>Feature sequence001 622 95 gene locus_tag LOCUS_00010 622 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1834 689 gene locus_tag LOCUS_00020 1834 689 CDS product GDP-mannose-dependent alpha-(1-2)-phosphatidylinositol mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_00020 2046 1831 gene locus_tag LOCUS_00030 2046 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3119 2043 gene locus_tag LOCUS_00040 3119 2043 CDS product myo-inositol-1-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257445.1 protein_id gnl|my_center|LOCUS_00040 4001 3135 gene locus_tag LOCUS_00050 4001 3135 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258386.1 protein_id gnl|my_center|LOCUS_00050 4128 4799 gene locus_tag LOCUS_00060 4128 4799 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_00060 5987 5070 gene locus_tag LOCUS_00070 5987 5070 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944714.1 protein_id gnl|my_center|LOCUS_00070 6379 6017 gene locus_tag LOCUS_00080 gene rbfA 6379 6017 CDS product ribosome-binding factor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BH6 protein_id gnl|my_center|LOCUS_00080 8227 6401 gene locus_tag LOCUS_00090 8227 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 8551 8228 gene locus_tag LOCUS_00100 8551 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10189 8567 gene locus_tag LOCUS_00110 10189 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10767 10444 gene locus_tag LOCUS_00120 10767 10444 CDS product zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459031.1 protein_id gnl|my_center|LOCUS_00120 11196 10945 gene locus_tag LOCUS_00130 11196 10945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 <12717 11246 gene locus_tag LOCUS_00140 <12717 11246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJN1:proline--tRNA ligase >Feature sequence002 418 2214 gene locus_tag LOCUS_00150 418 2214 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_00150 2817 4022 gene locus_tag LOCUS_00160 gene rhlE-2 2817 4022 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_00160 4288 5394 gene locus_tag LOCUS_00170 gene hadC 4288 5394 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_00170 5425 6729 gene locus_tag LOCUS_00180 5425 6729 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_00180 7063 6749 gene locus_tag LOCUS_00190 7063 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 7229 8356 gene locus_tag LOCUS_00200 7229 8356 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_00200 8471 10432 gene locus_tag LOCUS_00210 8471 10432 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459204.1 protein_id gnl|my_center|LOCUS_00210 10501 12381 gene locus_tag LOCUS_00220 10501 12381 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_00220 >Feature sequence003 1573 1409 gene locus_tag LOCUS_00230 1573 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 2239 1667 gene locus_tag LOCUS_00240 2239 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085955.1 protein_id gnl|my_center|LOCUS_00240 2780 2265 gene locus_tag LOCUS_00250 2780 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 4095 2869 gene locus_tag LOCUS_00260 4095 2869 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_00260 4271 5533 gene locus_tag LOCUS_00270 4271 5533 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_00270 5547 6758 gene locus_tag LOCUS_00280 5547 6758 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545374.1 protein_id gnl|my_center|LOCUS_00280 6808 7503 gene locus_tag LOCUS_00290 gene araD 6808 7503 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226246.1 protein_id gnl|my_center|LOCUS_00290 7590 8810 gene locus_tag LOCUS_00300 7590 8810 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_00300 8843 9127 gene locus_tag LOCUS_00310 8843 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 9888 11204 gene locus_tag LOCUS_00320 9888 11204 CDS product 4-hydroxybutyrate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_00320 11656 11201 gene locus_tag LOCUS_00330 11656 11201 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_00330 12048 11698 gene locus_tag LOCUS_00340 12048 11698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 >Feature sequence004 56 772 gene locus_tag LOCUS_00350 56 772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_00350 769 1482 gene locus_tag LOCUS_00360 gene livF 769 1482 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000178146.1 protein_id gnl|my_center|LOCUS_00360 1629 2027 gene locus_tag LOCUS_00370 1629 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 2122 4203 gene locus_tag LOCUS_00380 2122 4203 CDS product methylhydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229602.1 protein_id gnl|my_center|LOCUS_00380 4207 5925 gene locus_tag LOCUS_00390 4207 5925 CDS product hydantoinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229601.1 protein_id gnl|my_center|LOCUS_00390 7492 6221 gene locus_tag LOCUS_00400 gene ybfB 7492 6221 CDS product putative MFS-type transporter YbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31444 protein_id gnl|my_center|LOCUS_00400 8087 7908 gene locus_tag LOCUS_00410 8087 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 8004 9128 gene locus_tag LOCUS_00420 8004 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00420 9217 9510 gene locus_tag LOCUS_00430 9217 9510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence005 18 914 gene locus_tag LOCUS_00440 18 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 2712 934 gene locus_tag LOCUS_00450 gene ade 2712 934 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RL95 protein_id gnl|my_center|LOCUS_00450 2867 4513 gene locus_tag LOCUS_00460 2867 4513 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553693.1 protein_id gnl|my_center|LOCUS_00460 4515 5423 gene locus_tag LOCUS_00470 4515 5423 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_00470 5435 6199 gene locus_tag LOCUS_00480 gene gctB 5435 6199 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_00480 6273 6551 gene locus_tag LOCUS_00490 6273 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00490 6658 7011 gene locus_tag LOCUS_00500 6658 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00500 6974 7174 gene locus_tag LOCUS_00510 6974 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 8612 7305 gene locus_tag LOCUS_00520 gene fldB 8612 7305 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048237.1 protein_id gnl|my_center|LOCUS_00520 >Feature sequence006 1405 551 gene locus_tag LOCUS_00530 1405 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 1905 1417 gene locus_tag LOCUS_00540 1905 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2348 3973 gene locus_tag LOCUS_00550 2348 3973 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_00550 4033 4383 gene locus_tag LOCUS_00560 4033 4383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 4539 4778 gene locus_tag LOCUS_00570 4539 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 6247 4814 gene locus_tag LOCUS_00580 6247 4814 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808599.1 protein_id gnl|my_center|LOCUS_00580 6595 6670 gene locus_tag LOCUS_t00010 6595 6670 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6871 7932 gene locus_tag LOCUS_00590 6871 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 8235 8402 gene locus_tag LOCUS_00600 8235 8402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 8484 8570 gene locus_tag LOCUS_t00020 8484 8570 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8641 8713 gene locus_tag LOCUS_t00030 8641 8713 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 8763 8848 gene locus_tag LOCUS_t00040 8763 8848 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence007 881 579 gene locus_tag LOCUS_00610 881 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 1108 1902 gene locus_tag LOCUS_00620 1108 1902 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_00620 3237 1918 gene locus_tag LOCUS_00630 3237 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 3396 4400 gene locus_tag LOCUS_00640 3396 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584126.1 protein_id gnl|my_center|LOCUS_00640 5108 4404 gene locus_tag LOCUS_00650 5108 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 5707 5117 gene locus_tag LOCUS_00660 5707 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5864 7147 gene locus_tag LOCUS_00670 5864 7147 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence008 1084 146 gene locus_tag LOCUS_00680 1084 146 CDS product UDP-glucose 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_00680 1894 1094 gene locus_tag LOCUS_00690 1894 1094 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902656.1 protein_id gnl|my_center|LOCUS_00690 2837 1896 gene locus_tag LOCUS_00700 2837 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 4734 2947 gene locus_tag LOCUS_00710 gene glmS 4734 2947 CDS product glutamine--fructose-6-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_00710 5921 4737 gene locus_tag LOCUS_00720 5921 4737 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_00720 7133 5931 gene locus_tag LOCUS_00730 7133 5931 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022964.1 protein_id gnl|my_center|LOCUS_00730 8461 7130 gene locus_tag LOCUS_00740 gene glmM 8461 7130 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065583.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence009 216 1370 gene locus_tag LOCUS_00750 gene miaB 216 1370 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHB1 protein_id gnl|my_center|LOCUS_00750 1373 2302 gene locus_tag LOCUS_00760 gene nadA 1373 2302 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74H71 protein_id gnl|my_center|LOCUS_00760 2306 3853 gene locus_tag LOCUS_00770 gene nadB 2306 3853 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMC0 protein_id gnl|my_center|LOCUS_00770 3870 4727 gene locus_tag LOCUS_00780 3870 4727 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256782.1 protein_id gnl|my_center|LOCUS_00780 5472 4768 gene locus_tag LOCUS_00790 5472 4768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 5774 5469 gene locus_tag LOCUS_00800 5774 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 6579 6118 gene locus_tag LOCUS_00810 gene dtd 6579 6118 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZI9 protein_id gnl|my_center|LOCUS_00810 6926 6582 gene locus_tag LOCUS_00820 6926 6582 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405142.1 protein_id gnl|my_center|LOCUS_00820 7174 7650 gene locus_tag LOCUS_00830 7174 7650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 7654 8085 gene locus_tag LOCUS_00840 7654 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence010 948 481 gene locus_tag LOCUS_00850 948 481 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_00850 1873 962 gene locus_tag LOCUS_00860 1873 962 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_00860 4166 1875 gene locus_tag LOCUS_00870 4166 1875 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_00870 4841 4299 gene locus_tag LOCUS_00880 4841 4299 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877376.1 protein_id gnl|my_center|LOCUS_00880 6317 4929 gene locus_tag LOCUS_00890 6317 4929 CDS product cobyrinic acid a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258422.1 protein_id gnl|my_center|LOCUS_00890 6844 6314 gene locus_tag LOCUS_00900 6844 6314 CDS product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258439.1 protein_id gnl|my_center|LOCUS_00900 7109 7336 gene locus_tag LOCUS_00910 7109 7336 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257440.1 protein_id gnl|my_center|LOCUS_00910 7636 8427 gene locus_tag LOCUS_00920 7636 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 >Feature sequence011 742 2649 gene locus_tag LOCUS_00930 742 2649 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_00930 2646 3536 gene locus_tag LOCUS_00940 2646 3536 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_00940 3540 4628 gene locus_tag LOCUS_00950 3540 4628 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463596.1 protein_id gnl|my_center|LOCUS_00950 4704 5912 gene locus_tag LOCUS_00960 4704 5912 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807259.1 protein_id gnl|my_center|LOCUS_00960 5985 7256 gene locus_tag LOCUS_00970 5985 7256 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_00970 8311 7283 gene locus_tag LOCUS_00980 8311 7283 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902253.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence012 216 1106 gene locus_tag LOCUS_00990 216 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 1339 2934 gene locus_tag LOCUS_01000 1339 2934 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250100.1 protein_id gnl|my_center|LOCUS_01000 2938 3345 gene locus_tag LOCUS_01010 2938 3345 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_01010 3696 5480 gene locus_tag LOCUS_01020 gene entE 3696 5480 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_01020 6539 5733 gene locus_tag LOCUS_01030 6539 5733 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393687.1 protein_id gnl|my_center|LOCUS_01030 7993 6539 gene locus_tag LOCUS_01040 gene ccsB 7993 6539 CDS product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 protein_id gnl|my_center|LOCUS_01040 >Feature sequence013 2098 842 gene locus_tag LOCUS_01050 2098 842 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_01050 2226 3593 gene locus_tag LOCUS_01060 2226 3593 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_01060 3627 4427 gene locus_tag LOCUS_01070 3627 4427 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_01070 5210 4467 gene locus_tag LOCUS_01080 5210 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 6206 5331 gene locus_tag LOCUS_01090 6206 5331 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893595.1 protein_id gnl|my_center|LOCUS_01090 7148 6270 gene locus_tag LOCUS_01100 7148 6270 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_01100 8062 7187 gene locus_tag LOCUS_01110 8062 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 >Feature sequence014 355 4518 gene locus_tag LOCUS_01120 355 4518 CDS product 2-hydroxyglutaryl-CoA dehydratase activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545106.1 protein_id gnl|my_center|LOCUS_01120 4632 5243 gene locus_tag LOCUS_01130 4632 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808897.1 protein_id gnl|my_center|LOCUS_01130 5472 6191 gene locus_tag LOCUS_01140 gene menG 5472 6191 CDS product demethylmenaquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIZ5 protein_id gnl|my_center|LOCUS_01140 7208 6201 gene locus_tag LOCUS_01150 7208 6201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 7512 8192 gene locus_tag LOCUS_01160 7512 8192 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808122.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence015 1857 2453 gene locus_tag LOCUS_01170 1857 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2539 3798 gene locus_tag LOCUS_01180 gene moeA 2539 3798 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_01180 3818 4459 gene locus_tag LOCUS_01190 3818 4459 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393319.1 protein_id gnl|my_center|LOCUS_01190 4475 5185 gene locus_tag LOCUS_01200 4475 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_01200 5463 5182 gene locus_tag LOCUS_01210 5463 5182 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_01210 6401 5466 gene locus_tag LOCUS_01220 6401 5466 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545758.1 protein_id gnl|my_center|LOCUS_01220 6639 6406 gene locus_tag LOCUS_01230 6639 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 6684 6950 gene locus_tag LOCUS_01240 6684 6950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256481.1 protein_id gnl|my_center|LOCUS_01240 >Feature sequence016 903 331 gene locus_tag LOCUS_01250 903 331 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_01250 1403 900 gene locus_tag LOCUS_01260 1403 900 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939670.1 protein_id gnl|my_center|LOCUS_01260 2331 1417 gene locus_tag LOCUS_01270 2331 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 2603 2364 gene locus_tag LOCUS_01280 2603 2364 CDS product NrdH-redoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966062.1 protein_id gnl|my_center|LOCUS_01280 3337 2684 gene locus_tag LOCUS_01290 gene nth 3337 2684 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q746Z0 protein_id gnl|my_center|LOCUS_01290 3825 3334 gene locus_tag LOCUS_01300 3825 3334 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877399.1 protein_id gnl|my_center|LOCUS_01300 4437 3838 gene locus_tag LOCUS_01310 gene sfsA 4437 3838 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLC7 protein_id gnl|my_center|LOCUS_01310 4692 5915 gene locus_tag LOCUS_01320 gene glcF-2 4692 5915 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CP9 protein_id gnl|my_center|LOCUS_01320 5975 6769 gene locus_tag LOCUS_01330 5975 6769 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000219772.1 protein_id gnl|my_center|LOCUS_01330 6918 7946 gene locus_tag LOCUS_01340 6918 7946 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence017 1215 700 gene locus_tag LOCUS_01350 1215 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 1892 1212 gene locus_tag LOCUS_01360 1892 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2838 2002 gene locus_tag LOCUS_01370 2838 2002 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932020.1 protein_id gnl|my_center|LOCUS_01370 3625 2840 gene locus_tag LOCUS_01380 3625 2840 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392597.1 protein_id gnl|my_center|LOCUS_01380 5275 3746 gene locus_tag LOCUS_01390 gene rny 5275 3746 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJJ4 protein_id gnl|my_center|LOCUS_01390 5640 5377 gene locus_tag LOCUS_01400 5640 5377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5542 6237 gene locus_tag LOCUS_01410 5542 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_01410 7404 6637 gene locus_tag LOCUS_01420 gene crt 7404 6637 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P52046 protein_id gnl|my_center|LOCUS_01420 7619 7774 gene locus_tag LOCUS_01430 7619 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence018 997 2316 gene locus_tag LOCUS_01440 997 2316 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118925.1 protein_id gnl|my_center|LOCUS_01440 3907 2321 gene locus_tag LOCUS_01450 gene serA 3907 2321 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM01 protein_id gnl|my_center|LOCUS_01450 5018 3936 gene locus_tag LOCUS_01460 5018 3936 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582464.1 protein_id gnl|my_center|LOCUS_01460 6364 5066 gene locus_tag LOCUS_01470 gene tyrS 6364 5066 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGW1 protein_id gnl|my_center|LOCUS_01470 7308 6361 gene locus_tag LOCUS_01480 7308 6361 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WG00 protein_id gnl|my_center|LOCUS_01480 7219 7401 gene locus_tag LOCUS_01490 7219 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 >Feature sequence019 168 1790 gene locus_tag LOCUS_01500 168 1790 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_01500 1828 2790 gene locus_tag LOCUS_01510 1828 2790 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084172.1 protein_id gnl|my_center|LOCUS_01510 2812 3909 gene locus_tag LOCUS_01520 2812 3909 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903761.1 protein_id gnl|my_center|LOCUS_01520 3912 4919 gene locus_tag LOCUS_01530 3912 4919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_01530 4894 5877 gene locus_tag LOCUS_01540 4894 5877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_01540 6513 5866 gene locus_tag LOCUS_01550 6513 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence020 <1 1060 gene locus_tag LOCUS_01560 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258069.1:aspartate aminotransferase family protein 1169 2272 gene locus_tag LOCUS_01570 1169 2272 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391982.1 protein_id gnl|my_center|LOCUS_01570 3950 2295 gene locus_tag LOCUS_01580 3950 2295 CDS product fumarate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869524.1 protein_id gnl|my_center|LOCUS_01580 5904 3970 gene locus_tag LOCUS_01590 5904 3970 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_01590 6066 7271 gene locus_tag LOCUS_01600 6066 7271 CDS product dihydropyrimidine dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987091.