>Feature sequence01 249 97 gene locus_tag LOCUS_00010 249 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1649 597 gene locus_tag LOCUS_00020 1649 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939277.1 protein_id gnl|my_center|LOCUS_00020 1908 3272 gene locus_tag LOCUS_00030 1908 3272 CDS product bifunctional folylpolyglutamate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392070.1 protein_id gnl|my_center|LOCUS_00030 3355 4791 gene locus_tag LOCUS_00040 3355 4791 CDS product dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015074.1 protein_id gnl|my_center|LOCUS_00040 5303 4848 gene locus_tag LOCUS_00050 5303 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6141 7361 gene locus_tag LOCUS_00060 6141 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7414 10413 gene locus_tag LOCUS_00070 7414 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 8133 8425 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cgtggcggtcggcgtggcgggagtcgtgg 11786 10443 gene locus_tag LOCUS_00080 11786 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 13606 12176 gene locus_tag LOCUS_00090 13606 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 15572 13911 gene locus_tag LOCUS_00100 15572 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_00100 15998 15699 gene locus_tag LOCUS_00110 15998 15699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 18053 16386 gene locus_tag LOCUS_00120 18053 16386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203819.1 protein_id gnl|my_center|LOCUS_00120 19920 18223 gene locus_tag LOCUS_00130 19920 18223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 20015 20422 gene locus_tag LOCUS_00140 20015 20422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 21938 20448 gene locus_tag LOCUS_00150 21938 20448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_00150 22313 23143 gene locus_tag LOCUS_00160 22313 23143 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143025.1 protein_id gnl|my_center|LOCUS_00160 25421 23232 gene locus_tag LOCUS_00170 25421 23232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 25695 25622 gene locus_tag LOCUS_t00010 25695 25622 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 26011 26517 gene locus_tag LOCUS_00180 26011 26517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 26531 27280 gene locus_tag LOCUS_00190 26531 27280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 27719 27862 gene locus_tag LOCUS_00200 27719 27862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 28706 27882 gene locus_tag LOCUS_00210 28706 27882 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_00210 29087 29704 gene locus_tag LOCUS_00220 29087 29704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_00220 29721 30800 gene locus_tag LOCUS_00230 gene menC 29721 30800 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP8 protein_id gnl|my_center|LOCUS_00230 30833 32269 gene locus_tag LOCUS_00240 gene menE 30833 32269 CDS product O-succinylbenzoic acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057063.1 protein_id gnl|my_center|LOCUS_00240 32577 32266 gene locus_tag LOCUS_00250 32577 32266 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_00250 33771 32986 gene locus_tag LOCUS_00260 gene cobK 33771 32986 CDS product cobalt-precorrin-6X reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141635.1 protein_id gnl|my_center|LOCUS_00260 34621 33779 gene locus_tag LOCUS_00270 gene cobM 34621 33779 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141377.1 protein_id gnl|my_center|LOCUS_00270 36245 34821 gene locus_tag LOCUS_00280 36245 34821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 37474 36539 gene locus_tag LOCUS_00290 gene argF 37474 36539 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJW4 protein_id gnl|my_center|LOCUS_00290 37905 37654 gene locus_tag LOCUS_00300 37905 37654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 protein_id gnl|my_center|LOCUS_00300 38540 38361 gene locus_tag LOCUS_00310 38540 38361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 38565 39260 gene locus_tag LOCUS_00320 38565 39260 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_00320 39387 40094 gene locus_tag LOCUS_00330 gene surE 39387 40094 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_00330 40254 42602 gene locus_tag LOCUS_00340 40254 42602 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_00340 42666 43148 gene locus_tag LOCUS_00350 42666 43148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 43437 44669 gene locus_tag LOCUS_00360 43437 44669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057888.1 protein_id gnl|my_center|LOCUS_00360 45494 44739 gene locus_tag LOCUS_00370 45494 44739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47355 45598 gene locus_tag LOCUS_00380 47355 45598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 47586 48149 gene locus_tag LOCUS_00390 47586 48149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 48470 48781 gene locus_tag LOCUS_00400 48470 48781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 49601 48789 gene locus_tag LOCUS_00410 49601 48789 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057314.1 protein_id gnl|my_center|LOCUS_00410 49777 51972 gene locus_tag LOCUS_00420 49777 51972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_00420 52389 52063 gene locus_tag LOCUS_00430 52389 52063 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888273.1 protein_id gnl|my_center|LOCUS_00430 52724 52407 gene locus_tag LOCUS_00440 52724 52407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143785.1 protein_id gnl|my_center|LOCUS_00440 55930 52745 gene locus_tag LOCUS_00450 55930 52745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 56874 56068 gene locus_tag LOCUS_00460 56874 56068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 58671 57358 gene locus_tag LOCUS_00470 58671 57358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 58628 58768 gene locus_tag LOCUS_00480 58628 58768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 59081 59569 gene locus_tag LOCUS_00490 59081 59569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_00490 59692 60162 gene locus_tag LOCUS_00500 59692 60162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 60297 61127 gene locus_tag LOCUS_00510 gene surE 60297 61127 CDS product 5'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI06 protein_id gnl|my_center|LOCUS_00510 61287 62216 gene locus_tag LOCUS_00520 61287 62216 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058143.1 protein_id gnl|my_center|LOCUS_00520 62252 62857 gene locus_tag LOCUS_00530 62252 62857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125563.1 protein_id gnl|my_center|LOCUS_00530 63191 62997 gene locus_tag LOCUS_00540 63191 62997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 63261 64736 gene locus_tag LOCUS_00550 63261 64736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_00550 64873 66480 gene locus_tag LOCUS_00560 64873 66480 CDS product dolichyl-phosphate-mannose-protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_00560 69191 66519 gene locus_tag LOCUS_00570 69191 66519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 70183 69188 gene locus_tag LOCUS_00580 70183 69188 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206339.1 protein_id gnl|my_center|LOCUS_00580 71663 70458 gene locus_tag LOCUS_00590 71663 70458 CDS product multidrug resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_00590 72311 71946 gene locus_tag LOCUS_00600 72311 71946 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMC5 protein_id gnl|my_center|LOCUS_00600 73057 72389 gene locus_tag LOCUS_00610 73057 72389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 73740 73531 gene locus_tag LOCUS_00620 73740 73531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 73898 76918 gene locus_tag LOCUS_00630 73898 76918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 77281 77063 gene locus_tag LOCUS_00640 77281 77063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056987.1 protein_id gnl|my_center|LOCUS_00640 78106 77546 gene locus_tag LOCUS_00650 78106 77546 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141429.1 protein_id gnl|my_center|LOCUS_00650 78337 79674 gene locus_tag LOCUS_00660 78337 79674 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 protein_id gnl|my_center|LOCUS_00660 79784 82918 gene locus_tag LOCUS_00670 79784 82918 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120142.1 protein_id gnl|my_center|LOCUS_00670 83920 82976 gene locus_tag LOCUS_00680 83920 82976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226738.1 protein_id gnl|my_center|LOCUS_00680 84127 84627 gene locus_tag LOCUS_00690 84127 84627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 85320 84703 gene locus_tag LOCUS_00700 85320 84703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 85442 85615 gene locus_tag LOCUS_00710 85442 85615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 86585 85737 gene locus_tag LOCUS_00720 86585 85737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 88451 86604 gene locus_tag LOCUS_00730 88451 86604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 90116 88542 gene locus_tag LOCUS_00740 90116 88542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 91120 90113 gene locus_tag LOCUS_00750 91120 90113 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_00750 92589 91318 gene locus_tag LOCUS_00760 92589 91318 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_00760 93971 93168 gene locus_tag LOCUS_00770 gene cobS 93971 93168 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ91 protein_id gnl|my_center|LOCUS_00770 94304 94119 gene locus_tag LOCUS_00780 94304 94119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 94679 95050 gene locus_tag LOCUS_00790 94679 95050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 95966 95127 gene locus_tag LOCUS_00800 95966 95127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 97502 96009 gene locus_tag LOCUS_00810 97502 96009 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_00810 98007 97633 gene locus_tag LOCUS_00820 98007 97633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_00820 99925 98081 gene locus_tag LOCUS_00830 99925 98081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_00830 100317 102473 gene locus_tag LOCUS_00840 100317 102473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 103263 102508 gene locus_tag LOCUS_00850 103263 102508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 103708 103250 gene locus_tag LOCUS_00860 103708 103250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056683.1 protein_id gnl|my_center|LOCUS_00860 105022 103904 gene locus_tag LOCUS_00870 105022 103904 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057211.1 protein_id gnl|my_center|LOCUS_00870 105378 105815 gene locus_tag LOCUS_00880 gene petE 105378 105815 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142337.1 protein_id gnl|my_center|LOCUS_00880 105991 106161 gene locus_tag LOCUS_00890 105991 106161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 106359 107495 gene locus_tag LOCUS_00900 106359 107495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 107868 107518 gene locus_tag LOCUS_00910 107868 107518 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002935368.1 protein_id gnl|my_center|LOCUS_00910 108188 109171 gene locus_tag LOCUS_00920 108188 109171 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057951.1 protein_id gnl|my_center|LOCUS_00920 109429 111153 gene locus_tag LOCUS_00930 109429 111153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 111662 112240 gene locus_tag LOCUS_00940 111662 112240 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056727.1 protein_id gnl|my_center|LOCUS_00940 112487 113839 gene locus_tag LOCUS_00950 112487 113839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 116068 113873 gene locus_tag LOCUS_00960 116068 113873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 116321 117322 gene locus_tag LOCUS_00970 gene ilvC 116321 117322 CDS product ketol-acid reductoisomerase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR0 protein_id gnl|my_center|LOCUS_00970 118424 117555 gene locus_tag LOCUS_00980 118424 117555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_00980 120013 121491 gene locus_tag LOCUS_00990 120013 121491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 121627 124506 gene locus_tag LOCUS_01000 121627 124506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 124611 125606 gene locus_tag LOCUS_01010 gene dnaJ 124611 125606 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_01010 125788 126537 gene locus_tag LOCUS_01020 125788 126537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_01020 127497 126970 gene locus_tag LOCUS_01030 gene purE 127497 126970 CDS product N5-carboxyaminoimidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL75 protein_id gnl|my_center|LOCUS_01030 128790 127543 gene locus_tag LOCUS_01040 gene ndbB 128790 127543 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056978.1 protein_id gnl|my_center|LOCUS_01040 130184 128877 gene locus_tag LOCUS_01050 130184 128877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 131164 130220 gene locus_tag LOCUS_01060 131164 130220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 132066 131410 gene locus_tag LOCUS_01070 132066 131410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 132354 132428 gene locus_tag LOCUS_t00020 132354 132428 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 132997 134811 gene locus_tag LOCUS_01080 gene pyrG 132997 134811 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT7 protein_id gnl|my_center|LOCUS_01080 135316 134912 gene locus_tag LOCUS_01090 135316 134912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 135559 137976 gene locus_tag LOCUS_01100 135559 137976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 138782 138051 gene locus_tag LOCUS_01110 138782 138051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 139192 138794 gene locus_tag LOCUS_01120 139192 138794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 139405 141171 gene locus_tag LOCUS_01130 139405 141171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_01130 141416 141718 gene locus_tag LOCUS_01140 141416 141718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 142859 141849 gene locus_tag LOCUS_01150 142859 141849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_01150 144285 142927 gene locus_tag LOCUS_01160 gene der 144285 142927 CDS product GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI1 protein_id gnl|my_center|LOCUS_01160 145359 144427 gene locus_tag LOCUS_01170 145359 144427 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_01170 146554 145742 gene locus_tag LOCUS_01180 146554 145742 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_01180 146719 147909 gene locus_tag LOCUS_01190 146719 147909 CDS product arsenic-transporting ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_01190 148802 147966 gene locus_tag LOCUS_01200 148802 147966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 149763 149005 gene locus_tag LOCUS_01210 149763 149005 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_01210 152434 149810 gene locus_tag LOCUS_01220 gene clpB1 152434 149810 CDS product chaperone protein ClpB 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ40 protein_id gnl|my_center|LOCUS_01220 152692 153186 gene locus_tag LOCUS_01230 152692 153186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 153262 153891 gene locus_tag LOCUS_01240 153262 153891 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 protein_id gnl|my_center|LOCUS_01240 154514 154963 gene locus_tag LOCUS_01250 154514 154963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 155878 154994 gene locus_tag LOCUS_01260 155878 154994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 158752 156338 gene locus_tag LOCUS_01270 158752 156338 CDS product putative phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN6 protein_id gnl|my_center|LOCUS_01270 159341 160570 gene locus_tag LOCUS_01280 159341 160570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972257.1 protein_id gnl|my_center|LOCUS_01280 163905 160567 gene locus_tag LOCUS_01290 163905 160567 CDS product acriflavin resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868786.1 protein_id gnl|my_center|LOCUS_01290 165590 163908 gene locus_tag LOCUS_01300 165590 163908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 166740 165997 gene locus_tag LOCUS_01310 166740 165997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 167717 167052 gene locus_tag LOCUS_01320 167717 167052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106538.1 protein_id gnl|my_center|LOCUS_01320 167891 169897 gene locus_tag LOCUS_01330 gene uvrB 167891 169897 CDS product UvrABC system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC6 protein_id gnl|my_center|LOCUS_01330 171751 170621 gene locus_tag LOCUS_01340 gene thrC 171751 170621 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJJ6 protein_id gnl|my_center|LOCUS_01340 172056 171868 gene locus_tag LOCUS_01350 172056 171868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 172223 173257 gene locus_tag LOCUS_01360 gene desA 172223 173257 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_01360 173691 177416 gene locus_tag LOCUS_01370 173691 177416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 177689 178780 gene locus_tag LOCUS_01380 177689 178780 CDS product diguanylate cyclase response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_01380 179400 178834 gene locus_tag LOCUS_01390 179400 178834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 180216 179764 gene locus_tag LOCUS_01400 180216 179764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_01400 180931 180347 gene locus_tag LOCUS_01410 180931 180347 CDS product phosphate transport system regulatory protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B8E156 protein_id gnl|my_center|LOCUS_01410 183307 181658 gene locus_tag LOCUS_01420 183307 181658 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_01420 184091 183288 gene locus_tag LOCUS_01430 184091 183288 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_01430 184894 184529 gene locus_tag LOCUS_01440 184894 184529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 190606 184991 gene locus_tag LOCUS_01450 190606 184991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 196435 190820 gene locus_tag LOCUS_01460 196435 190820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 196491 196724 gene locus_tag LOCUS_01470 196491 196724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 197429 197812 gene locus_tag LOCUS_01480 197429 197812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 198050 199228 gene locus_tag LOCUS_01490 gene dxr 198050 199228 CDS product 1-deoxy-D-xylulose 5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK30 protein_id gnl|my_center|LOCUS_01490 199314 200204 gene locus_tag LOCUS_01500 199314 200204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_01500 200372 200593 gene locus_tag LOCUS_01510 200372 200593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 201647 200622 gene locus_tag LOCUS_01520 201647 200622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 202265 201672 gene locus_tag LOCUS_01530 202265 201672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 202951 202376 gene locus_tag LOCUS_01540 202951 202376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 205279 203252 gene locus_tag LOCUS_01550 205279 203252 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_01550 205553 206710 gene locus_tag LOCUS_01560 gene cofH 205553 206710 CDS product FO synthase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DII8 protein_id gnl|my_center|LOCUS_01560 206716 207666 gene locus_tag LOCUS_01570 206716 207666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_01570 207732 208631 gene locus_tag LOCUS_01580 207732 208631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 209604 208648 gene locus_tag LOCUS_01590 209604 208648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 209860 210432 gene locus_tag LOCUS_01600 209860 210432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 210488 213241 gene locus_tag LOCUS_01610 210488 213241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 213971 213231 gene locus_tag LOCUS_01620 213971 213231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_01620 214473 214021 gene locus_tag LOCUS_01630 214473 214021 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_01630 214719 214474 gene locus_tag LOCUS_01640 214719 214474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 215478 214816 gene locus_tag LOCUS_01650 gene ycf39 215478 214816 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056872.1 protein_id gnl|my_center|LOCUS_01650 216470 215598 gene locus_tag LOCUS_01660 216470 215598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 216724 216512 gene locus_tag LOCUS_01670 216724 216512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 217069 216761 gene locus_tag LOCUS_01680 217069 216761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 217147 217803 gene locus_tag LOCUS_01690 217147 217803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 217890 219344 gene locus_tag LOCUS_01700 gene glcD 217890 219344 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057464.1 protein_id gnl|my_center|LOCUS_01700 219492 222302 gene locus_tag LOCUS_01710 219492 222302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 222324 223313 gene locus_tag LOCUS_01720 222324 223313 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_01720 224989 223364 gene locus_tag LOCUS_01730 gene leuA 224989 223364 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ32 protein_id gnl|my_center|LOCUS_01730 225727 225209 gene locus_tag LOCUS_01740 225727 225209 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_01740 226420 227613 gene locus_tag LOCUS_01750 226420 227613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 228116 227637 gene locus_tag LOCUS_01760 gene ispF 228116 227637 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHC4 protein_id gnl|my_center|LOCUS_01760 228225 229469 gene locus_tag LOCUS_01770 gene dapL 228225 229469 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH57 protein_id gnl|my_center|LOCUS_01770 229546 230436 gene locus_tag LOCUS_01780 229546 230436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 231168 230467 gene locus_tag LOCUS_01790 gene nth 231168 230467 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE9 protein_id gnl|my_center|LOCUS_01790 232312 231218 gene locus_tag LOCUS_01800 232312 231218 CDS product zinc metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE8 protein_id gnl|my_center|LOCUS_01800 233709 232534 gene locus_tag LOCUS_01810 gene sat 233709 232534 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK26 protein_id gnl|my_center|LOCUS_01810 234956 233886 gene locus_tag LOCUS_01820 234956 233886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 237337 235079 gene locus_tag LOCUS_01830 237337 235079 CDS product HlyB/MsbA family ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142193.1 protein_id gnl|my_center|LOCUS_01830 238681 237563 gene locus_tag LOCUS_01840 238681 237563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 239194 238994 gene locus_tag LOCUS_01850 239194 238994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 239411 240340 gene locus_tag LOCUS_01860 gene gloB 239411 240340 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF1 protein_id gnl|my_center|LOCUS_01860 240886 242049 gene locus_tag LOCUS_01870 gene sigA 240886 242049 CDS product RNA polymerase sigma factor SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL79 protein_id gnl|my_center|LOCUS_01870 242453 242193 gene locus_tag LOCUS_01880 242453 242193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 242909 244084 gene locus_tag LOCUS_01890 242909 244084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 244948 244205 gene locus_tag LOCUS_01900 244948 244205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142610.1 protein_id gnl|my_center|LOCUS_01900 245224 245442 gene locus_tag LOCUS_01910 245224 245442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 247107 245470 gene locus_tag LOCUS_01920 247107 245470 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_01920 248483 247146 gene locus_tag LOCUS_01930 248483 247146 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057949.1 protein_id gnl|my_center|LOCUS_01930 249670 248789 gene locus_tag LOCUS_01940 gene trmJ 249670 248789 CDS product tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH44 protein_id gnl|my_center|LOCUS_01940 249825 249664 gene locus_tag LOCUS_01950 249825 249664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 249836 250090 gene locus_tag LOCUS_01960 249836 250090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_01960 250583 250365 gene locus_tag LOCUS_01970 250583 250365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 250546 251784 gene locus_tag LOCUS_01980 250546 251784 CDS product murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_01980 251793 253475 gene locus_tag LOCUS_01990 251793 253475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 253512 253952 gene locus_tag LOCUS_02000 253512 253952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 254704 253970 gene locus_tag LOCUS_02010 254704 253970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 255180 254842 gene locus_tag LOCUS_02020 255180 254842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 255584 255168 gene locus_tag LOCUS_02030 255584 255168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 257908 255587 gene locus_tag LOCUS_02040 257908 255587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 258070 258960 gene locus_tag LOCUS_02050 258070 258960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 261076 259064 gene locus_tag LOCUS_02060 261076 259064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 261452 262924 gene locus_tag LOCUS_02070 261452 262924 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140391.1 protein_id gnl|my_center|LOCUS_02070 263608 263949 gene locus_tag LOCUS_02080 263608 263949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 264331 264762 gene locus_tag LOCUS_02090 264331 264762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 264821 266005 gene locus_tag LOCUS_02100 gene tgt 264821 266005 CDS product queuine tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM7 protein_id gnl|my_center|LOCUS_02100 266342 267838 gene locus_tag LOCUS_02110 gene pepA 266342 267838 CDS product putative cytosol aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI46 protein_id gnl|my_center|LOCUS_02110 268042 269220 gene locus_tag LOCUS_02120 268042 269220 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141217.1 protein_id gnl|my_center|LOCUS_02120 271765 269255 gene locus_tag LOCUS_02130 271765 269255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 273476 272466 gene locus_tag LOCUS_02140 gene prmC 273476 272466 CDS product release factor glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV7 protein_id gnl|my_center|LOCUS_02140 274335 273568 gene locus_tag LOCUS_02150 274335 273568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141751.1 protein_id gnl|my_center|LOCUS_02150 276103 274940 gene locus_tag LOCUS_02160 gene hemH 276103 274940 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGU6 protein_id gnl|my_center|LOCUS_02160 276296 276937 gene locus_tag LOCUS_02170 276296 276937 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141483.1 protein_id gnl|my_center|LOCUS_02170 277009 277878 gene locus_tag LOCUS_02180 277009 277878 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404255.1 protein_id gnl|my_center|LOCUS_02180 278444 277932 gene locus_tag LOCUS_02190 278444 277932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 278570 278740 gene locus_tag LOCUS_02200 278570 278740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 279999 278737 gene locus_tag LOCUS_02210 279999 278737 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058122.1 protein_id gnl|my_center|LOCUS_02210 280544 280194 gene locus_tag LOCUS_02220 280544 280194 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_02220 281093 281836 gene locus_tag LOCUS_02230 281093 281836 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142663.1 protein_id gnl|my_center|LOCUS_02230 282389 284029 gene locus_tag LOCUS_02240 gene speE 282389 284029 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7UWD1 protein_id gnl|my_center|LOCUS_02240 284179 284781 gene locus_tag LOCUS_02250 284179 284781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 284759 285187 gene locus_tag LOCUS_02260 284759 285187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 285228 286088 gene locus_tag LOCUS_02270 285228 286088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 286160 287905 gene locus_tag LOCUS_02280 286160 287905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_02280 288232 287918 gene locus_tag LOCUS_02290 288232 287918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 289163 289996 gene locus_tag LOCUS_02300 289163 289996 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_02300 291921 290026 gene locus_tag LOCUS_02310 291921 290026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 293657 292014 gene locus_tag LOCUS_02320 293657 292014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 293953 295200 gene locus_tag LOCUS_02330 293953 295200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 295595 296386 gene locus_tag LOCUS_02340 295595 296386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 298634 296559 gene locus_tag LOCUS_02350 gene fus 298634 296559 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_02350 299630 299091 gene locus_tag LOCUS_02360 299630 299091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 300029 302233 gene locus_tag LOCUS_02370 300029 302233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 302442 302756 gene locus_tag LOCUS_02380 302442 302756 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_02380 302824 303402 gene locus_tag LOCUS_02390 302824 303402 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_02390 304910 303447 gene locus_tag LOCUS_02400 304910 303447 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_02400 307688 305004 gene locus_tag LOCUS_02410 307688 305004 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_02410 308805 307978 gene locus_tag LOCUS_02420 gene cphB 308805 307978 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P3 protein_id gnl|my_center|LOCUS_02420 309658 308948 gene locus_tag LOCUS_02430 gene rpiA 309658 308948 CDS product ribose-5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJF2 protein_id gnl|my_center|LOCUS_02430 310621 309875 gene locus_tag LOCUS_02440 310621 309875 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_02440 311753 310665 gene locus_tag LOCUS_02450 311753 310665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_02450 312354 311980 gene locus_tag LOCUS_02460 312354 311980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_02460 312784 314250 gene locus_tag LOCUS_02470 312784 314250 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_02470 314604 319892 gene locus_tag LOCUS_02480 314604 319892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 320079 320360 gene locus_tag LOCUS_02490 gene clpS 320079 320360 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056066.1 protein_id gnl|my_center|LOCUS_02490 320805 321506 gene locus_tag LOCUS_02500 320805 321506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143841.1 protein_id gnl|my_center|LOCUS_02500 321949 321512 gene locus_tag LOCUS_02510 321949 321512 CDS product flavohemoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141571.1 protein_id gnl|my_center|LOCUS_02510 323746 322487 gene locus_tag LOCUS_02520 323746 322487 CDS product peptidase M20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058279.1 protein_id gnl|my_center|LOCUS_02520 324796 323963 gene locus_tag LOCUS_02530 324796 323963 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_02530 325960 326613 gene locus_tag LOCUS_02540 325960 326613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 326796 328634 gene locus_tag LOCUS_02550 326796 328634 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_02550 333668 328824 gene locus_tag LOCUS_02560 333668 328824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 335333 334293 gene locus_tag LOCUS_02570 335333 334293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 336680 335589 gene locus_tag LOCUS_02580 336680 335589 CDS product 3-chlorobenzoate-3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_02580 336848 337282 gene locus_tag LOCUS_02590 336848 337282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 337981 337406 gene locus_tag LOCUS_02600 337981 337406 CDS product transcriptional regulator BetI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532408.1 protein_id gnl|my_center|LOCUS_02600 338073 338681 gene locus_tag LOCUS_02610 338073 338681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 338742 339275 gene locus_tag LOCUS_02620 338742 339275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 339453 340172 gene locus_tag LOCUS_02630 339453 340172 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057934.1 protein_id gnl|my_center|LOCUS_02630 340557 341624 gene locus_tag LOCUS_02640 340557 341624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 342157 341639 gene locus_tag LOCUS_02650 342157 341639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057705.1 protein_id gnl|my_center|LOCUS_02650 342282 343568 gene locus_tag LOCUS_02660 342282 343568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 345263 343809 gene locus_tag LOCUS_02670 345263 343809 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_02670 345451 345831 gene locus_tag LOCUS_02680 345451 345831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 345919 346947 gene locus_tag LOCUS_02690 345919 346947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 347946 346960 gene locus_tag LOCUS_02700 347946 346960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 348613 349716 gene locus_tag LOCUS_02710 348613 349716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_02710 349842 350399 gene locus_tag LOCUS_02720 349842 350399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 351006 352331 gene locus_tag LOCUS_02730 351006 352331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 352928 353125 gene locus_tag LOCUS_02740 352928 353125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 353861 353154 gene locus_tag LOCUS_02750 353861 353154 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057970.1 protein_id gnl|my_center|LOCUS_02750 354286 358890 gene locus_tag LOCUS_02760 354286 358890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 358893 360707 gene locus_tag LOCUS_02770 358893 360707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 361773 363023 gene locus_tag LOCUS_02780 361773 363023 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142380.1 protein_id gnl|my_center|LOCUS_02780 363105 363767 gene locus_tag LOCUS_02790 gene msrA 363105 363767 CDS product peptide methionine sulfoxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHL9 protein_id gnl|my_center|LOCUS_02790 364367 364014 gene locus_tag LOCUS_02800 364367 364014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 364771 364355 gene locus_tag LOCUS_02810 364771 364355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 365205 364774 gene locus_tag LOCUS_02820 365205 364774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence02 565 1248 gene locus_tag LOCUS_02830 565 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_02830 2320 1406 gene locus_tag LOCUS_02840 gene murB 2320 1406 CDS product UDP-N-acetylenolpyruvoylglucosamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV6 protein_id gnl|my_center|LOCUS_02840 4066 2642 gene locus_tag LOCUS_02850 gene murC 4066 2642 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLV5 protein_id gnl|my_center|LOCUS_02850 4496 5515 gene locus_tag LOCUS_02860 4496 5515 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIW5 protein_id gnl|my_center|LOCUS_02860 5782 7179 gene locus_tag LOCUS_02870 5782 7179 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057361.1 protein_id gnl|my_center|LOCUS_02870 8376 7210 gene locus_tag LOCUS_02880 gene aspC 8376 7210 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG0 protein_id gnl|my_center|LOCUS_02880 9206 10105 gene locus_tag LOCUS_02890 9206 10105 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057816.1 protein_id gnl|my_center|LOCUS_02890 10411 10581 gene locus_tag LOCUS_02900 10411 10581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 10859 10635 gene locus_tag LOCUS_02910 10859 10635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10827 11624 gene locus_tag LOCUS_02920 gene ribF 10827 11624 CDS product riboflavin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM6 protein_id gnl|my_center|LOCUS_02920 11706 12653 gene locus_tag LOCUS_02930 11706 12653 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_02930 12746 13444 gene locus_tag LOCUS_02940 12746 13444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 13722 13946 gene locus_tag LOCUS_02950 13722 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 14681 14130 gene locus_tag LOCUS_02960 14681 14130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112815.1 protein_id gnl|my_center|LOCUS_02960 15871 14696 gene locus_tag LOCUS_02970 15871 14696 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH66 protein_id gnl|my_center|LOCUS_02970 16668 15904 gene locus_tag LOCUS_02980 16668 15904 CDS product urease-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066605.1 protein_id gnl|my_center|LOCUS_02980 18231 16747 gene locus_tag LOCUS_02990 18231 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 18319 18681 gene locus_tag LOCUS_03000 18319 18681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P55580 protein_id gnl|my_center|LOCUS_03000 18802 19059 gene locus_tag LOCUS_03010 18802 19059 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142871.1 protein_id gnl|my_center|LOCUS_03010 19170 19811 gene locus_tag LOCUS_03020 19170 19811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_03020 19928 22264 gene locus_tag LOCUS_03030 19928 22264 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057117.1 protein_id gnl|my_center|LOCUS_03030 22659 23252 gene locus_tag LOCUS_03040 22659 23252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 23702 23364 gene locus_tag LOCUS_03050 23702 23364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 23827 24207 gene locus_tag LOCUS_03060 23827 24207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 