 1618 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 protein_id gnl|my_center|LOCUS_27480 >Feature sequence641 992 33 gene locus_tag LOCUS_27490 992 33 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861644.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence642 164 1474 gene locus_tag LOCUS_27500 164 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143462.1 protein_id gnl|my_center|LOCUS_27500 1485 1673 gene locus_tag LOCUS_27510 1485 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence643 <1775 608 gene locus_tag LOCUS_27520 <1775 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCU9:phosphate transport system permease protein >Feature sequence644 >Feature sequence645 1362 298 gene locus_tag LOCUS_27530 1362 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 1613 1377 gene locus_tag LOCUS_27540 1613 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence646 127 1419 gene locus_tag LOCUS_27550 127 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 1419 1679 gene locus_tag LOCUS_27560 1419 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence647 1687 608 gene locus_tag LOCUS_27570 1687 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence648 693 43 gene locus_tag LOCUS_27580 693 43 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228286.1 protein_id gnl|my_center|LOCUS_27580 <1741 690 gene locus_tag LOCUS_27590 <1741 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973239.1:histidine kinase >Feature sequence649 1234 797 gene locus_tag LOCUS_27600 1234 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 >Feature sequence650 594 1286 gene locus_tag LOCUS_27610 594 1286 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002068284.1 protein_id gnl|my_center|LOCUS_27610 1289 1528 gene locus_tag LOCUS_27620 1289 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence651 >Feature sequence652 143 580 gene locus_tag LOCUS_27630 143 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 595 1692 gene locus_tag LOCUS_27640 595 1692 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257313.1 protein_id gnl|my_center|LOCUS_27640 >Feature sequence653 118 1326 gene locus_tag LOCUS_27650 118 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_27650 >Feature sequence654 233 970 gene locus_tag LOCUS_27660 233 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 967 1368 gene locus_tag LOCUS_27670 967 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence655 >Feature sequence656 1028 1228 gene locus_tag LOCUS_27680 1028 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 >Feature sequence657 >Feature sequence658 <1 1368 gene locus_tag LOCUS_27690 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCA1:DNA ligase >Feature sequence659 1008 250 gene locus_tag LOCUS_27700 1008 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence660 1443 571 gene locus_tag LOCUS_27710 1443 571 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022257.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence661 481 47 gene locus_tag LOCUS_27720 481 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 723 541 gene locus_tag LOCUS_27730 723 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 708 1106 gene locus_tag LOCUS_27740 708 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 1099 1452 gene locus_tag LOCUS_27750 1099 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence662 142 573 gene locus_tag LOCUS_27760 142 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 570 1430 gene locus_tag LOCUS_27770 570 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 >Feature sequence663 <1648 192 gene locus_tag LOCUS_27780 <1648 192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DHJ8:putative gluconeogenesis factor >Feature sequence664 389 1411 gene locus_tag LOCUS_27790 389 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence665 966 196 gene locus_tag LOCUS_27800 966 196 CDS product sporulation initiation inhibitor Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582622.1 protein_id gnl|my_center|LOCUS_27800 1454 972 gene locus_tag LOCUS_27810 1454 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 >Feature sequence666 <1 752 gene locus_tag LOCUS_27820 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259143.1:LLM class F420-dependent oxidoreductase >Feature sequence667 <1 507 gene locus_tag LOCUS_27830 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259731.1:MFS transporter 1447 590 gene locus_tag LOCUS_27840 gene catE 1447 590 CDS product catechol-2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54721 protein_id gnl|my_center|LOCUS_27840 >Feature sequence668 29 568 gene locus_tag LOCUS_27850 29 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1603 650 gene locus_tag LOCUS_27860 1603 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence669 216 1409 gene locus_tag LOCUS_27870 216 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence670 <1 1477 gene locus_tag LOCUS_27880 <1 1477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028181.1:endo alpha-1,4 polygalactosaminidase >Feature sequence671 >Feature sequence672 <1587 1036 gene locus_tag LOCUS_27890 <1587 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q9X1L4:1,4-dihydroxy-2-naphthoate octaprenyltransferase >Feature sequence673 1117 425 gene locus_tag LOCUS_27900 1117 425 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_27900 >Feature sequence674 1125 37 gene locus_tag LOCUS_27910 1125 37 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391617.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence675 201 1379 gene locus_tag LOCUS_27920 gene galK 201 1379 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M60 protein_id gnl|my_center|LOCUS_27920 >Feature sequence676 1401 265 gene locus_tag LOCUS_27930 1401 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256125.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence677 122 1051 gene locus_tag LOCUS_27940 gene nadC 122 1051 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404648.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence678 1158 76 gene locus_tag LOCUS_27950 1158 76 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_27950 >Feature sequence679 >Feature sequence680 >Feature sequence681 <1 1357 gene locus_tag LOCUS_27960 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942344.1:bifunctional malic enzyme oxidoreductase/phosphotransacetylase >Feature sequence682 >Feature sequence683 383 1411 gene locus_tag LOCUS_27970 383 1411 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258092.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence684 134 592 gene locus_tag LOCUS_27980 134 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 781 1170 gene locus_tag LOCUS_27990 781 1170 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_27990 1519 1253 gene locus_tag LOCUS_28000 1519 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 >Feature sequence685 909 256 gene locus_tag LOCUS_28010 909 256 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940928.1 protein_id gnl|my_center|LOCUS_28010 <1503 906 gene locus_tag LOCUS_28020 <1503 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940927.1:histidine kinase