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence021 <1 648 gene locus_tag LOCUS_01610 <1 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941438.1:(Fe-S)-binding protein 741 2951 gene locus_tag LOCUS_01620 741 2951 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272564.1 protein_id gnl|my_center|LOCUS_01620 3356 5107 gene locus_tag LOCUS_01630 3356 5107 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706263.1 protein_id gnl|my_center|LOCUS_01630 5501 6916 gene locus_tag LOCUS_01640 5501 6916 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence022 170 1000 gene locus_tag LOCUS_01650 170 1000 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090625.1 protein_id gnl|my_center|LOCUS_01650 1292 2488 gene locus_tag LOCUS_01660 1292 2488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_01660 2608 2904 gene locus_tag LOCUS_01670 2608 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3286 3119 gene locus_tag LOCUS_01680 3286 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3855 3325 gene locus_tag LOCUS_01690 3855 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4067 5317 gene locus_tag LOCUS_01700 4067 5317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086725.1 protein_id gnl|my_center|LOCUS_01700 5489 6955 gene locus_tag LOCUS_01710 gene ubiD 5489 6955 CDS product 3-octaprenyl-4-hydroxybenzoate carboxy-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJG1 protein_id gnl|my_center|LOCUS_01710 >Feature sequence023 1073 1273 gene locus_tag LOCUS_01720 1073 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 1266 2780 gene locus_tag LOCUS_01730 1266 2780 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796334.1 protein_id gnl|my_center|LOCUS_01730 2857 3282 gene locus_tag LOCUS_01740 2857 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3334 3732 gene locus_tag LOCUS_01750 3334 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3742 4404 gene locus_tag LOCUS_01760 3742 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392861.1 protein_id gnl|my_center|LOCUS_01760 4421 5263 gene locus_tag LOCUS_01770 gene pheA 4421 5263 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WC28 protein_id gnl|my_center|LOCUS_01770 5263 5460 gene locus_tag LOCUS_01780 5263 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5514 6719 gene locus_tag LOCUS_01790 5514 6719 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870036.1 protein_id gnl|my_center|LOCUS_01790 6716 6898 gene locus_tag LOCUS_01800 6716 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence024 1718 1428 gene locus_tag LOCUS_01810 1718 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4021 1727 gene locus_tag LOCUS_01820 4021 1727 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_01820 4499 4023 gene locus_tag LOCUS_01830 4499 4023 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459383.1 protein_id gnl|my_center|LOCUS_01830 5327 4515 gene locus_tag LOCUS_01840 5327 4515 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_01840 5721 6515 gene locus_tag LOCUS_01850 5721 6515 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence025 466 122 gene locus_tag LOCUS_01860 466 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01860 919 635 gene locus_tag LOCUS_01870 919 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 1201 1524 gene locus_tag LOCUS_01880 1201 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 2977 1541 gene locus_tag LOCUS_01890 2977 1541 CDS product UbiD-like decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JPD8 protein_id gnl|my_center|LOCUS_01890 4668 3022 gene locus_tag LOCUS_01900 gene entE 4668 3022 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_01900 4938 5102 gene locus_tag LOCUS_01910 4938 5102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 5772 6074 gene locus_tag LOCUS_01920 5772 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence026 957 2051 gene locus_tag LOCUS_01930 957 2051 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000155556.1 protein_id gnl|my_center|LOCUS_01930 2678 2148 gene locus_tag LOCUS_01940 2678 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 2904 4169 gene locus_tag LOCUS_01950 2904 4169 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086785.1 protein_id gnl|my_center|LOCUS_01950 5697 4345 gene locus_tag LOCUS_01960 5697 4345 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_01960 5914 5705 gene locus_tag LOCUS_01970 5914 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6407 6736 gene locus_tag LOCUS_01980 6407 6736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence027 834 67 gene locus_tag LOCUS_01990 834 67 CDS product cAMP phosphodiesterase class-II:metallo-beta-lactamase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_01990 1492 851 gene locus_tag LOCUS_02000 1492 851 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020681.1 protein_id gnl|my_center|LOCUS_02000 2468 1494 gene locus_tag LOCUS_02010 gene corA 2468 1494 CDS product magnesium transport protein CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F2H8 protein_id gnl|my_center|LOCUS_02010 4832 2547 gene locus_tag LOCUS_02020 4832 2547 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029077.1 protein_id gnl|my_center|LOCUS_02020 5141 4851 gene locus_tag LOCUS_02030 5141 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_02030 5503 5216 gene locus_tag LOCUS_02040 5503 5216 CDS product zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391912.1 protein_id gnl|my_center|LOCUS_02040 5811 6476 gene locus_tag LOCUS_02050 gene rplY 5811 6476 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMC2 protein_id gnl|my_center|LOCUS_02050 >Feature sequence028 389 1009 gene locus_tag LOCUS_02060 389 1009 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174153.1 protein_id gnl|my_center|LOCUS_02060 1079 1543 gene locus_tag LOCUS_02070 1079 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 1702 2259 gene locus_tag LOCUS_02080 1702 2259 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459068.1 protein_id gnl|my_center|LOCUS_02080 2558 3460 gene locus_tag LOCUS_02090 2558 3460 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_02090 4027 3620 gene locus_tag LOCUS_02100 4027 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 4313 4951 gene locus_tag LOCUS_02110 4313 4951 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877520.1 protein_id gnl|my_center|LOCUS_02110 4948 6093 gene locus_tag LOCUS_02120 4948 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_02120 6717 6130 gene locus_tag LOCUS_02130 6717 6130 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence029 1730 591 gene locus_tag LOCUS_02140 gene yhfN 1730 591 CDS product putative metalloprotease YhfN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P40769 protein_id gnl|my_center|LOCUS_02140 2494 1766 gene locus_tag LOCUS_02150 2494 1766 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_02150 3761 2475 gene locus_tag LOCUS_02160 3761 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_02160 3877 4872 gene locus_tag LOCUS_02170 gene tsaD 3877 4872 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHP1 protein_id gnl|my_center|LOCUS_02170 5340 5642 gene locus_tag LOCUS_02180 gene groS1 5340 5642 CDS product 10 kDa chaperonin 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UM98 protein_id gnl|my_center|LOCUS_02180 >Feature sequence030 1416 847 gene locus_tag LOCUS_02190 1416 847 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_02190 2243 1491 gene locus_tag LOCUS_02200 2243 1491 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_02200 2371 2649 gene locus_tag LOCUS_02210 2371 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2661 3182 gene locus_tag LOCUS_02220 2661 3182 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_02220 3190 5166 gene locus_tag LOCUS_02230 3190 5166 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146547.1 protein_id gnl|my_center|LOCUS_02230 <6604 5163 gene locus_tag LOCUS_02240 <6604 5163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000553652.1:cyclohexanecarboxylate-CoA ligase >Feature sequence031 18 1661 gene locus_tag LOCUS_02250 gene entE 18 1661 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_02250 2712 1771 gene locus_tag LOCUS_02260 2712 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 2986 4407 gene locus_tag LOCUS_02270 gene hudA 2986 4407 CDS product UbiD-like decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6N5 protein_id gnl|my_center|LOCUS_02270 4419 4655 gene locus_tag LOCUS_02280 4419 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4785 5861 gene locus_tag LOCUS_02290 4785 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence032 2567 1251 gene locus_tag LOCUS_02300 2567 1251 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_02300 3720 2596 gene locus_tag LOCUS_02310 gene hadC 3720 2596 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_02310 4475 3729 gene locus_tag LOCUS_02320 4475 3729 CDS product N-carbamoylsarcosine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333956.1 protein_id gnl|my_center|LOCUS_02320 5791 4484 gene locus_tag LOCUS_02330 5791 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 <6448 5811 gene locus_tag LOCUS_02340 <6448 5811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048213.1:3-hydroxyacyl-ACP dehydratase >Feature sequence033 1187 177 gene locus_tag LOCUS_02350 1187 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3487 1190 gene locus_tag LOCUS_02360 3487 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6254 3522 gene locus_tag LOCUS_02370 6254 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 6438 6259 gene locus_tag LOCUS_02380 6438 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence034 1141 41 gene locus_tag LOCUS_02390 1141 41 CDS product iron ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016302.1 protein_id gnl|my_center|LOCUS_02390 2887 1154 gene locus_tag LOCUS_02400 2887 1154 CDS product iron dicitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064852.1 protein_id gnl|my_center|LOCUS_02400 4057 2936 gene locus_tag LOCUS_02410 4057 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 4545 4282 gene locus_tag LOCUS_02420 4545 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 4817 4662 gene locus_tag LOCUS_02430 4817 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 5111 6199 gene locus_tag LOCUS_02440 gene adh 5111 6199 CDS product putative alcohol dehydrogenase adh inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WQC3 protein_id gnl|my_center|LOCUS_02440 >Feature sequence035 587 102 gene locus_tag LOCUS_02450 587 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 1189 806 gene locus_tag LOCUS_02460 1189 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223357.1 protein_id gnl|my_center|LOCUS_02460 2610 1393 gene locus_tag LOCUS_02470 2610 1393 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871084.1 protein_id gnl|my_center|LOCUS_02470 2981 3781 gene locus_tag LOCUS_02480 2981 3781 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_02480 3887 5539 gene locus_tag LOCUS_02490 3887 5539 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_02490 6172 5981 gene locus_tag LOCUS_02500 6172 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 >Feature sequence036 32 913 gene locus_tag LOCUS_02510 gene pdxS 32 913 CDS product pyridoxal 5'-phosphate synthase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMJ0 protein_id gnl|my_center|LOCUS_02510 917 1492 gene locus_tag LOCUS_02520 gene pdxT 917 1492 CDS product pyridoxal 5'-phosphate synthase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMI9 protein_id gnl|my_center|LOCUS_02520 1509 2432 gene locus_tag LOCUS_02530 1509 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 2447 3991 gene locus_tag LOCUS_02540 2447 3991 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_02540 3995 4636 gene locus_tag LOCUS_02550 gene tmk 3995 4636 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9RY40 protein_id gnl|my_center|LOCUS_02550 4614 4859 gene locus_tag LOCUS_02560 4614 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 4882 5484 gene locus_tag LOCUS_02570 4882 5484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 6171 5518 gene locus_tag LOCUS_02580 6171 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 >Feature sequence037 <1 685 gene locus_tag LOCUS_02590 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811019.1:2-hydroxyglutaryl-CoA dehydratase 721 2010 gene locus_tag LOCUS_02600 721 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 2110 2436 gene locus_tag LOCUS_02610 2110 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3703 2483 gene locus_tag LOCUS_02620 3703 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423257.1 protein_id gnl|my_center|LOCUS_02620 4971 3757 gene locus_tag LOCUS_02630 4971 3757 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817791.1 protein_id gnl|my_center|LOCUS_02630 >Feature sequence038 1075 590 gene locus_tag LOCUS_02640 1075 590 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_02640 2024 1080 gene locus_tag LOCUS_02650 2024 1080 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003532039.1 protein_id gnl|my_center|LOCUS_02650 2169 3602 gene locus_tag LOCUS_02660 2169 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039294.1 protein_id gnl|my_center|LOCUS_02660 3599 4636 gene locus_tag LOCUS_02670 3599 4636 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240530.1 protein_id gnl|my_center|LOCUS_02670 5607 5401 gene locus_tag LOCUS_02680 5607 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5947 5639 gene locus_tag LOCUS_02690 5947 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 >Feature sequence039 116 292 gene locus_tag LOCUS_02700 116 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 309 473 gene locus_tag LOCUS_02710 309 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 678 1910 gene locus_tag LOCUS_02720 gene cinA 678 1910 CDS product putative competence-damage inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKI6 protein_id gnl|my_center|LOCUS_02720 2087 2500 gene locus_tag LOCUS_02730 2087 2500 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0V2 protein_id gnl|my_center|LOCUS_02730 2497 3522 gene locus_tag LOCUS_02740 2497 3522 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022952.1 protein_id gnl|my_center|LOCUS_02740 3509 4420 gene locus_tag LOCUS_02750 3509 4420 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_02750 4417 5538 gene locus_tag LOCUS_02760 4417 5538 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_02760 5689 6105 gene locus_tag LOCUS_02770 5689 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence040 240 584 gene locus_tag LOCUS_02780 240 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1441 527 gene locus_tag LOCUS_02790 1441 527 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_02790 1701 1495 gene locus_tag LOCUS_02800 gene rpmE 1701 1495 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97F64 protein_id gnl|my_center|LOCUS_02800 1956 1702 gene locus_tag LOCUS_02810 gene rpmA 1956 1702 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F7U1 protein_id gnl|my_center|LOCUS_02810 2215 1877 gene locus_tag LOCUS_02820 2215 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 3821 2340 gene locus_tag LOCUS_02830 gene hudA 3821 2340 CDS product UbiD-like decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6N5 protein_id gnl|my_center|LOCUS_02830 4852 3905 gene locus_tag LOCUS_02840 4852 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 5078 5791 gene locus_tag LOCUS_02850 5078 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 >Feature sequence041 1880 681 gene locus_tag LOCUS_02860 gene argJ 1880 681 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG63 protein_id gnl|my_center|LOCUS_02860 2009 2734 gene locus_tag LOCUS_02870 2009 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228944.1 protein_id gnl|my_center|LOCUS_02870 2983 2789 gene locus_tag LOCUS_02880 2983 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_02880 3601 3215 gene locus_tag LOCUS_02890 3601 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 4005 3598 gene locus_tag LOCUS_02900 4005 3598 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 protein_id gnl|my_center|LOCUS_02900 4628 4122 gene locus_tag LOCUS_02910 4628 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979109.1 protein_id gnl|my_center|LOCUS_02910 5030 4785 gene locus_tag LOCUS_02920 5030 4785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 >Feature sequence042 <1 1090 gene locus_tag LOCUS_02930 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003817791.1:CoA transferase 1087 2283 gene locus_tag LOCUS_02940 1087 2283 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_02940 2698 2297 gene locus_tag LOCUS_02950 2698 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 3739 2720 gene locus_tag LOCUS_02960 3739 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4316 3753 gene locus_tag LOCUS_02970 4316 3753 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_02970 5103 4333 gene locus_tag LOCUS_02980 5103 4333 CDS product 2-oxoglutarate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_02980 <6072 5108 gene locus_tag LOCUS_02990 <6072 5108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865396.1:3-methyl-2-oxobutanoate dehydrogenase subunit VorB >Feature sequence043 226 1530 gene locus_tag LOCUS_03000 226 1530 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_03000 1739 1551 gene locus_tag LOCUS_03010 1739 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 1940 2515 gene locus_tag LOCUS_03020 1940 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 2590 3267 gene locus_tag LOCUS_03030 2590 3267 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_03030 3673 3299 gene locus_tag LOCUS_03040 3673 3299 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_03040 4862 3681 gene locus_tag LOCUS_03050 gene iscS 4862 3681 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHY5 protein_id gnl|my_center|LOCUS_03050 5305 4859 gene locus_tag LOCUS_03060 5305 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence044 1573 2487 gene locus_tag LOCUS_03070 gene xerD 1573 2487 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIC9 protein_id gnl|my_center|LOCUS_03070 2530 2784 gene locus_tag LOCUS_03080 2530 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2795 3463 gene locus_tag LOCUS_03090 gene pcm 2795 3463 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CZ5 protein_id gnl|my_center|LOCUS_03090 3460 4935 gene locus_tag LOCUS_03100 gene gatB 3460 4935 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGY5 protein_id gnl|my_center|LOCUS_03100 4976 5194 gene locus_tag LOCUS_03110 4976 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 5208 5630 gene locus_tag LOCUS_03120 5208 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence045 1345 1172 gene locus_tag LOCUS_03130 1345 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2644 1370 gene locus_tag LOCUS_03140 2644 1370 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584093.1 protein_id gnl|my_center|LOCUS_03140 3828 2677 gene locus_tag LOCUS_03150 gene hadC 3828 2677 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_03150 4011 4592 gene locus_tag LOCUS_03160 4011 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4613 5413 gene locus_tag LOCUS_03170 4613 5413 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867971.1 protein_id gnl|my_center|LOCUS_03170 5503 5694 gene locus_tag LOCUS_03180 gene tatA 5503 5694 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q747S5 protein_id gnl|my_center|LOCUS_03180 >Feature sequence046 397 1599 gene locus_tag LOCUS_03190 397 1599 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_03190 1631 2800 gene locus_tag LOCUS_03200 1631 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3229 2795 gene locus_tag LOCUS_03210 3229 2795 CDS product HIT family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_03210 4298 3495 gene locus_tag LOCUS_03220 4298 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 4654 4385 gene locus_tag LOCUS_03230 4654 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 5767 4688 gene locus_tag LOCUS_03240 5767 4688 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIP0 protein_id gnl|my_center|LOCUS_03240 >Feature sequence047 1491 208 gene locus_tag LOCUS_03250 1491 208 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_03250 4483 1580 gene locus_tag LOCUS_03260 gene uvrA 4483 1580 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLU9 protein_id gnl|my_center|LOCUS_03260 4631 4945 gene locus_tag LOCUS_03270 gene rsfS 4631 4945 CDS product ribosomal silencing factor RsfS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK69 protein_id gnl|my_center|LOCUS_03270 5614 5165 gene locus_tag LOCUS_03280 5614 5165 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence048 101 1285 gene locus_tag LOCUS_03290 gene dhaT 101 1285 CDS product alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119340.1 protein_id gnl|my_center|LOCUS_03290 1330 2475 gene locus_tag LOCUS_03300 1330 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 2668 3240 gene locus_tag LOCUS_03310 2668 3240 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173882.1 protein_id gnl|my_center|LOCUS_03310 3635 5041 gene locus_tag LOCUS_03320 3635 5041 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_03320 5147 5308 gene locus_tag LOCUS_03330 5147 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 >Feature sequence049 1228 695 gene locus_tag LOCUS_03340 1228 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1506 2603 gene locus_tag LOCUS_03350 1506 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2627 4405 gene locus_tag LOCUS_03360 2627 4405 CDS product peptidase M28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538194.1 protein_id gnl|my_center|LOCUS_03360 5698 4406 gene locus_tag LOCUS_03370 5698 4406 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531219.1 protein_id gnl|my_center|LOCUS_03370 >Feature sequence050 351 1175 gene locus_tag LOCUS_03380 351 1175 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023828.1 protein_id gnl|my_center|LOCUS_03380 1266 1523 gene locus_tag LOCUS_03390 1266 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810443.1 protein_id gnl|my_center|LOCUS_03390 1829 1527 gene locus_tag LOCUS_03400 1829 1527 CDS product UPF0213 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3CS42 protein_id gnl|my_center|LOCUS_03400 3172 1838 gene locus_tag LOCUS_03410 3172 1838 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947065.1 protein_id gnl|my_center|LOCUS_03410 3611 3817 gene locus_tag LOCUS_03420 3611 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence051 221 1297 gene locus_tag LOCUS_03430 221 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1347 2921 gene locus_tag LOCUS_03440 1347 2921 CDS product reactivating factor for ethanolamine ammonia lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462271.1 protein_id gnl|my_center|LOCUS_03440 2935 3633 gene locus_tag LOCUS_03450 2935 3633 CDS product vitamin B12 dependent methionine synthase activation domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435810.1 protein_id gnl|my_center|LOCUS_03450 3630 4268 gene locus_tag LOCUS_03460 3630 4268 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_03460 4304 5395 gene locus_tag LOCUS_03470 4304 5395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 >Feature sequence052 681 430 gene locus_tag LOCUS_03480 681 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 1484 699 gene locus_tag LOCUS_03490 1484 699 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_03490 3445 1508 gene locus_tag LOCUS_03500 3445 1508 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392714.1 protein_id gnl|my_center|LOCUS_03500 4836 3490 gene locus_tag LOCUS_03510 4836 3490 CDS product acetyl-CoA synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811725.1 protein_id gnl|my_center|LOCUS_03510 <5599 4849 gene locus_tag LOCUS_03520 <5599 4849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392712.1:corrinoid/iron-sulfur protein small subunit >Feature sequence053 1627 647 gene locus_tag LOCUS_03530 1627 647 CDS product nitrate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256331.1 protein_id gnl|my_center|LOCUS_03530 2434 1646 gene locus_tag LOCUS_03540 2434 1646 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461832.1 protein_id gnl|my_center|LOCUS_03540 2736 2431 gene locus_tag LOCUS_03550 2736 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964707.1 protein_id gnl|my_center|LOCUS_03550 3400 2756 gene locus_tag LOCUS_03560 gene thiN 3400 2756 CDS product thiamine pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454892.1 protein_id gnl|my_center|LOCUS_03560 <5593 3908 gene locus_tag LOCUS_03570 <5593 3908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969633.1:dehydrogenase >Feature sequence054 57 623 gene locus_tag LOCUS_03580 57 623 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393271.1 protein_id gnl|my_center|LOCUS_03580 1308 652 gene locus_tag LOCUS_03590 1308 652 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808122.1 protein_id gnl|my_center|LOCUS_03590 2669 1386 gene locus_tag LOCUS_03600 2669 1386 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_03600 3419 2691 gene locus_tag LOCUS_03610 3419 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 <5529 3449 gene locus_tag LOCUS_03620 <5529 3449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJD6:endonuclease MutS2 >Feature sequence055 844 1302 gene locus_tag LOCUS_03630 844 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 2146 1358 gene locus_tag LOCUS_03640 gene gctB 2146 1358 CDS product 3-oxoadipate--succinyl-CoA transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_03640 3056 2133 gene locus_tag LOCUS_03650 3056 2133 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_03650 4739 3069 gene locus_tag LOCUS_03660 gene pchD 4739 3069 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114688.