24875 24261 gene locus_tag LOCUS_03070 24875 24261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877100.1 protein_id gnl|my_center|LOCUS_03070 25238 26296 gene locus_tag LOCUS_03080 25238 26296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 27256 29751 gene locus_tag LOCUS_03090 27256 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 30720 30034 gene locus_tag LOCUS_03100 30720 30034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 31182 31409 gene locus_tag LOCUS_03110 31182 31409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 31406 32257 gene locus_tag LOCUS_03120 31406 32257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143510.1 protein_id gnl|my_center|LOCUS_03120 33303 32872 gene locus_tag LOCUS_03130 33303 32872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057805.1 protein_id gnl|my_center|LOCUS_03130 33600 34652 gene locus_tag LOCUS_03140 gene thiE 33600 34652 CDS product thiamine-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHK2 protein_id gnl|my_center|LOCUS_03140 34712 35434 gene locus_tag LOCUS_03150 34712 35434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 36035 35454 gene locus_tag LOCUS_03160 36035 35454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056409.1 protein_id gnl|my_center|LOCUS_03160 36725 36258 gene locus_tag LOCUS_03170 36725 36258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 37071 38249 gene locus_tag LOCUS_03180 gene purT 37071 38249 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KDJ0 protein_id gnl|my_center|LOCUS_03180 41006 38361 gene locus_tag LOCUS_03190 41006 38361 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122988.1 protein_id gnl|my_center|LOCUS_03190 41660 41469 gene locus_tag LOCUS_03200 41660 41469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 42577 41999 gene locus_tag LOCUS_03210 42577 41999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_03210 42919 45363 gene locus_tag LOCUS_03220 42919 45363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 45495 48071 gene locus_tag LOCUS_03230 gene leuS 45495 48071 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH61 protein_id gnl|my_center|LOCUS_03230 48190 48741 gene locus_tag LOCUS_03240 48190 48741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 48753 49058 gene locus_tag LOCUS_03250 48753 49058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03250 49180 49404 gene locus_tag LOCUS_03260 49180 49404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 50627 49473 gene locus_tag LOCUS_03270 50627 49473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918442.1 protein_id gnl|my_center|LOCUS_03270 53021 50778 gene locus_tag LOCUS_03280 53021 50778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918443.1 protein_id gnl|my_center|LOCUS_03280 54517 53279 gene locus_tag LOCUS_03290 54517 53279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_03290 54605 55345 gene locus_tag LOCUS_03300 54605 55345 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125717.1 protein_id gnl|my_center|LOCUS_03300 55363 56187 gene locus_tag LOCUS_03310 55363 56187 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_03310 56212 56982 gene locus_tag LOCUS_03320 56212 56982 CDS product phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125719.1 protein_id gnl|my_center|LOCUS_03320 57036 57290 gene locus_tag LOCUS_03330 57036 57290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03330 57669 57439 gene locus_tag LOCUS_03340 57669 57439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 57890 57714 gene locus_tag LOCUS_03350 57890 57714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 58147 59640 gene locus_tag LOCUS_03360 58147 59640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 59956 59672 gene locus_tag LOCUS_03370 59956 59672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 60212 60427 gene locus_tag LOCUS_03380 60212 60427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 60765 60403 gene locus_tag LOCUS_03390 60765 60403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 61106 60756 gene locus_tag LOCUS_03400 61106 60756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 61261 65097 gene locus_tag LOCUS_03410 61261 65097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 65302 66327 gene locus_tag LOCUS_03420 65302 66327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 66333 68150 gene locus_tag LOCUS_03430 66333 68150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 68695 69798 gene locus_tag LOCUS_03440 68695 69798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_03440 69894 72077 gene locus_tag LOCUS_03450 69894 72077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 72168 72899 gene locus_tag LOCUS_03460 gene pdxJ 72168 72899 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPF2 protein_id gnl|my_center|LOCUS_03460 73019 73348 gene locus_tag LOCUS_03470 gene ycf54 73019 73348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_03470 73488 74090 gene locus_tag LOCUS_03480 73488 74090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 76122 74380 gene locus_tag LOCUS_03490 76122 74380 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804193.1 protein_id gnl|my_center|LOCUS_03490 77167 76211 gene locus_tag LOCUS_03500 gene pys 77167 76211 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_03500 78744 77338 gene locus_tag LOCUS_03510 gene pds 78744 77338 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_03510 81571 78944 gene locus_tag LOCUS_03520 81571 78944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 81925 81764 gene locus_tag LOCUS_03530 81925 81764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 81924 83219 gene locus_tag LOCUS_03540 81924 83219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 84060 83206 gene locus_tag LOCUS_03550 84060 83206 CDS product UPF0176 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZQ82 protein_id gnl|my_center|LOCUS_03550 84222 84295 gene locus_tag LOCUS_t00030 84222 84295 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 84849 84433 gene locus_tag LOCUS_03560 gene msrB 84849 84433 CDS product peptide methionine sulfoxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK9 protein_id gnl|my_center|LOCUS_03560 85271 84966 gene locus_tag LOCUS_03570 85271 84966 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_03570 85484 87082 gene locus_tag LOCUS_03580 85484 87082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 87676 87167 gene locus_tag LOCUS_03590 gene ppa 87676 87167 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR2 protein_id gnl|my_center|LOCUS_03590 88640 87807 gene locus_tag LOCUS_03600 gene menB 88640 87807 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG66 protein_id gnl|my_center|LOCUS_03600 89288 88761 gene locus_tag LOCUS_03610 89288 88761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 89463 90101 gene locus_tag LOCUS_03620 89463 90101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 90289 91608 gene locus_tag LOCUS_03630 gene thrA 90289 91608 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM46 protein_id gnl|my_center|LOCUS_03630 92530 91682 gene locus_tag LOCUS_03640 gene rfaJ 92530 91682 CDS product lipopolysaccharide 1,2-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P27129 protein_id gnl|my_center|LOCUS_03640 92811 92990 gene locus_tag LOCUS_03650 92811 92990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 93886 94701 gene locus_tag LOCUS_03660 93886 94701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 95026 96204 gene locus_tag LOCUS_03670 gene tal 95026 96204 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL7 protein_id gnl|my_center|LOCUS_03670 96671 99316 gene locus_tag LOCUS_03680 gene gyrA 96671 99316 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ59 protein_id gnl|my_center|LOCUS_03680 99416 100069 gene locus_tag LOCUS_03690 99416 100069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 100973 100086 gene locus_tag LOCUS_03700 100973 100086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_03700 104210 101265 gene locus_tag LOCUS_03710 104210 101265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 106211 105405 gene locus_tag LOCUS_03720 106211 105405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 107933 106491 gene locus_tag LOCUS_03730 gene gltX 107933 106491 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI5 protein_id gnl|my_center|LOCUS_03730 108367 109083 gene locus_tag LOCUS_03740 gene ho1 108367 109083 CDS product heme oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056220.1 protein_id gnl|my_center|LOCUS_03740 110287 109226 gene locus_tag LOCUS_03750 110287 109226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 112843 110657 gene locus_tag LOCUS_03760 112843 110657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 113838 113443 gene locus_tag LOCUS_03770 113838 113443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 114346 115143 gene locus_tag LOCUS_03780 114346 115143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 117003 115423 gene locus_tag LOCUS_03790 117003 115423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_03790 117695 117000 gene locus_tag LOCUS_03800 117695 117000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 117870 117942 gene locus_tag LOCUS_t00040 117870 117942 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 118027 118641 gene locus_tag LOCUS_03810 118027 118641 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706359.1 protein_id gnl|my_center|LOCUS_03810 119792 118638 gene locus_tag LOCUS_03820 119792 118638 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974018.1 protein_id gnl|my_center|LOCUS_03820 121561 119816 gene locus_tag LOCUS_03830 121561 119816 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_03830 122176 123762 gene locus_tag LOCUS_03840 122176 123762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 123980 124708 gene locus_tag LOCUS_03850 123980 124708 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143254.1 protein_id gnl|my_center|LOCUS_03850 124965 126086 gene locus_tag LOCUS_03860 gene ycf84 124965 126086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_03860 126189 127844 gene locus_tag LOCUS_03870 126189 127844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 128102 129547 gene locus_tag LOCUS_03880 128102 129547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 129702 130733 gene locus_tag LOCUS_03890 129702 130733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 131171 130737 gene locus_tag LOCUS_03900 131171 130737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 132592 131282 gene locus_tag LOCUS_03910 gene ndhH 132592 131282 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD9 protein_id gnl|my_center|LOCUS_03910 132585 133583 gene locus_tag LOCUS_03920 gene rsmH 132585 133583 CDS product ribosomal RNA small subunit methyltransferase H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCQ1 protein_id gnl|my_center|LOCUS_03920 133655 134173 gene locus_tag LOCUS_03930 133655 134173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 134249 135019 gene locus_tag LOCUS_03940 134249 135019 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262210.1 protein_id gnl|my_center|LOCUS_03940 137173 135056 gene locus_tag LOCUS_03950 137173 135056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 139004 137502 gene locus_tag LOCUS_03960 139004 137502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057693.1 protein_id gnl|my_center|LOCUS_03960 139776 143069 gene locus_tag LOCUS_03970 139776 143069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 143246 144115 gene locus_tag LOCUS_03980 gene dapB 143246 144115 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH2 protein_id gnl|my_center|LOCUS_03980 144332 145081 gene locus_tag LOCUS_03990 144332 145081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_03990 145490 146911 gene locus_tag LOCUS_04000 145490 146911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 147463 146954 gene locus_tag LOCUS_04010 147463 146954 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_04010 147619 148761 gene locus_tag LOCUS_04020 147619 148761 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258295.1 protein_id gnl|my_center|LOCUS_04020 149085 148888 gene locus_tag LOCUS_04030 149085 148888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 149290 149015 gene locus_tag LOCUS_04040 149290 149015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 149315 150673 gene locus_tag LOCUS_04050 149315 150673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 151545 150706 gene locus_tag LOCUS_04060 gene ccmO 151545 150706 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142089.1 protein_id gnl|my_center|LOCUS_04060 152796 151702 gene locus_tag LOCUS_04070 gene chlI 152796 151702 CDS product Mg-protoporphyrin IX chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS0 protein_id gnl|my_center|LOCUS_04070 153794 153000 gene locus_tag LOCUS_04080 153794 153000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_04080 154485 154093 gene locus_tag LOCUS_04090 154485 154093 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_04090 154670 154533 gene locus_tag LOCUS_04100 154670 154533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 155861 154812 gene locus_tag LOCUS_04110 155861 154812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 157455 155944 gene locus_tag LOCUS_04120 157455 155944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 158876 157962 gene locus_tag LOCUS_04130 gene glyQ 158876 157962 CDS product glycine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK36 protein_id gnl|my_center|LOCUS_04130 159239 160375 gene locus_tag LOCUS_04140 159239 160375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 160590 160862 gene locus_tag LOCUS_04150 160590 160862 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072776.1 protein_id gnl|my_center|LOCUS_04150 160909 162600 gene locus_tag LOCUS_04160 160909 162600 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_04160 163471 162689 gene locus_tag LOCUS_04170 163471 162689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 163653 163725 gene locus_tag LOCUS_t00050 163653 163725 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 163905 163977 gene locus_tag LOCUS_t00060 163905 163977 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 165720 164110 gene locus_tag LOCUS_04180 165720 164110 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_04180 166823 165750 gene locus_tag LOCUS_04190 166823 165750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 170295 166990 gene locus_tag LOCUS_04200 170295 166990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 170752 170537 gene locus_tag LOCUS_04210 170752 170537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 172569 170845 gene locus_tag LOCUS_04220 172569 170845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 173159 172689 gene locus_tag LOCUS_04230 gene rimP 173159 172689 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHL1 protein_id gnl|my_center|LOCUS_04230 174282 173776 gene locus_tag LOCUS_04240 174282 173776 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_04240 176837 174321 gene locus_tag LOCUS_04250 176837 174321 CDS product inter-alpha-trypsin inhibitor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_04250 177049 178635 gene locus_tag LOCUS_04260 177049 178635 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143167.1 protein_id gnl|my_center|LOCUS_04260 179302 178718 gene locus_tag LOCUS_04270 179302 178718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_04270 180375 179407 gene locus_tag LOCUS_04280 180375 179407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 183176 180510 gene locus_tag LOCUS_04290 gene apcE 183176 180510 CDS product photosystem I reaction center subunit X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_04290 183569 184864 gene locus_tag LOCUS_04300 183569 184864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_04300 185035 185499 gene locus_tag LOCUS_04310 185035 185499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 185546 186289 gene locus_tag LOCUS_04320 gene atpB 185546 186289 CDS product ATP synthase subunit a inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP8 protein_id gnl|my_center|LOCUS_04320 186351 186596 gene locus_tag LOCUS_04330 gene atpE 186351 186596 CDS product ATP synthase subunit c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP7 protein_id gnl|my_center|LOCUS_04330 186872 187360 gene locus_tag LOCUS_04340 gene atpG 186872 187360 CDS product ATP synthase subunit b' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP6 protein_id gnl|my_center|LOCUS_04340 187369 187929 gene locus_tag LOCUS_04350 gene atpF 187369 187929 CDS product ATP synthase subunit b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCS1 protein_id gnl|my_center|LOCUS_04350 187935 188495 gene locus_tag LOCUS_04360 gene atpH 187935 188495 CDS product ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP4 protein_id gnl|my_center|LOCUS_04360 188579 190096 gene locus_tag LOCUS_04370 gene atpA 188579 190096 CDS product ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLP3 protein_id gnl|my_center|LOCUS_04370 190184 191134 gene locus_tag LOCUS_04380 gene atpG 190184 191134 CDS product ATP synthase gamma chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLU1 protein_id gnl|my_center|LOCUS_04380 191277 191606 gene locus_tag LOCUS_04390 191277 191606 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_04390 191945 192430 gene locus_tag LOCUS_04400 gene apcA 191945 192430 CDS product allophycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50030 protein_id gnl|my_center|LOCUS_04400 192528 193013 gene locus_tag LOCUS_04410 gene apcB 192528 193013 CDS product allophycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50031 protein_id gnl|my_center|LOCUS_04410 193252 193455 gene locus_tag LOCUS_04420 gene apcC 193252 193455 CDS product phycobilisome 7.8 kDa linker polypeptide, allophycocyanin-associated, core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50036 protein_id gnl|my_center|LOCUS_04420 193637 194866 gene locus_tag LOCUS_04430 gene ftsW 193637 194866 CDS product cell division protein FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056295.1 protein_id gnl|my_center|LOCUS_04430 194880 195452 gene locus_tag LOCUS_04440 194880 195452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 196967 195465 gene locus_tag LOCUS_04450 196967 195465 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_04450 197576 197157 gene locus_tag LOCUS_04460 197576 197157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 199725 197944 gene locus_tag LOCUS_04470 199725 197944 CDS product putative lipid II flippase MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG7 protein_id gnl|my_center|LOCUS_04470 199877 202483 gene locus_tag LOCUS_04480 199877 202483 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_04480 202732 203169 gene locus_tag LOCUS_04490 202732 203169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 203296 203973 gene locus_tag LOCUS_04500 gene cpcF 203296 203973 CDS product phycocyanobilin lyase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50038 protein_id gnl|my_center|LOCUS_04500 205307 204000 gene locus_tag LOCUS_04510 gene miaB 205307 204000 CDS product tRNA-2-methylthio-N(6)-dimethylallyladenosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB2 protein_id gnl|my_center|LOCUS_04510 205599 205526 gene locus_tag LOCUS_t00070 205599 205526 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 206131 205904 gene locus_tag LOCUS_04520 206131 205904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 206370 207110 gene locus_tag LOCUS_04530 206370 207110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 207945 207142 gene locus_tag LOCUS_04540 207945 207142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_04540 208647 209726 gene locus_tag LOCUS_04550 gene glgC 208647 209726 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057127.1 protein_id gnl|my_center|LOCUS_04550 210490 209840 gene locus_tag LOCUS_04560 210490 209840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 213918 211117 gene locus_tag LOCUS_04570 gene secA 213918 211117 CDS product protein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHU4 protein_id gnl|my_center|LOCUS_04570 214453 214061 gene locus_tag LOCUS_04580 214453 214061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 215296 214655 gene locus_tag LOCUS_04590 215296 214655 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_04590 215768 215328 gene locus_tag LOCUS_04600 gene ycf20 215768 215328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_04600 215845 217842 gene locus_tag LOCUS_04610 gene arnT 215845 217842 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125444.1 protein_id gnl|my_center|LOCUS_04610 218099 217950 gene locus_tag LOCUS_04620 218099 217950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 218257 219396 gene locus_tag LOCUS_04630 218257 219396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 219739 220461 gene locus_tag LOCUS_04640 219739 220461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057874.1 protein_id gnl|my_center|LOCUS_04640 220712 220545 gene locus_tag LOCUS_04650 220712 220545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 221839 220841 gene locus_tag LOCUS_04660 221839 220841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 222330 223205 gene locus_tag LOCUS_04670 222330 223205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 223461 224777 gene locus_tag LOCUS_04680 223461 224777 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055927.1 protein_id gnl|my_center|LOCUS_04680 225298 225813 gene locus_tag LOCUS_04690 225298 225813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 226657 227919 gene locus_tag LOCUS_04700 226657 227919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 228073 228546 gene locus_tag LOCUS_04710 228073 228546 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_04710 228646 230148 gene locus_tag LOCUS_04720 228646 230148 CDS product neopullulanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143635.1 protein_id gnl|my_center|LOCUS_04720 230174 231109 gene locus_tag LOCUS_04730 230174 231109 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143461.1 protein_id gnl|my_center|LOCUS_04730 231298 232308 gene locus_tag LOCUS_04740 231298 232308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 232378 233304 gene locus_tag LOCUS_04750 232378 233304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 234268 233330 gene locus_tag LOCUS_04760 gene cysK 234268 233330 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI7 protein_id gnl|my_center|LOCUS_04760 234835 234386 gene locus_tag LOCUS_04770 234835 234386 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ9 protein_id gnl|my_center|LOCUS_04770 235648 234956 gene locus_tag LOCUS_04780 235648 234956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 235860 235669 gene locus_tag LOCUS_04790 235860 235669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 237792 236209 gene locus_tag LOCUS_04800 gene serA 237792 236209 CDS product D-3-phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM01 protein_id gnl|my_center|LOCUS_04800 240436 237935 gene locus_tag LOCUS_04810 240436 237935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 242103 240700 gene locus_tag LOCUS_04820 gene lysA 242103 240700 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPE5 protein_id gnl|my_center|LOCUS_04820 242693 243169 gene locus_tag LOCUS_04830 242693 243169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 243291 244301 gene locus_tag LOCUS_04840 243291 244301 CDS product radical SAM/Cys-rich domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_04840 244386 245042 gene locus_tag LOCUS_04850 244386 245042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 245493 245149 gene locus_tag LOCUS_04860 245493 245149 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_04860 245860 247848 gene locus_tag LOCUS_04870 245860 247848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 248876 247860 gene locus_tag LOCUS_04880 248876 247860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 250988 249069 gene locus_tag LOCUS_04890 gene dnaK2 250988 249069 CDS product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 protein_id gnl|my_center|LOCUS_04890 251320 252777 gene locus_tag LOCUS_04900 251320 252777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 254521 252767 gene locus_tag LOCUS_04910 254521 252767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_04910 255128 257035 gene locus_tag LOCUS_04920 gene cobJ 255128 257035 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142541.1 protein_id gnl|my_center|LOCUS_04920 257283 257032 gene locus_tag LOCUS_04930 gene ycf34 257283 257032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_04930 258485 257613 gene locus_tag LOCUS_04940 258485 257613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 259597 258482 gene locus_tag LOCUS_04950 259597 258482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 260633 259623 gene locus_tag LOCUS_04960 260633 259623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 262275 260743 gene locus_tag LOCUS_04970 262275 260743 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_04970 263209 262349 gene locus_tag LOCUS_04980 263209 262349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 263736 263398 gene locus_tag LOCUS_04990 263736 263398 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NM87 protein_id gnl|my_center|LOCUS_04990 265508 263853 gene locus_tag LOCUS_05000 265508 263853 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_05000 265600 266682 gene locus_tag LOCUS_05010 265600 266682 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_05010 268598 266838 gene locus_tag LOCUS_05020 268598 266838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 270582 269032 gene locus_tag LOCUS_05030 270582 269032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 271364 270576 gene locus_tag LOCUS_05040 271364 270576 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403708.1 protein_id gnl|my_center|LOCUS_05040 272240 271416 gene locus_tag LOCUS_05050 272240 271416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 273407 272379 gene locus_tag LOCUS_05060 273407 272379 CDS product Zn-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969001.1 protein_id gnl|my_center|LOCUS_05060 273966 275273 gene locus_tag LOCUS_05070 273966 275273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 278370 275362 gene locus_tag LOCUS_05080 gene gcvP 278370 275362 CDS product glycine dehydrogenase (decarboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP12 protein_id gnl|my_center|LOCUS_05080 278752 279372 gene locus_tag LOCUS_05090 gene sigG 278752 279372 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_05090 279496 280077 gene locus_tag LOCUS_05100 279496 280077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 280248 280388 gene locus_tag LOCUS_05110 280248 280388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 280735 282537 gene locus_tag LOCUS_05120 280735 282537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 282534 282995 gene locus_tag LOCUS_05130 282534 282995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 283319 283080 gene locus_tag LOCUS_05140 283319 283080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 284305 283637 gene locus_tag LOCUS_05150 284305 283637 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_05150 284633 287035 gene locus_tag LOCUS_05160 284633 287035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_05160 287153 288760 gene locus_tag LOCUS_05170 287153 288760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 288773 289552 gene locus_tag LOCUS_05180 gene deoC 288773 289552 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ1 protein_id gnl|my_center|LOCUS_05180 290863 289604 gene locus_tag LOCUS_05190 290863 289604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 291887 291237 gene locus_tag LOCUS_05200 gene folE 291887 291237 CDS product GTP cyclohydrolase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB8 protein_id gnl|my_center|LOCUS_05200 292089 291865 gene locus_tag LOCUS_05210 292089 291865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 294058 292271 gene locus_tag LOCUS_05220 gene putP 294058 292271 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 protein_id gnl|my_center|LOCUS_05220 294197 294763 gene locus_tag LOCUS_05230 294197 294763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 295263 296345 gene locus_tag LOCUS_05240 295263 296345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence03 129 578 gene locus_tag LOCUS_05250 129 578 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082236.1 protein_id gnl|my_center|LOCUS_05250 897 2186 gene locus_tag LOCUS_05260 gene eno 897 2186 CDS product enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL40 protein_id gnl|my_center|LOCUS_05260 2304 2597 gene locus_tag LOCUS_05270 2304 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2594 3100 gene locus_tag LOCUS_05280 2594 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3926 3090 gene locus_tag LOCUS_05290 3926 3090 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056833.1 protein_id gnl|my_center|LOCUS_05290 5962 4028 gene locus_tag LOCUS_05300 gene ycf45 5962 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_05300 7487 6384 gene locus_tag LOCUS_05310 7487 6384 CDS product 4Fe-4S ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_05310 9758 7524 gene locus_tag LOCUS_05320 9758 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 10583 10002 gene locus_tag LOCUS_05330 10583 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 12530 10728 gene locus_tag LOCUS_05340 12530 10728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13578 12685 gene locus_tag LOCUS_05350 13578 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 14477 13584 gene locus_tag LOCUS_05360 14477 13584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 15624 14842 gene locus_tag LOCUS_05370 gene thf1 15624 14842 CDS product protein Thf1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJT8 protein_id gnl|my_center|LOCUS_05370 16364 15810 gene locus_tag LOCUS_05380 16364 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 16599 17096 gene locus_tag LOCUS_05390 16599 17096 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_05390 18151 17117 gene locus_tag LOCUS_05400 gene cobD 18151 17117 CDS product cobalamin biosynthesis protein CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE1 protein_id gnl|my_center|LOCUS_05400 19651 18182 gene locus_tag LOCUS_05410 gene tldD 19651 18182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_05410 19768 20457 gene locus_tag LOCUS_05420 19768 20457 CDS product fibrillin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_05420 22266 20473 gene locus_tag LOCUS_05430 22266 20473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 23954 22266 gene locus_tag LOCUS_05440 23954 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 25275 23965 gene locus_tag LOCUS_05450 25275 23965 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230408.1 protein_id gnl|my_center|LOCUS_05450 27041 25533 gene locus_tag LOCUS_05460 27041 25533 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_05460 27776 27189 gene locus_tag LOCUS_05470 27776 27189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_05470 30139 28052 gene locus_tag LOCUS_05480 gene fusA2 30139 28052 CDS product elongation factor G 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87M30 protein_id gnl|my_center|LOCUS_05480 31373 30477 gene locus_tag LOCUS_05490 gene ubiA 31373 30477 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFU6 protein_id gnl|my_center|LOCUS_05490 31700 31449 gene locus_tag LOCUS_05500 gene purS 31700 31449 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNG9 protein_id gnl|my_center|LOCUS_05500 31928 32401 gene locus_tag LOCUS_05510 31928 32401 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_05510 32535 32747 gene locus_tag LOCUS_05520 gene cspG 32535 32747 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423776.1 protein_id gnl|my_center|LOCUS_05520 33415 33131 gene locus_tag LOCUS_05530 33415 33131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 34838 34113 gene locus_tag LOCUS_05540 34838 34113 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_05540 35374 34859 gene locus_tag LOCUS_05550 35374 34859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 37045 36443 gene locus_tag LOCUS_05560 37045 36443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 37240 37049 gene locus_tag LOCUS_05570 37240 37049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 38765 37596 gene locus_tag LOCUS_05580 gene carA 38765 37596 CDS product carbamoyl-phosphate synthase small chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU5 protein_id gnl|my_center|LOCUS_05580 39332 39144 gene locus_tag LOCUS_05590 39332 39144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 39433 40350 gene locus_tag LOCUS_05600 39433 40350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 40660 42024 gene locus_tag LOCUS_05610 40660 42024 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_05610 42860 42051 gene locus_tag LOCUS_05620 42860 42051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 43056 43595 gene locus_tag LOCUS_05630 43056 43595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 43701 44627 gene locus_tag LOCUS_05640 43701 44627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 44727 44654 gene locus_tag LOCUS_t00080 44727 44654 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 45005 46357 gene locus_tag LOCUS_05650 45005 46357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227755.1 protein_id gnl|my_center|LOCUS_05650 46361 47890 gene locus_tag LOCUS_05660 46361 47890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 47996 49096 gene locus_tag LOCUS_05670 47996 49096 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227757.1 protein_id gnl|my_center|LOCUS_05670 49109 51439 gene locus_tag LOCUS_05680 49109 51439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029876.1 protein_id gnl|my_center|LOCUS_05680 51436 52626 gene locus_tag LOCUS_05690 51436 52626 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536536.1 protein_id gnl|my_center|LOCUS_05690 53077 52664 gene locus_tag LOCUS_05700 53077 52664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05700 53447 53067 gene locus_tag LOCUS_05710 53447 53067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05710 53745 53608 gene locus_tag LOCUS_05720 53745 53608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 54500 53916 gene locus_tag LOCUS_05730 54500 53916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 54772 55857 gene locus_tag LOCUS_05740 54772 55857 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_05740 55958 56740 gene locus_tag LOCUS_05750 gene ccdA 55958 56740 CDS product cytochrome C biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_05750 56904 58346 gene locus_tag LOCUS_05760 gene ccsB 56904 58346 CDS product cytochrome c biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL16 protein_id gnl|my_center|LOCUS_05760 59931 58318 gene locus_tag LOCUS_05770 59931 58318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 60300 61691 gene locus_tag LOCUS_05780 60300 61691 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057131.1 protein_id gnl|my_center|LOCUS_05780 61860 63479 gene locus_tag LOCUS_05790 61860 63479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 63577 64110 gene locus_tag LOCUS_05800 63577 64110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 64452 64216 gene locus_tag LOCUS_05810 64452 64216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 64358 64843 gene locus_tag LOCUS_05820 64358 64843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 64958 66604 gene locus_tag LOCUS_05830 gene ppx 64958 66604 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_05830 66890 67972 gene locus_tag LOCUS_05840 66890 67972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 69125 68052 gene locus_tag LOCUS_05850 gene rfbA 69125 68052 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_05850 70074 69196 gene locus_tag LOCUS_05860 gene rfbD 70074 69196 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143224.1 protein_id gnl|my_center|LOCUS_05860 70685 70128 gene locus_tag LOCUS_05870 gene rfbC-2 70685 70128 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_05870 72333 70834 gene locus_tag LOCUS_05880 72333 70834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 75602 72474 gene locus_tag LOCUS_05890 75602 72474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 76780 75884 gene locus_tag LOCUS_05900 76780 75884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 77831 76944 gene locus_tag LOCUS_05910 77831 76944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_05910 78346 77942 gene locus_tag LOCUS_05920 78346 77942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 78884 79384 gene locus_tag LOCUS_05930 78884 79384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 79890 79369 gene locus_tag LOCUS_05940 79890 79369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 81585 80050 gene locus_tag LOCUS_05950 gene kaiC 81585 80050 CDS product circadian clock protein kinase KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V60 protein_id gnl|my_center|LOCUS_05950 82463 82143 gene locus_tag LOCUS_05960 gene kaiB 82463 82143 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V61 protein_id gnl|my_center|LOCUS_05960 82664 82909 gene locus_tag LOCUS_05970 82664 82909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 83819 82890 gene locus_tag LOCUS_05980 gene kaiA 83819 82890 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q79V62 protein_id gnl|my_center|LOCUS_05980 84221 84148 gene locus_tag LOCUS_t00090 84221 84148 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 84737 84333 gene locus_tag LOCUS_05990 84737 84333 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_05990 84889 85569 gene locus_tag LOCUS_06000 84889 85569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 85685 86140 gene locus_tag LOCUS_06010 85685 86140 CDS product polyketide cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_06010 86269 87486 gene locus_tag LOCUS_06020 gene tyrS 86269 87486 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR1 protein_id gnl|my_center|LOCUS_06020 87583 87927 gene locus_tag LOCUS_06030 87583 87927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 87939 88364 gene locus_tag LOCUS_06040 87939 88364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 91655 88440 gene locus_tag LOCUS_06050 91655 88440 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_06050 92810 91665 gene locus_tag LOCUS_06060 92810 