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence056 1892 3691 gene locus_tag LOCUS_03670 1892 3691 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEU1 protein_id gnl|my_center|LOCUS_03670 5024 3714 gene locus_tag LOCUS_03680 5024 3714 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence057 1 702 gene locus_tag LOCUS_03690 1 702 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFJ6 protein_id gnl|my_center|LOCUS_03690 699 1910 gene locus_tag LOCUS_03700 699 1910 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2H4 protein_id gnl|my_center|LOCUS_03700 2027 2530 gene locus_tag LOCUS_03710 2027 2530 CDS product rubrerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_03710 3148 2558 gene locus_tag LOCUS_03720 3148 2558 CDS product FMN reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_03720 4367 3207 gene locus_tag LOCUS_03730 4367 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 <5482 4370 gene locus_tag LOCUS_03740 <5482 4370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020091.1:2-ketoisovalerate ferredoxin oxidoreductase subunit alpha >Feature sequence058 919 2013 gene locus_tag LOCUS_03750 919 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3220 2108 gene locus_tag LOCUS_03760 3220 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 3657 4208 gene locus_tag LOCUS_03770 3657 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4657 4905 gene locus_tag LOCUS_03780 4657 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03780 >Feature sequence059 1443 2333 gene locus_tag LOCUS_03790 1443 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2404 3279 gene locus_tag LOCUS_03800 2404 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 4099 3347 gene locus_tag LOCUS_03810 gene fabG-2 4099 3347 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_03810 4372 4223 gene locus_tag LOCUS_03820 4372 4223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence060 917 381 gene locus_tag LOCUS_03830 917 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 1679 921 gene locus_tag LOCUS_03840 1679 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03840 1761 3056 gene locus_tag LOCUS_03850 1761 3056 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_03850 3080 4057 gene locus_tag LOCUS_03860 3080 4057 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929890.1 protein_id gnl|my_center|LOCUS_03860 <5421 4341 gene locus_tag LOCUS_03870 <5421 4341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860960.1:CoA transferase >Feature sequence061 1327 419 gene locus_tag LOCUS_03880 1327 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 1928 1311 gene locus_tag LOCUS_03890 1928 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3279 2020 gene locus_tag LOCUS_03900 3279 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 4034 3282 gene locus_tag LOCUS_03910 4034 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4834 4037 gene locus_tag LOCUS_03920 4834 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence062 <1 1009 gene locus_tag LOCUS_03930 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229602.1:methylhydantoinase 1048 2874 gene locus_tag LOCUS_03940 gene hyuB 1048 2874 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_03940 3045 3749 gene locus_tag LOCUS_03950 3045 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 <5384 3764 gene locus_tag LOCUS_03960 <5384 3764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877962.1:NADH oxidase >Feature sequence063 1769 1068 gene locus_tag LOCUS_03970 1769 1068 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BAA9 protein_id gnl|my_center|LOCUS_03970 2384 1770 gene locus_tag LOCUS_03980 2384 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4099 2381 gene locus_tag LOCUS_03990 4099 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4207 4968 gene locus_tag LOCUS_04000 gene rsmG 4207 4968 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9LCY2 protein_id gnl|my_center|LOCUS_04000 >Feature sequence064 1077 676 gene locus_tag LOCUS_04010 1077 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1262 1942 gene locus_tag LOCUS_04020 1262 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2051 2386 gene locus_tag LOCUS_04030 gene ywzG 2051 2386 CDS product putative DNA-binding protein YwzG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:C0H3S6 protein_id gnl|my_center|LOCUS_04030 2405 3331 gene locus_tag LOCUS_04040 2405 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 3803 4390 gene locus_tag LOCUS_04050 3803 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 >Feature sequence065 <1 1179 gene locus_tag LOCUS_04060 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WAN1:chromosomal replication initiator protein DnaA 1586 2407 gene locus_tag LOCUS_04070 1586 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2415 3017 gene locus_tag LOCUS_04080 gene nadD 2415 3017 CDS product putative nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1BA24 protein_id gnl|my_center|LOCUS_04080 4844 3387 gene locus_tag LOCUS_04090 gene mnmE 4844 3387 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKE3 protein_id gnl|my_center|LOCUS_04090 >Feature sequence066 170 1252 gene locus_tag LOCUS_04100 170 1252 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258545.1 protein_id gnl|my_center|LOCUS_04100 1249 2673 gene locus_tag LOCUS_04110 1249 2673 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_04110 2677 3738 gene locus_tag LOCUS_04120 2677 3738 CDS product phosphate starvation-inducible protein PsiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392147.1 protein_id gnl|my_center|LOCUS_04120 3745 4923 gene locus_tag LOCUS_04130 3745 4923 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224295.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence067 2660 276 gene locus_tag LOCUS_04140 2660 276 CDS product glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939547.1 protein_id gnl|my_center|LOCUS_04140 3659 2757 gene locus_tag LOCUS_04150 3659 2757 CDS product pyruvate formate lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_04150 3758 4750 gene locus_tag LOCUS_04160 3758 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence068 1672 2598 gene locus_tag LOCUS_04170 1672 2598 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_04170 3065 3895 gene locus_tag LOCUS_04180 gene rnz 3065 3895 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TYN1 protein_id gnl|my_center|LOCUS_04180 4074 4886 gene locus_tag LOCUS_04190 4074 4886 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence069 660 1445 gene locus_tag LOCUS_04200 660 1445 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_04200 1645 1842 gene locus_tag LOCUS_04210 1645 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 1829 2017 gene locus_tag LOCUS_04220 1829 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 2211 3227 gene locus_tag LOCUS_04230 2211 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063668.1 protein_id gnl|my_center|LOCUS_04230 4158 3325 gene locus_tag LOCUS_04240 4158 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 4393 4151 gene locus_tag LOCUS_04250 4393 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 5023 4829 gene locus_tag LOCUS_04260 5023 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence070 2244 1093 gene locus_tag LOCUS_04270 gene hadC 2244 1093 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_04270 2666 2493 gene locus_tag LOCUS_04280 2666 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3047 2823 gene locus_tag LOCUS_04290 3047 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4162 3203 gene locus_tag LOCUS_04300 4162 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 4406 4125 gene locus_tag LOCUS_04310 4406 4125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4647 5153 gene locus_tag LOCUS_04320 4647 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence071 1689 244 gene locus_tag LOCUS_04330 1689 244 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHC2 protein_id gnl|my_center|LOCUS_04330 2681 1698 gene locus_tag LOCUS_04340 gene lacD 2681 1698 CDS product tagatose 1,6-diphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404751.1 protein_id gnl|my_center|LOCUS_04340 2809 4107 gene locus_tag LOCUS_04350 2809 4107 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975162.1 protein_id gnl|my_center|LOCUS_04350 4836 4126 gene locus_tag LOCUS_04360 4836 4126 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963678.1 protein_id gnl|my_center|LOCUS_04360 5168 4902 gene locus_tag LOCUS_04370 5168 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence072 500 574 gene locus_tag LOCUS_t00050 500 574 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1413 3611 gene locus_tag LOCUS_04380 1413 3611 CDS product dimethyl sulfoxide reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392899.1 protein_id gnl|my_center|LOCUS_04380 3690 4304 gene locus_tag LOCUS_04390 3690 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4336 5115 gene locus_tag LOCUS_04400 4336 5115 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728229.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence073 2444 1029 gene locus_tag LOCUS_04410 gene serS 2444 1029 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE34 protein_id gnl|my_center|LOCUS_04410 4009 2483 gene locus_tag LOCUS_04420 gene lysS 4009 2483 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM49 protein_id gnl|my_center|LOCUS_04420 4507 4013 gene locus_tag LOCUS_04430 gene greA 4507 4013 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM50 protein_id gnl|my_center|LOCUS_04430 <5176 4611 gene locus_tag LOCUS_04440 <5176 4611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFW9:DNA repair protein RecO >Feature sequence074 1031 2794 gene locus_tag LOCUS_04450 1031 2794 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703274.1 protein_id gnl|my_center|LOCUS_04450 2953 4134 gene locus_tag LOCUS_04460 2953 4134 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228032.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence075 278 1534 gene locus_tag LOCUS_04470 278 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392827.1 protein_id gnl|my_center|LOCUS_04470 1479 1796 gene locus_tag LOCUS_04480 1479 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3316 1883 gene locus_tag LOCUS_04490 3316 1883 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461336.1 protein_id gnl|my_center|LOCUS_04490 3712 3548 gene locus_tag LOCUS_04500 3712 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 5154 4120 gene locus_tag LOCUS_04510 5154 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence076 1232 381 gene locus_tag LOCUS_04520 1232 381 CDS product ferredoxin-NADP+ reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_04520 4017 1243 gene locus_tag LOCUS_04530 4017 1243 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_04530 <5135 4035 gene locus_tag LOCUS_04540 <5135 4035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053741.1:glutamate synthase >Feature sequence077 1741 482 gene locus_tag LOCUS_04550 gene ybfB 1741 482 CDS product putative MFS-type transporter YbfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31444 protein_id gnl|my_center|LOCUS_04550 2043 3317 gene locus_tag LOCUS_04560 2043 3317 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876428.1 protein_id gnl|my_center|LOCUS_04560 3322 3759 gene locus_tag LOCUS_04570 3322 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence078 753 64 gene locus_tag LOCUS_04580 753 64 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_04580 1263 892 gene locus_tag LOCUS_04590 1263 892 CDS product 6-carboxy-5,6,7,8-tetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YJJ7 protein_id gnl|my_center|LOCUS_04590 2626 1244 gene locus_tag LOCUS_04600 2626 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2802 4352 gene locus_tag LOCUS_04610 2802 4352 CDS product methylmalonyl-CoA carboxyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_04610 4364 4552 gene locus_tag LOCUS_04620 4364 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence079 132 1100 gene locus_tag LOCUS_04630 132 1100 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_04630 1154 2560 gene locus_tag LOCUS_04640 1154 2560 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393793.1 protein_id gnl|my_center|LOCUS_04640 4100 2577 gene locus_tag LOCUS_04650 gene asnB 4100 2577 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_04650 >Feature sequence080 1952 378 gene locus_tag LOCUS_04660 1952 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2814 1939 gene locus_tag LOCUS_04670 2814 1939 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_04670 3754 2882 gene locus_tag LOCUS_04680 3754 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence081 643 1524 gene locus_tag LOCUS_04690 643 1524 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2Q6 protein_id gnl|my_center|LOCUS_04690 1720 2403 gene locus_tag LOCUS_04700 gene hrb 1720 2403 CDS product high molecular weight rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9FDN6 protein_id gnl|my_center|LOCUS_04700 2445 3629 gene locus_tag LOCUS_04710 2445 3629 CDS product MBL fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939297.1 protein_id gnl|my_center|LOCUS_04710 <5082 3652 gene locus_tag LOCUS_04720 <5082 3652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391701.1:aldehyde ferredoxin oxidoreductase >Feature sequence082 926 537 gene locus_tag LOCUS_04730 926 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_04730 1178 1345 gene locus_tag LOCUS_04740 1178 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 1345 2661 gene locus_tag LOCUS_04750 1345 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871010.1 protein_id gnl|my_center|LOCUS_04750 3475 2672 gene locus_tag LOCUS_04760 3475 2672 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729564.1 protein_id gnl|my_center|LOCUS_04760 4827 3505 gene locus_tag LOCUS_04770 4827 3505 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence083 1081 554 gene locus_tag LOCUS_04780 1081 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1274 1092 gene locus_tag LOCUS_04790 1274 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1431 2114 gene locus_tag LOCUS_04800 1431 2114 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727023.1 protein_id gnl|my_center|LOCUS_04800 2333 2485 gene locus_tag LOCUS_04810 2333 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 2495 2896 gene locus_tag LOCUS_04820 2495 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3321 2986 gene locus_tag LOCUS_04830 3321 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3509 4792 gene locus_tag LOCUS_04840 3509 4792 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085873.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence084 411 752 gene locus_tag LOCUS_04850 411 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1656 784 gene locus_tag LOCUS_04860 gene ispH 1656 784 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749Y8 protein_id gnl|my_center|LOCUS_04860 2331 1660 gene locus_tag LOCUS_04870 2331 1660 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460203.1 protein_id gnl|my_center|LOCUS_04870 2991 2332 gene locus_tag LOCUS_04880 2991 2332 CDS product cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460204.1 protein_id gnl|my_center|LOCUS_04880 3805 3110 gene locus_tag LOCUS_04890 3805 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 <5007 3974 gene locus_tag LOCUS_04900 <5007 3974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74DD6:ferrous iron transport protein B >Feature sequence085 254 1018 gene locus_tag LOCUS_04910 254 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 2265 1030 gene locus_tag LOCUS_04920 2265 1030 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392515.1 protein_id gnl|my_center|LOCUS_04920 3048 2350 gene locus_tag LOCUS_04930 3048 2350 CDS product UPF0173 metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q725W7 protein_id gnl|my_center|LOCUS_04930 4699 3140 gene locus_tag LOCUS_04940 4699 3140 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085732.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence086 <1 1111 gene locus_tag LOCUS_04950 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867476.1:CoA-binding protein 1259 2143 gene locus_tag LOCUS_04960 1259 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2506 2649 gene locus_tag LOCUS_04970 2506 2649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04970 2829 2972 gene locus_tag LOCUS_04980 2829 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 4694 3048 gene locus_tag LOCUS_04990 4694 3048 CDS product cyclohexanecarboxylate-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553693.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence087 1329 301 gene locus_tag LOCUS_05000 1329 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 1639 1364 gene locus_tag LOCUS_05010 1639 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3744 1651 gene locus_tag LOCUS_05020 3744 1651 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817414.1 protein_id gnl|my_center|LOCUS_05020 4912 3758 gene locus_tag LOCUS_05030 4912 3758 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence088 2685 3122 gene locus_tag LOCUS_05040 2685 3122 CDS product NADH-quinone oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393386.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence089 405 758 gene locus_tag LOCUS_05050 405 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 774 1238 gene locus_tag LOCUS_05060 774 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1238 1468 gene locus_tag LOCUS_05070 1238 1468 CDS product preprotein translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_05070 1480 1956 gene locus_tag LOCUS_05080 1480 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391975.1 protein_id gnl|my_center|LOCUS_05080 1975 2280 gene locus_tag LOCUS_05090 1975 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2300 2635 gene locus_tag LOCUS_05100 2300 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2646 2900 gene locus_tag LOCUS_05110 2646 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 2919 3323 gene locus_tag LOCUS_05120 2919 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393003.1 protein_id gnl|my_center|LOCUS_05120 3808 3320 gene locus_tag LOCUS_05130 3808 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4398 3835 gene locus_tag LOCUS_05140 4398 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence090 1067 2365 gene locus_tag LOCUS_05150 1067 2365 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_05150 2666 2376 gene locus_tag LOCUS_05160 2666 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 4523 2730 gene locus_tag LOCUS_05170 4523 2730 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459452.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence091 <1 1007 gene locus_tag LOCUS_05180 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q818A4:aldehyde-alcohol dehydrogenase 1871 1032 gene locus_tag LOCUS_05190 1871 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2728 2006 gene locus_tag LOCUS_05200 2728 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4452 2725 gene locus_tag LOCUS_05210 4452 2725 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_05210 4808 4467 gene locus_tag LOCUS_05220 4808 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence092 <1 1520 gene locus_tag LOCUS_05230 <1 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000553693.1:cyclohexanecarboxylate-CoA ligase 2205 2711 gene locus_tag LOCUS_05240 gene slyD 2205 2711 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F0KKH7 protein_id gnl|my_center|LOCUS_05240 3357 3136 gene locus_tag LOCUS_05250 3357 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence093 <1 708 gene locus_tag LOCUS_05260 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860836.1:galactitol-1-phosphate 5-dehydrogenase 985 743 gene locus_tag LOCUS_05270 985 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 3942 1057 gene locus_tag LOCUS_05280 3942 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence094 2331 1063 gene locus_tag LOCUS_05290 gene ahcY 2331 1063 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHE1 protein_id gnl|my_center|LOCUS_05290 3567 2335 gene locus_tag LOCUS_05300 3567 2335 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546177.1 protein_id gnl|my_center|LOCUS_05300 4324 3818 gene locus_tag LOCUS_05310 4324 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence095 2305 1235 gene locus_tag LOCUS_05320 2305 1235 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_05320 3587 2307 gene locus_tag LOCUS_05330 3587 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 <4788 3538 gene locus_tag LOCUS_05340 <4788 3538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878942.1:ATPase >Feature sequence096 <1 1682 gene locus_tag LOCUS_05350 <1 1682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8DKW6:ATP-dependent DNA helicase RecG 1693 2175 gene locus_tag LOCUS_05360 1693 2175 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877752.1 protein_id gnl|my_center|LOCUS_05360 2176 3834 gene locus_tag LOCUS_05370 gene argS 2176 3834 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFU7 protein_id gnl|my_center|LOCUS_05370 >Feature sequence097 <1 1587 gene locus_tag LOCUS_05380 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014538204.1:methylhydantoinase 1626 4076 gene locus_tag LOCUS_05390 1626 4076 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462124.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence098 206 1054 gene locus_tag LOCUS_05400 206 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 1093 1932 gene locus_tag LOCUS_05410 1093 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_05410 1968 2750 gene locus_tag LOCUS_05420 gene menB 1968 2750 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE2 protein_id gnl|my_center|LOCUS_05420 2759 3613 gene locus_tag LOCUS_05430 2759 3613 CDS product 4-hydroxyphenyl-beta-ketoacyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225127.1 protein_id gnl|my_center|LOCUS_05430 3620 4480 gene locus_tag LOCUS_05440 gene rsmA 3620 4480 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH36 protein_id gnl|my_center|LOCUS_05440 >Feature sequence099 888 334 gene locus_tag LOCUS_05450 gene hslV 888 334 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP6 protein_id gnl|my_center|LOCUS_05450 1796 909 gene locus_tag LOCUS_05460 1796 909 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_05460 3199 1811 gene locus_tag LOCUS_05470 3199 1811 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_05470 3738 3214 gene locus_tag LOCUS_05480 3738 3214 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958021.1 protein_id gnl|my_center|LOCUS_05480 <4759 3738 gene locus_tag LOCUS_05490 <4759 3738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NHM2:3-dehydroquinate synthase >Feature sequence100 <1 1854 gene locus_tag LOCUS_05500 <1 1854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q89FE3:glucose-6-phosphate isomerase 3502 1883 gene locus_tag LOCUS_05510 3502 1883 CDS product carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706269.1 protein_id gnl|my_center|LOCUS_05510 <4720 3586 gene locus_tag LOCUS_05520 <4720 3586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808460.1:MFS transporter >Feature sequence101 1523 2371 gene locus_tag LOCUS_05530 1523 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2634 2440 gene locus_tag LOCUS_05540 2634 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 3985 2660 gene locus_tag LOCUS_05550 3985 2660 CDS product phenylacetate-coenzyme A ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK58 protein_id gnl|my_center|LOCUS_05550 4300 4719 gene locus_tag LOCUS_05560 4300 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393379.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence102 247 35 gene locus_tag LOCUS_05570 gene cspA 247 35 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115279.1 protein_id gnl|my_center|LOCUS_05570 944 408 gene locus_tag LOCUS_05580 944 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2081 1191 gene locus_tag LOCUS_05590 gene yqkF 2081 1191 CDS product putative oxidoreductase YqkF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P54569 protein_id gnl|my_center|LOCUS_05590 2636 2202 gene locus_tag LOCUS_05600 2636 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 4433 3303 gene locus_tag LOCUS_05610 4433 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence103 <1 1084 gene locus_tag LOCUS_05620 <1 1084 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943914.1:methylmalonyl-CoA mutase 1098 2750 gene locus_tag LOCUS_05630 1098 2750 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_05630 2774 3919 gene locus_tag LOCUS_05640 2774 3919 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence104 1781 444 gene locus_tag LOCUS_05650 1781 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393778.1 protein_id gnl|my_center|LOCUS_05650 2872 1799 gene locus_tag LOCUS_05660 2872 1799 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_05660 3213 4364 gene locus_tag LOCUS_05670 3213 4364 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804113.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence105 1515 1051 gene locus_tag LOCUS_05680 1515 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2021 1512 gene locus_tag LOCUS_05690 2021 1512 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_05690 3271 2018 gene locus_tag LOCUS_05700 3271 2018 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_05700 <4593 3273 gene locus_tag LOCUS_05710 <4593 3273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393034.1:pyruvate carboxylase subunit B >Feature sequence106 58 861 gene locus_tag LOCUS_05720 58 861 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583263.1 protein_id gnl|my_center|LOCUS_05720 864 2282 gene locus_tag LOCUS_05730 864 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 3468 2275 gene locus_tag LOCUS_05740 3468 2275 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ87 protein_id gnl|my_center|LOCUS_05740 3969 3487 gene locus_tag LOCUS_05750 3969 3487 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392703.1 protein_id gnl|my_center|LOCUS_05750 <4566 3992 gene locus_tag LOCUS_05760 <4566 3992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021506.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence107 315 782 gene locus_tag LOCUS_05770 315 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1098 823 gene locus_tag LOCUS_05780 1098 823 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920730.1 protein_id gnl|my_center|LOCUS_05780 1387 1145 gene locus_tag LOCUS_05790 1387 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2676 1444 gene locus_tag LOCUS_05800 gene thrC1 2676 1444 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66864 protein_id gnl|my_center|LOCUS_05800 3713 2751 gene locus_tag LOCUS_05810 3713 2751 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence108 1009 2274 gene locus_tag LOCUS_05820 1009 2274 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174885.1 protein_id gnl|my_center|LOCUS_05820 2295 2681 gene locus_tag LOCUS_05830 2295 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2739 2811 gene locus_tag LOCUS_t00060 2739 2811 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2848 2921 gene locus_tag LOCUS_t00070 2848 2921 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4161 3043 gene locus_tag LOCUS_05840 4161 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4443 4225 gene locus_tag LOCUS_05850 4443 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence109 <1 1393 gene locus_tag LOCUS_05860 <1 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to NP_310435.2:short chain acyl-CoA synthetase 1977 1408 gene locus_tag LOCUS_05870 1977 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 3274 2618 gene locus_tag LOCUS_05880 3274 2618 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_05880 4113 3640 gene locus_tag LOCUS_05890 gene greA 4113 3640 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RM50 protein_id gnl|my_center|LOCUS_05890 >Feature sequence110 3 1652 gene locus_tag LOCUS_05900 gene entE 3 1652 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955347.1 protein_id gnl|my_center|LOCUS_05900 2037 1819 gene locus_tag LOCUS_05910 2037 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2960 2331 gene locus_tag LOCUS_05920 2960 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence111 1612 983 gene locus_tag LOCUS_05930 1612 983 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258063.1 protein_id gnl|my_center|LOCUS_05930 2712 1624 gene locus_tag LOCUS_05940 2712 1624 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK07 protein_id gnl|my_center|LOCUS_05940 3300 2728 gene locus_tag LOCUS_05950 gene dcd 3300 2728 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B1MJL3 protein_id gnl|my_center|LOCUS_05950 4316 3504 gene locus_tag LOCUS_05960 4316 3504 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963019.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence112 1117 173 gene locus_tag LOCUS_05970 1117 173 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFM9 protein_id gnl|my_center|LOCUS_05970 2056 1265 gene locus_tag LOCUS_05980 gene nfi 2056 1265 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDJ2 protein_id gnl|my_center|LOCUS_05980 2208 2411 gene locus_tag LOCUS_05990 gene rpsP 2208 2411 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I4M6 protein_id gnl|my_center|LOCUS_05990 2465 2692 gene locus_tag LOCUS_06000 2465 2692 CDS product UPF0109 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q18BB7 protein_id gnl|my_center|LOCUS_06000 2730 3260 gene locus_tag LOCUS_06010 gene rimM 2730 3260 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJV5 protein_id gnl|my_center|LOCUS_06010 3306 3932 gene locus_tag LOCUS_06020 gene rex 3306 3932 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WB43 protein_id gnl|my_center|LOCUS_06020 4393 3983 gene locus_tag LOCUS_06030 gene atpC 4393 3983 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGS3 protein_id gnl|my_center|LOCUS_06030 >Feature sequence113 257 670 gene locus_tag LOCUS_06040 257 670 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_06040 989 1750 gene locus_tag LOCUS_06050 989 1750 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_06050 2279 2058 gene locus_tag LOCUS_06060 2279 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 2785 3885 gene locus_tag LOCUS_06070 2785 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence114 969 163 gene locus_tag LOCUS_06080 969 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 1744 1019 gene locus_tag LOCUS_06090 1744 1019 CDS product carboxymethylenebutenolidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143390.1 protein_id gnl|my_center|LOCUS_06090 2219 1917 gene locus_tag LOCUS_06100 2219 1917 CDS product NIPSNAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521451.1 protein_id gnl|my_center|LOCUS_06100 2425 2282 gene locus_tag LOCUS_06110 2425 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 3209 3823 gene locus_tag LOCUS_06120 3209 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4107 4430 gene locus_tag LOCUS_06130 4107 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence115 703 2187 gene locus_tag LOCUS_06140 703 2187 CDS product 3,4-dihydroxybenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704601.1 protein_id gnl|my_center|LOCUS_06140 2330 3211 gene locus_tag LOCUS_06150 gene dhaA 2330 3211 CDS product haloalkane dehalogenase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WMR9 protein_id gnl|my_center|LOCUS_06150 >Feature sequence116 594 3167 gene locus_tag LOCUS_06160 594 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 3181 3603 gene locus_tag LOCUS_06170 3181 3603 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327433.1 protein_id gnl|my_center|LOCUS_06170 <4373 3654 gene locus_tag LOCUS_06180 <4373 3654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877874.1:MFS transporter >Feature sequence117 53 304 gene locus_tag LOCUS_06190 53 304 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_06190 831 562 gene locus_tag LOCUS_06200 gene fdx 831 562 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808570.1 protein_id gnl|my_center|LOCUS_06200 1349 867 gene locus_tag LOCUS_06210 gene coaD 1349 867 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHB8 protein_id gnl|my_center|LOCUS_06210 1798 1346 gene locus_tag LOCUS_06220 1798 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 2024 3412 gene locus_tag LOCUS_06230 gene hslU 2024 3412 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O66574 protein_id gnl|my_center|LOCUS_06230 >Feature sequence118 120 1037 gene locus_tag LOCUS_06240 120 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931510.1 protein_id gnl|my_center|LOCUS_06240 1096 2583 gene locus_tag LOCUS_06250 1096 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2580 3125 gene locus_tag LOCUS_06260 2580 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3135 4022 gene locus_tag LOCUS_06270 3135 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068111.1 protein_id gnl|my_center|LOCUS_06270 >Feature sequence119 373 885 gene locus_tag LOCUS_06280 373 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 1840 995 gene locus_tag LOCUS_06290 1840 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530494.1 protein_id gnl|my_center|LOCUS_06290 2539 1844 gene locus_tag LOCUS_06300 2539 1844 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918213.1 protein_id gnl|my_center|LOCUS_06300 3665 2772 gene locus_tag LOCUS_06310 3665 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877507.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence120 1414 587 gene locus_tag LOCUS_06320 1414 587 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_06320 2164 1469 gene locus_tag LOCUS_06330 gene rnc 2164 1469 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AX1 protein_id gnl|my_center|LOCUS_06330 2314 3528 gene locus_tag LOCUS_06340 2314 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 3754 3488 gene locus_tag LOCUS_06350 3754 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 <4318 3768 gene locus_tag LOCUS_06360 <4318 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257493.1:DNA polymerase III subunit epsilon >Feature sequence121 487 1530 gene locus_tag LOCUS_06370 487 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 1542 1757 gene locus_tag LOCUS_06380 1542 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 1757 2473 gene locus_tag LOCUS_06390 1757 2473 CDS product cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731030.1 protein_id gnl|my_center|LOCUS_06390 2476 3558 gene locus_tag LOCUS_06400 gene cbiD 2476 3558 CDS product cobalt-precorrin-5B C(1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJI7 protein_id gnl|my_center|LOCUS_06400 3534 4169 gene locus_tag LOCUS_06410 3534 4169 CDS product precorrin-6y C5,15-methyltransferase (decarboxylating) subunit CbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392603.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence122 57 368 gene locus_tag LOCUS_06420 gene rplX 57 368 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P38513 protein_id gnl|my_center|LOCUS_06420 382 924 gene locus_tag LOCUS_06430 382 924 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_06430 977 1111 gene locus_tag LOCUS_06440 977 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1122 1523 gene locus_tag LOCUS_06450 gene rpsH 1122 1523 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH80 protein_id gnl|my_center|LOCUS_06450 1534 2088 gene locus_tag LOCUS_06460 gene rplF 1534 2088 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR2 protein_id gnl|my_center|LOCUS_06460 2093 2467 gene locus_tag LOCUS_06470 gene rplR 2093 2467 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH82 protein_id gnl|my_center|LOCUS_06470 2476 3030 gene locus_tag LOCUS_06480 gene rpsE 2476 3030 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFR4 protein_id gnl|my_center|LOCUS_06480 3002 3193 gene locus_tag LOCUS_06490 gene rpmD 3002 3193 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH84 protein_id gnl|my_center|LOCUS_06490 3190 3636 gene locus_tag LOCUS_06500 gene rplO 3190 3636 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y447 protein_id gnl|my_center|LOCUS_06500 >Feature sequence123 404 1132 gene locus_tag LOCUS_06510 404 1132 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930274.1 protein_id gnl|my_center|LOCUS_06510 1252 2181 gene locus_tag LOCUS_06520 gene pyrD 1252 2181 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGM0 protein_id gnl|my_center|LOCUS_06520 2468 2256 gene locus_tag LOCUS_06530 2468 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2701 3474 gene locus_tag LOCUS_06540 2701 3474 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_06540 4168 3578 gene locus_tag LOCUS_06550 4168 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence124 3 1052 gene locus_tag LOCUS_06560 gene lysA 3 1052 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIR2 protein_id gnl|my_center|LOCUS_06560 1085 2068 gene locus_tag LOCUS_06570 1085 2068 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_06570 2075 2914 gene locus_tag LOCUS_06580 2075 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 3504 2947 gene locus_tag LOCUS_06590 3504 2947 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583256.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence125 746 444 gene locus_tag LOCUS_06600 746 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 1618 758 gene locus_tag LOCUS_06610 1618 758 CDS product molybdopterin oxidoreductase membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_06610 2243 1641 gene locus_tag LOCUS_06620 2243 1641 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064598.1 protein_id gnl|my_center|LOCUS_06620 3119 2313 gene locus_tag LOCUS_06630 3119 2313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006315998.1 protein_id gnl|my_center|LOCUS_06630 3910 3116 gene locus_tag LOCUS_06640 3910 3116 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337597.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence126 <1 914 gene locus_tag LOCUS_06650 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869733.1:C4-dicarboxylate ABC transporter 1013 3100 gene locus_tag LOCUS_06660 1013 3100 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393465.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence127 <1 1903 gene locus_tag LOCUS_06670 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000380694.1:dimethyl sulfoxide reductase subunit A 1906 3093 gene locus_tag LOCUS_06680 gene pdxA 1906 3093 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKJ4 protein_id gnl|my_center|LOCUS_06680 3646 3572 gene locus_tag LOCUS_t00080 3646 3572 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3812 4033 gene locus_tag LOCUS_06690 3812 4033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence128 1 480 gene locus_tag LOCUS_06700 1 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 652 1710 gene locus_tag LOCUS_06710 gene yacL 652 1710 CDS product putative PIN and TRAM-domain containing protein YacL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q06754 protein_id gnl|my_center|LOCUS_06710 1688 2386 gene locus_tag LOCUS_06720 1688 2386 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942744.1 protein_id gnl|my_center|LOCUS_06720 2455 2913 gene locus_tag LOCUS_06730 gene ispF 2455 2913 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q839V8 protein_id gnl|my_center|LOCUS_06730 >Feature sequence129 <1 821 gene locus_tag LOCUS_06740 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811376.1:cell division protein FtsZ 1232 837 gene locus_tag LOCUS_06750 1232 837 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_06750 2927 1245 gene locus_tag LOCUS_06760 2927 1245 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_06760 3375 2944 gene locus_tag LOCUS_06770 3375 2944 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence130 779 117 gene locus_tag LOCUS_06780 779 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 1292 789 gene locus_tag LOCUS_06790 1292 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2529 1414 gene locus_tag LOCUS_06800 2529 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 2897 2694 gene locus_tag LOCUS_06810 2897 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence131 <1 1209 gene locus_tag LOCUS_06820 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090641.1:amidase 2896 1466 gene locus_tag LOCUS_06830 2896 1466 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence132 2558 1659 gene locus_tag LOCUS_06840 2558 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3451 2918 gene locus_tag LOCUS_06850 3451 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 3962 3468 gene locus_tag LOCUS_06860 3962 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence133 <1 939 gene locus_tag LOCUS_06870 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIW9:homoserine dehydrogenase 964 2016 gene locus_tag LOCUS_06880 964 2016 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIX0 protein_id gnl|my_center|LOCUS_06880 2037 2456 gene locus_tag LOCUS_06890 2037 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2449 2607 gene locus_tag LOCUS_06900 2449 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2626 3192 gene locus_tag LOCUS_06910 gene folE 2626 3192 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RLE7 protein_id gnl|my_center|LOCUS_06910 <3971 3213 gene locus_tag LOCUS_06920 <3971 3213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RG54:transport permease protein >Feature sequence134 357 683 gene locus_tag LOCUS_06930 357 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 884 1354 gene locus_tag LOCUS_06940 884 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 1369 2025 gene locus_tag LOCUS_06950 1369 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence135 1608 526 gene locus_tag LOCUS_06960 gene cobT 1608 526 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIQ7 protein_id gnl|my_center|LOCUS_06960 1930 2577 gene locus_tag LOCUS_06970 1930 2577 CDS product lysine transporter LysE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392339.1 protein_id gnl|my_center|LOCUS_06970 2655 3137 gene locus_tag LOCUS_06980 2655 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence136 <1 734 gene locus_tag LOCUS_06990 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P58254:protein RecA 771 1409 gene locus_tag LOCUS_07000 gene recX 771 1409 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJ77 protein_id gnl|my_center|LOCUS_07000 2209 1406 gene locus_tag LOCUS_07010 gene mutM 2209 1406 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHE9 protein_id gnl|my_center|LOCUS_07010 <3832 2212 gene locus_tag LOCUS_07020 <3832 2212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74FR5:DNA polymerase >Feature sequence137 658 320 gene locus_tag LOCUS_07030 658 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 869 1906 gene locus_tag LOCUS_07040 869 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804719.1 protein_id gnl|my_center|LOCUS_07040 2261 2097 gene locus_tag LOCUS_07050 2261 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence138 3385 3311 gene locus_tag LOCUS_t00090 3385 3311 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence139 1977 535 gene locus_tag LOCUS_07060 1977 535 CDS product 4-hydroxybutyryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064616.1 protein_id gnl|my_center|LOCUS_07060 3673 2066 gene locus_tag LOCUS_07070 3673 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence140 <1 1500 gene locus_tag LOCUS_07080 <1 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986883.1:GTP-binding protein 1574 2581 gene locus_tag LOCUS_07090 1574 2581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879345.1 protein_id gnl|my_center|LOCUS_07090 2873 2697 gene locus_tag LOCUS_07100 2873 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3065 2907 gene locus_tag LOCUS_07110 3065 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence141 1516 293 gene locus_tag LOCUS_07120 1516 293 CDS product aspartokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0J9 protein_id gnl|my_center|LOCUS_07120 2350 2144 gene locus_tag LOCUS_07130 2350 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3597 2395 gene locus_tag LOCUS_07140 3597 2395 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence142 1131 19 gene locus_tag LOCUS_07150 1131 19 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046900.1 protein_id gnl|my_center|LOCUS_07150 2294 1143 gene locus_tag LOCUS_07160 gene ahbC 2294 1143 CDS product 12,18-didecarboxysiroheme deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022974.1 protein_id gnl|my_center|LOCUS_07160 2807 2409 gene locus_tag LOCUS_07170 2807 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702218.1 protein_id gnl|my_center|LOCUS_07170 <3728 2811 gene locus_tag LOCUS_07180 <3728 2811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003975900.1:cysteine synthase >Feature sequence143 3042 1708 gene locus_tag LOCUS_07190 3042 1708 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_07190 3694 3212 gene locus_tag LOCUS_07200 3694 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020713.1 protein_id gnl|my_center|LOCUS_07200 >Feature sequence144 <1 1027 gene locus_tag LOCUS_07210 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391701.1:aldehyde ferredoxin oxidoreductase 1069 1560 gene locus_tag LOCUS_07220 1069 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1577 1843 gene locus_tag LOCUS_07230 1577 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2848 1853 gene locus_tag LOCUS_07240 2848 1853 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258742.1 protein_id gnl|my_center|LOCUS_07240 3093 2848 gene locus_tag LOCUS_07250 3093 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence145 2162 1044 gene locus_tag LOCUS_07260 2162 1044 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811019.1 protein_id gnl|my_center|LOCUS_07260 <3710 2243 gene locus_tag LOCUS_07270 <3710 2243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392243.1:aldehyde ferredoxin oxidoreductase >Feature sequence146 1045 209 gene locus_tag LOCUS_07280 1045 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1164 2840 gene locus_tag LOCUS_07290 1164 2840 CDS product 2,3-dihydroxybenzoate-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960113.1 protein_id gnl|my_center|LOCUS_07290 >Feature sequence147 <1 856 gene locus_tag LOCUS_07300 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943070.1:ATP-dependent protease 1052 1315 gene locus_tag LOCUS_07310 1052 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1401 2615 gene locus_tag LOCUS_07320 1401 2615 CDS product peptidase S41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_07320 2665 3111 gene locus_tag LOCUS_07330 gene smpB 2665 3111 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q815L5 protein_id gnl|my_center|LOCUS_07330 3144 3498 gene locus_tag LOCUS_tm00010 3144 3498 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence148 82 942 gene locus_tag LOCUS_07340 82 942 CDS product NAD-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942601.1 protein_id gnl|my_center|LOCUS_07340 968 1339 gene locus_tag LOCUS_07350 968 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1385 3166 gene locus_tag LOCUS_07360 1385 3166 CDS product 3-oxoacid CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414123.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence149 331 531 gene locus_tag LOCUS_07370 331 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 641 1114 gene locus_tag LOCUS_07380 641 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07380 2719 1403 gene locus_tag LOCUS_07390 2719 1403 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_07390 3593 2814 gene locus_tag LOCUS_07400 3593 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence150 857 84 gene locus_tag LOCUS_07410 857 84 CDS product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_07410 1456 1067 gene locus_tag LOCUS_07420 1456 1067 CDS product enamine deaminase RidA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169716.1 protein_id gnl|my_center|LOCUS_07420 1722 3041 gene locus_tag LOCUS_07430 1722 3041 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460239.