91665 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056368.1 protein_id gnl|my_center|LOCUS_06060 93053 93787 gene locus_tag LOCUS_06070 gene pyrF 93053 93787 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT3 protein_id gnl|my_center|LOCUS_06070 93919 94746 gene locus_tag LOCUS_06080 gene desC1 93919 94746 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_06080 96737 95013 gene locus_tag LOCUS_06090 gene sdhA 96737 95013 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_06090 97540 96884 gene locus_tag LOCUS_06100 gene hisI 97540 96884 CDS product histidine biosynthesis bifunctional protein HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM88 protein_id gnl|my_center|LOCUS_06100 98763 97618 gene locus_tag LOCUS_06110 98763 97618 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_06110 99337 99894 gene locus_tag LOCUS_06120 gene efp 99337 99894 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD3 protein_id gnl|my_center|LOCUS_06120 99941 100495 gene locus_tag LOCUS_06130 gene accB 99941 100495 CDS product acetyl-CoA carboxylase, biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057135.1 protein_id gnl|my_center|LOCUS_06130 101427 100492 gene locus_tag LOCUS_06140 101427 100492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056124.1 protein_id gnl|my_center|LOCUS_06140 101554 102186 gene locus_tag LOCUS_06150 101554 102186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056125.1 protein_id gnl|my_center|LOCUS_06150 102278 103252 gene locus_tag LOCUS_06160 102278 103252 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_06160 103323 104438 gene locus_tag LOCUS_06170 103323 104438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 104995 104435 gene locus_tag LOCUS_06180 104995 104435 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_06180 105129 106019 gene locus_tag LOCUS_06190 105129 106019 CDS product inward rectifier potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_06190 106915 106016 gene locus_tag LOCUS_06200 106915 106016 CDS product ribosome biogenesis GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS4 protein_id gnl|my_center|LOCUS_06200 108475 107030 gene locus_tag LOCUS_06210 gene pcxA 108475 107030 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59112 protein_id gnl|my_center|LOCUS_06210 108629 110965 gene locus_tag LOCUS_06220 108629 110965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056596.1 protein_id gnl|my_center|LOCUS_06220 111530 111030 gene locus_tag LOCUS_06230 111530 111030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 112097 111558 gene locus_tag LOCUS_06240 112097 111558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 112782 112306 gene locus_tag LOCUS_06250 112782 112306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 113240 112896 gene locus_tag LOCUS_06260 113240 112896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 113802 113428 gene locus_tag LOCUS_06270 113802 113428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 114323 113934 gene locus_tag LOCUS_06280 114323 113934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056929.1 protein_id gnl|my_center|LOCUS_06280 114484 115752 gene locus_tag LOCUS_06290 gene xseA 114484 115752 CDS product exodeoxyribonuclease 7 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RIB5 protein_id gnl|my_center|LOCUS_06290 116425 115754 gene locus_tag LOCUS_06300 116425 115754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 protein_id gnl|my_center|LOCUS_06300 116797 116465 gene locus_tag LOCUS_06310 116797 116465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 119165 116805 gene locus_tag LOCUS_06320 119165 116805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 119368 119174 gene locus_tag LOCUS_06330 119368 119174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 119441 120715 gene locus_tag LOCUS_06340 119441 120715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 123807 120721 gene locus_tag LOCUS_06350 123807 120721 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_06350 124394 123894 gene locus_tag LOCUS_06360 124394 123894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 124653 126446 gene locus_tag LOCUS_06370 124653 126446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 127693 126443 gene locus_tag LOCUS_06380 127693 126443 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_06380 129035 129598 gene locus_tag LOCUS_06390 gene psbP 129035 129598 CDS product photosystem II oxygen-evolving complex 23K protein PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_06390 129654 130361 gene locus_tag LOCUS_06400 129654 130361 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC5 protein_id gnl|my_center|LOCUS_06400 130487 132094 gene locus_tag LOCUS_06410 130487 132094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 132305 133141 gene locus_tag LOCUS_06420 gene prmA 132305 133141 CDS product ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM00 protein_id gnl|my_center|LOCUS_06420 133405 133190 gene locus_tag LOCUS_06430 133405 133190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 133846 134667 gene locus_tag LOCUS_06440 133846 134667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_06440 135527 134691 gene locus_tag LOCUS_06450 135527 134691 CDS product 3-hydroxy acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692220.1 protein_id gnl|my_center|LOCUS_06450 136544 135663 gene locus_tag LOCUS_06460 136544 135663 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141692.1 protein_id gnl|my_center|LOCUS_06460 137313 136549 gene locus_tag LOCUS_06470 137313 136549 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_06470 138318 138620 gene locus_tag LOCUS_06480 138318 138620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 139053 138709 gene locus_tag LOCUS_06490 139053 138709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 139556 139245 gene locus_tag LOCUS_06500 139556 139245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_06500 141606 139801 gene locus_tag LOCUS_06510 141606 139801 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143414.1 protein_id gnl|my_center|LOCUS_06510 142058 142396 gene locus_tag LOCUS_06520 gene glnB 142058 142396 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_06520 143045 142590 gene locus_tag LOCUS_06530 143045 142590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 144318 143035 gene locus_tag LOCUS_06540 144318 143035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_06540 145372 144398 gene locus_tag LOCUS_06550 145372 144398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 146537 145362 gene locus_tag LOCUS_06560 146537 145362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 147017 147505 gene locus_tag LOCUS_06570 147017 147505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 147607 148992 gene locus_tag LOCUS_06580 147607 148992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 148989 149783 gene locus_tag LOCUS_06590 148989 149783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 151512 149830 gene locus_tag LOCUS_06600 gene ilvD 151512 149830 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK13 protein_id gnl|my_center|LOCUS_06600 152842 151790 gene locus_tag LOCUS_06610 152842 151790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 153302 153472 gene locus_tag LOCUS_06620 153302 153472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 153666 154535 gene locus_tag LOCUS_06630 153666 154535 CDS product photosystem reaction center subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056697.1 protein_id gnl|my_center|LOCUS_06630 155763 154675 gene locus_tag LOCUS_06640 155763 154675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_06640 157767 155815 gene locus_tag LOCUS_06650 157767 155815 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_06650 158281 157835 gene locus_tag LOCUS_06660 158281 157835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141871.1 protein_id gnl|my_center|LOCUS_06660 158507 158902 gene locus_tag LOCUS_06670 158507 158902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 161146 158966 gene locus_tag LOCUS_06680 161146 158966 CDS product transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056777.1 protein_id gnl|my_center|LOCUS_06680 161954 161340 gene locus_tag LOCUS_06690 gene ctuR 161954 161340 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124677.1 protein_id gnl|my_center|LOCUS_06690 162680 161967 gene locus_tag LOCUS_06700 162680 161967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_06700 163899 162787 gene locus_tag LOCUS_06710 gene hrcA 163899 162787 CDS product heat-inducible transcription repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU4 protein_id gnl|my_center|LOCUS_06710 164435 164905 gene locus_tag LOCUS_06720 164435 164905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 165198 164938 gene locus_tag LOCUS_06730 165198 164938 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_06730 165907 165272 gene locus_tag LOCUS_06740 165907 165272 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK86 protein_id gnl|my_center|LOCUS_06740 166603 166229 gene locus_tag LOCUS_06750 166603 166229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 167124 168869 gene locus_tag LOCUS_06760 167124 168869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 168944 170608 gene locus_tag LOCUS_06770 gene phnE 168944 170608 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707871.1 protein_id gnl|my_center|LOCUS_06770 170918 170694 gene locus_tag LOCUS_06780 170918 170694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144012.1 protein_id gnl|my_center|LOCUS_06780 171274 172734 gene locus_tag LOCUS_06790 171274 172734 CDS product dihydrolipoamide dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056712.1 protein_id gnl|my_center|LOCUS_06790 173331 174035 gene locus_tag LOCUS_06800 gene coaX 173331 174035 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS3 protein_id gnl|my_center|LOCUS_06800 174829 174239 gene locus_tag LOCUS_06810 174829 174239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 174828 175013 gene locus_tag LOCUS_06820 174828 175013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 175348 175917 gene locus_tag LOCUS_06830 175348 175917 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533494.1 protein_id gnl|my_center|LOCUS_06830 176130 177119 gene locus_tag LOCUS_06840 176130 177119 CDS product pyridine nucleotide-disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142928.1 protein_id gnl|my_center|LOCUS_06840 177838 177155 gene locus_tag LOCUS_06850 177838 177155 CDS product KHG-KDPG bifunctional aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_06850 178365 177835 gene locus_tag LOCUS_06860 178365 177835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 179225 178428 gene locus_tag LOCUS_06870 gene minD 179225 178428 CDS product site-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHE2 protein_id gnl|my_center|LOCUS_06870 179449 180375 gene locus_tag LOCUS_06880 179449 180375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_06880 180481 181983 gene locus_tag LOCUS_06890 180481 181983 CDS product DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_06890 182567 181992 gene locus_tag LOCUS_06900 182567 181992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142343.1 protein_id gnl|my_center|LOCUS_06900 183486 182605 gene locus_tag LOCUS_06910 183486 182605 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_06910 183536 184942 gene locus_tag LOCUS_06920 183536 184942 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJP5 protein_id gnl|my_center|LOCUS_06920 184972 185547 gene locus_tag LOCUS_06930 gene nadD 184972 185547 CDS product nicotinate-nicotinamide nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_06930 185529 186278 gene locus_tag LOCUS_06940 185529 186278 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_06940 186341 187339 gene locus_tag LOCUS_06950 186341 187339 CDS product delta(24)-sterol C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_06950 187367 188782 gene locus_tag LOCUS_06960 187367 188782 CDS product Na+-transporting ATP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056159.1 protein_id gnl|my_center|LOCUS_06960 190813 188801 gene locus_tag LOCUS_06970 190813 188801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 191102 192121 gene locus_tag LOCUS_06980 gene gapA 191102 192121 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8EJC9 protein_id gnl|my_center|LOCUS_06980 192209 193540 gene locus_tag LOCUS_06990 192209 193540 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880869.1 protein_id gnl|my_center|LOCUS_06990 197119 193568 gene locus_tag LOCUS_07000 197119 193568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 201027 197290 gene locus_tag LOCUS_07010 201027 197290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 201719 202249 gene locus_tag LOCUS_07020 201719 202249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 202279 203484 gene locus_tag LOCUS_07030 202279 203484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 204759 203689 gene locus_tag LOCUS_07040 gene idiA 204759 203689 CDS product iron deficiency-induced protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH9 protein_id gnl|my_center|LOCUS_07040 205106 206164 gene locus_tag LOCUS_07050 gene prfB 205106 206164 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VE10 protein_id gnl|my_center|LOCUS_07050 206899 206228 gene locus_tag LOCUS_07060 206899 206228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_07060 207366 209378 gene locus_tag LOCUS_07070 207366 209378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 210633 209443 gene locus_tag LOCUS_07080 gene hisC 210633 209443 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM42 protein_id gnl|my_center|LOCUS_07080 211015 212688 gene locus_tag LOCUS_07090 211015 212688 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256685.1 protein_id gnl|my_center|LOCUS_07090 212811 214658 gene locus_tag LOCUS_07100 gene nadE 212811 214658 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_07100 219627 214756 gene locus_tag LOCUS_07110 219627 214756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 220327 219659 gene locus_tag LOCUS_07120 220327 219659 CDS product carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142007.1 protein_id gnl|my_center|LOCUS_07120 220686 220919 gene locus_tag LOCUS_07130 220686 220919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 221354 220968 gene locus_tag LOCUS_07140 gene gcvH 221354 220968 CDS product glycine cleavage system H protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H1F8 protein_id gnl|my_center|LOCUS_07140 222769 221444 gene locus_tag LOCUS_07150 gene rimO 222769 221444 CDS product ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL8 protein_id gnl|my_center|LOCUS_07150 222853 223602 gene locus_tag LOCUS_07160 222853 223602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142667.1 protein_id gnl|my_center|LOCUS_07160 223684 225210 gene locus_tag LOCUS_07170 gene murE 223684 225210 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI4 protein_id gnl|my_center|LOCUS_07170 225264 226220 gene locus_tag LOCUS_07180 gene rnz 225264 226220 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKE4 protein_id gnl|my_center|LOCUS_07180 226820 226224 gene locus_tag LOCUS_07190 gene cpcT 226820 226224 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH04 protein_id gnl|my_center|LOCUS_07190 228141 226855 gene locus_tag LOCUS_07200 gene serS 228141 226855 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN0 protein_id gnl|my_center|LOCUS_07200 228879 229232 gene locus_tag LOCUS_07210 228879 229232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 229284 229850 gene locus_tag LOCUS_07220 229284 229850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_07220 230663 229869 gene locus_tag LOCUS_07230 230663 229869 CDS product creatininase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_07230 231078 230671 gene locus_tag LOCUS_07240 231078 230671 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_07240 231462 232661 gene locus_tag LOCUS_07250 231462 232661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_07250 232968 232798 gene locus_tag LOCUS_07260 232968 232798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 233159 234280 gene locus_tag LOCUS_07270 gene ccsA 233159 234280 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH3 protein_id gnl|my_center|LOCUS_07270 234309 235349 gene locus_tag LOCUS_07280 gene tilS 234309 235349 CDS product tRNA(Ile)-lysidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIH2 protein_id gnl|my_center|LOCUS_07280 235775 236755 gene locus_tag LOCUS_07290 gene ycf39 235775 236755 CDS product 3-beta hydroxysteroid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_07290 236879 236712 gene locus_tag LOCUS_07300 236879 236712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 236908 237834 gene locus_tag LOCUS_07310 gene nadK1 236908 237834 CDS product NAD kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK1 protein_id gnl|my_center|LOCUS_07310 237986 238282 gene locus_tag LOCUS_07320 237986 238282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_07320 238648 240141 gene locus_tag LOCUS_07330 238648 240141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_07330 240302 240937 gene locus_tag LOCUS_07340 240302 240937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 241059 241763 gene locus_tag LOCUS_07350 241059 241763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 242704 241760 gene locus_tag LOCUS_07360 242704 241760 CDS product isoaspartyl peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_07360 242869 243090 gene locus_tag LOCUS_07370 242869 243090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence04 1599 163 gene locus_tag LOCUS_07380 1599 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 1860 3239 gene locus_tag LOCUS_07390 1860 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 3307 3918 gene locus_tag LOCUS_07400 gene pyrE 3307 3918 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW5 protein_id gnl|my_center|LOCUS_07400 3981 4730 gene locus_tag LOCUS_07410 gene fabG 3981 4730 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_07410 5083 5556 gene locus_tag LOCUS_07420 5083 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 5750 5896 gene locus_tag LOCUS_07430 5750 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 9121 7328 gene locus_tag LOCUS_07440 9121 7328 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_07440 9839 9687 gene locus_tag LOCUS_07450 9839 9687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 12725 9861 gene locus_tag LOCUS_07460 12725 9861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 13256 14680 gene locus_tag LOCUS_07470 13256 14680 CDS product two-component sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058184.1 protein_id gnl|my_center|LOCUS_07470 14851 16464 gene locus_tag LOCUS_07480 14851 16464 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ1 protein_id gnl|my_center|LOCUS_07480 16614 17327 gene locus_tag LOCUS_07490 16614 17327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 17418 17885 gene locus_tag LOCUS_07500 17418 17885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143379.1 protein_id gnl|my_center|LOCUS_07500 18074 18328 gene locus_tag LOCUS_07510 18074 18328 CDS product TIGR03643 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964138.1 protein_id gnl|my_center|LOCUS_07510 18462 19007 gene locus_tag LOCUS_07520 18462 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 20621 19035 gene locus_tag LOCUS_07530 gene nnr 20621 19035 CDS product bifunctional NAD(P)H-hydrate repair enzyme Nnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC3 protein_id gnl|my_center|LOCUS_07530 21534 20695 gene locus_tag LOCUS_07540 21534 20695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_07540 21626 22036 gene locus_tag LOCUS_07550 21626 22036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 23183 22059 gene locus_tag LOCUS_07560 23183 22059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 24286 23366 gene locus_tag LOCUS_07570 24286 23366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 25945 24443 gene locus_tag LOCUS_07580 25945 24443 CDS product alginate O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946526.1 protein_id gnl|my_center|LOCUS_07580 27080 27493 gene locus_tag LOCUS_07590 27080 27493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 28364 27567 gene locus_tag LOCUS_07600 28364 27567 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058216.1 protein_id gnl|my_center|LOCUS_07600 28438 28896 gene locus_tag LOCUS_07610 28438 28896 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_07610 29058 30449 gene locus_tag LOCUS_07620 29058 30449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 30666 30505 gene locus_tag LOCUS_07630 30666 30505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 32022 30682 gene locus_tag LOCUS_07640 32022 30682 CDS product modulator of DNA gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056923.1 protein_id gnl|my_center|LOCUS_07640 32196 33791 gene locus_tag LOCUS_07650 32196 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836808.1 protein_id gnl|my_center|LOCUS_07650 34417 33800 gene locus_tag LOCUS_07660 34417 33800 CDS product serine esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_07660 34521 36092 gene locus_tag LOCUS_07670 gene purH 34521 36092 CDS product bifunctional purine biosynthesis protein PurH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN5 protein_id gnl|my_center|LOCUS_07670 37477 36101 gene locus_tag LOCUS_07680 37477 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 39171 37555 gene locus_tag LOCUS_07690 39171 37555 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_07690 39425 39937 gene locus_tag LOCUS_07700 gene ppiB 39425 39937 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8F376 protein_id gnl|my_center|LOCUS_07700 40762 40448 gene locus_tag LOCUS_07710 40762 40448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 41999 40920 gene locus_tag LOCUS_07720 41999 40920 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_07720 42349 43452 gene locus_tag LOCUS_07730 gene aroB 42349 43452 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKS3 protein_id gnl|my_center|LOCUS_07730 45322 43445 gene locus_tag LOCUS_07740 45322 43445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 45520 46494 gene locus_tag LOCUS_07750 gene nadA 45520 46494 CDS product quinolinate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP65 protein_id gnl|my_center|LOCUS_07750 47151 46618 gene locus_tag LOCUS_07760 47151 46618 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_07760 48343 47330 gene locus_tag LOCUS_07770 48343 47330 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057413.1 protein_id gnl|my_center|LOCUS_07770 49434 48343 gene locus_tag LOCUS_07780 gene pyrB 49434 48343 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM4 protein_id gnl|my_center|LOCUS_07780 49652 50338 gene locus_tag LOCUS_07790 49652 50338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 52489 50429 gene locus_tag LOCUS_07800 gene rnj 52489 50429 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK3 protein_id gnl|my_center|LOCUS_07800 54132 53248 gene locus_tag LOCUS_07810 gene dapA 54132 53248 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJK4 protein_id gnl|my_center|LOCUS_07810 55342 54293 gene locus_tag LOCUS_07820 gene asd 55342 54293 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP2 protein_id gnl|my_center|LOCUS_07820 57108 55411 gene locus_tag LOCUS_07830 57108 55411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 57260 58618 gene locus_tag LOCUS_07840 57260 58618 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056650.1 protein_id gnl|my_center|LOCUS_07840 60321 58663 gene locus_tag LOCUS_07850 60321 58663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 61259 62152 gene locus_tag LOCUS_07860 gene btpA 61259 62152 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_07860 62327 63262 gene locus_tag LOCUS_07870 62327 63262 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056436.1 protein_id gnl|my_center|LOCUS_07870 63851 65719 gene locus_tag LOCUS_07880 63851 65719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 65997 65785 gene locus_tag LOCUS_07890 65997 65785 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_07890 66924 66061 gene locus_tag LOCUS_07900 66924 66061 CDS product Mrr restriction system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546249.1 protein_id gnl|my_center|LOCUS_07900 67750 67103 gene locus_tag LOCUS_07910 67750 67103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 68478 67831 gene locus_tag LOCUS_07920 68478 67831 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705438.1 protein_id gnl|my_center|LOCUS_07920 69206 68625 gene locus_tag LOCUS_07930 69206 68625 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_07930 69440 71314 gene locus_tag LOCUS_07940 69440 71314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056770.1 protein_id gnl|my_center|LOCUS_07940 71782 71324 gene locus_tag LOCUS_07950 gene dtd 71782 71324 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q183H9 protein_id gnl|my_center|LOCUS_07950 72301 71819 gene locus_tag LOCUS_07960 72301 71819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056704.1 protein_id gnl|my_center|LOCUS_07960 72464 72985 gene locus_tag LOCUS_07970 72464 72985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 73486 73097 gene locus_tag LOCUS_07980 73486 73097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_07980 73607 74797 gene locus_tag LOCUS_07990 gene queA 73607 74797 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFD9 protein_id gnl|my_center|LOCUS_07990 75206 76243 gene locus_tag LOCUS_08000 75206 76243 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_08000 76353 77249 gene locus_tag LOCUS_08010 76353 77249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 77312 77935 gene locus_tag LOCUS_08020 77312 77935 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 protein_id gnl|my_center|LOCUS_08020 79596 78355 gene locus_tag LOCUS_08030 gene argJ 79596 78355 CDS product arginine biosynthesis bifunctional protein ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN4 protein_id gnl|my_center|LOCUS_08030 81605 80121 gene locus_tag LOCUS_08040 gene gatB 81605 80121 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC4 protein_id gnl|my_center|LOCUS_08040 83137 81941 gene locus_tag LOCUS_08050 83137 81941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 83332 83532 gene locus_tag LOCUS_08060 83332 83532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 84913 83939 gene locus_tag LOCUS_08070 84913 83939 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957074.1 protein_id gnl|my_center|LOCUS_08070 86303 86776 gene locus_tag LOCUS_08080 86303 86776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 87273 88628 gene locus_tag LOCUS_08090 87273 88628 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_08090 88744 90117 gene locus_tag LOCUS_08100 88744 90117 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_08100 91812 90175 gene locus_tag LOCUS_08110 91812 90175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 92627 94216 gene locus_tag LOCUS_08120 92627 94216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 94282 94479 gene locus_tag LOCUS_08130 94282 94479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 94535 95200 gene locus_tag LOCUS_08140 94535 95200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056484.1 protein_id gnl|my_center|LOCUS_08140 95479 96207 gene locus_tag LOCUS_08150 95479 96207 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144148.1 protein_id gnl|my_center|LOCUS_08150 96436 96362 gene locus_tag LOCUS_t00100 96436 96362 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 96706 97662 gene locus_tag LOCUS_08160 96706 97662 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI21 protein_id gnl|my_center|LOCUS_08160 97947 98219 gene locus_tag LOCUS_08170 97947 98219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 98216 99736 gene locus_tag LOCUS_08180 98216 99736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 99819 100442 gene locus_tag LOCUS_08190 gene rimM 99819 100442 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK05 protein_id gnl|my_center|LOCUS_08190 102887 100449 gene locus_tag LOCUS_08200 102887 100449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 103150 103938 gene locus_tag LOCUS_08210 103150 103938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_08210 104199 105350 gene locus_tag LOCUS_08220 104199 105350 CDS product geranylgeranyl bacteriochlorophyll reductase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058112.1 protein_id gnl|my_center|LOCUS_08220 106248 108038 gene locus_tag LOCUS_08230 106248 108038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 108937 108284 gene locus_tag LOCUS_08240 108937 108284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 109380 111092 gene locus_tag LOCUS_08250 109380 111092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 111111 112070 gene locus_tag LOCUS_08260 111111 112070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 112965 112084 gene locus_tag LOCUS_08270 112965 112084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 113604 115874 gene locus_tag LOCUS_08280 113604 115874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 117859 115856 gene locus_tag LOCUS_08290 117859 115856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 118015 118836 gene locus_tag LOCUS_08300 gene nei 118015 118836 CDS product endonuclease 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B7N9V3 protein_id gnl|my_center|LOCUS_08300 119085 119936 gene locus_tag LOCUS_08310 119085 119936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 120361 122373 gene locus_tag LOCUS_08320 120361 122373 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_08320 122602 123042 gene locus_tag LOCUS_08330 122602 123042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057140.1 protein_id gnl|my_center|LOCUS_08330 124458 123286 gene locus_tag LOCUS_08340 gene petH 124458 123286 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q93RE3 protein_id gnl|my_center|LOCUS_08340 125275 126276 gene locus_tag LOCUS_08350 gene prk 125275 126276 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHN2 protein_id gnl|my_center|LOCUS_08350 127356 126379 gene locus_tag LOCUS_08360 gene queG 127356 126379 CDS product epoxyqueuosine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA9 protein_id gnl|my_center|LOCUS_08360 128272 127346 gene locus_tag LOCUS_08370 128272 127346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 128695 128327 gene locus_tag LOCUS_08380 128695 128327 CDS product 7,8-dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV4 protein_id gnl|my_center|LOCUS_08380 129143 128760 gene locus_tag LOCUS_08390 129143 128760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 130497 129361 gene locus_tag LOCUS_08400 130497 129361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 131634 130564 gene locus_tag LOCUS_08410 131634 130564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 132550 131903 gene locus_tag LOCUS_08420 132550 131903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 133278 132595 gene locus_tag LOCUS_08430 133278 132595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_08430 133911 134441 gene locus_tag LOCUS_08440 gene ycf52 133911 134441 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_08440 134502 134575 gene locus_tag LOCUS_t00110 134502 134575 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 134795 134676 gene locus_tag LOCUS_08450 134795 134676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 135560 134889 gene locus_tag LOCUS_08460 135560 134889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 135697 136119 gene locus_tag LOCUS_08470 135697 136119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 137809 136289 gene locus_tag LOCUS_08480 137809 136289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 138295 139629 gene locus_tag LOCUS_08490 138295 139629 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_08490 139741 140100 gene locus_tag LOCUS_08500 139741 140100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 141944 140115 gene locus_tag LOCUS_08510 141944 140115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 142353 144491 gene locus_tag LOCUS_08520 142353 144491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 144611 144844 gene locus_tag LOCUS_08530 gene ycf40 144611 144844 CDS product thiamine biosynthesis protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_08530 145068 146060 gene locus_tag LOCUS_08540 145068 146060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 146526 146263 gene locus_tag LOCUS_08550 146526 146263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 147629 148954 gene locus_tag LOCUS_08560 gene bchN 147629 148954 CDS product light-independent protochlorophyllide reductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RWR8 protein_id gnl|my_center|LOCUS_08560 149015 150670 gene locus_tag LOCUS_08570 gene chlB 149015 150670 CDS product light-independent protochlorophyllide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD38 protein_id gnl|my_center|LOCUS_08570 150719 151621 gene locus_tag LOCUS_08580 gene chlL 150719 151621 CDS product light-independent protochlorophyllide reductase iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VD39 protein_id gnl|my_center|LOCUS_08580 151663 152094 gene locus_tag LOCUS_08590 151663 152094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 152548 153105 gene locus_tag LOCUS_08600 152548 153105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 153119 154192 gene locus_tag LOCUS_08610 153119 154192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 154246 155229 gene locus_tag LOCUS_08620 154246 155229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 155939 155235 gene locus_tag LOCUS_08630 155939 155235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 156165 157847 gene locus_tag LOCUS_08640 156165 157847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_08640 158067 159281 gene locus_tag LOCUS_08650 158067 159281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 159387 159890 gene locus_tag LOCUS_08660 gene ycf51 159387 159890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_08660 160151 160002 gene locus_tag LOCUS_08670 160151 160002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 160123 161322 gene locus_tag LOCUS_08680 gene gldA 160123 161322 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057886.1 protein_id gnl|my_center|LOCUS_08680 161319 162560 gene locus_tag LOCUS_08690 161319 162560 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_08690 162587 163456 gene locus_tag LOCUS_08700 162587 163456 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_08700 163727 166597 gene locus_tag LOCUS_08710 163727 166597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 166710 167732 gene locus_tag LOCUS_08720 166710 167732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 168015 169187 gene locus_tag LOCUS_08730 168015 169187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 169343 170407 gene locus_tag LOCUS_08740 169343 170407 CDS product two-component system sensor kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544542.1 protein_id gnl|my_center|LOCUS_08740 171186 170404 gene locus_tag LOCUS_08750 gene xthA 171186 170404 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124637.1 protein_id gnl|my_center|LOCUS_08750 171432 171208 gene locus_tag LOCUS_08760 gene ndhO 171432 171208 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFI1 protein_id gnl|my_center|LOCUS_08760 172449 171544 gene locus_tag LOCUS_08770 gene mutM 172449 171544 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59065 protein_id gnl|my_center|LOCUS_08770 172759 172574 gene locus_tag LOCUS_08780 gene psaE 172759 172574 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDK5 protein_id gnl|my_center|LOCUS_08780 173544 173023 gene locus_tag LOCUS_08790 173544 173023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 174622 173729 gene locus_tag LOCUS_08800 174622 173729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 175479 174691 gene locus_tag LOCUS_08810 gene sigF 175479 174691 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_08810 176748 175966 gene locus_tag LOCUS_08820 gene psbO 176748 175966 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A431 protein_id gnl|my_center|LOCUS_08820 177252 178460 gene locus_tag LOCUS_08830 177252 178460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 178677 179459 gene locus_tag LOCUS_08840 gene ycf53 178677 179459 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_08840 179530 181026 gene locus_tag LOCUS_08850 179530 181026 CDS product putative bicarbonate transporter, IctB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_08850 181038 181610 gene locus_tag LOCUS_08860 181038 181610 CDS product ribosomal-protein-alanine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q97FA0 protein_id gnl|my_center|LOCUS_08860 182194 182018 gene locus_tag LOCUS_08870 182194 182018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 182120 184621 gene locus_tag LOCUS_08880 gene clpC 182120 184621 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_08880 184884 186104 gene locus_tag LOCUS_08890 184884 186104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 186130 186894 gene locus_tag LOCUS_08900 186130 186894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_08900 187586 186969 gene locus_tag LOCUS_08910 gene coaE 187586 186969 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG1 protein_id gnl|my_center|LOCUS_08910 187909 188634 gene locus_tag LOCUS_08920 gene tpiA 187909 188634 CDS product triosephosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA0 protein_id gnl|my_center|LOCUS_08920 189073 189684 gene locus_tag LOCUS_08930 189073 189684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 189990 191258 gene locus_tag LOCUS_08940 189990 191258 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056420.1 protein_id gnl|my_center|LOCUS_08940 191468 191833 gene locus_tag LOCUS_08950 191468 191833 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence05 2612 2031 gene locus_tag LOCUS_08960 2612 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121865.1 protein_id gnl|my_center|LOCUS_08960 3298 2696 gene locus_tag LOCUS_08970 3298 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3497 4726 gene locus_tag LOCUS_08980 3497 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_08980 4908 5333 gene locus_tag LOCUS_08990 4908 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 9091 5330 gene locus_tag LOCUS_09000 