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence151 <1 1182 gene locus_tag LOCUS_07440 <1 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181489.1:MFS transporter 2168 1188 gene locus_tag LOCUS_07450 gene holA 2168 1188 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403276.1 protein_id gnl|my_center|LOCUS_07450 3227 2940 gene locus_tag LOCUS_07460 3227 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 >Feature sequence152 <1 2230 gene locus_tag LOCUS_07470 <1 2230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RKZ1:leucine--tRNA ligase 2227 2892 gene locus_tag LOCUS_07480 2227 2892 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence153 908 375 gene locus_tag LOCUS_07490 908 375 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940509.1 protein_id gnl|my_center|LOCUS_07490 1694 927 gene locus_tag LOCUS_07500 1694 927 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258270.1 protein_id gnl|my_center|LOCUS_07500 3012 1705 gene locus_tag LOCUS_07510 3012 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 <3531 3012 gene locus_tag LOCUS_07520 <3531 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811019.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence154 <1 1550 gene locus_tag LOCUS_07530 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WKL7:tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG 1547 3094 gene locus_tag LOCUS_07540 1547 3094 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_07540 3144 3377 gene locus_tag LOCUS_07550 3144 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence155 259 35 gene locus_tag LOCUS_07560 259 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 635 474 gene locus_tag LOCUS_07570 635 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 909 613 gene locus_tag LOCUS_07580 909 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07580 1564 944 gene locus_tag LOCUS_07590 gene trpF 1564 944 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AH7 protein_id gnl|my_center|LOCUS_07590 1651 1947 gene locus_tag LOCUS_07600 1651 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2802 2032 gene locus_tag LOCUS_07610 gene trpC 2802 2032 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QX95 protein_id gnl|my_center|LOCUS_07610 3505 2804 gene locus_tag LOCUS_07620 3505 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence156 1830 517 gene locus_tag LOCUS_07630 1830 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1927 1808 gene locus_tag LOCUS_07640 1927 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3054 1924 gene locus_tag LOCUS_07650 3054 1924 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869008.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence157 1217 2644 gene locus_tag LOCUS_07660 1217 2644 CDS product ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877547.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence158 1082 843 gene locus_tag LOCUS_07670 1082 843 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256580.1 protein_id gnl|my_center|LOCUS_07670 2302 1106 gene locus_tag LOCUS_07680 2302 1106 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_07680 2422 2883 gene locus_tag LOCUS_07690 gene ybeY 2422 2883 CDS product endoribonuclease YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O67367 protein_id gnl|my_center|LOCUS_07690 >Feature sequence159 2326 1832 gene locus_tag LOCUS_07700 2326 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2748 2524 gene locus_tag LOCUS_07710 2748 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 <3450 2790 gene locus_tag LOCUS_07720 <3450 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969635.1:dehydrogenase >Feature sequence160 2573 1386 gene locus_tag LOCUS_07730 2573 1386 CDS product iron-sulfur-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878013.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence161 1186 299 gene locus_tag LOCUS_07740 1186 299 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_07740 2105 1176 gene locus_tag LOCUS_07750 2105 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <3449 2117 gene locus_tag LOCUS_07760 <3449 2117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405161.1:succinate dehydrogenase >Feature sequence162 335 260 gene locus_tag LOCUS_t00100 335 260 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 677 1573 gene locus_tag LOCUS_07770 gene crt 677 1573 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_07770 1587 2447 gene locus_tag LOCUS_07780 1587 2447 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896244.1 protein_id gnl|my_center|LOCUS_07780 2452 3381 gene locus_tag LOCUS_07790 2452 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence163 <1 874 gene locus_tag LOCUS_07800 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404736.1:dimethylhistidine N-methyltransferase <3426 925 gene locus_tag LOCUS_07810 <3426 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817414.1:dehydrogenase >Feature sequence164 <1 936 gene locus_tag LOCUS_07820 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460386.1:peptidase M16 <3424 1404 gene locus_tag LOCUS_07830 <3424 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941439.1:two-component sensor histidine kinase >Feature sequence165 485 2176 gene locus_tag LOCUS_07840 485 2176 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_07840 2149 2457 gene locus_tag LOCUS_07850 2149 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 <3418 2471 gene locus_tag LOCUS_07860 <3418 2471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459116.1:FAD-binding dehydrogenase >Feature sequence166 32 700 gene locus_tag LOCUS_07870 32 700 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048417.1 protein_id gnl|my_center|LOCUS_07870 715 1995 gene locus_tag LOCUS_07880 gene glgC 715 1995 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WI38 protein_id gnl|my_center|LOCUS_07880 3215 2028 gene locus_tag LOCUS_07890 3215 2028 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583229.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence167 555 935 gene locus_tag LOCUS_07900 555 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1153 2139 gene locus_tag LOCUS_07910 1153 2139 CDS product sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942004.1 protein_id gnl|my_center|LOCUS_07910 2132 2407 gene locus_tag LOCUS_07920 2132 2407 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_07920 2733 2530 gene locus_tag LOCUS_07930 2733 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 2927 3067 gene locus_tag LOCUS_07940 2927 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 >Feature sequence168 1765 2808 gene locus_tag LOCUS_07950 1765 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3023 3145 gene locus_tag LOCUS_07960 3023 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 >Feature sequence169 945 10 gene locus_tag LOCUS_07970 gene prmA 945 10 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD89 protein_id gnl|my_center|LOCUS_07970 2053 932 gene locus_tag LOCUS_07980 gene dnaJ 2053 932 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKX3 protein_id gnl|my_center|LOCUS_07980 <3379 2268 gene locus_tag LOCUS_07990 <3379 2268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72DW8:chaperone protein DnaK >Feature sequence170 <1 893 gene locus_tag LOCUS_08000 <1 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122759.1:cycloinulo-oligosaccharide fructanotransferase 1588 890 gene locus_tag LOCUS_08010 1588 890 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_08010 2009 2755 gene locus_tag LOCUS_08020 gene fabG 2009 2755 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P51831 protein_id gnl|my_center|LOCUS_08020 >Feature sequence171 1336 281 gene locus_tag LOCUS_08030 1336 281 CDS product iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878131.1 protein_id gnl|my_center|LOCUS_08030 1528 2634 gene locus_tag LOCUS_08040 1528 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 2748 2822 gene locus_tag LOCUS_t00110 2748 2822 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence172 299 1513 gene locus_tag LOCUS_08050 299 1513 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_08050 2310 1510 gene locus_tag LOCUS_08060 2310 1510 CDS product alpha/beta hydrolase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869263.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence173 <3351 620 gene locus_tag LOCUS_08070 <3351 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877688.1:molybdopterin oxidoreductase >Feature sequence174 1197 2576 gene locus_tag LOCUS_08080 1197 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence175 114 452 gene locus_tag LOCUS_08090 114 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 439 2313 gene locus_tag LOCUS_08100 439 2313 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_08100 2327 2761 gene locus_tag LOCUS_08110 2327 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 <3322 2739 gene locus_tag LOCUS_08120 <3322 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P9WFZ5:trehalose-phosphate phosphatase >Feature sequence176 710 27 gene locus_tag LOCUS_08130 710 27 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_08130 1111 899 gene locus_tag LOCUS_08140 1111 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1734 1414 gene locus_tag LOCUS_08150 1734 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2377 1799 gene locus_tag LOCUS_08160 2377 1799 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409492.1 protein_id gnl|my_center|LOCUS_08160 2901 3044 gene locus_tag LOCUS_08170 2901 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 >Feature sequence177 1122 511 gene locus_tag LOCUS_08180 1122 511 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE78 protein_id gnl|my_center|LOCUS_08180 2221 1127 gene locus_tag LOCUS_08190 gene fbp 2221 1127 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RG86 protein_id gnl|my_center|LOCUS_08190 <3284 2244 gene locus_tag LOCUS_08200 <3284 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257715.1:methylmalonyl-CoA mutase >Feature sequence178 2519 1746 gene locus_tag LOCUS_08210 2519 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 >Feature sequence179 1117 407 gene locus_tag LOCUS_08220 gene hisA 1117 407 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WD26 protein_id gnl|my_center|LOCUS_08220 1273 3141 gene locus_tag LOCUS_08230 1273 3141 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392091.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence180 228 1256 gene locus_tag LOCUS_08240 228 1256 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_08240 2154 1267 gene locus_tag LOCUS_08250 2154 1267 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393185.1 protein_id gnl|my_center|LOCUS_08250 3075 2161 gene locus_tag LOCUS_08260 gene secF 3075 2161 CDS product protein-export membrane protein SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGQ9 protein_id gnl|my_center|LOCUS_08260 >Feature sequence181 <1 606 gene locus_tag LOCUS_08270 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817317.1:molecular chaperone GroEL 766 1332 gene locus_tag LOCUS_08280 766 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080707.1 protein_id gnl|my_center|LOCUS_08280 2603 1329 gene locus_tag LOCUS_08290 2603 1329 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence182 761 465 gene locus_tag LOCUS_08300 gene rplW 761 465 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B5X3 protein_id gnl|my_center|LOCUS_08300 1405 758 gene locus_tag LOCUS_08310 gene rplD 1405 758 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP8 protein_id gnl|my_center|LOCUS_08310 2001 1402 gene locus_tag LOCUS_08320 gene rplC 2001 1402 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH66 protein_id gnl|my_center|LOCUS_08320 2356 2048 gene locus_tag LOCUS_08330 gene rpsJ 2356 2048 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH65 protein_id gnl|my_center|LOCUS_08330 <3190 2382 gene locus_tag LOCUS_08340 <3190 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q748Y8:elongation factor G 2 >Feature sequence183 1213 1923 gene locus_tag LOCUS_08350 1213 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08350 2635 2156 gene locus_tag LOCUS_08360 2635 2156 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence184 792 301 gene locus_tag LOCUS_08370 792 301 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_08370 1304 777 gene locus_tag LOCUS_08380 1304 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2361 1294 gene locus_tag LOCUS_08390 gene nuoH 2361 1294 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJU3 protein_id gnl|my_center|LOCUS_08390 <3180 2361 gene locus_tag LOCUS_08400 <3180 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WED7:NADH-quinone oxidoreductase subunit D 1 >Feature sequence185 <1 816 gene locus_tag LOCUS_08410 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226750.1:carboxylate--amine ligase 866 940 gene locus_tag LOCUS_t00120 866 940 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 950 1035 gene locus_tag LOCUS_t00130 950 1035 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1067 1141 gene locus_tag LOCUS_t00140 1067 1141 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1237 1313 gene locus_tag LOCUS_t00150 1237 1313 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence186 807 1991 gene locus_tag LOCUS_08420 807 1991 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence187 1 954 gene locus_tag LOCUS_08430 1 954 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704564.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence188 1736 1557 gene locus_tag LOCUS_08440 1736 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2715 1828 gene locus_tag LOCUS_08450 2715 1828 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence189 173 1090 gene locus_tag LOCUS_08460 173 1090 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701360.1 protein_id gnl|my_center|LOCUS_08460 1681 1133 gene locus_tag LOCUS_08470 1681 1133 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679998.1 protein_id gnl|my_center|LOCUS_08470 2125 1685 gene locus_tag LOCUS_08480 2125 1685 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259162.1 protein_id gnl|my_center|LOCUS_08480 3080 2169 gene locus_tag LOCUS_08490 3080 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence190 23 781 gene locus_tag LOCUS_08500 23 781 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061125.1 protein_id gnl|my_center|LOCUS_08500 808 1728 gene locus_tag LOCUS_08510 808 1728 CDS product 5-methyltetrahydrofolate:corrinoid/iron-sulfur protein Co-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_08510 <3148 1788 gene locus_tag LOCUS_08520 <3148 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74BP0:DNA mismatch repair protein MutL >Feature sequence191 <1 931 gene locus_tag LOCUS_08530 <1 931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFD0:deoxyguanosinetriphosphate triphosphohydrolase-like protein 928 2997 gene locus_tag LOCUS_08540 928 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence192 1005 433 gene locus_tag LOCUS_08550 1005 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2516 1002 gene locus_tag LOCUS_08560 2516 1002 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459454.1 protein_id gnl|my_center|LOCUS_08560 <3137 2605 gene locus_tag LOCUS_08570 <3137 2605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808742.1:ABC transporter substrate-binding protein >Feature sequence193 <1 718 gene locus_tag LOCUS_08580 <1 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228861.1:mechanosensitive ion channel protein MscS 2196 1882 gene locus_tag LOCUS_08590 2196 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08590 >Feature sequence194 1703 231 gene locus_tag LOCUS_08600 1703 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2314 1751 gene locus_tag LOCUS_08610 gene pyrR 2314 1751 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDU6 protein_id gnl|my_center|LOCUS_08610 >Feature sequence195 155 1255 gene locus_tag LOCUS_08620 155 1255 CDS product (4Fe-4S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878758.1 protein_id gnl|my_center|LOCUS_08620 1278 2039 gene locus_tag LOCUS_08630 1278 2039 CDS product multidrug ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898975.1 protein_id gnl|my_center|LOCUS_08630 2041 2772 gene locus_tag LOCUS_08640 2041 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence196 >Feature sequence197 390 1619 gene locus_tag LOCUS_08650 390 1619 CDS product heme d1 biosynthesis radical SAM protein NirJ2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392759.1 protein_id gnl|my_center|LOCUS_08650 2377 2841 gene locus_tag LOCUS_08660 2377 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2868 3050 gene locus_tag LOCUS_08670 2868 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence198 <1 1449 gene locus_tag LOCUS_08680 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WJ75:CTP synthase 1461 2111 gene locus_tag LOCUS_08690 gene tal 1461 2111 CDS product putative transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFV4 protein_id gnl|my_center|LOCUS_08690 >Feature sequence199 2447 1551 gene locus_tag LOCUS_08700 2447 1551 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013534.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence200 692 2416 gene locus_tag LOCUS_08710 692 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence201 347 1177 gene locus_tag LOCUS_08720 347 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258275.1 protein_id gnl|my_center|LOCUS_08720 1196 2101 gene locus_tag LOCUS_08730 1196 2101 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392393.1 protein_id gnl|my_center|LOCUS_08730 2098 2874 gene locus_tag LOCUS_08740 2098 2874 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YFL7 protein_id gnl|my_center|LOCUS_08740 >Feature sequence202 956 159 gene locus_tag LOCUS_08750 gene surE 956 159 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJD1 protein_id gnl|my_center|LOCUS_08750 1124 1501 gene locus_tag LOCUS_08760 1124 1501 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460440.1 protein_id gnl|my_center|LOCUS_08760 1492 2073 gene locus_tag LOCUS_08770 1492 2073 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813216.1 protein_id gnl|my_center|LOCUS_08770 2077 2268 gene locus_tag LOCUS_08780 2077 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 2272 2715 gene locus_tag LOCUS_08790 2272 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence203 320 153 gene locus_tag LOCUS_08800 320 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1264 698 gene locus_tag LOCUS_08810 1264 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 <3006 1290 gene locus_tag LOCUS_08820 <3006 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530646.1:oxidoreductase >Feature sequence204 879 2747 gene locus_tag LOCUS_08830 879 2747 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227894.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence205 853 413 gene locus_tag LOCUS_08840 853 413 CDS product phenylacetic acid degradation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546098.1 protein_id gnl|my_center|LOCUS_08840 1552 872 gene locus_tag LOCUS_08850 1552 872 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_08850 1968 1549 gene locus_tag LOCUS_08860 1968 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 <3003 1991 gene locus_tag LOCUS_08870 <3003 1991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747S1:thiamine-monophosphate kinase >Feature sequence206 1413 508 gene locus_tag LOCUS_08880 1413 508 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941438.1 protein_id gnl|my_center|LOCUS_08880 2241 1513 gene locus_tag LOCUS_08890 2241 1513 CDS product GlcNAc-PI de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978056.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence207 <1 1059 gene locus_tag LOCUS_08900 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHG9:transcription-repair-coupling factor 1926 1231 gene locus_tag LOCUS_08910 1926 1231 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633090.1 protein_id gnl|my_center|LOCUS_08910 2192 1932 gene locus_tag LOCUS_08920 gene acpP 2192 1932 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P63447 protein_id gnl|my_center|LOCUS_08920 2615 2211 gene locus_tag LOCUS_08930 gene nusB 2615 2211 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKH7 protein_id gnl|my_center|LOCUS_08930 >Feature sequence208 1297 965 gene locus_tag LOCUS_08940 1297 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1592 1377 gene locus_tag LOCUS_08950 1592 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2520 1567 gene locus_tag LOCUS_08960 2520 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence209 <1 529 gene locus_tag LOCUS_08970 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B8E123:arginine--tRNA ligase 1084 1335 gene locus_tag LOCUS_08980 1084 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08980 1611 2540 gene locus_tag LOCUS_08990 1611 2540 CDS product DDE transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence210 <1 1130 gene locus_tag LOCUS_09000 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227894.1:aldehyde ferredoxin oxidoreductase >Feature sequence211 262 2538 gene locus_tag LOCUS_09010 262 2538 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence212 <1 851 gene locus_tag LOCUS_09020 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090563.1:C4-dicarboxylate ABC transporter 891 1376 gene locus_tag LOCUS_09030 891 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1373 2677 gene locus_tag LOCUS_09040 1373 2677 CDS product C4-dicarboxylate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812141.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence213 753 1781 gene locus_tag LOCUS_09050 753 1781 CDS product aminoglycoside phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640185.1 protein_id gnl|my_center|LOCUS_09050 1837 2895 gene locus_tag LOCUS_09060 1837 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416605.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence214 2567 117 gene locus_tag LOCUS_09070 2567 117 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730132.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence215 2230 1295 gene locus_tag LOCUS_09080 2230 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence216 152 1120 gene locus_tag LOCUS_09090 152 1120 CDS product heptaprenyl diphosphate synthase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460185.1 protein_id gnl|my_center|LOCUS_09090 1825 1130 gene locus_tag LOCUS_09100 1825 1130 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461805.1 protein_id gnl|my_center|LOCUS_09100 2427 2017 gene locus_tag LOCUS_09110 gene moaE 2427 2017 CDS product molybdopterin synthase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O31705 protein_id gnl|my_center|LOCUS_09110 2606 2427 gene locus_tag LOCUS_09120 2606 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence217 <1 1139 gene locus_tag LOCUS_09130 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJ31:glutamate-1-semialdehyde 2,1-aminomutase 2383 1136 gene locus_tag LOCUS_09140 2383 1136 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHD3 protein_id gnl|my_center|LOCUS_09140 >Feature sequence218 <1 2148 gene locus_tag LOCUS_09150 <1 2148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCR2:alanine--tRNA ligase 2161 2589 gene locus_tag LOCUS_09160 2161 2589 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCR4 protein_id gnl|my_center|LOCUS_09160 >Feature sequence219 <1 684 gene locus_tag LOCUS_09170 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969635.1:dehydrogenase 681 1163 gene locus_tag LOCUS_09180 681 1163 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975049.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence220 1200 328 gene locus_tag LOCUS_09190 1200 328 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030811.1 protein_id gnl|my_center|LOCUS_09190 1656 1417 gene locus_tag LOCUS_09200 1656 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2537 1782 gene locus_tag LOCUS_09210 2537 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence221 440 904 gene locus_tag LOCUS_09220 gene ribH 440 904 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YHQ1 protein_id gnl|my_center|LOCUS_09220 1078 1254 gene locus_tag LOCUS_09230 1078 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1414 1262 gene locus_tag LOCUS_09240 1414 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2372 1596 gene locus_tag LOCUS_09250 gene trpA 2372 1596 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74AI3 protein_id gnl|my_center|LOCUS_09250 <2893 2369 gene locus_tag LOCUS_09260 <2893 2369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867583.1:tryptophan synthase subunit beta >Feature sequence222 1487 366 gene locus_tag LOCUS_09270 1487 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence223 729 346 gene locus_tag LOCUS_09280 729 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2026 1517 gene locus_tag LOCUS_09290 2026 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402240.1 protein_id gnl|my_center|LOCUS_09290 <2888 2055 gene locus_tag LOCUS_09300 <2888 2055 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811019.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence224 1683 1874 gene locus_tag LOCUS_09310 1683 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09310 >Feature sequence225 1519 395 gene locus_tag LOCUS_09320 gene hadC 1519 395 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_09320 2157 1576 gene locus_tag LOCUS_09330 2157 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2314 2520 gene locus_tag LOCUS_09340 2314 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence226 1255 257 gene locus_tag LOCUS_09350 1255 257 CDS product 4-oxalomesaconate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254327.1 protein_id gnl|my_center|LOCUS_09350 <2848 1931 gene locus_tag LOCUS_09360 <2848 1931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460641.1:tetrachloroethene dehalogenase >Feature sequence227 1786 785 gene locus_tag LOCUS_09370 gene ilvC 1786 785 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9WZ20 protein_id gnl|my_center|LOCUS_09370 <2841 1845 gene locus_tag LOCUS_09380 <2841 1845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022152.1:flavodoxin family protein >Feature sequence228 387 157 gene locus_tag LOCUS_09390 387 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 863 519 gene locus_tag LOCUS_09400 863 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1438 875 gene locus_tag LOCUS_09410 1438 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_09410 1752 1495 gene locus_tag LOCUS_09420 1752 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2316 2747 gene locus_tag LOCUS_tm00020 2316 2747 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 2656 2747 gene locus_tag LOCUS_t00160 2656 2747 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence229 2045 984 gene locus_tag LOCUS_09430 2045 984 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJN3 protein_id gnl|my_center|LOCUS_09430 <2834 2033 gene locus_tag LOCUS_09440 <2834 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RJN4:1-deoxy-D-xylulose 5-phosphate reductoisomerase >Feature sequence230 263 856 gene locus_tag LOCUS_09450 263 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256340.1 protein_id gnl|my_center|LOCUS_09450 853 2481 gene locus_tag LOCUS_09460 853 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence231 525 2381 gene locus_tag LOCUS_09470 525 2381 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence232 948 1262 gene locus_tag LOCUS_09480 948 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2575 1259 gene locus_tag LOCUS_09490 2575 1259 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_09490 2819 2613 gene locus_tag LOCUS_09500 2819 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence233 1934 1260 gene locus_tag LOCUS_09510 1934 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 2819 2601 gene locus_tag LOCUS_09520 2819 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence234 799 1719 gene locus_tag LOCUS_09530 gene fmt 799 1719 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z1X0 protein_id gnl|my_center|LOCUS_09530 >Feature sequence235 241 663 gene locus_tag LOCUS_09540 241 663 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392805.1 protein_id gnl|my_center|LOCUS_09540 656 1951 gene locus_tag LOCUS_09550 656 1951 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878451.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence236 992 219 gene locus_tag LOCUS_09560 992 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1290 1048 gene locus_tag LOCUS_09570 1290 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423249.1 protein_id gnl|my_center|LOCUS_09570 1579 1301 gene locus_tag LOCUS_09580 1579 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1936 1586 gene locus_tag LOCUS_09590 1936 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2300 1950 gene locus_tag LOCUS_09600 2300 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2615 2364 gene locus_tag LOCUS_09610 2615 2364 CDS product SirA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_008920735.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence237 2595 1798 gene locus_tag LOCUS_09620 2595 1798 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807577.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence238 <1 1513 gene locus_tag LOCUS_09630 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RIS7:putative K(+)-stimulated pyrophosphate-energized sodium pump 2664 2041 gene locus_tag LOCUS_09640 gene ycbL 2664 2041 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941784.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence239 <1 840 gene locus_tag LOCUS_09650 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGY4:glutamyl-tRNA(Gln) amidotransferase subunit A 959 1213 gene locus_tag LOCUS_09660 959 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence240 <1 1273 gene locus_tag LOCUS_09670 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929645.1:CoA transferase 1315 1539 gene locus_tag LOCUS_09680 1315 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence241 <1 1981 gene locus_tag LOCUS_09690 <1 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391709.1:ATP-dependent Clp protease ATP-binding subunit ClpC 2088 2309 gene locus_tag LOCUS_09700 2088 2309 CDS product biotinylated protein TB7.3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XCD6 protein_id gnl|my_center|LOCUS_09700 >Feature sequence242 1062 466 gene locus_tag LOCUS_09710 1062 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 <2767 1059 gene locus_tag LOCUS_09720 <2767 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:dehydrogenase >Feature sequence243 82 297 gene locus_tag LOCUS_09730 82 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 906 1070 gene locus_tag LOCUS_09740 906 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09740 1144 1692 gene locus_tag LOCUS_09750 1144 1692 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391771.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence244 1010 489 gene locus_tag LOCUS_09760 1010 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257178.1 protein_id gnl|my_center|LOCUS_09760 1511 1020 gene locus_tag LOCUS_09770 gene def 1511 1020 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YIL7 protein_id gnl|my_center|LOCUS_09770 <2759 1582 gene locus_tag LOCUS_09780 <2759 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WCQ7:primosomal protein N' >Feature sequence245 2562 676 gene locus_tag LOCUS_09790 2562 676 CDS product NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence246 366 43 gene locus_tag LOCUS_09800 366 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 <2748 613 gene locus_tag LOCUS_09810 <2748 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880782.1:formate dehydrogenase >Feature sequence247 1368 172 gene locus_tag LOCUS_09820 1368 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423257.1 protein_id gnl|my_center|LOCUS_09820 1565 1945 gene locus_tag LOCUS_09830 gene acpS 1565 1945 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q180W4 protein_id gnl|my_center|LOCUS_09830 >Feature sequence248 996 1859 gene locus_tag LOCUS_09840 996 1859 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869438.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence249 400 1926 gene locus_tag LOCUS_09850 gene mttB 400 1926 CDS product trimethylamine methyltransferase MttB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q18TV3 protein_id gnl|my_center|LOCUS_09850 1942 2634 gene locus_tag LOCUS_09860 1942 2634 CDS product corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence250 2272 968 gene locus_tag LOCUS_09870 2272 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063709.1 protein_id gnl|my_center|LOCUS_09870 2729 2277 gene locus_tag LOCUS_09880 2729 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence251 270 1286 gene locus_tag LOCUS_09890 270 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence252 303 148 gene locus_tag LOCUS_09900 303 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 541 263 gene locus_tag LOCUS_09910 541 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09910 719 546 gene locus_tag LOCUS_09920 719 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 1709 732 gene locus_tag LOCUS_09930 1709 732 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ29 protein_id gnl|my_center|LOCUS_09930 <2716 1709 gene locus_tag LOCUS_09940 <2716 1709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392762.1:uroporphyrinogen III methyltransferase >Feature sequence253 929 1114 gene locus_tag LOCUS_09950 929 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1243 1851 gene locus_tag LOCUS_09960 1243 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 1892 2380 gene locus_tag LOCUS_09970 1892 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence254 1433 507 gene locus_tag LOCUS_09980 1433 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 2626 1454 gene locus_tag LOCUS_09990 2626 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence255 298 555 gene locus_tag LOCUS_10000 298 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1371 571 gene locus_tag LOCUS_10010 1371 571 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730152.1 protein_id gnl|my_center|LOCUS_10010 1474 2481 gene locus_tag LOCUS_10020 1474 2481 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229029.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence256 549 1514 gene locus_tag LOCUS_10030 gene acoA 549 1514 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I2A0 protein_id gnl|my_center|LOCUS_10030 1547 2503 gene locus_tag LOCUS_10040 gene acoB 1547 2503 CDS product TPP-dependent acetoin dehydrogenase complex, E1 protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453964.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence257 387 707 gene locus_tag LOCUS_10050 387 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1900 1142 gene locus_tag LOCUS_10060 1900 1142 CDS product 2-deoxy-D-gluconate 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970992.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence258 348 1172 gene locus_tag LOCUS_10070 348 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence259 10 543 gene locus_tag LOCUS_10080 10 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence260 1111 1284 gene locus_tag LOCUS_10090 1111 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence261 <2628 1630 gene locus_tag LOCUS_10100 <2628 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WGE3:succinyl-CoA--D-citramalate CoA-transferase >Feature sequence262 173 583 gene locus_tag LOCUS_10110 173 583 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIF6 protein_id gnl|my_center|LOCUS_10110 630 929 gene locus_tag LOCUS_10120 630 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 1070 2077 gene locus_tag LOCUS_10130 1070 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence263 415 1620 gene locus_tag LOCUS_10140 gene aroC 415 1620 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RI73 protein_id gnl|my_center|LOCUS_10140 >Feature sequence264 1066 50 gene locus_tag LOCUS_10150 1066 50 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943556.1 protein_id gnl|my_center|LOCUS_10150 2070 1063 gene locus_tag LOCUS_10160 2070 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270469.1 protein_id gnl|my_center|LOCUS_10160 <2619 2067 gene locus_tag LOCUS_10170 <2619 2067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RLT8:enolase >Feature sequence265 1489 371 gene locus_tag LOCUS_10180 1489 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877363.1 protein_id gnl|my_center|LOCUS_10180 <2617 1506 gene locus_tag LOCUS_10190 <2617 1506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGU9:bifunctional purine biosynthesis protein PurH >Feature sequence266 2193 1000 gene locus_tag LOCUS_10200 2193 1000 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462175.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence267 129 500 gene locus_tag LOCUS_10210 129 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 856 665 gene locus_tag LOCUS_10220 856 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1292 2077 gene locus_tag LOCUS_10230 1292 2077 CDS product histidine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103622.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence268 1712 1293 gene locus_tag LOCUS_10240 gene rplS 1712 1293 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O53083 protein_id gnl|my_center|LOCUS_10240 2454 1702 gene locus_tag LOCUS_10250 gene trmD 2454 1702 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CQL4 protein_id gnl|my_center|LOCUS_10250 >Feature sequence269 1342 473 gene locus_tag LOCUS_10260 1342 473 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_10260 1858 1460 gene locus_tag LOCUS_10270 1858 1460 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978533.1 protein_id gnl|my_center|LOCUS_10270 1983 1831 gene locus_tag LOCUS_10280 1983 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2585 2205 gene locus_tag LOCUS_10290 2585 2205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence270 985 188 gene locus_tag LOCUS_10300 985 188 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807958.1 protein_id gnl|my_center|LOCUS_10300 1998 1060 gene locus_tag LOCUS_10310 1998 1060 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q89GE9 protein_id gnl|my_center|LOCUS_10310 <2578 1998 gene locus_tag LOCUS_10320 <2578 1998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846972.1:crotonase >Feature sequence271 >Feature sequence272 1245 1388 gene locus_tag LOCUS_10330 1245 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence273 258 938 gene locus_tag LOCUS_10340 258 938 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_10340 1043 1591 gene locus_tag LOCUS_10350 1043 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1805 2470 gene locus_tag LOCUS_10360 1805 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence274 <1 716 gene locus_tag LOCUS_10370 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WHF8:Holliday junction ATP-dependent DNA helicase RuvB 1591 2016 gene locus_tag LOCUS_10380 1591 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2087 2407 gene locus_tag LOCUS_10390 2087 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence275 1058 2182 gene locus_tag LOCUS_10400 1058 2182 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879449.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence276 97 171 gene locus_tag LOCUS_t00170 97 171 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 919 392 gene locus_tag LOCUS_10410 gene caiE 919 392 CDS product carnitine operon protein CaiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8XA36 protein_id gnl|my_center|LOCUS_10410 1577 1038 gene locus_tag LOCUS_10420 1577 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence277 <1 532 gene locus_tag LOCUS_10430 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813213.1:ribonuclease HII 592 1431 gene locus_tag LOCUS_10440 592 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1486 1854 gene locus_tag LOCUS_10450 1486 1854 CDS product UPF0102 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74FF9 protein_id gnl|my_center|LOCUS_10450 1936 2301 gene locus_tag LOCUS_10460 1936 2301 CDS product FmdB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256377.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence278 2 89 gene locus_tag LOCUS_t00180 2 89 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 155 227 gene locus_tag LOCUS_t00190 155 227 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 256 1458 gene locus_tag LOCUS_10470 gene tuf 256 1458 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFP5 protein_id gnl|my_center|LOCUS_10470 1461 1628 gene locus_tag LOCUS_10480 gene rpmG 1461 1628 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E0K6 protein_id gnl|my_center|LOCUS_10480 1650 1859 gene locus_tag LOCUS_10490 1650 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1873 2421 gene locus_tag LOCUS_10500 gene nusG 1873 2421 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFP5 protein_id gnl|my_center|LOCUS_10500 >Feature sequence279 1240 122 gene locus_tag LOCUS_10510 gene hadC 1240 122 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_10510 <2522 1483 gene locus_tag LOCUS_10520 <2522 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867476.1:CoA-binding protein >Feature sequence280 115 453 gene locus_tag LOCUS_10530 gene rnpA 115 453 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q181T2 protein_id gnl|my_center|LOCUS_10530 450 659 gene locus_tag LOCUS_10540 450 659 CDS product putative membrane protein insertion efficiency factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDP2 protein_id gnl|my_center|LOCUS_10540 1172 1366 gene locus_tag LOCUS_10550 1172 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence281 1397 57 gene locus_tag LOCUS_10560 gene secD 1397 57 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E2N3 protein_id gnl|my_center|LOCUS_10560 <2518 1394 gene locus_tag LOCUS_10570 <2518 1394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142918.1:HDIG domain-containing protein >Feature sequence282 68 946 gene locus_tag LOCUS_10580 gene mtnP 68 946 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74E52 protein_id gnl|my_center|LOCUS_10580 943 1968 gene locus_tag LOCUS_10590 943 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393405.1 protein_id gnl|my_center|LOCUS_10590 >Feature sequence283 805 80 gene locus_tag LOCUS_10600 805 80 CDS product primosomal replication protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_10600 2187 802 gene locus_tag LOCUS_10610 2187 802 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WHR5 protein_id gnl|my_center|LOCUS_10610 >Feature sequence284 397 918 gene locus_tag LOCUS_10620 397 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 935 1516 gene locus_tag LOCUS_10630 935 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 <2506 1720 gene locus_tag LOCUS_10640 <2506 1720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967713.1:enolase >Feature sequence285 173 2296 gene locus_tag LOCUS_10650 173 2296 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878793.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence286 1363 440 gene locus_tag LOCUS_10660 gene hemC 1363 440 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJ26 protein_id gnl|my_center|LOCUS_10660 <2490 1368 gene locus_tag LOCUS_10670 <2490 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q747I2:glutamyl-tRNA reductase >Feature sequence287 1735 524 gene locus_tag LOCUS_10680 1735 524 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_10680 <2487 1801 gene locus_tag LOCUS_10690 <2487 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877874.1:MFS transporter >Feature sequence288 <1 1114 gene locus_tag LOCUS_10700 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064334.1:dihydroorotase-like protein 1141 1773 gene locus_tag LOCUS_10710 1141 1773 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937344.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence289 347 1030 gene locus_tag LOCUS_10720 347 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2061 1027 gene locus_tag LOCUS_10730 gene pta 2061 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124631.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence290 <1 1432 gene locus_tag LOCUS_10740 <1 1432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392656.1:elongation factor G 1866 1429 gene locus_tag LOCUS_10750 1866 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 <2480 1905 gene locus_tag LOCUS_10760 <2480 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545166.1:electron transfer flavoprotein subunit alpha >Feature sequence291 925 119 gene locus_tag LOCUS_10770 gene dapB 925 119 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJL2 protein_id gnl|my_center|LOCUS_10770 2463 934 gene locus_tag LOCUS_10780 2463 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence292 >Feature sequence293 995 207 gene locus_tag LOCUS_10790 995 207 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG4 protein_id gnl|my_center|LOCUS_10790 1744 998 gene locus_tag LOCUS_10800 1744 998 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WAG3 protein_id gnl|my_center|LOCUS_10800 <2449 1833 gene locus_tag LOCUS_10810 <2449 1833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816051.1:acyl-CoA dehydrogenase >Feature sequence294 2214 1903 gene locus_tag LOCUS_10820 2214 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence295 237 377 gene locus_tag LOCUS_10830 237 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 967 1959 gene locus_tag LOCUS_10840 967 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence296 1816 884 gene locus_tag LOCUS_10850 1816 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270469.1 protein_id gnl|my_center|LOCUS_10850 >Feature sequence297 630 1121 gene locus_tag LOCUS_10860 gene ogt 630 1121 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P7F8 protein_id gnl|my_center|LOCUS_10860 <2430 1124 gene locus_tag LOCUS_10870 <2430 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIE8:DNA-directed DNA polymerase >Feature sequence298 >Feature sequence299 2239 1559 gene locus_tag LOCUS_10880 2239 1559 CDS product 5-amino-6-(5-phosphoribosylamino)uracil reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024246.1 protein_id gnl|my_center|LOCUS_10880 2424 2350 gene locus_tag LOCUS_t00200 2424 2350 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence300 1168 2061 gene locus_tag LOCUS_10890 1168 2061 CDS product CAAX amino protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942218.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence301 523 119 gene locus_tag LOCUS_10900 523 119 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888655.1 protein_id gnl|my_center|LOCUS_10900 1447 602 gene locus_tag LOCUS_10910 1447 602 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393766.1 protein_id gnl|my_center|LOCUS_10910 2395 1457 gene locus_tag LOCUS_10920 gene mdh 2395 1457 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P80039 protein_id gnl|my_center|LOCUS_10920 >Feature sequence302 1502 792 gene locus_tag LOCUS_10930 gene bioD 1502 792 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT8 protein_id gnl|my_center|LOCUS_10930 <2419 1503 gene locus_tag LOCUS_10940 <2419 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74CT9:adenosylmethionine-8-amino-7-oxononanoate aminotransferase >Feature sequence303 777 502 gene locus_tag LOCUS_10950 777 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_10950 1057 770 gene locus_tag LOCUS_10960 1057 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957044.1 protein_id gnl|my_center|LOCUS_10960 2198 1215 gene locus_tag LOCUS_10970 2198 1215 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808786.