gene smc 9091 5330 CDS product chromosome partition protein Smc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ZAK1 protein_id gnl|my_center|LOCUS_09000 9448 10557 gene locus_tag LOCUS_09010 9448 10557 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141839.1 protein_id gnl|my_center|LOCUS_09010 10871 11707 gene locus_tag LOCUS_09020 10871 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 11921 12904 gene locus_tag LOCUS_09030 gene hemC 11921 12904 CDS product porphobilinogen deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE4 protein_id gnl|my_center|LOCUS_09030 13446 13195 gene locus_tag LOCUS_09040 13446 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 14151 13480 gene locus_tag LOCUS_09050 14151 13480 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_09050 14446 15882 gene locus_tag LOCUS_09060 gene ycf24 14446 15882 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_09060 15972 16760 gene locus_tag LOCUS_09070 15972 16760 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_09070 16764 18176 gene locus_tag LOCUS_09080 16764 18176 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_09080 18228 19490 gene locus_tag LOCUS_09090 gene nifS 18228 19490 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH91 protein_id gnl|my_center|LOCUS_09090 19549 19803 gene locus_tag LOCUS_09100 19549 19803 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_09100 19915 20250 gene locus_tag LOCUS_09110 gene ycf64 19915 20250 CDS product glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKI5 protein_id gnl|my_center|LOCUS_09110 20355 20936 gene locus_tag LOCUS_09120 20355 20936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_09120 22231 20960 gene locus_tag LOCUS_09130 22231 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 22230 23192 gene locus_tag LOCUS_09140 22230 23192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 23209 24096 gene locus_tag LOCUS_09150 23209 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 24388 26226 gene locus_tag LOCUS_09160 gene ftsH 24388 26226 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI5 protein_id gnl|my_center|LOCUS_09160 27545 26358 gene locus_tag LOCUS_09170 gene bioF 27545 26358 CDS product putative 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ97 protein_id gnl|my_center|LOCUS_09170 29421 27643 gene locus_tag LOCUS_09180 29421 27643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 33457 29888 gene locus_tag LOCUS_09190 gene dnaE 33457 29888 CDS product DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEE6 protein_id gnl|my_center|LOCUS_09190 33568 34251 gene locus_tag LOCUS_09200 33568 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 35417 34248 gene locus_tag LOCUS_09210 35417 34248 CDS product succinyldiaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143457.1 protein_id gnl|my_center|LOCUS_09210 35489 35953 gene locus_tag LOCUS_09220 35489 35953 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963897.1 protein_id gnl|my_center|LOCUS_09220 36045 36527 gene locus_tag LOCUS_09230 36045 36527 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE37 protein_id gnl|my_center|LOCUS_09230 36724 37311 gene locus_tag LOCUS_09240 36724 37311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 37556 38023 gene locus_tag LOCUS_09250 37556 38023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 40909 38099 gene locus_tag LOCUS_09260 40909 38099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 41898 40990 gene locus_tag LOCUS_09270 41898 40990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 42546 44171 gene locus_tag LOCUS_09280 gene prfC 42546 44171 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV7 protein_id gnl|my_center|LOCUS_09280 44228 45259 gene locus_tag LOCUS_09290 44228 45259 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228623.1 protein_id gnl|my_center|LOCUS_09290 45528 46301 gene locus_tag LOCUS_09300 gene ycgL 45528 46301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P94389 protein_id gnl|my_center|LOCUS_09300 46365 46658 gene locus_tag LOCUS_09310 46365 46658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 47002 46682 gene locus_tag LOCUS_09320 47002 46682 CDS product divalent ion tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_09320 47075 47461 gene locus_tag LOCUS_09330 47075 47461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 48577 47462 gene locus_tag LOCUS_09340 48577 47462 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258191.1 protein_id gnl|my_center|LOCUS_09340 49713 48832 gene locus_tag LOCUS_09350 49713 48832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 50553 49840 gene locus_tag LOCUS_09360 50553 49840 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_09360 51244 50678 gene locus_tag LOCUS_09370 51244 50678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 51658 51359 gene locus_tag LOCUS_09380 51658 51359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 53715 52147 gene locus_tag LOCUS_09390 gene sbcD 53715 52147 CDS product nuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI2 protein_id gnl|my_center|LOCUS_09390 53844 54539 gene locus_tag LOCUS_09400 53844 54539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 54655 54581 gene locus_tag LOCUS_t00120 54655 54581 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 55433 54687 gene locus_tag LOCUS_09410 55433 54687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_09410 57055 55514 gene locus_tag LOCUS_09420 57055 55514 CDS product UPF0061 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIF6 protein_id gnl|my_center|LOCUS_09420 57082 57276 gene locus_tag LOCUS_09430 57082 57276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 57742 57290 gene locus_tag LOCUS_09440 57742 57290 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_09440 57899 58294 gene locus_tag LOCUS_09450 57899 58294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_09450 58697 59128 gene locus_tag LOCUS_09460 58697 59128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 59332 59502 gene locus_tag LOCUS_09470 59332 59502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_09470 60424 59624 gene locus_tag LOCUS_09480 60424 59624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119076.1 protein_id gnl|my_center|LOCUS_09480 61158 60484 gene locus_tag LOCUS_09490 61158 60484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_09490 61805 64408 gene locus_tag LOCUS_09500 61805 64408 CDS product alpha-1,4 glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLX1 protein_id gnl|my_center|LOCUS_09500 64652 66103 gene locus_tag LOCUS_09510 64652 66103 CDS product sodium:glutamate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056889.1 protein_id gnl|my_center|LOCUS_09510 67869 66121 gene locus_tag LOCUS_09520 67869 66121 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144121.1 protein_id gnl|my_center|LOCUS_09520 70138 68633 gene locus_tag LOCUS_09530 70138 68633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 72481 70370 gene locus_tag LOCUS_09540 72481 70370 CDS product phytoene dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141921.1 protein_id gnl|my_center|LOCUS_09540 72873 74207 gene locus_tag LOCUS_09550 72873 74207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 74357 74605 gene locus_tag LOCUS_09560 74357 74605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 75592 74591 gene locus_tag LOCUS_09570 75592 74591 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057872.1 protein_id gnl|my_center|LOCUS_09570 75742 77487 gene locus_tag LOCUS_09580 75742 77487 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_09580 78210 77566 gene locus_tag LOCUS_09590 78210 77566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 79309 78761 gene locus_tag LOCUS_09600 79309 78761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055932.1 protein_id gnl|my_center|LOCUS_09600 79982 79314 gene locus_tag LOCUS_09610 79982 79314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 81220 80039 gene locus_tag LOCUS_09620 gene yidC 81220 80039 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL96 protein_id gnl|my_center|LOCUS_09620 81818 81489 gene locus_tag LOCUS_09630 gene clpS 81818 81489 CDS product ATP-dependent Clp protease adapter protein ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJY3 protein_id gnl|my_center|LOCUS_09630 82035 83087 gene locus_tag LOCUS_09640 82035 83087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 83338 84423 gene locus_tag LOCUS_09650 83338 84423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 84434 85498 gene locus_tag LOCUS_09660 84434 85498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 85523 86554 gene locus_tag LOCUS_09670 85523 86554 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_09670 86615 87667 gene locus_tag LOCUS_09680 86615 87667 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_09680 88235 91822 gene locus_tag LOCUS_09690 88235 91822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 92063 92479 gene locus_tag LOCUS_09700 92063 92479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 93663 92668 gene locus_tag LOCUS_09710 93663 92668 CDS product cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768541.1 protein_id gnl|my_center|LOCUS_09710 94943 93741 gene locus_tag LOCUS_09720 94943 93741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 95792 94956 gene locus_tag LOCUS_09730 95792 94956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 98662 95921 gene locus_tag LOCUS_09740 gene arnT 98662 95921 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124217.1 protein_id gnl|my_center|LOCUS_09740 99507 98683 gene locus_tag LOCUS_09750 99507 98683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 100897 99551 gene locus_tag LOCUS_09760 100897 99551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 101560 101111 gene locus_tag LOCUS_09770 101560 101111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056323.1 protein_id gnl|my_center|LOCUS_09770 101995 101720 gene locus_tag LOCUS_09780 101995 101720 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142059.1 protein_id gnl|my_center|LOCUS_09780 103526 102171 gene locus_tag LOCUS_09790 gene thrC 103526 102171 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_09790 104119 104874 gene locus_tag LOCUS_09800 104119 104874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 105048 108101 gene locus_tag LOCUS_09810 105048 108101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 108512 109948 gene locus_tag LOCUS_09820 108512 109948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 110049 110426 gene locus_tag LOCUS_09830 110049 110426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_09830 111061 110546 gene locus_tag LOCUS_09840 111061 110546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 112357 111125 gene locus_tag LOCUS_09850 112357 111125 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC5 protein_id gnl|my_center|LOCUS_09850 113518 112766 gene locus_tag LOCUS_09860 113518 112766 CDS product teichoic acid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056307.1 protein_id gnl|my_center|LOCUS_09860 114068 113793 gene locus_tag LOCUS_09870 114068 113793 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058100.1 protein_id gnl|my_center|LOCUS_09870 115073 114447 gene locus_tag LOCUS_09880 gene hisB 115073 114447 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI3 protein_id gnl|my_center|LOCUS_09880 115451 115642 gene locus_tag LOCUS_09890 115451 115642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 116899 115748 gene locus_tag LOCUS_09900 116899 115748 CDS product class V aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_09900 117394 117999 gene locus_tag LOCUS_09910 117394 117999 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_09910 118090 119478 gene locus_tag LOCUS_09920 gene cbiA 118090 119478 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q748J6 protein_id gnl|my_center|LOCUS_09920 119471 120199 gene locus_tag LOCUS_09930 119471 120199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 120451 120915 gene locus_tag LOCUS_09940 120451 120915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 122051 121056 gene locus_tag LOCUS_09950 gene petA 122051 121056 CDS product cytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N5 protein_id gnl|my_center|LOCUS_09950 122717 122178 gene locus_tag LOCUS_09960 gene petC 122717 122178 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8N8 protein_id gnl|my_center|LOCUS_09960 123053 123385 gene locus_tag LOCUS_09970 123053 123385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_09970 124060 123401 gene locus_tag LOCUS_09980 124060 123401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 124873 124103 gene locus_tag LOCUS_09990 124873 124103 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388609.1 protein_id gnl|my_center|LOCUS_09990 125389 124916 gene locus_tag LOCUS_10000 gene smpB 125389 124916 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHM0 protein_id gnl|my_center|LOCUS_10000 125908 126090 gene locus_tag LOCUS_10010 125908 126090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 127554 126241 gene locus_tag LOCUS_10020 127554 126241 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM4 protein_id gnl|my_center|LOCUS_10020 127598 129211 gene locus_tag LOCUS_10030 gene ndhB 127598 129211 CDS product NAD(P)H-quinone oxidoreductase subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR6 protein_id gnl|my_center|LOCUS_10030 129354 129130 gene locus_tag LOCUS_10040 129354 129130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 130052 129483 gene locus_tag LOCUS_10050 130052 129483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 130300 130040 gene locus_tag LOCUS_10060 130300 130040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 131689 130496 gene locus_tag LOCUS_10070 131689 130496 CDS product nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144027.1 protein_id gnl|my_center|LOCUS_10070 132974 131772 gene locus_tag LOCUS_10080 132974 131772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_10080 133922 133089 gene locus_tag LOCUS_10090 133922 133089 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144100.1 protein_id gnl|my_center|LOCUS_10090 134377 135657 gene locus_tag LOCUS_10100 134377 135657 CDS product putative gluconeogenesis factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ8 protein_id gnl|my_center|LOCUS_10100 135677 136681 gene locus_tag LOCUS_10110 gene msrP 135677 136681 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3EIM2 protein_id gnl|my_center|LOCUS_10110 136931 138376 gene locus_tag LOCUS_10120 136931 138376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 139356 138439 gene locus_tag LOCUS_10130 139356 138439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_10130 139793 139524 gene locus_tag LOCUS_10140 139793 139524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 140571 139891 gene locus_tag LOCUS_10150 140571 139891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 141332 141646 gene locus_tag LOCUS_10160 141332 141646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 141837 142658 gene locus_tag LOCUS_10170 141837 142658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 142664 143452 gene locus_tag LOCUS_10180 142664 143452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 143640 146651 gene locus_tag LOCUS_10190 143640 146651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 146732 147640 gene locus_tag LOCUS_10200 146732 147640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_10200 148097 147822 gene locus_tag LOCUS_10210 148097 147822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 148262 149689 gene locus_tag LOCUS_10220 148262 149689 CDS product putative RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKB7 protein_id gnl|my_center|LOCUS_10220 149650 149865 gene locus_tag LOCUS_10230 149650 149865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 149852 150328 gene locus_tag LOCUS_10240 149852 150328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 151498 150554 gene locus_tag LOCUS_10250 151498 150554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_10250 152807 151554 gene locus_tag LOCUS_10260 152807 151554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697701.1 protein_id gnl|my_center|LOCUS_10260 153247 154755 gene locus_tag LOCUS_10270 153247 154755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 155167 154691 gene locus_tag LOCUS_10280 155167 154691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_10280 155722 158868 gene locus_tag LOCUS_10290 155722 158868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 158961 161876 gene locus_tag LOCUS_10300 158961 161876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 162017 163894 gene locus_tag LOCUS_10310 162017 163894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 164395 166887 gene locus_tag LOCUS_10320 gene clpC 164395 166887 CDS product ATP-dependent Clp protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_10320 167012 168166 gene locus_tag LOCUS_10330 167012 168166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 168394 170517 gene locus_tag LOCUS_10340 168394 170517 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_10340 171254 170562 gene locus_tag LOCUS_10350 gene purQ 171254 170562 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL01 protein_id gnl|my_center|LOCUS_10350 171777 171355 gene locus_tag LOCUS_10360 171777 171355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 172478 171936 gene locus_tag LOCUS_10370 172478 171936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 173357 172605 gene locus_tag LOCUS_10380 173357 172605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_10380 173582 174469 gene locus_tag LOCUS_10390 173582 174469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 175280 174555 gene locus_tag LOCUS_10400 175280 174555 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058197.1 protein_id gnl|my_center|LOCUS_10400 175746 177296 gene locus_tag LOCUS_10410 gene nirA 175746 177296 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_10410 178794 177346 gene locus_tag LOCUS_10420 178794 177346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 179668 178811 gene locus_tag LOCUS_10430 gene cobA 179668 178811 CDS product uroporphyrin-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142574.1 protein_id gnl|my_center|LOCUS_10430 180179 181327 gene locus_tag LOCUS_10440 180179 181327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 181469 182686 gene locus_tag LOCUS_10450 gene bme6 181469 182686 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974187.1 protein_id gnl|my_center|LOCUS_10450 182775 183770 gene locus_tag LOCUS_10460 182775 183770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 183847 184629 gene locus_tag LOCUS_10470 183847 184629 CDS product putative transcriptional regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DME3 protein_id gnl|my_center|LOCUS_10470 184701 186377 gene locus_tag LOCUS_10480 184701 186377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_10480 187236 186619 gene locus_tag LOCUS_10490 187236 186619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence06 1252 2172 gene locus_tag LOCUS_10500 1252 2172 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_10500 2690 2184 gene locus_tag LOCUS_10510 gene ycf52 2690 2184 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140110.1 protein_id gnl|my_center|LOCUS_10510 3895 2993 gene locus_tag LOCUS_10520 3895 2993 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968506.1 protein_id gnl|my_center|LOCUS_10520 5404 3992 gene locus_tag LOCUS_10530 5404 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5820 6311 gene locus_tag LOCUS_10540 5820 6311 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_10540 6301 8787 gene locus_tag LOCUS_10550 gene recJ 6301 8787 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_10550 9354 8818 gene locus_tag LOCUS_10560 9354 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 10064 9360 gene locus_tag LOCUS_10570 10064 9360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 10597 10962 gene locus_tag LOCUS_10580 gene rplU 10597 10962 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMF1 protein_id gnl|my_center|LOCUS_10580 11139 11408 gene locus_tag LOCUS_10590 gene rpmA 11139 11408 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NME2 protein_id gnl|my_center|LOCUS_10590 11693 13204 gene locus_tag LOCUS_10600 11693 13204 CDS product menaquinone-specific isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_10600 13562 13894 gene locus_tag LOCUS_10610 13562 13894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 14162 14386 gene locus_tag LOCUS_10620 14162 14386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 14590 16164 gene locus_tag LOCUS_10630 gene panC/cmk 14590 16164 CDS product bifunctional pantoate ligase/cytidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG73 protein_id gnl|my_center|LOCUS_10630 16542 17924 gene locus_tag LOCUS_10640 16542 17924 CDS product regulator of sigma-B activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_10640 18453 17953 gene locus_tag LOCUS_10650 18453 17953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 18431 18727 gene locus_tag LOCUS_10660 18431 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 19421 19167 gene locus_tag LOCUS_10670 19421 19167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 20208 20846 gene locus_tag LOCUS_10680 20208 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 21062 21739 gene locus_tag LOCUS_10690 21062 21739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 23180 21747 gene locus_tag LOCUS_10700 23180 21747 CDS product lysine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143476.1 protein_id gnl|my_center|LOCUS_10700 23349 24383 gene locus_tag LOCUS_10710 gene pdhA 23349 24383 CDS product pyruvate dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ3 protein_id gnl|my_center|LOCUS_10710 25138 24455 gene locus_tag LOCUS_10720 25138 24455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 31222 25385 gene locus_tag LOCUS_10730 31222 25385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 31800 33275 gene locus_tag LOCUS_10740 gene argH 31800 33275 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLW0 protein_id gnl|my_center|LOCUS_10740 34012 33302 gene locus_tag LOCUS_10750 34012 33302 CDS product D-alanyl-D-alanine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG61 protein_id gnl|my_center|LOCUS_10750 33935 34120 gene locus_tag LOCUS_10760 33935 34120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 34135 35499 gene locus_tag LOCUS_10770 34135 35499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 35583 36218 gene locus_tag LOCUS_10780 35583 36218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 36325 38889 gene locus_tag LOCUS_10790 gene mutS 36325 38889 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG52 protein_id gnl|my_center|LOCUS_10790 41472 38998 gene locus_tag LOCUS_10800 41472 38998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 41691 42206 gene locus_tag LOCUS_10810 41691 42206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 42888 42232 gene locus_tag LOCUS_10820 42888 42232 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_10820 43421 42924 gene locus_tag LOCUS_10830 43421 42924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 43634 45958 gene locus_tag LOCUS_10840 43634 45958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 46520 45972 gene locus_tag LOCUS_10850 46520 45972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 47487 46504 gene locus_tag LOCUS_10860 47487 46504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_10860 47637 47930 gene locus_tag LOCUS_10870 47637 47930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 48020 48784 gene locus_tag LOCUS_10880 gene pcyA 48020 48784 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59288 protein_id gnl|my_center|LOCUS_10880 49185 48781 gene locus_tag LOCUS_10890 49185 48781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 50591 54934 gene locus_tag LOCUS_10900 50591 54934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 54963 55631 gene locus_tag LOCUS_10910 54963 55631 CDS product Cro/Cl family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942196.1 protein_id gnl|my_center|LOCUS_10910 56566 55622 gene locus_tag LOCUS_10920 gene nadK2 56566 55622 CDS product NAD kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8RR32 protein_id gnl|my_center|LOCUS_10920 56901 56596 gene locus_tag LOCUS_10930 gene ndhE 56901 56596 CDS product NAD(P)H-quinone oxidoreductase subunit 4L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMW3 protein_id gnl|my_center|LOCUS_10930 57549 56953 gene locus_tag LOCUS_10940 gene ndhG 57549 56953 CDS product NADH:ubiquinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_10940 58228 57632 gene locus_tag LOCUS_10950 gene ndhI 58228 57632 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL31 protein_id gnl|my_center|LOCUS_10950 59416 58298 gene locus_tag LOCUS_10960 gene ndhA 59416 58298 CDS product NAD(P)H-quinone oxidoreductase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL32 protein_id gnl|my_center|LOCUS_10960 59730 60896 gene locus_tag LOCUS_10970 59730 60896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_10970 61106 62356 gene locus_tag LOCUS_10980 61106 62356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 65105 62451 gene locus_tag LOCUS_10990 65105 62451 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974776.1 protein_id gnl|my_center|LOCUS_10990 68689 65543 gene locus_tag LOCUS_11000 68689 65543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 69643 69993 gene locus_tag LOCUS_11010 69643 69993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 69997 70455 gene locus_tag LOCUS_11020 69997 70455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_11020 70937 70518 gene locus_tag LOCUS_11030 70937 70518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 71549 71007 gene locus_tag LOCUS_11040 71549 71007 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_11040 73297 71711 gene locus_tag LOCUS_11050 73297 71711 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_11050 73482 74093 gene locus_tag LOCUS_11060 73482 74093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 74472 75692 gene locus_tag LOCUS_11070 74472 75692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 75773 77050 gene locus_tag LOCUS_11080 75773 77050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 77059 77379 gene locus_tag LOCUS_11090 77059 77379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 78182 77412 gene locus_tag LOCUS_11100 78182 77412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_11100 78351 78773 gene locus_tag LOCUS_11110 78351 78773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 78887 79978 gene locus_tag LOCUS_11120 78887 79978 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q4ZXY8 protein_id gnl|my_center|LOCUS_11120 80325 79993 gene locus_tag LOCUS_11130 80325 79993 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144135.1 protein_id gnl|my_center|LOCUS_11130 80633 82057 gene locus_tag LOCUS_11140 80633 82057 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056302.1 protein_id gnl|my_center|LOCUS_11140 82191 82724 gene locus_tag LOCUS_11150 82191 82724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 83389 82769 gene locus_tag LOCUS_11160 83389 82769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 84012 83455 gene locus_tag LOCUS_11170 84012 83455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 83968 87048 gene locus_tag LOCUS_11180 83968 87048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 87174 90290 gene locus_tag LOCUS_11190 87174 90290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 91131 90445 gene locus_tag LOCUS_11200 gene ccdA 91131 90445 CDS product cytochrome c-type biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P45706 protein_id gnl|my_center|LOCUS_11200 91842 91243 gene locus_tag LOCUS_11210 91842 91243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 93313 92138 gene locus_tag LOCUS_11220 93313 92138 CDS product LPS biosynthesis protein RfbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876009.1 protein_id gnl|my_center|LOCUS_11220 94785 94228 gene locus_tag LOCUS_11230 94785 94228 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_11230 95078 95713 gene locus_tag LOCUS_11240 95078 95713 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_11240 95788 96276 gene locus_tag LOCUS_11250 95788 96276 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_11250 96670 101385 gene locus_tag LOCUS_11260 gene glsF 96670 101385 CDS product glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_11260 101611 102027 gene locus_tag LOCUS_11270 101611 102027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 102433 102146 gene locus_tag LOCUS_11280 102433 102146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 104533 102707 gene locus_tag LOCUS_11290 104533 102707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_11290 104524 104700 gene locus_tag LOCUS_11300 104524 104700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 104880 106637 gene locus_tag LOCUS_11310 104880 106637 CDS product flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_11310 106830 107414 gene locus_tag LOCUS_11320 106830 107414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 107782 107405 gene locus_tag LOCUS_11330 107782 107405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 109615 108218 gene locus_tag LOCUS_11340 109615 108218 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057883.1 protein_id gnl|my_center|LOCUS_11340 109861 110973 gene locus_tag LOCUS_11350 gene pilM 109861 110973 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058174.1 protein_id gnl|my_center|LOCUS_11350 111032 111967 gene locus_tag LOCUS_11360 111032 111967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142430.1 protein_id gnl|my_center|LOCUS_11360 112152 112916 gene locus_tag LOCUS_11370 112152 112916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 113477 115672 gene locus_tag LOCUS_11380 113477 115672 CDS product general secretion pathway protein GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_11380 115745 116704 gene locus_tag LOCUS_11390 115745 116704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 117918 116824 gene locus_tag LOCUS_11400 117918 116824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 118147 117902 gene locus_tag LOCUS_11410 118147 117902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 122259 118588 gene locus_tag LOCUS_11420 122259 118588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 123212 122409 gene locus_tag LOCUS_11430 123212 122409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 123707 123225 gene locus_tag LOCUS_11440 123707 123225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 123913 124710 gene locus_tag LOCUS_11450 123913 124710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_11450 125031 124741 gene locus_tag LOCUS_11460 gene gatC 125031 124741 CDS product aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ7 protein_id gnl|my_center|LOCUS_11460 125639 125169 gene locus_tag LOCUS_11470 gene ycf3 125639 125169 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ6 protein_id gnl|my_center|LOCUS_11470 126022 127422 gene locus_tag LOCUS_11480 126022 127422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 127472 128443 gene locus_tag LOCUS_11490 127472 128443 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140187.1 protein_id gnl|my_center|LOCUS_11490 128739 128593 gene locus_tag LOCUS_11500 gene hli4 128739 128593 CDS product high light inducible protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_11500 129777 128935 gene locus_tag LOCUS_11510 129777 128935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141492.1 protein_id gnl|my_center|LOCUS_11510 130373 129828 gene locus_tag LOCUS_11520 gene lspA 130373 129828 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA3 protein_id gnl|my_center|LOCUS_11520 131142 130507 gene locus_tag LOCUS_11530 131142 130507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 132299 131178 gene locus_tag LOCUS_11540 gene bioB 132299 131178 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q74CT7 protein_id gnl|my_center|LOCUS_11540 132452 132853 gene locus_tag LOCUS_11550 gene psb27 132452 132853 CDS product photosystem II lipoprotein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG60 protein_id gnl|my_center|LOCUS_11550 133003 134172 gene locus_tag LOCUS_11560 133003 134172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 135272 134355 gene locus_tag LOCUS_11570 135272 134355 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118743.1 protein_id gnl|my_center|LOCUS_11570 135794 135567 gene locus_tag LOCUS_11580 135794 135567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 135851 139321 gene locus_tag LOCUS_11590 135851 139321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 139450 139968 gene locus_tag LOCUS_11600 139450 139968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 140263 141081 gene locus_tag LOCUS_11610 gene yahI 140263 141081 CDS product short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905089.1 protein_id gnl|my_center|LOCUS_11610 141318 143243 gene locus_tag LOCUS_11620 141318 143243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 143423 144538 gene locus_tag LOCUS_11630 gene proB 143423 144538 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH42 protein_id gnl|my_center|LOCUS_11630 145508 144618 gene locus_tag LOCUS_11640 145508 144618 CDS product succinate--CoA ligase [ADP-forming] subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8A9M8 protein_id gnl|my_center|LOCUS_11640 147039 145540 gene locus_tag LOCUS_11650 147039 145540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 148024 147323 gene locus_tag LOCUS_11660 148024 147323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056349.1 protein_id gnl|my_center|LOCUS_11660 149304 148045 gene locus_tag LOCUS_11670 gene pilC 149304 148045 CDS product pilus biosynthesis protein PilC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142659.1 protein_id gnl|my_center|LOCUS_11670 150645 149557 gene locus_tag LOCUS_11680 gene pilT 150645 149557 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_11680 152945 150939 gene locus_tag LOCUS_11690 gene pilB 152945 150939 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_11690 154512 153310 gene locus_tag LOCUS_11700 154512 153310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 156370 154895 gene locus_tag LOCUS_11710 156370 154895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_11710 157483 156440 gene locus_tag LOCUS_11720 157483 156440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 157974 159854 gene locus_tag LOCUS_11730 157974 159854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 161313 159928 gene locus_tag LOCUS_11740 161313 159928 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_11740 161928 161332 gene locus_tag LOCUS_11750 161928 161332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_11750 162190 163788 gene locus_tag LOCUS_11760 gene ndhD2 162190 163788 CDS product NAD(P)H-quinone oxidoreductase chain 4 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX4 protein_id gnl|my_center|LOCUS_11760 164157 164783 gene locus_tag LOCUS_11770 gene sigH 164157 164783 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_11770 164780 165304 gene locus_tag LOCUS_11780 164780 165304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 165402 166028 gene locus_tag LOCUS_11790 165402 166028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 166111 166590 gene locus_tag LOCUS_11800 166111 166590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 167500 166976 gene locus_tag LOCUS_11810 167500 166976 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057216.1 protein_id gnl|my_center|LOCUS_11810 167898 169040 gene locus_tag LOCUS_11820 167898 169040 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_11820 169494 169003 gene locus_tag LOCUS_11830 169494 169003 CDS product cytidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057432.1 protein_id gnl|my_center|LOCUS_11830 171337 169523 gene locus_tag LOCUS_11840 gene pepF 171337 169523 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_11840 172361 171477 gene locus_tag LOCUS_11850 gene murI 172361 171477 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM3 protein_id gnl|my_center|LOCUS_11850 172678 173634 gene locus_tag LOCUS_11860 gene draG 172678 173634 CDS product ADP-ribosylglycohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_11860 173634 174470 gene locus_tag LOCUS_11870 173634 174470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024159.1 protein_id gnl|my_center|LOCUS_11870 174528 175805 gene locus_tag LOCUS_11880 174528 175805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 176533 175871 gene locus_tag LOCUS_11890 176533 175871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 177348 176533 gene locus_tag LOCUS_11900 gene phnC 177348 176533 CDS product phosphonates import ATP-binding protein PhnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5FMM1 protein_id gnl|my_center|LOCUS_11900 179034 177358 gene locus_tag LOCUS_11910 179034 177358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 180205 179519 gene locus_tag LOCUS_11920 180205 179519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 180667 181338 gene locus_tag LOCUS_11930 180667 181338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 182616 181459 gene locus_tag LOCUS_11940 gene rsgA 182616 181459 CDS product putative ribosome biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK79 protein_id gnl|my_center|LOCUS_11940 182894 182613 gene locus_tag LOCUS_11950 182894 182613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_11950 184082 182958 gene locus_tag LOCUS_11960 gene dnaJ 184082 182958 CDS product chaperone protein DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR7 protein_id gnl|my_center|LOCUS_11960 186598 184373 gene locus_tag LOCUS_11970 gene dnaK1 186598 184373 CDS product chaperone protein dnaK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR6 protein_id gnl|my_center|LOCUS_11970 187146 186967 gene locus_tag LOCUS_11980 187146 186967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 187428 187204 gene locus_tag LOCUS_11990 187428 187204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence07 2016 589 gene locus_tag LOCUS_12000 2016 589 CDS product modulator of DNA gyrase PmbA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_12000 2399 3562 gene locus_tag LOCUS_12010 2399 3562 CDS product guanosine monophosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_12010 4110 3880 gene locus_tag LOCUS_12020 