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence304 927 331 gene locus_tag LOCUS_10980 927 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808897.1 protein_id gnl|my_center|LOCUS_10980 1153 1938 gene locus_tag LOCUS_10990 1153 1938 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_10990 >Feature sequence305 <1 1186 gene locus_tag LOCUS_11000 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WGE3:succinyl-CoA--D-citramalate CoA-transferase <2396 1203 gene locus_tag LOCUS_11010 <2396 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WIJ6:UvrABC system protein B >Feature sequence306 27 599 gene locus_tag LOCUS_11020 27 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence307 1910 717 gene locus_tag LOCUS_11030 1910 717 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence308 133 1809 gene locus_tag LOCUS_11040 133 1809 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867965.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence309 346 1674 gene locus_tag LOCUS_11050 346 1674 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_11050 2024 1761 gene locus_tag LOCUS_11060 2024 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_11060 2219 2295 gene locus_tag LOCUS_t00210 2219 2295 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence310 492 37 gene locus_tag LOCUS_11070 492 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 700 1440 gene locus_tag LOCUS_11080 700 1440 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942651.1 protein_id gnl|my_center|LOCUS_11080 1433 2137 gene locus_tag LOCUS_11090 1433 2137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256822.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence311 1722 409 gene locus_tag LOCUS_11100 1722 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence312 312 1454 gene locus_tag LOCUS_11110 gene ftsZ 312 1454 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97IE9 protein_id gnl|my_center|LOCUS_11110 1599 2120 gene locus_tag LOCUS_11120 gene nrdR 1599 2120 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q45549 protein_id gnl|my_center|LOCUS_11120 >Feature sequence313 531 1307 gene locus_tag LOCUS_11130 531 1307 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_11130 1708 1475 gene locus_tag LOCUS_11140 1708 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence314 277 1473 gene locus_tag LOCUS_11150 gene bioF 277 1473 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q749W3 protein_id gnl|my_center|LOCUS_11150 >Feature sequence315 396 710 gene locus_tag LOCUS_11160 396 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 915 2123 gene locus_tag LOCUS_11170 915 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2306 2231 gene locus_tag LOCUS_t00220 2306 2231 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence316 >Feature sequence317 <1 813 gene locus_tag LOCUS_11180 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878184.1:fumarate reductase flavoprotein subunit 786 1529 gene locus_tag LOCUS_11190 786 1529 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YK48 protein_id gnl|my_center|LOCUS_11190 1547 2101 gene locus_tag LOCUS_11200 gene fumX 1547 2101 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881093.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence318 1079 375 gene locus_tag LOCUS_11210 1079 375 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763220.1 protein_id gnl|my_center|LOCUS_11210 >Feature sequence319 1335 211 gene locus_tag LOCUS_11220 1335 211 CDS product glutaconyl-CoA decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356002.1 protein_id gnl|my_center|LOCUS_11220 1503 1366 gene locus_tag LOCUS_11230 1503 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence320 >Feature sequence321 862 659 gene locus_tag LOCUS_11240 862 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1153 1368 gene locus_tag LOCUS_11250 1153 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1409 1855 gene locus_tag LOCUS_11260 1409 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460866.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence322 236 445 gene locus_tag LOCUS_11270 236 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 403 609 gene locus_tag LOCUS_11280 403 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 723 1103 gene locus_tag LOCUS_11290 723 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1142 1903 gene locus_tag LOCUS_11300 1142 1903 CDS product cytochrome c biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010351.1 protein_id gnl|my_center|LOCUS_11300 1917 2168 gene locus_tag LOCUS_11310 1917 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence323 176 808 gene locus_tag LOCUS_11320 176 808 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_11320 1253 720 gene locus_tag LOCUS_11330 1253 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1389 1850 gene locus_tag LOCUS_11340 gene lspA 1389 1850 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK54 protein_id gnl|my_center|LOCUS_11340 >Feature sequence324 2219 393 gene locus_tag LOCUS_11350 gene hyuB 2219 393 CDS product N-methylhydantoinase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence325 3 533 gene locus_tag LOCUS_11360 3 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 538 846 gene locus_tag LOCUS_11370 538 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1047 1295 gene locus_tag LOCUS_11380 1047 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1506 1898 gene locus_tag LOCUS_11390 1506 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1949 2155 gene locus_tag LOCUS_11400 1949 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence326 666 454 gene locus_tag LOCUS_11410 666 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1063 581 gene locus_tag LOCUS_11420 1063 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1599 1261 gene locus_tag LOCUS_11430 1599 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 1869 2126 gene locus_tag LOCUS_11440 1869 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence327 1024 143 gene locus_tag LOCUS_11450 gene sgbU 1024 143 CDS product hexulose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332337.1 protein_id gnl|my_center|LOCUS_11450 1142 2032 gene locus_tag LOCUS_11460 1142 2032 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403135.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence328 <1 1102 gene locus_tag LOCUS_11470 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582594.1:type I glutamate--ammonia ligase >Feature sequence329 1112 615 gene locus_tag LOCUS_11480 1112 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 1959 1180 gene locus_tag LOCUS_11490 1959 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11490 >Feature sequence330 286 438 gene locus_tag LOCUS_11500 286 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 462 701 gene locus_tag LOCUS_11510 462 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 981 1235 gene locus_tag LOCUS_11520 981 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1805 1954 gene locus_tag LOCUS_11530 1805 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence331 <1 1360 gene locus_tag LOCUS_11540 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879706.1:methylmalonyl-CoA carboxyltransferase >Feature sequence332 79 1803 gene locus_tag LOCUS_11550 gene ilvB 79 1803 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023692.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence333 914 264 gene locus_tag LOCUS_11560 914 264 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810152.1 protein_id gnl|my_center|LOCUS_11560 1250 915 gene locus_tag LOCUS_11570 gene rplV 1250 915 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DS19 protein_id gnl|my_center|LOCUS_11570 1543 1250 gene locus_tag LOCUS_11580 gene rpsS 1543 1250 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFQ1 protein_id gnl|my_center|LOCUS_11580 <2228 1543 gene locus_tag LOCUS_11590 <2228 1543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q18CG3:50S ribosomal protein L2 >Feature sequence334 588 142 gene locus_tag LOCUS_11600 588 142 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460706.1 protein_id gnl|my_center|LOCUS_11600 1867 740 gene locus_tag LOCUS_11610 1867 740 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIW8 protein_id gnl|my_center|LOCUS_11610 >Feature sequence335 >Feature sequence336 321 106 gene locus_tag LOCUS_11620 321 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 956 561 gene locus_tag LOCUS_11630 gene rpsI 956 561 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A5I7H0 protein_id gnl|my_center|LOCUS_11630 1408 953 gene locus_tag LOCUS_11640 gene rplM 1408 953 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HVY2 protein_id gnl|my_center|LOCUS_11640 2177 1395 gene locus_tag LOCUS_11650 gene truA 2177 1395 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB9 protein_id gnl|my_center|LOCUS_11650 >Feature sequence337 1095 691 gene locus_tag LOCUS_11660 1095 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence338 176 787 gene locus_tag LOCUS_11670 gene hisH 176 787 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RGW0 protein_id gnl|my_center|LOCUS_11670 839 1483 gene locus_tag LOCUS_11680 gene lexA 839 1483 CDS product LexA repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WE65 protein_id gnl|my_center|LOCUS_11680 >Feature sequence339 479 1048 gene locus_tag LOCUS_11690 479 1048 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173882.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence340 <2198 279 gene locus_tag LOCUS_11700 <2198 279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9W9P7:DNA helicase >Feature sequence341 326 1036 gene locus_tag LOCUS_11710 326 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2067 1354 gene locus_tag LOCUS_11720 2067 1354 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941604.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence342 <1 977 gene locus_tag LOCUS_11730 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010977989.1:decarboxylase UbiD <2196 1095 gene locus_tag LOCUS_11740 <2196 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000437634.1:MFS transporter >Feature sequence343 <1 926 gene locus_tag LOCUS_11750 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256886.1:RND transporter 991 1206 gene locus_tag LOCUS_11760 991 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 <2196 1314 gene locus_tag LOCUS_11770 <2196 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083215.1:trehalose synthase >Feature sequence344 1014 151 gene locus_tag LOCUS_11780 1014 151 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815017.1 protein_id gnl|my_center|LOCUS_11780 <2187 1201 gene locus_tag LOCUS_11790 <2187 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113355.1:MFS transporter >Feature sequence345 1377 283 gene locus_tag LOCUS_11800 1377 283 CDS product 5-methyltetrahydropteroyltriglutamate-- homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761791.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence346 372 1115 gene locus_tag LOCUS_11810 372 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1120 2070 gene locus_tag LOCUS_11820 1120 2070 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence347 <2176 938 gene locus_tag LOCUS_11830 <2176 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461376.1:MFS transporter >Feature sequence348 180 2045 gene locus_tag LOCUS_11840 180 2045 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence349 1387 305 gene locus_tag LOCUS_11850 1387 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1663 1800 gene locus_tag LOCUS_11860 1663 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1828 2097 gene locus_tag LOCUS_11870 1828 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence350 776 1966 gene locus_tag LOCUS_11880 776 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence351 402 91 gene locus_tag LOCUS_11890 402 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 1850 417 gene locus_tag LOCUS_11900 gene hudA 1850 417 CDS product UbiD-like decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9I6N5 protein_id gnl|my_center|LOCUS_11900 >Feature sequence352 1486 170 gene locus_tag LOCUS_11910 1486 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 <2148 1520 gene locus_tag LOCUS_11920 <2148 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048213.1:3-hydroxyacyl-ACP dehydratase >Feature sequence353 1 159 gene locus_tag LOCUS_11930 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 499 654 gene locus_tag LOCUS_11940 499 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence354 1108 260 gene locus_tag LOCUS_11950 gene dapF 1108 260 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RK34 protein_id gnl|my_center|LOCUS_11950 2022 1105 gene locus_tag LOCUS_11960 gene miaA 2022 1105 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDJ6 protein_id gnl|my_center|LOCUS_11960 >Feature sequence355 <2143 1163 gene locus_tag LOCUS_11970 <2143 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RG65:acetylornithine aminotransferase >Feature sequence356 1490 1074 gene locus_tag LOCUS_11980 1490 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11980 1919 1542 gene locus_tag LOCUS_11990 1919 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11990 >Feature sequence357 794 111 gene locus_tag LOCUS_12000 794 111 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809371.1 protein_id gnl|my_center|LOCUS_12000 1766 903 gene locus_tag LOCUS_12010 1766 903 CDS product polysaccharide deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence358 981 439 gene locus_tag LOCUS_12020 981 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1702 1181 gene locus_tag LOCUS_12030 1702 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031555.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence359 <1 641 gene locus_tag LOCUS_12040 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFN6:50S ribosomal protein L1 676 2121 gene locus_tag LOCUS_12050 676 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence360 922 1185 gene locus_tag LOCUS_12060 922 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence361 539 171 gene locus_tag LOCUS_12070 539 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 1157 654 gene locus_tag LOCUS_12080 1157 654 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941862.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence362 1498 746 gene locus_tag LOCUS_12090 1498 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 <2122 1515 gene locus_tag LOCUS_12100 <2122 1515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to P62364:ATP phosphoribosyltransferase >Feature sequence363 259 1440 gene locus_tag LOCUS_12110 gene hadC 259 1440 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986695.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence364 1682 471 gene locus_tag LOCUS_12120 gene fldA 1682 471 CDS product E-cinnamoyl-CoA--R-phenyllactate CoA transferase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048238.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence365 <2113 1529 gene locus_tag LOCUS_12130 <2113 1529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RFT7:thioredoxin reductase >Feature sequence366 845 57 gene locus_tag LOCUS_12140 845 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1833 865 gene locus_tag LOCUS_12150 1833 865 CDS product heat-shock protein HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence367 <2107 383 gene locus_tag LOCUS_12160 <2107 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392899.1:dimethyl sulfoxide reductase subunit A >Feature sequence368 1409 903 gene locus_tag LOCUS_12170 1409 903 CDS product cob(I)alamin adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868882.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence369 <2103 254 gene locus_tag LOCUS_12180 <2103 254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RGU5:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence370 >Feature sequence371 <1 1273 gene locus_tag LOCUS_12190 <1 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272451.1:dihydroxyacetone kinase >Feature sequence372 468 905 gene locus_tag LOCUS_12200 468 905 CDS product isochorismatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391792.1 protein_id gnl|my_center|LOCUS_12200 892 1182 gene locus_tag LOCUS_12210 892 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12210 1244 1546 gene locus_tag LOCUS_12220 1244 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12220 1497 1706 gene locus_tag LOCUS_12230 1497 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12230 >Feature sequence373 482 1981 gene locus_tag LOCUS_12240 gene trpE 482 1981 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence374 <1 798 gene locus_tag LOCUS_12250 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392501.1:NADH dehydrogenase subunit M 806 1258 gene locus_tag LOCUS_12260 806 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence375 44 835 gene locus_tag LOCUS_12270 44 835 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_12270 885 1160 gene locus_tag LOCUS_12280 885 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 <2076 1166 gene locus_tag LOCUS_12290 <2076 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003818460.1:phenylacetate--CoA ligase >Feature sequence376 >Feature sequence377 2073 1741 gene locus_tag LOCUS_12300 2073 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence378 1062 316 gene locus_tag LOCUS_12310 1062 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1805 1059 gene locus_tag LOCUS_12320 1805 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence379 1210 308 gene locus_tag LOCUS_12330 gene dapA 1210 308 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJK7 protein_id gnl|my_center|LOCUS_12330 <2062 1228 gene locus_tag LOCUS_12340 <2062 1228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to B5YHE3:aspartate-semialdehyde dehydrogenase >Feature sequence380 <1 705 gene locus_tag LOCUS_12350 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972726.1:aryldialkylphosphatase 885 1193 gene locus_tag LOCUS_12360 885 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence381 >Feature sequence382 <1 1247 gene locus_tag LOCUS_12370 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462314.1:adenylosuccinate synthetase >Feature sequence383 1306 101 gene locus_tag LOCUS_12380 1306 101 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_12380 1427 1867 gene locus_tag LOCUS_12390 1427 1867 CDS product protein archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E097 protein_id gnl|my_center|LOCUS_12390 >Feature sequence384 743 258 gene locus_tag LOCUS_12400 743 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence385 2 1078 gene locus_tag LOCUS_12410 2 1078 CDS product alpha-methylacyl-CoA racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920184.1 protein_id gnl|my_center|LOCUS_12410 1529 2026 gene locus_tag LOCUS_12420 1529 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence386 328 1473 gene locus_tag LOCUS_12430 gene hadC 328 1473 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence387 1520 117 gene locus_tag LOCUS_12440 1520 117 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258069.1 protein_id gnl|my_center|LOCUS_12440 <2040 1521 gene locus_tag LOCUS_12450 <2040 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460500.1:beta-ketoacyl-ACP reductase >Feature sequence388 1372 338 gene locus_tag LOCUS_12460 1372 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_12460 <2033 1397 gene locus_tag LOCUS_12470 <2033 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817435.1:bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase >Feature sequence389 493 71 gene locus_tag LOCUS_12480 gene rpsL 493 71 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WH60 protein_id gnl|my_center|LOCUS_12480 >Feature sequence390 1967 870 gene locus_tag LOCUS_12490 1967 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940824.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence391 131 1258 gene locus_tag LOCUS_12500 gene hadC 131 1258 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence392 882 364 gene locus_tag LOCUS_12510 882 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1262 1528 gene locus_tag LOCUS_12520 1262 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 <2012 1497 gene locus_tag LOCUS_12530 <2012 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WFZ9:DNA mismatch repair protein MutS >Feature sequence393 464 1408 gene locus_tag LOCUS_12540 464 1408 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385788.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence394 1493 1384 gene locus_tag LOCUS_r00010 1493 1384 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence395 1234 65 gene locus_tag LOCUS_12550 1234 65 CDS product acyl dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228924.1 protein_id gnl|my_center|LOCUS_12550 1347 1589 gene locus_tag LOCUS_12560 1347 1589 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence396 1551 1339 gene locus_tag LOCUS_12570 1551 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence397 <2007 471 gene locus_tag LOCUS_12580 <2007 471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146979.1:citramalate synthase >Feature sequence398 >Feature sequence399 1148 1223 gene locus_tag LOCUS_t00230 1148 1223 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1332 1595 gene locus_tag LOCUS_12590 1332 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1667 1742 gene locus_tag LOCUS_t00240 1667 1742 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence400 983 907 gene locus_tag LOCUS_t00250 983 907 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1991 1035 gene locus_tag LOCUS_12600 1991 1035 CDS product N-acylmannosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence401 <1 849 gene locus_tag LOCUS_12610 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q8CSU3:DNA topoisomerase 1 855 1784 gene locus_tag LOCUS_12620 gene xerD 855 1784 CDS product tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAJ2 protein_id gnl|my_center|LOCUS_12620 >Feature sequence402 269 1759 gene locus_tag LOCUS_12630 269 1759 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256426.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence403 290 42 gene locus_tag LOCUS_12640 290 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 1888 434 gene locus_tag LOCUS_12650 1888 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence404 1315 659 gene locus_tag LOCUS_12660 gene adk 1315 659 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Y449 protein_id gnl|my_center|LOCUS_12660 <1975 1325 gene locus_tag LOCUS_12670 <1975 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WH86:protein translocase subunit SecY >Feature sequence405 1204 188 gene locus_tag LOCUS_12680 gene pdxA 1204 188 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RKJ4 protein_id gnl|my_center|LOCUS_12680 <1973 1436 gene locus_tag LOCUS_12690 <1973 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545329.1:ribonucleotide-diphosphate reductase subunit alpha >Feature sequence406 1245 1712 gene locus_tag LOCUS_12700 1245 1712 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WJJ1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence407 <1 1651 gene locus_tag LOCUS_12710 <1 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RHN8:phenylalanine--tRNA ligase beta subunit >Feature sequence408 <1 588 gene locus_tag LOCUS_12720 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:carbon-monoxide dehydrogenase catalytic subunit 1496 693 gene locus_tag LOCUS_12730 1496 693 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence409 1195 401 gene locus_tag LOCUS_12740 1195 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 <1953 1161 gene locus_tag LOCUS_12750 <1953 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029969.1:nitrate reductase subunit beta >Feature sequence410 444 1841 gene locus_tag LOCUS_12760 444 1841 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence411 286 1068 gene locus_tag LOCUS_12770 286 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1068 1787 gene locus_tag LOCUS_12780 1068 1787 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence412 <1936 988 gene locus_tag LOCUS_12790 <1936 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003896797.1:dehydrogenase >Feature sequence413 376 1533 gene locus_tag LOCUS_12800 376 1533 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729030.