4110 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 5249 4155 gene locus_tag LOCUS_12030 5249 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 7247 6036 gene locus_tag LOCUS_12040 gene iscS 7247 6036 CDS product cysteine desulfurase IscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND52 protein_id gnl|my_center|LOCUS_12040 7675 11238 gene locus_tag LOCUS_12050 7675 11238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 11365 13137 gene locus_tag LOCUS_12060 11365 13137 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142407.1 protein_id gnl|my_center|LOCUS_12060 14073 13153 gene locus_tag LOCUS_12070 14073 13153 CDS product epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_12070 15566 14271 gene locus_tag LOCUS_12080 15566 14271 CDS product dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC8 protein_id gnl|my_center|LOCUS_12080 16367 15831 gene locus_tag LOCUS_12090 gene ilvH 16367 15831 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_12090 16248 16523 gene locus_tag LOCUS_12100 16248 16523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 17139 18896 gene locus_tag LOCUS_12110 17139 18896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 18977 25012 gene locus_tag LOCUS_12120 18977 25012 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_12120 25090 30486 gene locus_tag LOCUS_12130 25090 30486 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_12130 30564 36449 gene locus_tag LOCUS_12140 30564 36449 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_12140 36783 38750 gene locus_tag LOCUS_12150 36783 38750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 38743 40005 gene locus_tag LOCUS_12160 38743 40005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 40801 42477 gene locus_tag LOCUS_12170 40801 42477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 42474 43697 gene locus_tag LOCUS_12180 42474 43697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 43801 49161 gene locus_tag LOCUS_12190 43801 49161 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_12190 49265 49651 gene locus_tag LOCUS_12200 49265 49651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 49578 50132 gene locus_tag LOCUS_12210 49578 50132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12210 50241 54782 gene locus_tag LOCUS_12220 50241 54782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12220 54884 60220 gene locus_tag LOCUS_12230 54884 60220 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_12230 60261 64643 gene locus_tag LOCUS_12240 60261 64643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 65527 64640 gene locus_tag LOCUS_12250 65527 64640 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_12250 66023 66574 gene locus_tag LOCUS_12260 gene infC 66023 66574 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N2 protein_id gnl|my_center|LOCUS_12260 66866 69856 gene locus_tag LOCUS_12270 66866 69856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 70145 70612 gene locus_tag LOCUS_12280 70145 70612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 70775 72442 gene locus_tag LOCUS_12290 70775 72442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 72547 74058 gene locus_tag LOCUS_12300 gene ilvA 72547 74058 CDS product L-threonine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0C6P7U9 protein_id gnl|my_center|LOCUS_12300 75448 74156 gene locus_tag LOCUS_12310 75448 74156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12310 75611 75417 gene locus_tag LOCUS_12320 75611 75417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 76078 81270 gene locus_tag LOCUS_12330 76078 81270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 81540 83450 gene locus_tag LOCUS_12340 gene mnmG 81540 83450 CDS product tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF8 protein_id gnl|my_center|LOCUS_12340 83812 83456 gene locus_tag LOCUS_12350 83812 83456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 85077 83851 gene locus_tag LOCUS_12360 85077 83851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 85191 85610 gene locus_tag LOCUS_12370 85191 85610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 85832 86200 gene locus_tag LOCUS_12380 85832 86200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_12380 86356 87867 gene locus_tag LOCUS_12390 86356 87867 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057713.1 protein_id gnl|my_center|LOCUS_12390 88120 88473 gene locus_tag LOCUS_12400 88120 88473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057714.1 protein_id gnl|my_center|LOCUS_12400 89092 90405 gene locus_tag LOCUS_12410 89092 90405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 90760 91734 gene locus_tag LOCUS_12420 90760 91734 CDS product glutathione-dependent reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038653.1 protein_id gnl|my_center|LOCUS_12420 92552 91743 gene locus_tag LOCUS_12430 92552 91743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 93726 92755 gene locus_tag LOCUS_12440 gene sds 93726 92755 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_12440 94696 94965 gene locus_tag LOCUS_12450 94696 94965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 96217 95129 gene locus_tag LOCUS_12460 96217 95129 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057568.1 protein_id gnl|my_center|LOCUS_12460 97570 96545 gene locus_tag LOCUS_12470 97570 96545 CDS product phenazine biosynthesis protein PhzF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976065.1 protein_id gnl|my_center|LOCUS_12470 102886 97673 gene locus_tag LOCUS_12480 102886 97673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 103618 103004 gene locus_tag LOCUS_12490 103618 103004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 106835 103686 gene locus_tag LOCUS_12500 106835 103686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 107920 106892 gene locus_tag LOCUS_12510 107920 106892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 109254 108841 gene locus_tag LOCUS_12520 109254 108841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 110694 109744 gene locus_tag LOCUS_12530 gene ctaB 110694 109744 CDS product protoheme IX farnesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHQ2 protein_id gnl|my_center|LOCUS_12530 111727 110765 gene locus_tag LOCUS_12540 111727 110765 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_12540 112170 113708 gene locus_tag LOCUS_12550 112170 113708 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124737.1 protein_id gnl|my_center|LOCUS_12550 114275 113715 gene locus_tag LOCUS_12560 114275 113715 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_12560 114672 114361 gene locus_tag LOCUS_12570 114672 114361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142361.1 protein_id gnl|my_center|LOCUS_12570 114641 114811 gene locus_tag LOCUS_12580 114641 114811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 114845 117484 gene locus_tag LOCUS_12590 gene alaS 114845 117484 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH56 protein_id gnl|my_center|LOCUS_12590 118405 117581 gene locus_tag LOCUS_12600 118405 117581 CDS product serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_12600 120410 118866 gene locus_tag LOCUS_12610 120410 118866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058075.1 protein_id gnl|my_center|LOCUS_12610 121058 120705 gene locus_tag LOCUS_12620 121058 120705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 121956 121267 gene locus_tag LOCUS_12630 121956 121267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 124974 122080 gene locus_tag LOCUS_12640 124974 122080 CDS product poly(A) polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_12640 125236 125424 gene locus_tag LOCUS_12650 gene psbZ 125236 125424 CDS product photosystem II reaction center protein Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHJ2 protein_id gnl|my_center|LOCUS_12650 125615 126091 gene locus_tag LOCUS_12660 gene ribH 125615 126091 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP4 protein_id gnl|my_center|LOCUS_12660 126485 126291 gene locus_tag LOCUS_12670 126485 126291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 128753 126795 gene locus_tag LOCUS_12680 128753 126795 CDS product peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_12680 128891 129466 gene locus_tag LOCUS_12690 128891 129466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 129459 129848 gene locus_tag LOCUS_12700 129459 129848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_12700 131319 129955 gene locus_tag LOCUS_12710 gene glmM 131319 129955 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI20 protein_id gnl|my_center|LOCUS_12710 133067 131916 gene locus_tag LOCUS_12720 133067 131916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 134585 133260 gene locus_tag LOCUS_12730 134585 133260 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140568.1 protein_id gnl|my_center|LOCUS_12730 136137 134563 gene locus_tag LOCUS_12740 136137 134563 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_12740 136869 139352 gene locus_tag LOCUS_12750 gene pheT 136869 139352 CDS product phenylalanine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL37 protein_id gnl|my_center|LOCUS_12750 139669 146073 gene locus_tag LOCUS_12760 139669 146073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 150564 146104 gene locus_tag LOCUS_12770 150564 146104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 151591 154878 gene locus_tag LOCUS_12780 151591 154878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 155246 155031 gene locus_tag LOCUS_12790 155246 155031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057172.1 protein_id gnl|my_center|LOCUS_12790 158908 155396 gene locus_tag LOCUS_12800 gene mfd 158908 155396 CDS product transcription-repair-coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKA7 protein_id gnl|my_center|LOCUS_12800 >Feature sequence08 1071 145 gene locus_tag LOCUS_12810 1071 145 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089804.1 protein_id gnl|my_center|LOCUS_12810 1236 1754 gene locus_tag LOCUS_12820 1236 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1881 3389 gene locus_tag LOCUS_12830 1881 3389 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056229.1 protein_id gnl|my_center|LOCUS_12830 3946 3437 gene locus_tag LOCUS_12840 3946 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4495 4325 gene locus_tag LOCUS_12850 4495 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 5990 4716 gene locus_tag LOCUS_12860 5990 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 7262 6213 gene locus_tag LOCUS_12870 gene dnaX 7262 6213 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_12870 7965 7321 gene locus_tag LOCUS_12880 gene tmk 7965 7321 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMT7 protein_id gnl|my_center|LOCUS_12880 8066 8413 gene locus_tag LOCUS_12890 8066 8413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 8550 9650 gene locus_tag LOCUS_12900 8550 9650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 9917 11506 gene locus_tag LOCUS_12910 gene ndhD1 9917 11506 CDS product NAD(P)H-quinone oxidoreductase chain 4 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY0 protein_id gnl|my_center|LOCUS_12910 11768 12154 gene locus_tag LOCUS_12920 11768 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 12666 13157 gene locus_tag LOCUS_12930 12666 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 14580 13297 gene locus_tag LOCUS_12940 14580 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 15231 15890 gene locus_tag LOCUS_12950 15231 15890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 15918 16673 gene locus_tag LOCUS_12960 15918 16673 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529132.1 protein_id gnl|my_center|LOCUS_12960 17362 18303 gene locus_tag LOCUS_12970 17362 18303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 18773 19324 gene locus_tag LOCUS_12980 18773 19324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963161.1 protein_id gnl|my_center|LOCUS_12980 19324 20691 gene locus_tag LOCUS_12990 19324 20691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 20797 23487 gene locus_tag LOCUS_13000 gene mutS 20797 23487 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGS4 protein_id gnl|my_center|LOCUS_13000 23562 24077 gene locus_tag LOCUS_13010 23562 24077 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_13010 24606 25106 gene locus_tag LOCUS_13020 24606 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 25375 26214 gene locus_tag LOCUS_13030 25375 26214 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_13030 26890 26264 gene locus_tag LOCUS_13040 26890 26264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 26974 27630 gene locus_tag LOCUS_13050 26974 27630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 27573 28232 gene locus_tag LOCUS_13060 27573 28232 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123279.1 protein_id gnl|my_center|LOCUS_13060 28450 29034 gene locus_tag LOCUS_13070 28450 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 29131 29709 gene locus_tag LOCUS_13080 29131 29709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_13080 29811 31970 gene locus_tag LOCUS_13090 gene glyS 29811 31970 CDS product glycine--tRNA ligase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGX0 protein_id gnl|my_center|LOCUS_13090 32438 33082 gene locus_tag LOCUS_13100 gene rplC 32438 33082 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN1 protein_id gnl|my_center|LOCUS_13100 33127 33774 gene locus_tag LOCUS_13110 gene rplD 33127 33774 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN0 protein_id gnl|my_center|LOCUS_13110 33764 34081 gene locus_tag LOCUS_13120 gene rplW 33764 34081 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPG8 protein_id gnl|my_center|LOCUS_13120 34102 34965 gene locus_tag LOCUS_13130 gene rplB 34102 34965 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM8 protein_id gnl|my_center|LOCUS_13130 35055 35330 gene locus_tag LOCUS_13140 gene rpsS 35055 35330 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9W6 protein_id gnl|my_center|LOCUS_13140 35349 35693 gene locus_tag LOCUS_13150 gene rplV 35349 35693 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM6 protein_id gnl|my_center|LOCUS_13150 35727 36455 gene locus_tag LOCUS_13160 gene rpsC 35727 36455 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59187 protein_id gnl|my_center|LOCUS_13160 36511 36876 gene locus_tag LOCUS_13170 gene rplP 36511 36876 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM5 protein_id gnl|my_center|LOCUS_13170 36869 37150 gene locus_tag LOCUS_13180 36869 37150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 37157 37405 gene locus_tag LOCUS_13190 gene rpsQ 37157 37405 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM3 protein_id gnl|my_center|LOCUS_13190 37412 37780 gene locus_tag LOCUS_13200 gene rplN 37412 37780 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM2 protein_id gnl|my_center|LOCUS_13200 37781 38143 gene locus_tag LOCUS_13210 gene rplX 37781 38143 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM1 protein_id gnl|my_center|LOCUS_13210 38248 38793 gene locus_tag LOCUS_13220 gene rplE 38248 38793 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMM0 protein_id gnl|my_center|LOCUS_13220 38818 39219 gene locus_tag LOCUS_13230 gene rpsH 38818 39219 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML9 protein_id gnl|my_center|LOCUS_13230 39269 39808 gene locus_tag LOCUS_13240 gene rplF 39269 39808 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML8 protein_id gnl|my_center|LOCUS_13240 39808 40170 gene locus_tag LOCUS_13250 gene rplR 39808 40170 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML7 protein_id gnl|my_center|LOCUS_13250 40208 40735 gene locus_tag LOCUS_13260 gene rpsE 40208 40735 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59126 protein_id gnl|my_center|LOCUS_13260 40858 41334 gene locus_tag LOCUS_13270 gene rplO 40858 41334 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML6 protein_id gnl|my_center|LOCUS_13270 41433 42755 gene locus_tag LOCUS_13280 gene secY 41433 42755 CDS product protein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML5 protein_id gnl|my_center|LOCUS_13280 42755 43330 gene locus_tag LOCUS_13290 gene adk 42755 43330 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9XD15 protein_id gnl|my_center|LOCUS_13290 43460 43687 gene locus_tag LOCUS_13300 gene infA 43460 43687 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML3 protein_id gnl|my_center|LOCUS_13300 43842 44210 gene locus_tag LOCUS_13310 gene rpsM 43842 44210 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DML1 protein_id gnl|my_center|LOCUS_13310 44308 44703 gene locus_tag LOCUS_13320 gene rpsK 44308 44703 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59379 protein_id gnl|my_center|LOCUS_13320 44991 45935 gene locus_tag LOCUS_13330 gene rpoA 44991 45935 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFF5 protein_id gnl|my_center|LOCUS_13330 46038 46388 gene locus_tag LOCUS_13340 gene rplQ 46038 46388 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK9 protein_id gnl|my_center|LOCUS_13340 46437 47258 gene locus_tag LOCUS_13350 gene truA 46437 47258 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM6 protein_id gnl|my_center|LOCUS_13350 47345 47800 gene locus_tag LOCUS_13360 gene rplM 47345 47800 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK8 protein_id gnl|my_center|LOCUS_13360 47800 48210 gene locus_tag LOCUS_13370 gene rpsI 47800 48210 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMK7 protein_id gnl|my_center|LOCUS_13370 48409 48642 gene locus_tag LOCUS_13380 gene rpmE 48409 48642 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9Y9 protein_id gnl|my_center|LOCUS_13380 48735 49826 gene locus_tag LOCUS_13390 gene prfA 48735 49826 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMG9 protein_id gnl|my_center|LOCUS_13390 49907 50284 gene locus_tag LOCUS_13400 49907 50284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_13400 51348 50281 gene locus_tag LOCUS_13410 51348 50281 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_13410 51548 53128 gene locus_tag LOCUS_13420 gene trpE 51548 53128 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056140.1 protein_id gnl|my_center|LOCUS_13420 53132 53623 gene locus_tag LOCUS_13430 gene acpS 53132 53623 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NE72 protein_id gnl|my_center|LOCUS_13430 54007 54276 gene locus_tag LOCUS_13440 54007 54276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_13440 54364 55071 gene locus_tag LOCUS_13450 54364 55071 CDS product YggS family pyridoxal phosphate enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140704.1 protein_id gnl|my_center|LOCUS_13450 55704 56360 gene locus_tag LOCUS_13460 55704 56360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 56586 57368 gene locus_tag LOCUS_13470 gene proC 56586 57368 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMR1 protein_id gnl|my_center|LOCUS_13470 58544 57831 gene locus_tag LOCUS_13480 58544 57831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 59557 58670 gene locus_tag LOCUS_13490 59557 58670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 60448 59585 gene locus_tag LOCUS_13500 60448 59585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 61191 60547 gene locus_tag LOCUS_13510 gene plsY 61191 60547 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:E8TNE0 protein_id gnl|my_center|LOCUS_13510 63079 61331 gene locus_tag LOCUS_13520 63079 61331 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_13520 63980 63309 gene locus_tag LOCUS_13530 63980 63309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 64123 65127 gene locus_tag LOCUS_13540 gene phnD 64123 65127 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_13540 65220 66923 gene locus_tag LOCUS_13550 65220 66923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125671.1 protein_id gnl|my_center|LOCUS_13550 67369 66977 gene locus_tag LOCUS_13560 67369 66977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_13560 68239 67727 gene locus_tag LOCUS_13570 68239 67727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 68540 70165 gene locus_tag LOCUS_13580 gene hflX 68540 70165 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDU0 protein_id gnl|my_center|LOCUS_13580 70274 73276 gene locus_tag LOCUS_13590 70274 73276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 74144 73314 gene locus_tag LOCUS_13600 gene cysH 74144 73314 CDS product phosphoadenosine phosphosulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9KUX2 protein_id gnl|my_center|LOCUS_13600 75175 74204 gene locus_tag LOCUS_13610 gene tas 75175 74204 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_13610 75328 76656 gene locus_tag LOCUS_13620 75328 76656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 76704 77900 gene locus_tag LOCUS_13630 76704 77900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 78422 78021 gene locus_tag LOCUS_13640 gene mvpA 78422 78021 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV79 protein_id gnl|my_center|LOCUS_13640 78692 78429 gene locus_tag LOCUS_13650 78692 78429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 78985 78692 gene locus_tag LOCUS_13660 78985 78692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 79357 79025 gene locus_tag LOCUS_13670 79357 79025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 79596 82121 gene locus_tag LOCUS_13680 79596 82121 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_13680 82249 82758 gene locus_tag LOCUS_13690 82249 82758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 82834 83649 gene locus_tag LOCUS_13700 82834 83649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 83825 85291 gene locus_tag LOCUS_13710 83825 85291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 85655 85224 gene locus_tag LOCUS_13720 85655 85224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 86534 85767 gene locus_tag LOCUS_13730 86534 85767 CDS product short chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012707495.1 protein_id gnl|my_center|LOCUS_13730 86825 86998 gene locus_tag LOCUS_13740 86825 86998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 87135 87521 gene locus_tag LOCUS_13750 87135 87521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 88945 87536 gene locus_tag LOCUS_13760 88945 87536 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_13760 89335 91257 gene locus_tag LOCUS_13770 gene dxs 89335 91257 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL74 protein_id gnl|my_center|LOCUS_13770 91444 92709 gene locus_tag LOCUS_13780 gene proA 91444 92709 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NEF6 protein_id gnl|my_center|LOCUS_13780 93359 92778 gene locus_tag LOCUS_13790 93359 92778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_13790 93581 94420 gene locus_tag LOCUS_13800 gene pheA 93581 94420 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH54 protein_id gnl|my_center|LOCUS_13800 94530 95915 gene locus_tag LOCUS_13810 94530 95915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 97114 95942 gene locus_tag LOCUS_13820 97114 95942 CDS product ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_13820 98449 97232 gene locus_tag LOCUS_13830 98449 97232 CDS product devB secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_13830 98857 100842 gene locus_tag LOCUS_13840 98857 100842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 101371 100865 gene locus_tag LOCUS_13850 101371 100865 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_13850 103173 101368 gene locus_tag LOCUS_13860 103173 101368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057660.1 protein_id gnl|my_center|LOCUS_13860 103463 103212 gene locus_tag LOCUS_13870 103463 103212 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_13870 105048 103507 gene locus_tag LOCUS_13880 gene cobQ 105048 103507 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI74 protein_id gnl|my_center|LOCUS_13880 105496 105062 gene locus_tag LOCUS_13890 105496 105062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_13890 106133 105717 gene locus_tag LOCUS_13900 106133 105717 CDS product phosphotyrosine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_13900 107035 106331 gene locus_tag LOCUS_13910 107035 106331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_13910 107200 107943 gene locus_tag LOCUS_13920 107200 107943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_13920 108110 108646 gene locus_tag LOCUS_13930 108110 108646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 109733 108798 gene locus_tag LOCUS_13940 gene murQ 109733 108798 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJQ1 protein_id gnl|my_center|LOCUS_13940 110200 109763 gene locus_tag LOCUS_13950 110200 109763 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057974.1 protein_id gnl|my_center|LOCUS_13950 110746 110360 gene locus_tag LOCUS_13960 gene ycf35 110746 110360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_13960 111166 110954 gene locus_tag LOCUS_13970 111166 110954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057972.1 protein_id gnl|my_center|LOCUS_13970 111468 112508 gene locus_tag LOCUS_13980 111468 112508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140531.1 protein_id gnl|my_center|LOCUS_13980 113264 112593 gene locus_tag LOCUS_13990 113264 112593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 114675 113515 gene locus_tag LOCUS_14000 114675 113515 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_14000 114869 115795 gene locus_tag LOCUS_14010 114869 115795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057257.1 protein_id gnl|my_center|LOCUS_14010 115879 116145 gene locus_tag LOCUS_14020 115879 116145 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141485.1 protein_id gnl|my_center|LOCUS_14020 116351 116563 gene locus_tag LOCUS_14030 116351 116563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_14030 116653 118839 gene locus_tag LOCUS_14040 gene ppk 116653 118839 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA8 protein_id gnl|my_center|LOCUS_14040 119581 118850 gene locus_tag LOCUS_14050 119581 118850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143961.1 protein_id gnl|my_center|LOCUS_14050 120297 119731 gene locus_tag LOCUS_14060 gene rpsD 120297 119731 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59134 protein_id gnl|my_center|LOCUS_14060 121133 120552 gene locus_tag LOCUS_14070 121133 120552 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058037.1 protein_id gnl|my_center|LOCUS_14070 121506 122459 gene locus_tag LOCUS_14080 gene lipA2 121506 122459 CDS product lipoyl synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC2 protein_id gnl|my_center|LOCUS_14080 123344 122496 gene locus_tag LOCUS_14090 123344 122496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 123734 123393 gene locus_tag LOCUS_14100 123734 123393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 123925 125325 gene locus_tag LOCUS_14110 123925 125325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_14110 125374 126165 gene locus_tag LOCUS_14120 125374 126165 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_14120 126215 126946 gene locus_tag LOCUS_14130 126215 126946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 127058 127597 gene locus_tag LOCUS_14140 127058 127597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 128071 127610 gene locus_tag LOCUS_14150 128071 127610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 129463 128102 gene locus_tag LOCUS_14160 129463 128102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 130543 129719 gene locus_tag LOCUS_14170 gene mtnP 130543 129719 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE4 protein_id gnl|my_center|LOCUS_14170 131801 134554 gene locus_tag LOCUS_14180 131801 134554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 135551 134643 gene locus_tag LOCUS_14190 gene nadC 135551 134643 CDS product nicotinate-nucleotide diphosphorylase (carboxylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence09 402 121 gene locus_tag LOCUS_14200 402 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1326 475 gene locus_tag LOCUS_14210 1326 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1565 4450 gene locus_tag LOCUS_14220 gene ileS 1565 4450 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI7 protein_id gnl|my_center|LOCUS_14220 4455 5075 gene locus_tag LOCUS_14230 4455 5075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6193 5114 gene locus_tag LOCUS_14240 gene pfkA 6193 5114 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RVJ7 protein_id gnl|my_center|LOCUS_14240 6432 7064 gene locus_tag LOCUS_14250 6432 7064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 7204 7371 gene locus_tag LOCUS_14260 7204 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 7380 8723 gene locus_tag LOCUS_14270 gene cobL 7380 8723 CDS product precorrin-6Y C5,15-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 protein_id gnl|my_center|LOCUS_14270 8758 9843 gene locus_tag LOCUS_14280 8758 9843 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_14280 11286 9859 gene locus_tag LOCUS_14290 gene pntB 11286 9859 CDS product NAD(P) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL03 protein_id gnl|my_center|LOCUS_14290 11679 11401 gene locus_tag LOCUS_14300 11679 11401 CDS product pyridine nucleotide transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056542.1 protein_id gnl|my_center|LOCUS_14300 12921 11755 gene locus_tag LOCUS_14310 gene pntA 12921 11755 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_14310 13462 14382 gene locus_tag LOCUS_14320 13462 14382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 14411 14641 gene locus_tag LOCUS_14330 14411 14641 CDS product CPXCG motif-containing cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143465.1 protein_id gnl|my_center|LOCUS_14330 14884 15582 gene locus_tag LOCUS_14340 14884 15582 CDS product nitrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057403.1 protein_id gnl|my_center|LOCUS_14340 15733 16719 gene locus_tag LOCUS_14350 gene obg 15733 16719 CDS product GTPase Obg inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGG4 protein_id gnl|my_center|LOCUS_14350 16768 17550 gene locus_tag LOCUS_14360 16768 17550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 18413 17562 gene locus_tag LOCUS_14370 18413 17562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 19086 18424 gene locus_tag LOCUS_14380 19086 18424 CDS product 2'-5' RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141084.1 protein_id gnl|my_center|LOCUS_14380 19180 19467 gene locus_tag LOCUS_14390 19180 19467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056560.1 protein_id gnl|my_center|LOCUS_14390 19883 20062 gene locus_tag LOCUS_14400 19883 20062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142324.1 protein_id gnl|my_center|LOCUS_14400 20154 20906 gene locus_tag LOCUS_14410 20154 20906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 20997 21386 gene locus_tag LOCUS_14420 20997 21386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_14420 21565 22074 gene locus_tag LOCUS_14430 21565 22074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 22693 24078 gene locus_tag LOCUS_14440 22693 24078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 24126 24440 gene locus_tag LOCUS_14450 24126 24440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 25042 24767 gene locus_tag LOCUS_14460 25042 24767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 24927 26417 gene locus_tag LOCUS_14470 24927 26417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 26563 27528 gene locus_tag LOCUS_14480 26563 27528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056713.1 protein_id gnl|my_center|LOCUS_14480 27935 28474 gene locus_tag LOCUS_14490 27935 28474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 28502 29455 gene locus_tag LOCUS_14500 28502 29455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 31150 29516 gene locus_tag LOCUS_14510 31150 29516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 31324 31536 gene locus_tag LOCUS_14520 31324 31536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058299.1 protein_id gnl|my_center|LOCUS_14520 32491 31709 gene locus_tag LOCUS_14530 32491 31709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 32883 33746 gene locus_tag LOCUS_14540 32883 33746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521465.1 protein_id gnl|my_center|LOCUS_14540 36532 33743 gene locus_tag LOCUS_14550 36532 33743 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_14550 37653 36718 gene locus_tag LOCUS_14560 37653 36718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_14560 38082 39863 gene locus_tag LOCUS_14570 38082 39863 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP1 protein_id gnl|my_center|LOCUS_14570 39920 40165 gene locus_tag LOCUS_14580 39920 40165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 40863 40507 gene locus_tag LOCUS_14590 40863 40507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14590 40990 41595 gene locus_tag LOCUS_14600 40990 41595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 42635 41667 gene locus_tag LOCUS_14610 42635 41667 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_14610 42815 44341 gene locus_tag LOCUS_14620 42815 44341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393817.1 protein_id gnl|my_center|LOCUS_14620 45242 44451 gene locus_tag LOCUS_14630 45242 44451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 46213 45401 gene locus_tag LOCUS_14640 46213 45401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 46665 47453 gene locus_tag LOCUS_14650 46665 47453 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_14650 47901 48821 gene locus_tag LOCUS_14660 47901 48821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 49312 48887 gene locus_tag LOCUS_14670 49312 48887 CDS product ubiquinol-cytochrome c reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259228.1 protein_id gnl|my_center|LOCUS_14670 49655 50302 gene locus_tag LOCUS_14680 49655 50302 CDS product peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142152.1 protein_id gnl|my_center|LOCUS_14680 50556 51893 gene locus_tag LOCUS_14690 gene ispH 50556 51893 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK29 protein_id gnl|my_center|LOCUS_14690 51967 52872 gene locus_tag LOCUS_14700 51967 52872 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058191.1 protein_id gnl|my_center|LOCUS_14700 53200 53409 gene locus_tag LOCUS_14710 53200 53409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 53469 53690 gene locus_tag LOCUS_14720 53469 53690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 53971 54147 gene locus_tag LOCUS_14730 53971 54147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 54670 56784 gene locus_tag LOCUS_14740 54670 56784 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_14740 56969 57130 gene locus_tag LOCUS_14750 56969 57130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 57161 59266 gene locus_tag LOCUS_14760 57161 59266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 59812 60045 gene locus_tag LOCUS_14770 59812 60045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 60451 61749 gene locus_tag LOCUS_14780 60451 61749 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268208.1 protein_id gnl|my_center|LOCUS_14780 61829 64735 gene locus_tag LOCUS_14790 61829 64735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 64745 65653 gene locus_tag LOCUS_14800 64745 65653 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086032.1 protein_id gnl|my_center|LOCUS_14800 65666 66037 gene locus_tag LOCUS_14810 65666 66037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 66238 67227 gene locus_tag LOCUS_14820 66238 67227 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086669.1 protein_id gnl|my_center|LOCUS_14820 68243 67281 gene locus_tag LOCUS_14830 68243 67281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_14830 68369 69067 gene locus_tag LOCUS_14840 68369 69067 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_14840 69855 69310 gene locus_tag LOCUS_14850 gene kptA 69855 69310 CDS product putative RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBW7 protein_id gnl|my_center|LOCUS_14850 69944 70300 gene locus_tag LOCUS_14860 69944 70300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 70336 70665 gene locus_tag LOCUS_14870 70336 70665 CDS product UPF0016 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_14870 71099 70662 gene locus_tag LOCUS_14880 71099 70662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_14880 71384 71746 gene locus_tag LOCUS_14890 71384 71746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 72054 73766 gene locus_tag LOCUS_14900 72054 73766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057554.1 protein_id gnl|my_center|LOCUS_14900 73984 73841 gene locus_tag LOCUS_14910 gene psbN 73984 73841 CDS product protein PsbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ42 protein_id gnl|my_center|LOCUS_14910 74214 74417 gene locus_tag LOCUS_14920 gene psbH 74214 74417 CDS product photosystem II reaction center protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ43 protein_id gnl|my_center|LOCUS_14920 74613 74942 gene locus_tag LOCUS_14930 74613 74942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 74979 75557 gene locus_tag LOCUS_14940 74979 75557 CDS product C4-dicarboxylate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_14940 75618 76997 gene locus_tag LOCUS_14950 75618 76997 CDS product C4-dicarboxylate ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_14950 77235 77489 gene locus_tag LOCUS_14960 77235 77489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056973.1 protein_id gnl|my_center|LOCUS_14960 78035 78217 gene locus_tag LOCUS_14970 78035 78217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 79012 78251 gene locus_tag LOCUS_14980 79012 78251 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057273.1 protein_id gnl|my_center|LOCUS_14980 79451 81082 gene locus_tag LOCUS_14990 79451 81082 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_14990 81217 81942 gene locus_tag LOCUS_15000 81217 81942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 82015 82527 gene locus_tag LOCUS_15010 82015 82527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 83161 82619 gene locus_tag LOCUS_15020 gene psbV2 83161 82619 CDS product cytochrome c-550-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE2 protein_id gnl|my_center|LOCUS_15020 83879 83382 gene locus_tag LOCUS_15030 gene psbV 83879 83382 CDS product cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A386 protein_id gnl|my_center|LOCUS_15030 85155 84178 gene locus_tag LOCUS_15040 gene accD 85155 84178 CDS product acetyl-coenzyme A carboxylase carboxyl transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIE7 protein_id gnl|my_center|LOCUS_15040 86324 85482 gene locus_tag LOCUS_15050 86324 85482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 86483 87715 gene locus_tag LOCUS_15060 86483 87715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057682.1 protein_id gnl|my_center|LOCUS_15060 87933 89996 gene locus_tag LOCUS_15070 87933 89996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 90316 92196 gene locus_tag LOCUS_15080 90316 92196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 93116 92250 gene locus_tag LOCUS_15090 93116 92250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 94447 93299 gene locus_tag LOCUS_15100 94447 93299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 95637 94780 gene locus_tag LOCUS_15110 gene dapF 95637 94780 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM2 protein_id gnl|my_center|LOCUS_15110 95664 95876 gene locus_tag LOCUS_15120 95664 95876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 protein_id gnl|my_center|LOCUS_15120 95837 96982 gene locus_tag LOCUS_15130 95837 96982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 96990 97556 gene locus_tag LOCUS_15140 96990 97556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 97559 98194 gene locus_tag LOCUS_15150 97559 98194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 98243 98704 gene locus_tag LOCUS_15160 98243 98704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 99372 98701 gene locus_tag LOCUS_15170 99372 98701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 100586 99492 gene locus_tag LOCUS_15180 100586 99492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 104085 100843 gene locus_tag LOCUS_15190 104085 100843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_15190 104893 104159 gene locus_tag LOCUS_15200 104893 104159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 105820 104912 gene locus_tag LOCUS_15210 105820 104912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 106442 109201 gene locus_tag LOCUS_15220 gene topA 106442 109201 CDS product DNA topoisomerase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHR4 protein_id gnl|my_center|LOCUS_15220 109214 110704 gene locus_tag LOCUS_15230 109214 110704 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403192.1 protein_id gnl|my_center|LOCUS_15230 110833 111693 gene locus_tag LOCUS_15240 gene rsmA 110833 111693 CDS product ribosomal RNA small subunit methyltransferase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59157 protein_id gnl|my_center|LOCUS_15240 111854 115942 gene locus_tag LOCUS_15250 gene chlH 111854 115942 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_15250 116968 116081 gene locus_tag LOCUS_15260 116968 116081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence10 437 1456 gene locus_tag LOCUS_15270 gene ntcB 437 1456 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_15270 1516 2856 gene locus_tag LOCUS_15280 1516 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2967 4949 gene locus_tag LOCUS_15290 2967 4949 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058113.1 protein_id gnl|my_center|LOCUS_15290 5050 5439 gene locus_tag LOCUS_15300 5050 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 5447 6367 gene locus_tag LOCUS_15310 5447 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 6480 10724 gene locus_tag LOCUS_15320 6480 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 10717 12639 gene locus_tag LOCUS_15330 10717 12639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12688 13218 gene locus_tag LOCUS_15340 12688 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140909.1 protein_id gnl|my_center|LOCUS_15340 13222 14895 gene locus_tag LOCUS_15350 13222 14895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 15465 14896 gene locus_tag LOCUS_15360 15465 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 15665 17605 gene locus_tag LOCUS_15370 15665 17605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 17722 18399 gene locus_tag LOCUS_15380 17722 18399 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141158.1 protein_id gnl|my_center|LOCUS_15380 18392 19321 gene locus_tag LOCUS_15390 18392 19321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 20166 19327 gene locus_tag LOCUS_15400 20166 19327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 20582 20427 gene locus_tag LOCUS_15410 20582 20427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 22937 21039 gene locus_tag LOCUS_15420 22937 21039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 23261 23073 gene locus_tag LOCUS_15430 23261 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 23612 23430 gene locus_tag LOCUS_15440 23612 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 23971 23807 gene locus_tag LOCUS_15450 23971 23807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 24261 24085 gene locus_tag LOCUS_15460 24261 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 27197 24345 gene locus_tag LOCUS_15470 27197 24345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 27867 27328 gene locus_tag LOCUS_15480 27867 27328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 29292 28414 gene locus_tag LOCUS_15490 29292 28414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 29905 30288 gene locus_tag LOCUS_15500 29905 30288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 30323 30493 gene locus_tag LOCUS_15510 30323 30493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 30728 30958 gene locus_tag LOCUS_15520 30728 30958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 31977 30916 gene locus_tag LOCUS_15530 gene hemB 31977 30916 CDS product delta-aminolevulinic acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ6 protein_id gnl|my_center|LOCUS_15530 32417 33442 gene locus_tag LOCUS_15540 gene isiA 32417 33442 CDS product iron stress-induced chlorophyll-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK20 protein_id gnl|my_center|LOCUS_15540 33611 34123 gene locus_tag LOCUS_15550 gene isiB 33611 34123 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNU5 protein_id gnl|my_center|LOCUS_15550 34644 35147 gene locus_tag LOCUS_15560 34644 35147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 35259 36155 gene locus_tag LOCUS_15570 gene hslO 35259 36155 CDS product 33 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIA2 protein_id gnl|my_center|LOCUS_15570 36516 38525 gene locus_tag LOCUS_15580 36516 38525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 38537 39829 gene locus_tag LOCUS_15590 38537 39829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 40395 39847 gene locus_tag LOCUS_15600 40395 39847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 40943 40608 gene locus_tag LOCUS_15610 40943 40608 CDS product putative 30S ribosomal protein PSRP-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59327 protein_id gnl|my_center|LOCUS_15610 41132 41941 gene locus_tag LOCUS_15620 41132 41941 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056155.1 protein_id gnl|my_center|LOCUS_15620 42006 42998 gene locus_tag LOCUS_15630 42006 42998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 43453 42899 gene locus_tag LOCUS_15640 43453 42899 CDS product 1,4-dihydroxy-2-naphthoyl-CoA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLK3 protein_id gnl|my_center|LOCUS_15640 44153 45436 gene locus_tag LOCUS_15650 44153 45436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 45937 45491 gene locus_tag LOCUS_15660 45937 45491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_15660 45980 46714 gene locus_tag LOCUS_15670 45980 46714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 46818 47531 gene locus_tag LOCUS_15680 46818 47531 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_15680 47528 48679 gene locus_tag LOCUS_15690 47528 48679 CDS product UPF0284 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGL0 protein_id gnl|my_center|LOCUS_15690 49804 49421 gene locus_tag LOCUS_15700 49804 49421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_15700 50073 51542 gene locus_tag LOCUS_15710 50073 51542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_15710 51812 53095 gene locus_tag LOCUS_15720 51812 53095 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089836.1 protein_id gnl|my_center|LOCUS_15720 53086 55143 gene locus_tag LOCUS_15730 53086 55143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 58576 55166 gene locus_tag LOCUS_15740 58576 55166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 60070 59111 gene locus_tag LOCUS_15750 60070 59111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057827.1 protein_id gnl|my_center|LOCUS_15750 60853 60302 gene locus_tag LOCUS_15760 60853 60302 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057826.1 protein_id gnl|my_center|LOCUS_15760 61320 60949 gene locus_tag LOCUS_15770 61320 60949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057825.1 protein_id gnl|my_center|LOCUS_15770 61937 61377 gene locus_tag LOCUS_15780 61937 61377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057824.1 protein_id gnl|my_center|LOCUS_15780 62619 62703 gene locus_tag LOCUS_t00130 62619 62703 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 62923 63615 gene locus_tag LOCUS_15790 62923 63615 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL51 protein_id gnl|my_center|LOCUS_15790 63700 64386 gene locus_tag LOCUS_15800 63700 64386 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_15800 64490 65023 gene locus_tag LOCUS_15810 gene cpcS 64490 65023 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI91 protein_id gnl|my_center|LOCUS_15810 65269 66099 gene locus_tag LOCUS_15820 65269 66099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 66269 67645 gene locus_tag LOCUS_15830 gene ndh 66269 67645 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_15830 67715 68755 gene locus_tag LOCUS_15840 67715 68755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_15840 69315 68752 gene locus_tag LOCUS_15850 69315 68752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 70780 69308 gene locus_tag LOCUS_15860 gene glgA 70780 69308 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DPS3 protein_id gnl|my_center|LOCUS_15860 71627 73126 gene locus_tag LOCUS_15870 71627 73126 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_15870 73315 73707 gene locus_tag LOCUS_15880 73315 73707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 74115 73678 gene locus_tag LOCUS_15890 74115 73678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 74867 74568 gene locus_tag LOCUS_15900 74867 74568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057560.1 protein_id gnl|my_center|LOCUS_15900 75629 75204 gene locus_tag LOCUS_15910 75629 75204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 76069 75629 gene locus_tag LOCUS_15920 gene aroH 76069 75629 CDS product chorismate mutase AroH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHZ0 protein_id gnl|my_center|LOCUS_15920 78142 76313 gene locus_tag LOCUS_15930 78142 76313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 79197 78142 gene locus_tag LOCUS_15940 gene murG 79197 78142 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY4 protein_id gnl|my_center|LOCUS_15940 79358 80215 gene locus_tag LOCUS_15950 79358 80215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_15950 81344 80433 gene locus_tag LOCUS_15960 81344 80433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 81608 82534 gene locus_tag LOCUS_15970 81608 82534 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_15970 84168 82531 gene locus_tag LOCUS_15980 84168 82531 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142834.1 protein_id gnl|my_center|LOCUS_15980 84302 85798 gene locus_tag LOCUS_15990 84302 85798 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812308.1 protein_id gnl|my_center|LOCUS_15990 87289 85814 gene locus_tag LOCUS_16000 87289 85814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 87914 87312 gene locus_tag LOCUS_16010 87914 87312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 88225 89601 gene locus_tag LOCUS_16020 88225 89601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143146.1 protein_id gnl|my_center|LOCUS_16020 89644 90135 gene locus_tag LOCUS_16030 89644 90135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 90528 91274 gene locus_tag LOCUS_16040 90528 91274 CDS product plastoquinol terminal oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140604.1 protein_id gnl|my_center|LOCUS_16040 91694 100627 gene locus_tag LOCUS_16050 91694 100627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 101304 100780 gene locus_tag LOCUS_16060 101304 100780 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_16060 101844 101326 gene locus_tag LOCUS_16070 101844 101326 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_16070 102382 101882 gene locus_tag LOCUS_16080 102382 101882 CDS product tail Collar domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528764.1 protein_id gnl|my_center|LOCUS_16080 103102 102473 gene locus_tag LOCUS_16090 103102 102473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 103404 103105 gene locus_tag LOCUS_16100 103404 103105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_639540.2 protein_id gnl|my_center|LOCUS_16100 105261 103639 gene locus_tag LOCUS_16110 gene spoIID 105261 103639 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_16110 105704 106792 gene locus_tag LOCUS_16120 105704 106792 CDS product peptidase M23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389350.1 protein_id gnl|my_center|LOCUS_16120 107532 106819 gene locus_tag LOCUS_16130 107532 106819 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056429.1 protein_id gnl|my_center|LOCUS_16130 107838 107548 gene locus_tag LOCUS_16140 107838 107548 CDS product UPF0367 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKQ5 protein_id gnl|my_center|LOCUS_16140 >Feature sequence11 1502 888 gene locus_tag LOCUS_16150 1502 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2213 3274 gene locus_tag LOCUS_16160 2213 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 3423 4802 gene locus_tag LOCUS_16170 gene glmU 3423 4802 CDS product bifunctional protein GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLT5 protein_id gnl|my_center|LOCUS_16170 5025 8495 gene locus_tag LOCUS_16180 5025 8495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 8660 9142 gene locus_tag LOCUS_16190 8660 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 9204 9956 gene locus_tag LOCUS_16200 9204 9956 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_16200 10367 10071 gene locus_tag LOCUS_16210 10367 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10809 12224 gene locus_tag LOCUS_16220 gene glcE 10809 12224 CDS product glycolate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143064.1 protein_id gnl|my_center|LOCUS_16220 12370 13302 gene locus_tag LOCUS_16230 12370 13302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 14971 13313 gene locus_tag LOCUS_16240 14971 13313 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_16240 16327 15017 gene locus_tag LOCUS_16250 gene hisD 16327 15017 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR2 protein_id gnl|my_center|LOCUS_16250 16950 18575 gene locus_tag LOCUS_16260 16950 18575 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_16260 18964 20001 gene locus_tag LOCUS_16270 18964 20001 CDS product D-fructose 1,6-bisphosphatase class 2/sedoheptulose 1,7-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE9 protein_id gnl|my_center|LOCUS_16270 20485 21795 gene locus_tag LOCUS_16280 gene hemA 20485 21795 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI53 protein_id gnl|my_center|LOCUS_16280 23889 21895 gene locus_tag LOCUS_16290 gene speA 23889 21895 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY6 protein_id gnl|my_center|LOCUS_16290 24596 25048 gene locus_tag LOCUS_16300 gene ndk 24596 25048 CDS product nucleoside diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM56 protein_id gnl|my_center|LOCUS_16300 25413 26150 gene locus_tag LOCUS_16310 25413 26150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 26353 27243 gene locus_tag LOCUS_16320 26353 27243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 27302 28498 gene locus_tag LOCUS_16330 27302 28498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 28685 28960 gene locus_tag LOCUS_16340 28685 28960 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_16340 29080 29355 gene locus_tag LOCUS_16350 29080 29355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 29908 29444 gene locus_tag LOCUS_16360 29908 29444 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_16360 30531 30229 gene locus_tag LOCUS_16370 gene rpsN 30531 30229 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW7 protein_id gnl|my_center|LOCUS_16370 32694 30715 gene locus_tag LOCUS_16380 gene ftsH 32694 30715 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW1 protein_id gnl|my_center|LOCUS_16380 34209 33004 gene locus_tag LOCUS_16390 34209 33004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 34975 34415 gene locus_tag LOCUS_16400 34975 34415 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404744.1 protein_id gnl|my_center|LOCUS_16400 35481 34981 gene locus_tag LOCUS_16410 35481 34981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 36084 35515 gene locus_tag LOCUS_16420 36084 35515 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_16420 38226 36232 gene locus_tag LOCUS_16430 38226 36232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 38729 41017 gene locus_tag LOCUS_16440 38729 41017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 42057 41209 gene locus_tag LOCUS_16450 gene tsf 42057 41209 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q87MD9 protein_id gnl|my_center|LOCUS_16450 43194 42250 gene locus_tag LOCUS_16460 43194 42250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_16460 43619 43191 gene locus_tag LOCUS_16470 43619 43191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_16470 43924 44259 gene locus_tag LOCUS_16480 gene petJ 43924 44259 CDS product cytochrome c6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X9 protein_id gnl|my_center|LOCUS_16480 44752 46221 gene locus_tag LOCUS_16490 gene glcF 44752 46221 CDS product glycolate oxidase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCA7 protein_id gnl|my_center|LOCUS_16490 46272 46565 gene locus_tag LOCUS_16500 46272 46565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 protein_id gnl|my_center|LOCUS_16500 51576 46639 gene locus_tag LOCUS_16510 51576 46639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 52001 51738 gene locus_tag LOCUS_16520 52001 51738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 52150 52386 gene locus_tag LOCUS_16530 52150 52386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 52386 52802 gene locus_tag LOCUS_16540 gene mvpA 52386 52802 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q3IV79 protein_id gnl|my_center|LOCUS_16540 53411 52848 gene locus_tag LOCUS_16550 53411 52848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 54589 53555 gene locus_tag LOCUS_16560 gene chlG 54589 53555 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057379.1 protein_id gnl|my_center|LOCUS_16560 55803 54697 gene locus_tag LOCUS_16570 55803 54697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_16570 56144 55944 gene locus_tag LOCUS_16580 56144 55944 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_16580 56293 57075 gene locus_tag LOCUS_16590 gene hisF 56293 57075 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN7 protein_id gnl|my_center|LOCUS_16590 57294 57614 gene locus_tag LOCUS_16600 57294 57614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 57714 57786 gene locus_tag LOCUS_t00140 57714 57786 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 57876 58406 gene locus_tag LOCUS_16610 57876 58406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 58542 58778 gene locus_tag LOCUS_16620 58542 58778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 59188 60267 gene locus_tag LOCUS_16630 gene mraY 59188 60267 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK95 protein_id gnl|my_center|LOCUS_16630 60787 61368 gene locus_tag LOCUS_16640 60787 61368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 61466 63742 gene locus_tag LOCUS_16650 gene ndh 61466 63742 CDS product bifunctional NADH dehydrogenase FAD-containing subunit/selenide,water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124488.1 protein_id gnl|my_center|LOCUS_16650 63758 65221 gene locus_tag LOCUS_16660 63758 65221 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057573.1 protein_id gnl|my_center|LOCUS_16660 66861 65251 gene locus_tag LOCUS_16670 66861 65251 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_16670 67710 69227 gene locus_tag LOCUS_16680 67710 69227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 69374 73873 gene locus_tag LOCUS_16690 69374 73873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 74086 73928 gene locus_tag LOCUS_16700 74086 73928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 74279 75979 gene locus_tag LOCUS_16710 74279 75979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 76177 77085 gene locus_tag LOCUS_16720 76177 77085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 78526 77837 gene locus_tag LOCUS_16730 78526 77837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 79059 78631 gene locus_tag LOCUS_16740 79059 78631 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL47 protein_id gnl|my_center|LOCUS_16740 79155 82358 gene locus_tag LOCUS_16750 gene clpB2 79155 82358 CDS product chaperone protein ClpB 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG71 protein_id gnl|my_center|LOCUS_16750 82776 82435 gene locus_tag LOCUS_16760 82776 82435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_16760 82957 83568 gene locus_tag LOCUS_16770 gene aat 82957 83568 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKJ8 protein_id gnl|my_center|LOCUS_16770 83972 84835 gene locus_tag LOCUS_16780 83972 84835 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142637.1 protein_id gnl|my_center|LOCUS_16780 91697 84924 gene locus_tag LOCUS_16790 91697 84924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 92399 93115 gene locus_tag LOCUS_16800 92399 93115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 93163 93690 gene locus_tag LOCUS_16810 93163 93690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056576.1 protein_id gnl|my_center|LOCUS_16810 93767 94168 gene locus_tag LOCUS_16820 93767 94168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 94314 94922 gene locus_tag LOCUS_16830 94314 94922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 95790 95092 gene locus_tag LOCUS_16840 95790 95092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056315.1 protein_id gnl|my_center|LOCUS_16840 96639 96010 gene locus_tag LOCUS_16850 96639 96010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_16850 96846 97658 gene locus_tag LOCUS_16860 96846 97658 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_16860 97843 98934 gene locus_tag LOCUS_16870 97843 98934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 99796 98972 gene locus_tag LOCUS_16880 99796 98972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 100859 99960 gene locus_tag LOCUS_16890 100859 99960 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 protein_id gnl|my_center|LOCUS_16890 102354 100936 gene locus_tag LOCUS_16900 102354 100936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058234.1 protein_id gnl|my_center|LOCUS_16900 103590 102373 gene locus_tag LOCUS_16910 gene ruvB 103590 102373 CDS product Holliday junction ATP-dependent DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGR1 protein_id gnl|my_center|LOCUS_16910 104116 103619 gene locus_tag LOCUS_16920 104116 103619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 105292 104189 gene locus_tag LOCUS_16930 105292 104189 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_16930 105590 106078 gene locus_tag LOCUS_16940 105590 106078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 106175 107074 gene locus_tag LOCUS_16950 106175 107074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_16950 107213 107046 gene locus_tag LOCUS_16960 107213 107046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 107790 107554 gene locus_tag LOCUS_16970 107790 107554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 108643 107924 gene locus_tag LOCUS_16980 108643 107924 CDS product quercetin 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence12 2012 654 gene locus_tag LOCUS_16990 2012 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3402 2059 gene locus_tag LOCUS_17000 3402 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3960 4781 gene locus_tag LOCUS_17010 3960 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084260.1 protein_id gnl|my_center|LOCUS_17010 4881 5354 gene locus_tag LOCUS_17020 4881 5354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 6594 5359 gene locus_tag LOCUS_17030 gene ribD 6594 5359 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH08 protein_id gnl|my_center|LOCUS_17030 6770 7087 gene locus_tag LOCUS_17040 6770 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 7190 7867 gene locus_tag LOCUS_17050 7190 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 7936 8655 gene locus_tag LOCUS_17060 gene yhdW 7936 8655 CDS product putative glycerophosphoryl diester phosphodiesterase YhdW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O07592 protein_id gnl|my_center|LOCUS_17060 8751 10157 gene locus_tag LOCUS_17070 gene leuC 8751 10157 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFV7 protein_id gnl|my_center|LOCUS_17070 11088 10183 gene locus_tag LOCUS_17080 11088 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 12373 11264 gene locus_tag LOCUS_17090 12373 11264 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_17090 14499 12463 gene locus_tag LOCUS_17100 14499 12463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 15007 14567 gene locus_tag LOCUS_17110 15007 14567 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142398.1 protein_id gnl|my_center|LOCUS_17110 15647 14991 gene locus_tag LOCUS_17120 15647 14991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_17120 15836 16675 gene locus_tag LOCUS_17130 15836 16675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056104.1 protein_id gnl|my_center|LOCUS_17130 16770 17162 gene locus_tag LOCUS_17140 16770 17162 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109280.1 protein_id gnl|my_center|LOCUS_17140 17331 18413 gene locus_tag LOCUS_17150 gene fbaA 17331 18413 CDS product fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_17150 20525 18618 gene locus_tag LOCUS_17160 20525 18618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 20953 21744 gene locus_tag LOCUS_17170 20953 21744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 22116 21916 gene locus_tag LOCUS_17180 22116 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 22471 22851 gene locus_tag LOCUS_17190 22471 22851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 22982 24544 gene locus_tag LOCUS_17200 22982 24544 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918532.1 protein_id gnl|my_center|LOCUS_17200 24605 25465 gene locus_tag LOCUS_17210 gene folP 24605 25465 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ9 protein_id gnl|my_center|LOCUS_17210 25539 25880 gene locus_tag LOCUS_17220 25539 25880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 26438 25983 gene locus_tag LOCUS_17230 26438 25983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 27424 26462 gene locus_tag LOCUS_17240 27424 26462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_17240 27631 29010 gene locus_tag LOCUS_17250 gene murD 27631 29010 CDS product UDP-N-acetylmuramoylalanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMN8 protein_id gnl|my_center|LOCUS_17250 29141 30022 gene locus_tag LOCUS_17260 gene fabD 29141 30022 CDS product malonyl CoA-acyl carrier protein transacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMS0 protein_id gnl|my_center|LOCUS_17260 30103 30175 gene locus_tag LOCUS_t00150 30103 30175 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 30718 30323 gene locus_tag LOCUS_17270 30718 30323 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_17270 30944 30699 gene locus_tag LOCUS_17280 30944 30699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 31858 32952 gene locus_tag LOCUS_17290 31858 32952 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI38 protein_id gnl|my_center|LOCUS_17290 34229 33096 gene locus_tag LOCUS_17300 34229 33096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 34595 35500 gene locus_tag LOCUS_17310 34595 35500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_17310 35634 36932 gene locus_tag LOCUS_17320 35634 36932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 37066 38637 gene locus_tag LOCUS_17330 37066 38637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 38897 39772 gene locus_tag LOCUS_17340 38897 39772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057453.1 protein_id gnl|my_center|LOCUS_17340 39909 41168 gene locus_tag LOCUS_17350 39909 41168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 41239 41700 gene locus_tag LOCUS_17360 gene dnaJ 41239 41700 CDS product heat-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_17360 41763 42041 gene locus_tag LOCUS_17370 41763 42041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_17370 43090 42038 gene locus_tag LOCUS_17380 43090 42038 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144177.1 protein_id gnl|my_center|LOCUS_17380 43918 43292 gene locus_tag LOCUS_17390 43918 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 44780 46195 gene locus_tag LOCUS_17400 44780 46195 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD2 protein_id gnl|my_center|LOCUS_17400 46354 48111 gene locus_tag LOCUS_17410 46354 48111 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_17410 48122 48688 gene locus_tag LOCUS_17420 48122 48688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104398.1 protein_id gnl|my_center|LOCUS_17420 48839 49357 gene locus_tag LOCUS_17430 48839 49357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 49644 49492 gene locus_tag LOCUS_17440 49644 49492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 50899 49895 gene locus_tag LOCUS_17450 gene gpsA 50899 49895 CDS product glycerol-3-phosphate dehydrogenase [NAD(P)+] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NF59 protein_id gnl|my_center|LOCUS_17450 50985 51791 gene locus_tag LOCUS_17460 50985 51791 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266205.1 protein_id gnl|my_center|LOCUS_17460 52231 52097 gene locus_tag LOCUS_17470 52231 52097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 53265 52309 gene locus_tag LOCUS_17480 53265 52309 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_17480 54293 53304 gene locus_tag LOCUS_17490 gene thrB 54293 53304 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI27 protein_id gnl|my_center|LOCUS_17490 54763 54296 gene locus_tag LOCUS_17500 54763 54296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056602.1 protein_id gnl|my_center|LOCUS_17500 55536 54832 gene locus_tag LOCUS_17510 55536 54832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058104.1 protein_id gnl|my_center|LOCUS_17510 55647 56534 gene locus_tag LOCUS_17520 55647 56534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_17520 57747 56647 gene locus_tag LOCUS_17530 57747 56647 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889292.1 protein_id gnl|my_center|LOCUS_17530 58345 59883 gene locus_tag LOCUS_17540 58345 59883 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 protein_id gnl|my_center|LOCUS_17540 60584 60009 gene locus_tag LOCUS_17550 60584 60009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 60914 61786 gene locus_tag LOCUS_17560 60914 61786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_17560 61850 63055 gene locus_tag LOCUS_17570 61850 63055 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 protein_id gnl|my_center|LOCUS_17570 63963 63157 gene locus_tag LOCUS_17580 63963 63157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 64145 64585 gene locus_tag LOCUS_17590 64145 64585 CDS product putative pre-16S rRNA nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI8 protein_id gnl|my_center|LOCUS_17590 66084 64582 gene locus_tag LOCUS_17600 gene cry 66084 64582 CDS product cryptochrome DASH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMD1 protein_id gnl|my_center|LOCUS_17600 66481 66242 gene locus_tag LOCUS_17610 66481 66242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 66936 66586 gene locus_tag LOCUS_17620 gene ndhM 66936 66586 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKF6 protein_id gnl|my_center|LOCUS_17620 67161 67913 gene locus_tag LOCUS_17630 67161 67913 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057070.1 protein_id gnl|my_center|LOCUS_17630 68043 68579 gene locus_tag LOCUS_17640 68043 68579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057876.1 protein_id gnl|my_center|LOCUS_17640 69392 68598 gene locus_tag LOCUS_17650 69392 68598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 69900 70070 gene locus_tag LOCUS_17660 69900 70070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 70022 72712 gene locus_tag LOCUS_17670 70022 72712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 73114 72692 gene locus_tag LOCUS_17680 73114 72692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 73328 74497 gene locus_tag LOCUS_17690 73328 74497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_17690 75684 74530 gene locus_tag LOCUS_17700 gene pyrD 75684 74530 CDS product dihydroorotate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLB7 protein_id gnl|my_center|LOCUS_17700 76404 75742 gene locus_tag LOCUS_17710 76404 75742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 76746 78473 gene locus_tag LOCUS_17720 76746 78473 CDS product iron(III) ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057549.1 protein_id gnl|my_center|LOCUS_17720 79669 78548 gene locus_tag LOCUS_17730 79669 78548 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_17730 80271 79699 gene locus_tag LOCUS_17740 80271 79699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 80270 80926 gene locus_tag LOCUS_17750 gene hisH 80270 80926 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP5 protein_id gnl|my_center|LOCUS_17750 81021 81440 gene locus_tag LOCUS_17760 81021 81440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_17760 81784 81473 gene locus_tag LOCUS_17770 81784 81473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 82532 82347 gene locus_tag LOCUS_17780 82532 82347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 82531 82704 gene locus_tag LOCUS_17790 82531 82704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 82921 84342 gene locus_tag LOCUS_17800 82921 84342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 84496 84347 gene locus_tag LOCUS_17810 84496 84347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 84696 86702 gene locus_tag LOCUS_17820 84696 86702 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS5 protein_id gnl|my_center|LOCUS_17820 86804 89152 gene locus_tag LOCUS_17830 86804 89152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 89221 90204 gene locus_tag LOCUS_17840 89221 90204 CDS product Zn-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729098.1 protein_id gnl|my_center|LOCUS_17840 90578 90210 gene locus_tag LOCUS_17850 90578 90210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17850 91506 91018 gene locus_tag LOCUS_17860 gene psaL 91506 91018 CDS product photosystem I reaction center subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O87787 protein_id gnl|my_center|LOCUS_17860 91755 91540 gene locus_tag LOCUS_17870 91755 91540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 91899 91774 gene locus_tag LOCUS_17880 gene psaJ 91899 91774 CDS product photosystem I reaction center subunit IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A429 protein_id gnl|my_center|LOCUS_17880 92491 92009 gene locus_tag LOCUS_17890 gene psaF 92491 92009 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A401 protein_id gnl|my_center|LOCUS_17890 92724 93776 gene locus_tag LOCUS_17900 gene tsaD 92724 93776 CDS product tRNA N6-adenosine threonylcarbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI9 protein_id gnl|my_center|LOCUS_17900 95229 93787 gene locus_tag LOCUS_17910 95229 93787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 95662 98403 gene locus_tag LOCUS_17920 95662 98403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 98610 98765 gene locus_tag LOCUS_17930 98610 98765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 99196 102759 gene locus_tag LOCUS_17940 99196 102759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 103430 103260 gene locus_tag LOCUS_17950 103430 103260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 104586 103570 gene locus_tag LOCUS_17960 104586 103570 CDS product putative short-chain dehydrogenase/reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001702148.