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence414 <1 914 gene locus_tag LOCUS_12810 <1 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000955347.1:2,3-dihydroxybenzoate-AMP ligase 975 1049 gene locus_tag LOCUS_t00260 975 1049 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1686 1537 gene locus_tag LOCUS_12820 1686 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence415 <1930 1248 gene locus_tag LOCUS_12830 <1930 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:nicotinate dehydrogenase medium molybdopterin subunit >Feature sequence416 1045 233 gene locus_tag LOCUS_12840 1045 233 CDS product 2-oxoglutarate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_12840 1886 1059 gene locus_tag LOCUS_12850 1886 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence417 <1 784 gene locus_tag LOCUS_12860 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811376.1:cell division protein FtsZ 992 1519 gene locus_tag LOCUS_12870 gene nrdR 992 1519 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WKI1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence418 <1922 1142 gene locus_tag LOCUS_12880 <1922 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020389.1:4Fe-4S ferredoxin >Feature sequence419 352 1389 gene locus_tag LOCUS_12890 352 1389 CDS product 2-ketogluconate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089800.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence420 38 862 gene locus_tag LOCUS_12900 38 862 CDS product molybdenum hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393498.1 protein_id gnl|my_center|LOCUS_12900 859 1131 gene locus_tag LOCUS_12910 859 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence421 >Feature sequence422 107 967 gene locus_tag LOCUS_12920 gene atpG 107 967 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WGS5 protein_id gnl|my_center|LOCUS_12920 >Feature sequence423 94 705 gene locus_tag LOCUS_12930 gene recR 94 705 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RMH0 protein_id gnl|my_center|LOCUS_12930 705 1868 gene locus_tag LOCUS_12940 705 1868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence424 117 608 gene locus_tag LOCUS_12950 117 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12950 991 629 gene locus_tag LOCUS_12960 991 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence425 >Feature sequence426 1091 903 gene locus_tag LOCUS_12970 1091 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1869 1126 gene locus_tag LOCUS_12980 gene fabG-2 1869 1126 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942248.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence427 1414 179 gene locus_tag LOCUS_12990 1414 179 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004545374.1 protein_id gnl|my_center|LOCUS_12990 1533 1608 gene locus_tag LOCUS_t00270 1533 1608 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence428 832 1110 gene locus_tag LOCUS_13000 832 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence429 >Feature sequence430 >Feature sequence431 1307 582 gene locus_tag LOCUS_13010 1307 582 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_13010 <1890 1195 gene locus_tag LOCUS_13020 <1890 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to F9Y594:membrane protein insertase YidC >Feature sequence432 1418 468 gene locus_tag LOCUS_13030 1418 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence433 16 103 gene locus_tag LOCUS_t00280 16 103 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 212 297 gene locus_tag LOCUS_t00290 212 297 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 368 574 gene locus_tag LOCUS_13040 368 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence434 1 588 gene locus_tag LOCUS_13050 1 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 610 1851 gene locus_tag LOCUS_13060 gene sbcD 610 1851 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBP0 protein_id gnl|my_center|LOCUS_13060 >Feature sequence435 501 1088 gene locus_tag LOCUS_13070 gene hisB 501 1088 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WDZ1 protein_id gnl|my_center|LOCUS_13070 1339 1085 gene locus_tag LOCUS_13080 gene purS 1339 1085 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q81IQ5 protein_id gnl|my_center|LOCUS_13080 <1876 1341 gene locus_tag LOCUS_13090 <1876 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q72DY4:phosphoribosylaminoimidazole-succinocarboxamide synthase >Feature sequence436 340 218 gene locus_tag LOCUS_13100 340 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 969 385 gene locus_tag LOCUS_13110 969 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 1811 1341 gene locus_tag LOCUS_13120 1811 1341 CDS product tRNA-specific adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815124.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence437 <1 799 gene locus_tag LOCUS_13130 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WBL2:amidophosphoribosyltransferase 796 1824 gene locus_tag LOCUS_13140 gene purM 796 1824 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK39 protein_id gnl|my_center|LOCUS_13140 >Feature sequence438 >Feature sequence439 599 1747 gene locus_tag LOCUS_13150 599 1747 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089997.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence440 264 545 gene locus_tag LOCUS_13160 264 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1207 572 gene locus_tag LOCUS_13170 1207 572 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117903.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence441 724 224 gene locus_tag LOCUS_13180 724 224 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_13180 <1858 961 gene locus_tag LOCUS_13190 <1858 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RG98:3-isopropylmalate dehydratase large subunit >Feature sequence442 200 832 gene locus_tag LOCUS_13200 gene ubiX 200 832 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JL90 protein_id gnl|my_center|LOCUS_13200 1139 1540 gene locus_tag LOCUS_13210 1139 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020757.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence443 1179 532 gene locus_tag LOCUS_13220 1179 532 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392252.1 protein_id gnl|my_center|LOCUS_13220 <1850 1176 gene locus_tag LOCUS_13230 <1850 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q74GB4:putative cytosol aminopeptidase >Feature sequence444 <1849 49 gene locus_tag LOCUS_13240 <1849 49 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257113.1:DNA translocase FtsK >Feature sequence445 <1 839 gene locus_tag LOCUS_13250 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919308.1:acetyl-CoA acetyltransferase <1845 855 gene locus_tag LOCUS_13260 <1845 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013229596.1:CoA transferase >Feature sequence446 1302 490 gene locus_tag LOCUS_13270 1302 490 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920431.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence447 1314 1475 gene locus_tag LOCUS_13280 1314 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence448 58 1101 gene locus_tag LOCUS_13290 gene pheS 58 1101 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHN7 protein_id gnl|my_center|LOCUS_13290 >Feature sequence449 317 1117 gene locus_tag LOCUS_13300 317 1117 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090312.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence450 1469 294 gene locus_tag LOCUS_13310 gene hadC 1469 294 CDS product r-phenyllactate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence451 373 702 gene locus_tag LOCUS_13320 373 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 1166 1597 gene locus_tag LOCUS_13330 1166 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence452 865 1266 gene locus_tag LOCUS_13340 865 1266 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173118.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence453 1638 634 gene locus_tag LOCUS_13350 gene prmC 1638 634 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBM9 protein_id gnl|my_center|LOCUS_13350 >Feature sequence454 521 54 gene locus_tag LOCUS_13360 521 54 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846651.1 protein_id gnl|my_center|LOCUS_13360 <1808 518 gene locus_tag LOCUS_13370 <1808 518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:dehydrogenase >Feature sequence455 858 667 gene locus_tag LOCUS_13380 858 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1364 882 gene locus_tag LOCUS_13390 1364 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence456 727 128 gene locus_tag LOCUS_13400 gene pth 727 128 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBS1 protein_id gnl|my_center|LOCUS_13400 991 731 gene locus_tag LOCUS_13410 991 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1628 1023 gene locus_tag LOCUS_13420 1628 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13420 >Feature sequence457 <1 816 gene locus_tag LOCUS_13430 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020714.1:4Fe-4S ferredoxin 1641 901 gene locus_tag LOCUS_13440 1641 901 CDS product maleate cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence458 708 313 gene locus_tag LOCUS_13450 708 313 CDS product UPF0178 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RYA4 protein_id gnl|my_center|LOCUS_13450 1278 1024 gene locus_tag LOCUS_13460 1278 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence459 <1 1133 gene locus_tag LOCUS_13470 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000553693.1:cyclohexanecarboxylate-CoA ligase >Feature sequence460 453 1658 gene locus_tag LOCUS_13480 453 1658 CDS product peptidase ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence461 <1 711 gene locus_tag LOCUS_13490 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533209.1:glycosyl transferase 1671 694 gene locus_tag LOCUS_13500 1671 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence462 480 1277 gene locus_tag LOCUS_13510 480 1277 CDS product crotonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence463 959 195 gene locus_tag LOCUS_13520 gene fabG 959 195 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_13520 1498 1175 gene locus_tag LOCUS_13530 1498 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888345.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence464 891 547 gene locus_tag LOCUS_13540 891 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1755 1255 gene locus_tag LOCUS_13550 1755 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence465 >Feature sequence466 >Feature sequence467 1567 731 gene locus_tag LOCUS_13560 gene panC 1567 731 CDS product pantothenate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WFR6 protein_id gnl|my_center|LOCUS_13560 >Feature sequence468 499 645 gene locus_tag LOCUS_13570 499 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence469 561 64 gene locus_tag LOCUS_13580 561 64 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_13580 1384 554 gene locus_tag LOCUS_13590 gene nadK 1384 554 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WIJ8 protein_id gnl|my_center|LOCUS_13590 1768 1445 gene locus_tag LOCUS_13600 1768 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence470 <1 711 gene locus_tag LOCUS_13610 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WEX3:heat-inducible transcription repressor HrcA 734 1285 gene locus_tag LOCUS_13620 gene grpE 734 1285 CDS product protein GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WEX2 protein_id gnl|my_center|LOCUS_13620 >Feature sequence471 >Feature sequence472 795 478 gene locus_tag LOCUS_13630 795 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1688 804 gene locus_tag LOCUS_13640 1688 804 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence473 <1756 552 gene locus_tag LOCUS_13650 <1756 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877874.1:MFS transporter >Feature sequence474 <1 672 gene locus_tag LOCUS_13660 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525324.1:dehydrogenase >Feature sequence475 416 811 gene locus_tag LOCUS_13670 416 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13670 808 1176 gene locus_tag LOCUS_13680 808 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13680 1608 1489 gene locus_tag LOCUS_13690 1608 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 >Feature sequence476 1386 559 gene locus_tag LOCUS_13700 1386 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence477 <1 796 gene locus_tag LOCUS_13710 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867427.1:NDP-sugar dehydratase or epimerase 801 1217 gene locus_tag LOCUS_13720 801 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 1512 1363 gene locus_tag LOCUS_13730 1512 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1499 1710 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcacccccacgtgcgtggggacaac >Feature sequence478 <1 1400 gene locus_tag LOCUS_13740 <1 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000850979.1:aspartate aminotransferase family protein >Feature sequence479 2 382 gene locus_tag LOCUS_13750 2 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 >Feature sequence480 509 255 gene locus_tag LOCUS_13760 509 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1603 560 gene locus_tag LOCUS_13770 1603 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence481 <1 1282 gene locus_tag LOCUS_13780 <1 1282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877547.1:ACP synthase >Feature sequence482 1504 629 gene locus_tag LOCUS_13790 1504 629 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence483 194 343 gene locus_tag LOCUS_13800 194 343 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583928.1 protein_id gnl|my_center|LOCUS_13800 482 1624 gene locus_tag LOCUS_13810 gene guaB 482 1624 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125290.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence484 486 947 gene locus_tag LOCUS_13820 486 947 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938241.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence485 140 1015 gene locus_tag LOCUS_13830 140 1015 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_13830 1012 1482 gene locus_tag LOCUS_13840 1012 1482 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393459.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence486 <1 596 gene locus_tag LOCUS_13850 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227690.1:ABC transporter ATP-binding protein 1149 733 gene locus_tag LOCUS_13860 1149 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022301.1 protein_id gnl|my_center|LOCUS_13860 <1709 1201 gene locus_tag LOCUS_13870 <1709 1201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q6HES9:dihydroorotate dehydrogenase B (NAD(+)), electron transfer subunit >Feature sequence487 1648 1109 gene locus_tag LOCUS_13880 gene atpH 1648 1109 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H2D8 protein_id gnl|my_center|LOCUS_13880 >Feature sequence488 <1 811 gene locus_tag LOCUS_13890 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868279.1:aminotransferase DegT >Feature sequence489 189 1397 gene locus_tag LOCUS_13900 189 1397 CDS product formyl-CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence490 >Feature sequence491 <1 1053 gene locus_tag LOCUS_13910 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022820.1:disulfide reductase >Feature sequence492 1126 791 gene locus_tag LOCUS_13920 1126 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 <1685 1156 gene locus_tag LOCUS_13930 <1685 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836565.1:ethanolamine ammonia-lyase >Feature sequence493 1309 770 gene locus_tag LOCUS_13940 1309 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 >Feature sequence494 >Feature sequence495 630 55 gene locus_tag LOCUS_13950 630 55 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_13950 1125 1367 gene locus_tag LOCUS_13960 1125 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence496 <1 824 gene locus_tag LOCUS_13970 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965644.1:glycosyl transferase >Feature sequence497 <1 644 gene locus_tag LOCUS_13980 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RK33:LL-diaminopimelate aminotransferase >Feature sequence498 520 185 gene locus_tag LOCUS_13990 520 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 748 557 gene locus_tag LOCUS_14000 748 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence499 1342 671 gene locus_tag LOCUS_14010 1342 671 CDS product electron transporter SenC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256707.1 protein_id gnl|my_center|LOCUS_14010 >Feature sequence500 >Feature sequence501 <1664 711 gene locus_tag LOCUS_14020 <1664 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence502 <1664 284 gene locus_tag LOCUS_14030 <1664 284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964288.1:2-isopropylmalate synthase >Feature sequence503 >Feature sequence504 448 23 gene locus_tag LOCUS_14040 448 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 339 854 gene locus_tag LOCUS_14050 339 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 914 1162 gene locus_tag LOCUS_14060 914 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14060 >Feature sequence505 >Feature sequence506 541 1110 gene locus_tag LOCUS_14070 gene frr 541 1110 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RJP0 protein_id gnl|my_center|LOCUS_14070 >Feature sequence507 24 755 gene locus_tag LOCUS_14080 24 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1105 821 gene locus_tag LOCUS_14090 1105 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence508 >Feature sequence509 1025 405 gene locus_tag LOCUS_14100 1025 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14100 >Feature sequence510 <1 814 gene locus_tag LOCUS_14110 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265979.1:CoA transferase 879 1109 gene locus_tag LOCUS_14120 879 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence511 1080 487 gene locus_tag LOCUS_14130 1080 487 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WK59 protein_id gnl|my_center|LOCUS_14130 >Feature sequence512 252 995 gene locus_tag LOCUS_14140 252 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence513 562 1101 gene locus_tag LOCUS_14150 gene rplJ 562 1101 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RFN7 protein_id gnl|my_center|LOCUS_14150 1094 1504 gene locus_tag LOCUS_14160 gene rplL 1094 1504 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:D1B6T8 protein_id gnl|my_center|LOCUS_14160 >Feature sequence514 <1 677 gene locus_tag LOCUS_14170 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879450.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence515 410 1348 gene locus_tag LOCUS_14180 gene argF 410 1348 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGR7 protein_id gnl|my_center|LOCUS_14180 >Feature sequence516 >Feature sequence517 <1 691 gene locus_tag LOCUS_14190 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q7NLT3:3-phosphoshikimate 1-carboxyvinyltransferase 713 1000 gene locus_tag LOCUS_14200 713 1000 CDS product UPF0296 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97ID1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence518 1145 432 gene locus_tag LOCUS_14210 1145 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence519 194 1462 gene locus_tag LOCUS_14220 194 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence520 <1601 612 gene locus_tag LOCUS_14230 <1601 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085873.1:MFS transporter >Feature sequence521 167 1126 gene locus_tag LOCUS_14240 167 1126 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHT1 protein_id gnl|my_center|LOCUS_14240 1170 1445 gene locus_tag LOCUS_14250 gene cysO 1170 1445 CDS product sulfur carrier protein CysO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P9WP33 protein_id gnl|my_center|LOCUS_14250 >Feature sequence522 <1 1542 gene locus_tag LOCUS_14260 <1 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to A9WH11:DNA-directed RNA polymerase subunit beta' >Feature sequence523 >Feature sequence524 3 152 gene locus_tag LOCUS_14270 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 952 185 gene locus_tag LOCUS_14280 952 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878454.1 protein_id gnl|my_center|LOCUS_14280 <1594 939 gene locus_tag LOCUS_14290 <1594 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878453.1:glutamate synthase >Feature sequence525 >Feature sequence526 >Feature sequence527 <1582 414 gene locus_tag LOCUS_14300 <1582 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020733.1:disulfide reductase >Feature sequence528 253 1350 gene locus_tag LOCUS_14310 gene mnmA 253 1350 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RHY7 protein_id gnl|my_center|LOCUS_14310 >Feature sequence529 1 1188 gene locus_tag LOCUS_14320 1 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence530 73 912 gene locus_tag LOCUS_14330 73 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 919 1560 gene locus_tag LOCUS_14340 919 1560 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943961.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence531 301 657 gene locus_tag LOCUS_14350 301 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence532 >Feature sequence533 170 1015 gene locus_tag LOCUS_14360 170 1015 CDS product N-acyl homoserine lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216585.1 protein_id gnl|my_center|LOCUS_14360 <1564 1053 gene locus_tag LOCUS_14370 <1564 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086745.1:carbon monoxide dehydrogenase >Feature sequence534 351 1142 gene locus_tag LOCUS_14380 351 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence535 <1 682 gene locus_tag LOCUS_14390 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460176.1:transcriptional regulator 675 1319 gene locus_tag LOCUS_14400 675 1319 CDS product precorrin-2 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392765.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence536 >Feature sequence537 <1 1247 gene locus_tag LOCUS_14410 <1 1247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879770.1:aldehyde ferredoxin oxidoreductase >Feature sequence538 1 297 gene locus_tag LOCUS_14420 1 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 <1545 346 gene locus_tag LOCUS_14430 <1545 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064681.1:hydantoin utilization protein B >Feature sequence539 >Feature sequence540 <1 906 gene locus_tag LOCUS_14440 <1 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to Q2RG75:indolepyruvate oxidoreductase subunit IorA 903 1505 gene locus_tag LOCUS_14450 903 1505 CDS product indolepyruvate oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869131.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence541 <1 1167 gene locus_tag LOCUS_14460 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817240.1:adenylosuccinate lyase >Feature sequence542 >Feature sequence543 >Feature sequence544 <1 663 gene locus_tag LOCUS_14470 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392663.1:2-hydroxyglutaryl-CoA dehydratase >Feature sequence545 53 652 gene locus_tag LOCUS_14480 53 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence546 <1 1143 gene locus_tag LOCUS_14490 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867476.1:CoA-binding protein >Feature sequence547 <1512 604 gene locus_tag LOCUS_14500 <1512 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943373.1:MFS transporter