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence13 1255 2163 gene locus_tag LOCUS_17970 1255 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 2301 2217 gene locus_tag LOCUS_t00160 2301 2217 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3526 2402 gene locus_tag LOCUS_17980 3526 2402 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_17980 3874 4113 gene locus_tag LOCUS_17990 gene ndhL 3874 4113 CDS product NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ3 protein_id gnl|my_center|LOCUS_17990 4301 4630 gene locus_tag LOCUS_18000 4301 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_18000 4699 5496 gene locus_tag LOCUS_18010 gene trpA 4699 5496 CDS product tryptophan synthase alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN9 protein_id gnl|my_center|LOCUS_18010 6126 5527 gene locus_tag LOCUS_18020 6126 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 6308 6559 gene locus_tag LOCUS_18030 6308 6559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 6711 7148 gene locus_tag LOCUS_18040 6711 7148 CDS product heavy metal-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057725.1 protein_id gnl|my_center|LOCUS_18040 7226 8380 gene locus_tag LOCUS_18050 7226 8380 CDS product arsenical-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_18050 8647 9042 gene locus_tag LOCUS_18060 8647 9042 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_18060 10564 9080 gene locus_tag LOCUS_18070 10564 9080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 10854 11201 gene locus_tag LOCUS_18080 10854 11201 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 protein_id gnl|my_center|LOCUS_18080 11198 12667 gene locus_tag LOCUS_18090 gene ndhD5 11198 12667 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057654.1 protein_id gnl|my_center|LOCUS_18090 12670 13059 gene locus_tag LOCUS_18100 12670 13059 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_18100 13077 13307 gene locus_tag LOCUS_18110 13077 13307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_18110 13322 13606 gene locus_tag LOCUS_18120 13322 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057651.1 protein_id gnl|my_center|LOCUS_18120 13599 14375 gene locus_tag LOCUS_18130 13599 14375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 14411 15103 gene locus_tag LOCUS_18140 14411 15103 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_18140 15233 16768 gene locus_tag LOCUS_18150 15233 16768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141950.1 protein_id gnl|my_center|LOCUS_18150 17735 16791 gene locus_tag LOCUS_18160 17735 16791 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_18160 17865 18074 gene locus_tag LOCUS_18170 17865 18074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 18187 18816 gene locus_tag LOCUS_18180 18187 18816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 18985 19896 gene locus_tag LOCUS_18190 18985 19896 CDS product glycosyl transferase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141255.1 protein_id gnl|my_center|LOCUS_18190 19897 20496 gene locus_tag LOCUS_18200 19897 20496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 21678 20500 gene locus_tag LOCUS_18210 gene purK 21678 20500 CDS product N5-carboxyaminoimidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJG7 protein_id gnl|my_center|LOCUS_18210 22328 21795 gene locus_tag LOCUS_18220 22328 21795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125313.1 protein_id gnl|my_center|LOCUS_18220 22525 22887 gene locus_tag LOCUS_18230 22525 22887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_18230 23160 23792 gene locus_tag LOCUS_18240 23160 23792 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 protein_id gnl|my_center|LOCUS_18240 25968 23923 gene locus_tag LOCUS_18250 gene ndhF 25968 23923 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140222.1 protein_id gnl|my_center|LOCUS_18250 26643 26290 gene locus_tag LOCUS_18260 gene trxM2 26643 26290 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH72 protein_id gnl|my_center|LOCUS_18260 27724 26990 gene locus_tag LOCUS_18270 27724 26990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_18270 28065 29033 gene locus_tag LOCUS_18280 gene ycf30 28065 29033 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_18280 29415 31100 gene locus_tag LOCUS_18290 29415 31100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_18290 31163 31915 gene locus_tag LOCUS_18300 31163 31915 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_18300 31984 32916 gene locus_tag LOCUS_18310 31984 32916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_18310 33029 33988 gene locus_tag LOCUS_18320 33029 33988 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_18320 33981 34571 gene locus_tag LOCUS_18330 gene gmhB 33981 34571 CDS product D-glycero-D-manno-heptose-1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH26 protein_id gnl|my_center|LOCUS_18330 35428 34637 gene locus_tag LOCUS_18340 35428 34637 CDS product serine/threonine protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_18340 35831 36418 gene locus_tag LOCUS_18350 35831 36418 CDS product segregation and condensation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJH4 protein_id gnl|my_center|LOCUS_18350 38587 36491 gene locus_tag LOCUS_18360 38587 36491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 38872 39726 gene locus_tag LOCUS_18370 38872 39726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 40406 39771 gene locus_tag LOCUS_18380 40406 39771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 40566 41138 gene locus_tag LOCUS_18390 40566 41138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 42378 41215 gene locus_tag LOCUS_18400 gene moeB 42378 41215 CDS product molybdenum cofactor biosynthesis protein MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_18400 43106 42543 gene locus_tag LOCUS_18410 43106 42543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_18410 43375 43605 gene locus_tag LOCUS_18420 gene cp12 43375 43605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_18420 43865 44458 gene locus_tag LOCUS_18430 43865 44458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_18430 44483 44776 gene locus_tag LOCUS_18440 44483 44776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 45850 44858 gene locus_tag LOCUS_18450 45850 44858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920393.1 protein_id gnl|my_center|LOCUS_18450 46259 45894 gene locus_tag LOCUS_18460 46259 45894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 46771 48102 gene locus_tag LOCUS_18470 46771 48102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057686.1 protein_id gnl|my_center|LOCUS_18470 49230 48154 gene locus_tag LOCUS_18480 49230 48154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_18480 49596 49970 gene locus_tag LOCUS_18490 49596 49970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 50144 50800 gene locus_tag LOCUS_18500 gene trmB 50144 50800 CDS product tRNA (guanine-N(7)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH6 protein_id gnl|my_center|LOCUS_18500 51265 50804 gene locus_tag LOCUS_18510 51265 50804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 52383 51295 gene locus_tag LOCUS_18520 52383 51295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 54057 52474 gene locus_tag LOCUS_18530 54057 52474 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_18530 55427 54315 gene locus_tag LOCUS_18540 55427 54315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 56621 55647 gene locus_tag LOCUS_18550 56621 55647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 60733 56666 gene locus_tag LOCUS_18560 60733 56666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 60957 60742 gene locus_tag LOCUS_18570 60957 60742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 61171 63702 gene locus_tag LOCUS_18580 61171 63702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 63790 64923 gene locus_tag LOCUS_18590 63790 64923 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_18590 65054 64983 gene locus_tag LOCUS_t00170 65054 64983 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65125 65646 gene locus_tag LOCUS_18600 65125 65646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 65897 65703 gene locus_tag LOCUS_18610 65897 65703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 66635 68134 gene locus_tag LOCUS_18620 66635 68134 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_18620 68195 71368 gene locus_tag LOCUS_18630 68195 71368 CDS product acriflavine resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_18630 72448 71411 gene locus_tag LOCUS_18640 72448 71411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 72688 72903 gene locus_tag LOCUS_18650 72688 72903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_18650 72940 73095 gene locus_tag LOCUS_18660 72940 73095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 73460 73795 gene locus_tag LOCUS_18670 73460 73795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 73925 74674 gene locus_tag LOCUS_18680 73925 74674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 75074 74742 gene locus_tag LOCUS_18690 75074 74742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_18690 75623 75258 gene locus_tag LOCUS_18700 75623 75258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_18700 76437 75886 gene locus_tag LOCUS_18710 76437 75886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 77096 77551 gene locus_tag LOCUS_18720 77096 77551 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055874.1 protein_id gnl|my_center|LOCUS_18720 77819 79114 gene locus_tag LOCUS_18730 gene purB 77819 79114 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW4 protein_id gnl|my_center|LOCUS_18730 80166 79156 gene locus_tag LOCUS_18740 80166 79156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 82842 80647 gene locus_tag LOCUS_18750 gene psaB 82842 80647 CDS product photosystem I P700 chlorophyll a apoprotein A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A407 protein_id gnl|my_center|LOCUS_18750 85151 82902 gene locus_tag LOCUS_18760 gene psaA 85151 82902 CDS product photosystem I P700 chlorophyll a apoprotein A1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A405 protein_id gnl|my_center|LOCUS_18760 87496 85526 gene locus_tag LOCUS_18770 gene acsA 87496 85526 CDS product acetyl-coenzyme A synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH2 protein_id gnl|my_center|LOCUS_18770 87819 88274 gene locus_tag LOCUS_18780 87819 88274 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143294.1 protein_id gnl|my_center|LOCUS_18780 89698 88343 gene locus_tag LOCUS_18790 89698 88343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037869.1 protein_id gnl|my_center|LOCUS_18790 91168 89813 gene locus_tag LOCUS_18800 91168 89813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 92376 91315 gene locus_tag LOCUS_18810 92376 91315 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141637.1 protein_id gnl|my_center|LOCUS_18810 93743 92601 gene locus_tag LOCUS_18820 93743 92601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 94140 95858 gene locus_tag LOCUS_18830 94140 95858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18830 96161 98422 gene locus_tag LOCUS_18840 96161 98422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 98521 98841 gene locus_tag LOCUS_18850 98521 98841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143090.1 protein_id gnl|my_center|LOCUS_18850 99109 100638 gene locus_tag LOCUS_18860 gene psbB 99109 100638 CDS product photosystem II CP47 reaction center protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIQ1 protein_id gnl|my_center|LOCUS_18860 101324 101788 gene locus_tag LOCUS_18870 gene nrdR 101324 101788 CDS product transcriptional repressor NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHT4 protein_id gnl|my_center|LOCUS_18870 102093 103064 gene locus_tag LOCUS_18880 102093 103064 CDS product paraslipin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_18880 104334 103075 gene locus_tag LOCUS_18890 104334 103075 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_18890 105165 104353 gene locus_tag LOCUS_18900 105165 104353 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMH9 protein_id gnl|my_center|LOCUS_18900 105883 105317 gene locus_tag LOCUS_18910 gene ycf4 105883 105317 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ41 protein_id gnl|my_center|LOCUS_18910 >Feature sequence14 622 1107 gene locus_tag LOCUS_18920 622 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 1168 1476 gene locus_tag LOCUS_18930 1168 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 1540 2673 gene locus_tag LOCUS_18940 1540 2673 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143424.1 protein_id gnl|my_center|LOCUS_18940 4531 2687 gene locus_tag LOCUS_18950 4531 2687 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055904.1 protein_id gnl|my_center|LOCUS_18950 4929 5732 gene locus_tag LOCUS_18960 4929 5732 CDS product protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_18960 6654 5809 gene locus_tag LOCUS_18970 6654 5809 CDS product universal stress protein UspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057366.1 protein_id gnl|my_center|LOCUS_18970 6994 7449 gene locus_tag LOCUS_18980 6994 7449 CDS product 4-hydroxybenzoyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964360.1 protein_id gnl|my_center|LOCUS_18980 7606 7884 gene locus_tag LOCUS_18990 7606 7884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 7948 8181 gene locus_tag LOCUS_19000 7948 8181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142550.1 protein_id gnl|my_center|LOCUS_19000 9291 8206 gene locus_tag LOCUS_19010 9291 8206 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_19010 10524 9472 gene locus_tag LOCUS_19020 10524 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 11151 10879 gene locus_tag LOCUS_19030 11151 10879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 12131 11523 gene locus_tag LOCUS_19040 12131 11523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12659 12985 gene locus_tag LOCUS_19050 12659 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 13076 13981 gene locus_tag LOCUS_19060 13076 13981 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_19060 14018 14800 gene locus_tag LOCUS_19070 14018 14800 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057158.1 protein_id gnl|my_center|LOCUS_19070 15985 14846 gene locus_tag LOCUS_19080 15985 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 18834 16117 gene locus_tag LOCUS_19090 18834 16117 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_19090 19894 19007 gene locus_tag LOCUS_19100 19894 19007 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_19100 20973 19900 gene locus_tag LOCUS_19110 20973 19900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 21851 21264 gene locus_tag LOCUS_19120 21851 21264 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057261.1 protein_id gnl|my_center|LOCUS_19120 22158 22592 gene locus_tag LOCUS_19130 22158 22592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 22731 23423 gene locus_tag LOCUS_19140 22731 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_19140 23520 24197 gene locus_tag LOCUS_19150 gene nusB 23520 24197 CDS product N utilization substance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKZ0 protein_id gnl|my_center|LOCUS_19150 24308 26110 gene locus_tag LOCUS_19160 24308 26110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 26364 26543 gene locus_tag LOCUS_19170 26364 26543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 26999 26607 gene locus_tag LOCUS_19180 26999 26607 CDS product reactive intermediate/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_19180 27467 29086 gene locus_tag LOCUS_19190 27467 29086 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_19190 29865 29230 gene locus_tag LOCUS_19200 29865 29230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_19200 30014 32008 gene locus_tag LOCUS_19210 30014 32008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 32718 32080 gene locus_tag LOCUS_19220 32718 32080 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143281.1 protein_id gnl|my_center|LOCUS_19220 33997 33020 gene locus_tag LOCUS_19230 33997 33020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 34707 34000 gene locus_tag LOCUS_19240 34707 34000 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHX1 protein_id gnl|my_center|LOCUS_19240 36009 34831 gene locus_tag LOCUS_19250 36009 34831 CDS product glycosyl transferase family 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_19250 36800 36072 gene locus_tag LOCUS_19260 36800 36072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 37039 39129 gene locus_tag LOCUS_19270 37039 39129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 39455 41227 gene locus_tag LOCUS_19280 gene ilvG 39455 41227 CDS product acetolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJD1 protein_id gnl|my_center|LOCUS_19280 41913 41341 gene locus_tag LOCUS_19290 41913 41341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 44910 42058 gene locus_tag LOCUS_19300 44910 42058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 48060 46573 gene locus_tag LOCUS_19310 gene ffh 48060 46573 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHI6 protein_id gnl|my_center|LOCUS_19310 48643 48155 gene locus_tag LOCUS_19320 48643 48155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_19320 48924 49883 gene locus_tag LOCUS_19330 48924 49883 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP3 protein_id gnl|my_center|LOCUS_19330 49998 49926 gene locus_tag LOCUS_t00180 49998 49926 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 51715 50243 gene locus_tag LOCUS_19340 51715 50243 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHH4 protein_id gnl|my_center|LOCUS_19340 52510 53412 gene locus_tag LOCUS_19350 52510 53412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 53576 54049 gene locus_tag LOCUS_19360 53576 54049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084229.1 protein_id gnl|my_center|LOCUS_19360 54049 54288 gene locus_tag LOCUS_19370 54049 54288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 54577 55128 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcactccctccaatccacttgaattaatggaaac 55170 55787 gene locus_tag LOCUS_19380 55170 55787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 58506 55837 gene locus_tag LOCUS_19390 58506 55837 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056205.1 protein_id gnl|my_center|LOCUS_19390 58545 58757 gene locus_tag LOCUS_19400 58545 58757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 58739 59419 gene locus_tag LOCUS_19410 58739 59419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 60233 59331 gene locus_tag LOCUS_19420 60233 59331 CDS product 6-pyruvoyltetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_19420 60862 60260 gene locus_tag LOCUS_19430 gene gmk 60862 60260 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ7 protein_id gnl|my_center|LOCUS_19430 61171 61887 gene locus_tag LOCUS_19440 61171 61887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 61887 63668 gene locus_tag LOCUS_19450 61887 63668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 64517 63699 gene locus_tag LOCUS_19460 64517 63699 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227632.1 protein_id gnl|my_center|LOCUS_19460 65930 64671 gene locus_tag LOCUS_19470 65930 64671 CDS product glycosyltransferase WbuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_19470 66232 66762 gene locus_tag LOCUS_19480 66232 66762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 66858 66998 gene locus_tag LOCUS_19490 66858 66998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 67075 67512 gene locus_tag LOCUS_19500 67075 67512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 67645 69402 gene locus_tag LOCUS_19510 67645 69402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257660.1 protein_id gnl|my_center|LOCUS_19510 69477 71537 gene locus_tag LOCUS_19520 69477 71537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 71750 74140 gene locus_tag LOCUS_19530 71750 74140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 74225 75913 gene locus_tag LOCUS_19540 74225 75913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 76000 77358 gene locus_tag LOCUS_19550 76000 77358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 77444 78949 gene locus_tag LOCUS_19560 77444 78949 CDS product lignostilbene alpha-beta-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_19560 78976 80031 gene locus_tag LOCUS_19570 gene hisC 78976 80031 CDS product histidinol-phosphate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P61000 protein_id gnl|my_center|LOCUS_19570 80526 80927 gene locus_tag LOCUS_19580 80526 80927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 81836 81078 gene locus_tag LOCUS_19590 gene ycf23 81836 81078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_19590 82907 81936 gene locus_tag LOCUS_19600 82907 81936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 83008 83355 gene locus_tag LOCUS_19610 83008 83355 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340579.1 protein_id gnl|my_center|LOCUS_19610 83432 84541 gene locus_tag LOCUS_19620 83432 84541 CDS product S-(hydroxymethyl)glutathione dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q2RNU6 protein_id gnl|my_center|LOCUS_19620 85102 84557 gene locus_tag LOCUS_19630 85102 84557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 86923 85595 gene locus_tag LOCUS_19640 86923 85595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 87445 88317 gene locus_tag LOCUS_19650 87445 88317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140303.1 protein_id gnl|my_center|LOCUS_19650 88665 89957 gene locus_tag LOCUS_19660 gene ftsZ 88665 89957 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNW0 protein_id gnl|my_center|LOCUS_19660 89978 90802 gene locus_tag LOCUS_19670 89978 90802 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_19670 91850 90855 gene locus_tag LOCUS_19680 91850 90855 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142814.1 protein_id gnl|my_center|LOCUS_19680 92925 91987 gene locus_tag LOCUS_19690 92925 91987 CDS product glycosyl transferase family A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_19690 94929 93319 gene locus_tag LOCUS_19700 94929 93319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_19700 95766 95026 gene locus_tag LOCUS_19710 95766 95026 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056208.1 protein_id gnl|my_center|LOCUS_19710 95935 99486 gene locus_tag LOCUS_19720 95935 99486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 99506 99721 gene locus_tag LOCUS_19730 99506 99721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 99714 100109 gene locus_tag LOCUS_19740 gene vapC 99714 100109 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8Z2U3 protein_id gnl|my_center|LOCUS_19740 100417 100788 gene locus_tag LOCUS_19750 100417 100788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 101956 100844 gene locus_tag LOCUS_19760 101956 100844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 102803 102057 gene locus_tag LOCUS_19770 102803 102057 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056010.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence15 710 408 gene locus_tag LOCUS_19780 710 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 1180 1022 gene locus_tag LOCUS_19790 1180 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1145 1795 gene locus_tag LOCUS_19800 1145 1795 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI28 protein_id gnl|my_center|LOCUS_19800 2349 4577 gene locus_tag LOCUS_19810 2349 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 4652 6001 gene locus_tag LOCUS_19820 gene proA 4652 6001 CDS product gamma-glutamyl phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU1 protein_id gnl|my_center|LOCUS_19820 6187 7503 gene locus_tag LOCUS_19830 6187 7503 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_19830 7668 7922 gene locus_tag LOCUS_19840 gene ycf19 7668 7922 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_19840 9100 8135 gene locus_tag LOCUS_19850 gene fcl 9100 8135 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL64 protein_id gnl|my_center|LOCUS_19850 10309 9233 gene locus_tag LOCUS_19860 gene gmd 10309 9233 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL63 protein_id gnl|my_center|LOCUS_19860 11050 10511 gene locus_tag LOCUS_19870 11050 10511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 12435 11500 gene locus_tag LOCUS_19880 12435 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 12703 13614 gene locus_tag LOCUS_19890 12703 13614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 13607 14701 gene locus_tag LOCUS_19900 gene thiL 13607 14701 CDS product thiamine-monophosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGF1 protein_id gnl|my_center|LOCUS_19900 16052 14775 gene locus_tag LOCUS_19910 16052 14775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 16149 17945 gene locus_tag LOCUS_19920 gene proS 16149 17945 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKT0 protein_id gnl|my_center|LOCUS_19920 18019 18861 gene locus_tag LOCUS_19930 18019 18861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 18892 19683 gene locus_tag LOCUS_19940 18892 19683 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL42 protein_id gnl|my_center|LOCUS_19940 19754 20671 gene locus_tag LOCUS_19950 19754 20671 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_19950 22074 20728 gene locus_tag LOCUS_19960 22074 20728 CDS product protoporphyrin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NP87 protein_id gnl|my_center|LOCUS_19960 22326 23021 gene locus_tag LOCUS_19970 22326 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 24413 23097 gene locus_tag LOCUS_19980 24413 23097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 25085 25225 gene locus_tag LOCUS_19990 25085 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 26617 25277 gene locus_tag LOCUS_20000 26617 25277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_20000 26942 28681 gene locus_tag LOCUS_20010 26942 28681 CDS product diflavin flavoprotein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_20010 28975 28902 gene locus_tag LOCUS_t00190 28975 28902 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 29234 29163 gene locus_tag LOCUS_t00200 29234 29163 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 29512 29715 gene locus_tag LOCUS_20020 29512 29715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 30563 29769 gene locus_tag LOCUS_20030 gene cpmA 30563 29769 CDS product 1-(5-phosphoribosyl)-5-amino-4-imidazole-carboxylate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_20030 31516 30581 gene locus_tag LOCUS_20040 31516 30581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 31967 31467 gene locus_tag LOCUS_20050 31967 31467 CDS product DNA mismatch repair protein MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_20050 32454 31972 gene locus_tag LOCUS_20060 gene bcp-1 32454 31972 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_20060 33120 32572 gene locus_tag LOCUS_20070 gene frr 33120 32572 CDS product ribosome-recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM64 protein_id gnl|my_center|LOCUS_20070 33835 33107 gene locus_tag LOCUS_20080 gene pyrH 33835 33107 CDS product uridylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM63 protein_id gnl|my_center|LOCUS_20080 34906 33989 gene locus_tag LOCUS_20090 gene lgt 34906 33989 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7ND43 protein_id gnl|my_center|LOCUS_20090 35325 35720 gene locus_tag LOCUS_20100 35325 35720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 35998 39027 gene locus_tag LOCUS_20110 gene ppc 35998 39027 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3X5 protein_id gnl|my_center|LOCUS_20110 39606 39130 gene locus_tag LOCUS_20120 39606 39130 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200519.1 protein_id gnl|my_center|LOCUS_20120 39925 39665 gene locus_tag LOCUS_20130 39925 39665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_20130 40147 40410 gene locus_tag LOCUS_20140 40147 40410 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_20140 40862 40536 gene locus_tag LOCUS_20150 40862 40536 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIL6 protein_id gnl|my_center|LOCUS_20150 41271 43211 gene locus_tag LOCUS_20160 gene sir 41271 43211 CDS product sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056194.1 protein_id gnl|my_center|LOCUS_20160 43347 44801 gene locus_tag LOCUS_20170 gene cysS 43347 44801 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW6 protein_id gnl|my_center|LOCUS_20170 45649 44912 gene locus_tag LOCUS_20180 45649 44912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 46486 45917 gene locus_tag LOCUS_20190 46486 45917 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_20190 46780 47331 gene locus_tag LOCUS_20200 46780 47331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 47433 49091 gene locus_tag LOCUS_20210 47433 49091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_20210 49503 49120 gene locus_tag LOCUS_20220 49503 49120 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141555.1 protein_id gnl|my_center|LOCUS_20220 49808 50416 gene locus_tag LOCUS_20230 49808 50416 CDS product hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_20230 51526 50504 gene locus_tag LOCUS_20240 gene purM 51526 50504 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHY2 protein_id gnl|my_center|LOCUS_20240 52457 53545 gene locus_tag LOCUS_20250 52457 53545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 53634 54455 gene locus_tag LOCUS_20260 53634 54455 CDS product laccase domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGK9 protein_id gnl|my_center|LOCUS_20260 54472 55080 gene locus_tag LOCUS_20270 54472 55080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 55657 55187 gene locus_tag LOCUS_20280 55657 55187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 57484 55790 gene locus_tag LOCUS_20290 57484 55790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 59345 57582 gene locus_tag LOCUS_20300 59345 57582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 59456 59695 gene locus_tag LOCUS_20310 59456 59695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 59901 61394 gene locus_tag LOCUS_20320 59901 61394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 61449 62099 gene locus_tag LOCUS_20330 61449 62099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 62096 62953 gene locus_tag LOCUS_20340 62096 62953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 63113 63769 gene locus_tag LOCUS_20350 63113 63769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118577.1 protein_id gnl|my_center|LOCUS_20350 64012 64644 gene locus_tag LOCUS_20360 64012 64644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 64757 65245 gene locus_tag LOCUS_20370 64757 65245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 65343 65564 gene locus_tag LOCUS_20380 65343 65564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 65803 66528 gene locus_tag LOCUS_20390 gene chlM 65803 66528 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_20390 66609 67073 gene locus_tag LOCUS_20400 66609 67073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 67130 67507 gene locus_tag LOCUS_20410 67130 67507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_20410 67567 67954 gene locus_tag LOCUS_tm00010 67567 67954 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 68424 68879 gene locus_tag LOCUS_20420 68424 68879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140630.1 protein_id gnl|my_center|LOCUS_20420 68924 69304 gene locus_tag LOCUS_20430 68924 69304 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_20430 69502 69705 gene locus_tag LOCUS_20440 69502 69705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 69605 70471 gene locus_tag LOCUS_20450 69605 70471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057926.1 protein_id gnl|my_center|LOCUS_20450 71614 70475 gene locus_tag LOCUS_20460 71614 70475 CDS product mechanosensitive ion channel protein MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104649.1 protein_id gnl|my_center|LOCUS_20460 73697 71652 gene locus_tag LOCUS_20470 73697 71652 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_20470 74112 73897 gene locus_tag LOCUS_20480 gene rpsR 74112 73897 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH98 protein_id gnl|my_center|LOCUS_20480 74372 74178 gene locus_tag LOCUS_20490 gene rpmG 74372 74178 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCB9 protein_id gnl|my_center|LOCUS_20490 75339 74614 gene locus_tag LOCUS_20500 75339 74614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 77067 75373 gene locus_tag LOCUS_20510 gene lepA 77067 75373 CDS product elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM20 protein_id gnl|my_center|LOCUS_20510 78123 77932 gene locus_tag LOCUS_20520 78123 77932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 78067 78294 gene locus_tag LOCUS_20530 78067 78294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 78566 80605 gene locus_tag LOCUS_20540 78566 80605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 81348 80602 gene locus_tag LOCUS_20550 81348 80602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228262.1 protein_id gnl|my_center|LOCUS_20550 81726 82364 gene locus_tag LOCUS_20560 81726 82364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_20560 82639 82376 gene locus_tag LOCUS_20570 82639 82376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 82799 83695 gene locus_tag LOCUS_20580 82799 83695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 86125 83756 gene locus_tag LOCUS_20590 gene zam 86125 83756 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_20590 87697 87071 gene locus_tag LOCUS_20600 87697 87071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 88156 89289 gene locus_tag LOCUS_20610 88156 89289 CDS product monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_20610 89420 91093 gene locus_tag LOCUS_20620 89420 91093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 91302 93200 gene locus_tag LOCUS_20630 gene thrS 91302 93200 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0QWG2 protein_id gnl|my_center|LOCUS_20630 93718 93281 gene locus_tag LOCUS_20640 93718 93281 CDS product cell division protein ZipA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406573.1 protein_id gnl|my_center|LOCUS_20640 94120 95046 gene locus_tag LOCUS_20650 94120 95046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 95264 96004 gene locus_tag LOCUS_20660 95264 96004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence16 336 1283 gene locus_tag LOCUS_20670 gene cofG 336 1283 CDS product FO synthase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR6 protein_id gnl|my_center|LOCUS_20670 2027 1287 gene locus_tag LOCUS_20680 2027 1287 CDS product ATP-dependent protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_20680 3164 2094 gene locus_tag LOCUS_20690 3164 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_20690 3395 3201 gene locus_tag LOCUS_20700 3395 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4251 3454 gene locus_tag LOCUS_20710 4251 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 4477 4316 gene locus_tag LOCUS_20720 4477 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 4508 4693 gene locus_tag LOCUS_20730 4508 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 5031 5393 gene locus_tag LOCUS_20740 gene rplS 5031 5393 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJC4 protein_id gnl|my_center|LOCUS_20740 5529 5602 gene locus_tag LOCUS_t00210 5529 5602 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 5926 6147 gene locus_tag LOCUS_20750 gene secE 5926 6147 CDS product protein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM30 protein_id gnl|my_center|LOCUS_20750 6144 6776 gene locus_tag LOCUS_20760 gene nusG 6144 6776 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM29 protein_id gnl|my_center|LOCUS_20760 6787 7212 gene locus_tag LOCUS_20770 gene rplK 6787 7212 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM28 protein_id gnl|my_center|LOCUS_20770 7352 8068 gene locus_tag LOCUS_20780 gene rplA 7352 8068 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM27 protein_id gnl|my_center|LOCUS_20780 8373 8909 gene locus_tag LOCUS_20790 gene rplJ 8373 8909 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM26 protein_id gnl|my_center|LOCUS_20790 9096 9491 gene locus_tag LOCUS_20800 gene rplL 9096 9491 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM25 protein_id gnl|my_center|LOCUS_20800 9699 10463 gene locus_tag LOCUS_20810 9699 10463 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_20810 10508 10924 gene locus_tag LOCUS_20820 10508 10924 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_20820 11005 11787 gene locus_tag LOCUS_20830 11005 11787 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_20830 11882 12643 gene locus_tag LOCUS_20840 11882 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 13125 12661 gene locus_tag LOCUS_20850 13125 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_20850 13408 14289 gene locus_tag LOCUS_20860 13408 14289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 15184 14321 gene locus_tag LOCUS_20870 15184 14321 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_20870 15780 15247 gene locus_tag LOCUS_20880 15780 15247 CDS product thermonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_20880 16168 15773 gene locus_tag LOCUS_20890 16168 15773 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_20890 16398 16484 gene locus_tag LOCUS_t00220 16398 16484 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 16758 17207 gene locus_tag LOCUS_20900 16758 17207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 17612 18931 gene locus_tag LOCUS_20910 17612 18931 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_20910 18968 20032 gene locus_tag LOCUS_20920 18968 20032 CDS product peptidase M42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728943.1 protein_id gnl|my_center|LOCUS_20920 20062 20523 gene locus_tag LOCUS_20930 20062 20523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 21596 20541 gene locus_tag LOCUS_20940 gene ccmA 21596 20541 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_20940 22459 21833 gene locus_tag LOCUS_20950 22459 21833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 22761 22492 gene locus_tag LOCUS_20960 gene rpsO 22761 22492 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJL5 protein_id gnl|my_center|LOCUS_20960 23577 22870 gene locus_tag LOCUS_20970 gene ispD 23577 22870 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL91 protein_id gnl|my_center|LOCUS_20970 25077 23581 gene locus_tag LOCUS_20980 25077 23581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 25700 25074 gene locus_tag LOCUS_20990 25700 25074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056685.1 protein_id gnl|my_center|LOCUS_20990 25846 26358 gene locus_tag LOCUS_21000 gene apt 25846 26358 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGH9 protein_id gnl|my_center|LOCUS_21000 27115 26348 gene locus_tag LOCUS_21010 27115 26348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 29198 27423 gene locus_tag LOCUS_21020 29198 27423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 29753 29448 gene locus_tag LOCUS_21030 gene cpeR 29753 29448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141186.1 protein_id gnl|my_center|LOCUS_21030 30395 29760 gene locus_tag LOCUS_21040 gene cpcT3 30395 29760 CDS product chromophore lyase CpcT/CpeT 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD3 protein_id gnl|my_center|LOCUS_21040 31239 30682 gene locus_tag LOCUS_21050 gene cpeS 31239 30682 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD4 protein_id gnl|my_center|LOCUS_21050 31531 31304 gene locus_tag LOCUS_21060 31531 31304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 32489 31731 gene locus_tag LOCUS_21070 gene cpeE 32489 31731 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_21070 33461 32706 gene locus_tag LOCUS_21080 gene cpeD 33461 32706 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141264.1 protein_id gnl|my_center|LOCUS_21080 34608 33736 gene locus_tag LOCUS_21090 gene cpeC 34608 33736 CDS product phycoerythrin-associated linker protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141263.1 protein_id gnl|my_center|LOCUS_21090 35724 34975 gene locus_tag LOCUS_21100 gene cpcG2 35724 34975 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_21100 36459 37139 gene locus_tag LOCUS_21110 gene nblB 36459 37139 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_21110 38046 37159 gene locus_tag LOCUS_21120 38046 37159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_21120 38318 38914 gene locus_tag LOCUS_21130 gene cpcS 38318 38914 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL67 protein_id gnl|my_center|LOCUS_21130 39047 39781 gene locus_tag LOCUS_21140 gene pebA 39047 39781 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL66 protein_id gnl|my_center|LOCUS_21140 39851 40594 gene locus_tag LOCUS_21150 gene pebB 39851 40594 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NL65 protein_id gnl|my_center|LOCUS_21150 40715 41473 gene locus_tag LOCUS_21160 40715 41473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 41470 42108 gene locus_tag LOCUS_21170 41470 42108 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_21170 43387 42182 gene locus_tag LOCUS_21180 gene pgk 43387 42182 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGP7 protein_id gnl|my_center|LOCUS_21180 43438 43827 gene locus_tag LOCUS_21190 43438 43827 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_21190 44683 43901 gene locus_tag LOCUS_21200 gene hisA 44683 43901 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino] imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA5 protein_id gnl|my_center|LOCUS_21200 45646 44774 gene locus_tag LOCUS_21210 45646 44774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 46336 48474 gene locus_tag LOCUS_21220 46336 48474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 49115 48663 gene locus_tag LOCUS_21230 gene psaD 49115 48663 CDS product photosystem I protein PsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_21230 49371 50126 gene locus_tag LOCUS_21240 49371 50126 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_21240 50821 50138 gene locus_tag LOCUS_21250 50821 50138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 51177 50905 gene locus_tag LOCUS_21260 51177 50905 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_21260 51283 52233 gene locus_tag LOCUS_21270 51283 52233 CDS product glycosly transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056836.1 protein_id gnl|my_center|LOCUS_21270 53888 52230 gene locus_tag LOCUS_21280 gene ribA 53888 52230 CDS product riboflavin biosynthesis protein RibBA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI64 protein_id gnl|my_center|LOCUS_21280 54445 54747 gene locus_tag LOCUS_21290 54445 54747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 54863 55873 gene locus_tag LOCUS_21300 54863 55873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142445.1 protein_id gnl|my_center|LOCUS_21300 55931 57166 gene locus_tag LOCUS_21310 gene anmK 55931 57166 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC2 protein_id gnl|my_center|LOCUS_21310 58190 57276 gene locus_tag LOCUS_21320 58190 57276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 58561 59520 gene locus_tag LOCUS_21330 gene recO 58561 59520 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPH1 protein_id gnl|my_center|LOCUS_21330 59535 61034 gene locus_tag LOCUS_21340 59535 61034 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_21340 61091 64456 gene locus_tag LOCUS_21350 61091 64456 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_21350 64534 65235 gene locus_tag LOCUS_21360 64534 65235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_21360 65343 70760 gene locus_tag LOCUS_21370 65343 70760 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_21370 72770 70881 gene locus_tag LOCUS_21380 gene ftsH 72770 70881 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKW7 protein_id gnl|my_center|LOCUS_21380 73779 73177 gene locus_tag LOCUS_21390 73779 73177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 74120 75148 gene locus_tag LOCUS_21400 74120 75148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 75438 76700 gene locus_tag LOCUS_21410 75438 76700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 78002 76728 gene locus_tag LOCUS_21420 78002 76728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 79912 78014 gene locus_tag LOCUS_21430 79912 78014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_21430 80134 79940 gene locus_tag LOCUS_21440 80134 79940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 80211 81077 gene locus_tag LOCUS_21450 80211 81077 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_21450 81102 81470 gene locus_tag LOCUS_21460 81102 81470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012706774.1 protein_id gnl|my_center|LOCUS_21460 81619 82425 gene locus_tag LOCUS_21470 81619 82425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 83607 82468 gene locus_tag LOCUS_21480 83607 82468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 83918 85414 gene locus_tag LOCUS_21490 gene glpK 83918 85414 CDS product glycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q63X50 protein_id gnl|my_center|LOCUS_21490 91262 85461 gene locus_tag LOCUS_21500 91262 85461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 91505 91879 gene locus_tag LOCUS_21510 91505 91879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 92057 92410 gene locus_tag LOCUS_21520 92057 92410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence17 800 231 gene locus_tag LOCUS_21530 800 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_21530 1125 2174 gene locus_tag LOCUS_21540 1125 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 2373 2113 gene locus_tag LOCUS_21550 2373 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 2662 3609 gene locus_tag LOCUS_21560 2662 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 5800 4028 gene locus_tag LOCUS_21570 5800 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 6025 6333 gene locus_tag LOCUS_21580 gene psaK 6025 6333 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A425 protein_id gnl|my_center|LOCUS_21580 7774 6497 gene locus_tag LOCUS_21590 7774 6497 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS4 protein_id gnl|my_center|LOCUS_21590 8280 8044 gene locus_tag LOCUS_21600 gene acpP 8280 8044 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P43709 protein_id gnl|my_center|LOCUS_21600 8669 9691 gene locus_tag LOCUS_21610 8669 9691 CDS product heterodisulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_21610 9920 10165 gene locus_tag LOCUS_21620 gene psaC 9920 10165 CDS product photosystem I iron-sulfur center inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A415 protein_id gnl|my_center|LOCUS_21620 10796 10293 gene locus_tag LOCUS_21630 10796 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 11475 11089 gene locus_tag LOCUS_21640 11475 11089 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_21640 11699 11478 gene locus_tag LOCUS_21650 11699 11478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11845 12273 gene locus_tag LOCUS_21660 11845 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 13294 12293 gene locus_tag LOCUS_21670 gene pheS 13294 12293 CDS product phenylalanine--tRNA ligase alpha subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL09 protein_id gnl|my_center|LOCUS_21670 13349 16327 gene locus_tag LOCUS_21680 gene polA 13349 16327 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_21680 16442 17026 gene locus_tag LOCUS_21690 16442 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 17150 17734 gene locus_tag LOCUS_21700 17150 17734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 17832 18416 gene locus_tag LOCUS_21710 17832 18416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 19501 18788 gene locus_tag LOCUS_21720 19501 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 23308 19682 gene locus_tag LOCUS_21730 23308 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 24288 23311 gene locus_tag LOCUS_21740 24288 23311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 25043 24444 gene locus_tag LOCUS_21750 25043 24444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 25595 25071 gene locus_tag LOCUS_21760 gene moaC 25595 25071 CDS product cyclic pyranopterin monophosphate synthase accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFZ6 protein_id gnl|my_center|LOCUS_21760 25647 25720 gene locus_tag LOCUS_t00230 25647 25720 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25878 26462 gene locus_tag LOCUS_21770 25878 26462 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS3 protein_id gnl|my_center|LOCUS_21770 26521 28704 gene locus_tag LOCUS_21780 26521 28704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 29535 30464 gene locus_tag LOCUS_21790 29535 30464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 30586 32268 gene locus_tag LOCUS_21800 gene ctaD 30586 32268 CDS product cytochrome c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIM0 protein_id gnl|my_center|LOCUS_21800 32360 32980 gene locus_tag LOCUS_21810 gene ctaE 32360 32980 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_21810 33274 35022 gene locus_tag LOCUS_21820 33274 35022 CDS product potassium efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140386.1 protein_id gnl|my_center|LOCUS_21820 35311 36579 gene locus_tag LOCUS_21830 35311 36579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057279.1 protein_id gnl|my_center|LOCUS_21830 36722 38257 gene locus_tag LOCUS_21840 gene radA 36722 38257 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NHX9 protein_id gnl|my_center|LOCUS_21840 38400 40007 gene locus_tag LOCUS_21850 38400 40007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 40175 41035 gene locus_tag LOCUS_21860 40175 41035 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110226.1 protein_id gnl|my_center|LOCUS_21860 41189 43816 gene locus_tag LOCUS_21870 41189 43816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_21870 43916 46120 gene locus_tag LOCUS_21880 43916 46120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 46256 47368 gene locus_tag LOCUS_21890 46256 47368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412408.1 protein_id gnl|my_center|LOCUS_21890 47634 52613 gene locus_tag LOCUS_21900 47634 52613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 52937 55873 gene locus_tag LOCUS_21910 52937 55873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 56039 56448 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaattcaggatttgagaagcctcaaag 57584 56694 gene locus_tag LOCUS_21920 gene lipA1 57584 56694 CDS product lipoyl synthase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL83 protein_id gnl|my_center|LOCUS_21920 57768 58550 gene locus_tag LOCUS_21930 gene nfi 57768 58550 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JIJ2 protein_id gnl|my_center|LOCUS_21930 59089 61149 gene locus_tag LOCUS_21940 59089 61149 CDS product catalase peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814129.1 protein_id gnl|my_center|LOCUS_21940 61515 61300 gene locus_tag LOCUS_21950 61515 61300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 62051 61539 gene locus_tag LOCUS_21960 62051 61539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 63761 62202 gene locus_tag LOCUS_21970 63761 62202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_21970 64663 64169 gene locus_tag LOCUS_21980 gene cpeA 64663 64169 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_21980 65322 64768 gene locus_tag LOCUS_21990 gene cpeB 65322 64768 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_21990 65704 66072 gene locus_tag LOCUS_22000 65704 66072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 66292 66894 gene locus_tag LOCUS_22010 66292 66894 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_22010 68758 67190 gene locus_tag LOCUS_22020 68758 67190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 69238 69153 gene locus_tag LOCUS_t00240 69238 69153 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 69314 69239 gene locus_tag LOCUS_t00250 69314 69239 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 69859 69783 gene locus_tag LOCUS_t00260 69859 69783 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 70679 70464 gene locus_tag LOCUS_22030 70679 70464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 74319 71017 gene locus_tag LOCUS_22040 gene pyrA 74319 71017 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGI5 protein_id gnl|my_center|LOCUS_22040 75269 74700 gene locus_tag LOCUS_22050 75269 74700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 76110 75550 gene locus_tag LOCUS_22060 76110 75550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390488.1 protein_id gnl|my_center|LOCUS_22060 76461 76120 gene locus_tag LOCUS_22070 76461 76120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 76461 76643 gene locus_tag LOCUS_22080 76461 76643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 80527 76640 gene locus_tag LOCUS_22090 80527 76640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 81966 80656 gene locus_tag LOCUS_22100 gene kmo 81966 80656 CDS product kynurenine 3-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5ZX41 protein_id gnl|my_center|LOCUS_22100 82383 82075 gene locus_tag LOCUS_22110 82383 82075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 82828 82400 gene locus_tag LOCUS_22120 82828 82400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22120 83042 85213 gene locus_tag LOCUS_22130 83042 85213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056792.1 protein_id gnl|my_center|LOCUS_22130 86131 85784 gene locus_tag LOCUS_22140 86131 85784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 86275 87024 gene locus_tag LOCUS_22150 86275 87024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence18 433 203 gene locus_tag LOCUS_22160 433 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 690 1706 gene locus_tag LOCUS_22170 690 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 1888 2928 gene locus_tag LOCUS_22180 1888 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 8517 2986 gene locus_tag LOCUS_22190 8517 2986 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_22190 11063 8910 gene locus_tag LOCUS_22200 11063 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 12494 11250 gene locus_tag LOCUS_22210 12494 11250 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056017.1 protein_id gnl|my_center|LOCUS_22210 12871 13602 gene locus_tag LOCUS_22220 12871 13602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 13878 15257 gene locus_tag LOCUS_22230 13878 15257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 15449 17302 gene locus_tag LOCUS_22240 15449 17302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 18714 17347 gene locus_tag LOCUS_22250 18714 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 19739 19227 gene locus_tag LOCUS_22260 19739 19227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 19802 20920 gene locus_tag LOCUS_22270 19802 20920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 21294 21001 gene locus_tag LOCUS_22280 gene petF1 21294 21001 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3C9 protein_id gnl|my_center|LOCUS_22280 21783 21487 gene locus_tag LOCUS_22290 gene petF1 21783 21487 CDS product ferredoxin-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A3C9 protein_id gnl|my_center|LOCUS_22290 22276 21983 gene locus_tag LOCUS_22300 gene petF 22276 21983 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_22300 22838 23854 gene locus_tag LOCUS_22310 gene bvdR 22838 23854 CDS product biliverdin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140852.1 protein_id gnl|my_center|LOCUS_22310 24956 23838 gene locus_tag LOCUS_22320 24956 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 26162 25062 gene locus_tag LOCUS_22330 26162 25062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 27789 26212 gene locus_tag LOCUS_22340 27789 26212 CDS product alginate O-acetylation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140949.1 protein_id gnl|my_center|LOCUS_22340 27951 29039 gene locus_tag LOCUS_22350 27951 29039 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144332.1 protein_id gnl|my_center|LOCUS_22350 29112 29492 gene locus_tag LOCUS_22360 29112 29492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 29551 31269 gene locus_tag LOCUS_22370 29551 31269 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_22370 31272 32756 gene locus_tag LOCUS_22380 31272 32756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057111.1 protein_id gnl|my_center|LOCUS_22380 33263 33487 gene locus_tag LOCUS_22390 33263 33487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_22390 33659 35047 gene locus_tag LOCUS_22400 gene cpeY 33659 35047 CDS product phycocyanin operon protein Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_22400 35148 35750 gene locus_tag LOCUS_22410 gene cpeZ 35148 35750 CDS product bilin biosynthesis protein CpeZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124494.1 protein_id gnl|my_center|LOCUS_22410 36402 35788 gene locus_tag LOCUS_22420 36402 35788 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMR9 protein_id gnl|my_center|LOCUS_22420 36712 37377 gene locus_tag LOCUS_22430 36712 37377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22430 37298 37909 gene locus_tag LOCUS_22440 37298 37909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22440 38358 39440 gene locus_tag LOCUS_22450 38358 39440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 39592 40017 gene locus_tag LOCUS_22460 39592 40017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 40447 42165 gene locus_tag LOCUS_22470 gene nadB 40447 42165 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGB1 protein_id gnl|my_center|LOCUS_22470 42381 42974 gene locus_tag LOCUS_22480 42381 42974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 45470 42990 gene locus_tag LOCUS_22490 gene priA 45470 42990 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLR3 protein_id gnl|my_center|LOCUS_22490 45991 45515 gene locus_tag LOCUS_22500 45991 45515 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_22500 47539 46718 gene locus_tag LOCUS_22510 47539 46718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058285.1 protein_id gnl|my_center|LOCUS_22510 47696 48895 gene locus_tag LOCUS_22520 47696 48895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 48939 49292 gene locus_tag LOCUS_22530 48939 49292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 49988 49479 gene locus_tag LOCUS_22540 gene apcF 49988 49479 CDS product phycobilisome core component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_22540 50734 52155 gene locus_tag LOCUS_22550 gene glnA 50734 52155 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ7 protein_id gnl|my_center|LOCUS_22550 52438 53592 gene locus_tag LOCUS_22560 52438 53592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 53742 55154 gene locus_tag LOCUS_22570 53742 55154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 55365 57206 gene locus_tag LOCUS_22580 55365 57206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142666.1 protein_id gnl|my_center|LOCUS_22580 58210 57215 gene locus_tag LOCUS_22590 58210 57215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 58360 58587 gene locus_tag LOCUS_22600 58360 58587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 59001 60527 gene locus_tag LOCUS_22610 59001 60527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 60704 61477 gene locus_tag LOCUS_22620 gene uppS 60704 61477 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI29 protein_id gnl|my_center|LOCUS_22620 61702 61631 gene locus_tag LOCUS_t00270 61702 61631 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61883 62944 gene locus_tag LOCUS_22630 gene glk 61883 62944 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT6 protein_id gnl|my_center|LOCUS_22630 63199 65253 gene locus_tag LOCUS_22640 63199 65253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 66185 65385 gene locus_tag LOCUS_22650 66185 65385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 66537 67634 gene locus_tag LOCUS_22660 66537 67634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 68653 68859 gene locus_tag LOCUS_22670 68653 68859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 68865 69266 gene locus_tag LOCUS_22680 gene mvpA 68865 69266 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3ERI7 protein_id gnl|my_center|LOCUS_22680 69663 69304 gene locus_tag LOCUS_22690 69663 69304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 70067 69651 gene locus_tag LOCUS_22700 70067 69651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 70341 71213 gene locus_tag LOCUS_22710 gene aroE 70341 71213 CDS product shikimate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA6 protein_id gnl|my_center|LOCUS_22710 71342 72589 gene locus_tag LOCUS_22720 gene trpB 71342 72589 CDS product tryptophan synthase beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG49 protein_id gnl|my_center|LOCUS_22720 72610 73392 gene locus_tag LOCUS_22730 72610 73392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 76727 73380 gene locus_tag LOCUS_22740 76727 73380 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140084.1 protein_id gnl|my_center|LOCUS_22740 78043 76772 gene locus_tag LOCUS_22750 78043 76772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_22750 79142 78150 gene locus_tag LOCUS_22760 79142 78150 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_22760 79305 79535 gene locus_tag LOCUS_22770 gene rpoZ 79305 79535 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NK60 protein_id gnl|my_center|LOCUS_22770 79666 80175 gene locus_tag LOCUS_22780 79666 80175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 80202 80567 gene locus_tag LOCUS_22790 80202 80567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_22790 80647 80722 gene locus_tag LOCUS_t00280 80647 80722 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 80907 82661 gene locus_tag LOCUS_22800 gene argS 80907 82661 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKN4 protein_id gnl|my_center|LOCUS_22800 83107 82664 gene locus_tag LOCUS_22810 83107 82664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence19 1207 326 gene locus_tag LOCUS_22820 1207 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2740 1391 gene locus_tag LOCUS_22830 gene dnaB 2740 1391 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA9 protein_id gnl|my_center|LOCUS_22830 3370 2912 gene locus_tag LOCUS_22840 gene rplI 3370 2912 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0A499 protein_id gnl|my_center|LOCUS_22840 5870 3651 gene locus_tag LOCUS_22850 5870 3651 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_22850 7769 6018 gene locus_tag LOCUS_22860 7769 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 8331 7855 gene locus_tag LOCUS_22870 8331 7855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 8482 8871 gene locus_tag LOCUS_22880 8482 8871 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707273.1 protein_id gnl|my_center|LOCUS_22880 10356 8920 gene locus_tag LOCUS_22890 10356 8920 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_22890 10355 10792 gene locus_tag LOCUS_22900 10355 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142480.1 protein_id gnl|my_center|LOCUS_22900 11117 11962 gene locus_tag LOCUS_22910 11117 11962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 12199 13743 gene locus_tag LOCUS_22920 gene trpE 12199 13743 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_22920 13766 14974 gene locus_tag LOCUS_22930 13766 14974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 15096 15572 gene locus_tag LOCUS_22940 15096 15572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 17553 15658 gene locus_tag LOCUS_22950 17553 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 18320 17652 gene locus_tag LOCUS_22960 18320 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140697.1 protein_id gnl|my_center|LOCUS_22960 18954 18346 gene locus_tag LOCUS_22970 18954 18346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_22970 22362 18985 gene locus_tag LOCUS_22980 22362 18985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 22577 23368 gene locus_tag LOCUS_22990 gene gst 22577 23368 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_22990 25605 23455 gene locus_tag LOCUS_23000 25605 23455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 26894 25941 gene locus_tag LOCUS_23010 26894 25941 CDS product thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140721.1 protein_id gnl|my_center|LOCUS_23010 27386 29203 gene locus_tag LOCUS_23020 27386 29203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 29387 32374 gene locus_tag LOCUS_23030 gene putA 29387 32374 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_23030 33370 32483 gene locus_tag LOCUS_23040 33370 32483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056085.1 protein_id gnl|my_center|LOCUS_23040 33960 33433 gene locus_tag LOCUS_23050 33960 33433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056084.1 protein_id gnl|my_center|LOCUS_23050 34952 34083 gene locus_tag LOCUS_23060 34952 34083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 36673 35249 gene locus_tag LOCUS_23070 36673 35249 CDS product 6-phosphogluconate dehydrogenase, decarboxylating inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLC0 protein_id gnl|my_center|LOCUS_23070 37589 37461 gene locus_tag LOCUS_23080 37589 37461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 37626 39278 gene locus_tag LOCUS_23090 37626 39278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 42061 39314 gene locus_tag LOCUS_23100 42061 39314 CDS product peptidase U32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140940.1 protein_id gnl|my_center|LOCUS_23100 42193 45111 gene locus_tag LOCUS_23110 42193 45111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 45583 45239 gene locus_tag LOCUS_23120 gene rplT 45583 45239 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH02 protein_id gnl|my_center|LOCUS_23120 46012 45812 gene locus_tag LOCUS_23130 gene rpmI 46012 45812 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9L2 protein_id gnl|my_center|LOCUS_23130 46772 46179 gene locus_tag LOCUS_23140 46772 46179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 48073 46946 gene locus_tag LOCUS_23150 48073 46946 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057877.1 protein_id gnl|my_center|LOCUS_23150 49200 48091 gene locus_tag LOCUS_23160 49200 48091 CDS product deoxyhypusine synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKP1 protein_id gnl|my_center|LOCUS_23160 49564 49379 gene locus_tag LOCUS_23170 49564 49379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 49539 50048 gene locus_tag LOCUS_23180 49539 50048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 50249 50716 gene locus_tag LOCUS_23190 50249 50716 CDS product UPF0225 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3FUM0 protein_id gnl|my_center|LOCUS_23190 50973 51485 gene locus_tag LOCUS_23200 50973 51485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 53059 51530 gene locus_tag LOCUS_23210 53059 51530 CDS product sodium-independent anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115333.1 protein_id gnl|my_center|LOCUS_23210 53256 53891 gene locus_tag LOCUS_23220 53256 53891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056107.1 protein_id gnl|my_center|LOCUS_23220 53966 54793 gene locus_tag LOCUS_23230 53966 54793 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_23230 56147 54858 gene locus_tag LOCUS_23240 56147 54858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 56754 56272 gene locus_tag LOCUS_23250 56754 56272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 57104 58264 gene locus_tag LOCUS_23260 gene aroF 57104 58264 CDS product phospho-2-dehydro-3-deoxyheptonate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A1JK32 protein_id gnl|my_center|LOCUS_23260 58360 58584 gene locus_tag LOCUS_23270 58360 58584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 58754 60133 gene locus_tag LOCUS_23280 58754 60133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143184.1 protein_id gnl|my_center|LOCUS_23280 60178 60834 gene locus_tag LOCUS_23290 60178 60834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143183.1 protein_id gnl|my_center|LOCUS_23290 61157 60831 gene locus_tag LOCUS_23300 61157 60831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 61564 61145 gene locus_tag LOCUS_23310 61564 61145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 61720 63279 gene locus_tag LOCUS_23320 gene crtH 61720 63279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142130.1 protein_id gnl|my_center|LOCUS_23320 63338 65713 gene locus_tag LOCUS_23330 gene pcrA 63338 65713 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG65 protein_id gnl|my_center|LOCUS_23330 65869 65735 gene locus_tag LOCUS_23340 65869 65735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 66426 67385 gene locus_tag LOCUS_23350 gene crtR 66426 67385 CDS product beta-carotene hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_23350 68330 67440 gene locus_tag LOCUS_23360 68330 67440 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143303.1 protein_id gnl|my_center|LOCUS_23360 69189 68401 gene locus_tag LOCUS_23370 69189 68401 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_23370 69416 70345 gene locus_tag LOCUS_23380 69416 70345 CDS product manganese ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143301.1 protein_id gnl|my_center|LOCUS_23380 70960 70409 gene locus_tag LOCUS_23390 70960 70409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 71292 71843 gene locus_tag LOCUS_23400 71292 71843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 71927 73180 gene locus_tag LOCUS_23410 71927 73180 CDS product CinA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH31 protein_id gnl|my_center|LOCUS_23410 73373 74251 gene locus_tag LOCUS_23420 73373 74251 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085765.1 protein_id gnl|my_center|LOCUS_23420 74349 75299 gene locus_tag LOCUS_23430 74349 75299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 75717 75388 gene locus_tag LOCUS_23440 75717 75388 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9JYY9 protein_id gnl|my_center|LOCUS_23440 76037 76786 gene locus_tag LOCUS_23450 76037 76786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 78994 77978 gene locus_tag LOCUS_23460 78994 77978 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_23460 79738 79025 gene locus_tag LOCUS_23470 gene trmD 79738 79025 CDS product tRNA (guanine-N(1)-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM2 protein_id gnl|my_center|LOCUS_23470 80585 82564 gene locus_tag LOCUS_23480 80585 82564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence20 2 691 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctctgaccaatctccaatcctgaattaa 2070 895 gene locus_tag LOCUS_23490 2070 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2403 6071 gene locus_tag LOCUS_23500 2403 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 9560 6159 gene locus_tag LOCUS_23510 9560 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 11032 9950 gene locus_tag LOCUS_23520 11032 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 13884 11296 gene locus_tag LOCUS_23530 13884 11296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 14239 15087 gene locus_tag LOCUS_23540 gene tyrA 14239 15087 CDS product arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058267.1 protein_id gnl|my_center|LOCUS_23540 15824 15204 gene locus_tag LOCUS_23550 15824 15204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 16487 20155 gene locus_tag LOCUS_23560 16487 20155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 20322 20251 gene locus_tag LOCUS_t00290 20322 20251 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 20615 20382 gene locus_tag LOCUS_23570 20615 20382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 20997 22277 gene locus_tag LOCUS_23580 20997 22277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 23260 22655 gene locus_tag LOCUS_23590 gene clpP2 23260 22655 CDS product ATP-dependent Clp protease proteolytic subunit 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJZ9 protein_id gnl|my_center|LOCUS_23590 24026 23358 gene locus_tag LOCUS_23600 gene clpP 24026 23358 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI33 protein_id gnl|my_center|LOCUS_23600 25285 24176 gene locus_tag LOCUS_23610 25285 24176 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 protein_id gnl|my_center|LOCUS_23610 25476 25691 gene locus_tag LOCUS_23620 25476 25691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 26269 25739 gene locus_tag LOCUS_23630 26269 25739 CDS product sigma-B activity negative regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_23630 27599 26595 gene locus_tag LOCUS_23640 27599 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 28366 29637 gene locus_tag LOCUS_23650 28366 29637 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_23650 29998 31041 gene locus_tag LOCUS_23660 29998 31041 CDS product protein sphX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_23660 31371 32300 gene locus_tag LOCUS_23670 31371 32300 CDS product phosphate transport system permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU9 protein_id gnl|my_center|LOCUS_23670 32300 33226 gene locus_tag LOCUS_23680 32300 33226 CDS product phosphate transport system permease protein PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WCU8 protein_id gnl|my_center|LOCUS_23680 33315 34142 gene locus_tag LOCUS_23690 gene pstB 33315 34142 CDS product phosphate import ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCZ3 protein_id gnl|my_center|LOCUS_23690 36526 34259 gene locus_tag LOCUS_23700 36526 34259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 36916 37164 gene locus_tag LOCUS_23710 36916 37164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 37578 37261 gene locus_tag LOCUS_23720 37578 37261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 38292 38083 gene locus_tag LOCUS_23730 38292 38083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 39054 38635 gene locus_tag LOCUS_23740 39054 38635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 39255 40136 gene locus_tag LOCUS_23750 39255 40136 CDS product S-formylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8P5F4 protein_id gnl|my_center|LOCUS_23750 40192 40845 gene locus_tag LOCUS_23760 40192 40845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_23760 41490 40879 gene locus_tag LOCUS_23770 41490 40879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 42083 41532 gene locus_tag LOCUS_23780 42083 41532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_23780 42732 42100 gene locus_tag LOCUS_23790 42732 42100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 46288 42770 gene locus_tag LOCUS_23800 46288 42770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 47743 46361 gene locus_tag LOCUS_23810 47743 46361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 50961 47791 gene locus_tag LOCUS_23820 gene valS 50961 47791 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS8 protein_id gnl|my_center|LOCUS_23820 53572 51260 gene locus_tag LOCUS_23830 53572 51260 CDS product transglutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_23830 59329 53801 gene locus_tag LOCUS_23840 59329 53801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 63967 59510 gene locus_tag LOCUS_23850 63967 59510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 64577 64038 gene locus_tag LOCUS_23860 gene cheW 64577 64038 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_23860 64956 64582 gene locus_tag LOCUS_23870 64956 64582 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_23870 66627 65395 gene locus_tag LOCUS_23880 66627 65395 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056200.1 protein_id gnl|my_center|LOCUS_23880 67380 69086 gene locus_tag LOCUS_23890 67380 69086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 protein_id gnl|my_center|LOCUS_23890 69279 69833 gene locus_tag LOCUS_23900 69279 69833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 70791 69847 gene locus_tag LOCUS_23910 70791 69847 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_23910 70939 71901 gene locus_tag LOCUS_23920 70939 71901 CDS product methyltransferase type 11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_23920 71919 72173 gene locus_tag LOCUS_23930 71919 72173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058260.1 protein_id gnl|my_center|LOCUS_23930 72222 72857 gene locus_tag LOCUS_23940 72222 72857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 72860 73603 gene locus_tag LOCUS_23950 72860 73603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23950 74861 73776 gene locus_tag LOCUS_23960 gene desA 74861 73776 CDS product delta 12 acyl-lipid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143724.1 protein_id gnl|my_center|LOCUS_23960 75981 75154 gene locus_tag LOCUS_23970 75981 75154 CDS product tRNA/rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057803.1 protein_id gnl|my_center|LOCUS_23970 <77198 76040 gene locus_tag LOCUS_23980 <77198 76040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:transposase >Feature sequence21 659 955 gene locus_tag LOCUS_23990 659 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_23990 975 1316 gene locus_tag LOCUS_24000 975 1316 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_24000 1383 1781 gene locus_tag LOCUS_24010 1383 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 1826 2245 gene locus_tag LOCUS_24020 gene vapc26 1826 2245 CDS product ribonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3P2L6 protein_id gnl|my_center|LOCUS_24020 2926 2267 gene locus_tag LOCUS_24030 2926 2267 CDS product phycocyanobilin lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056611.1 protein_id gnl|my_center|LOCUS_24030 3103 3888 gene locus_tag LOCUS_24040 gene cobI 3103 3888 CDS product precorrin-2 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_24040 4012 5487 gene locus_tag LOCUS_24050 4012 5487 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_24050 5497 6237 gene locus_tag LOCUS_24060 5497 6237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057138.1 protein_id gnl|my_center|LOCUS_24060 6325 7683 gene locus_tag LOCUS_24070 6325 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 8286 7696 gene locus_tag LOCUS_24080 gene leuD 8286 7696 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_24080 9296 8352 gene locus_tag LOCUS_24090 9296 8352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 10165 9485 gene locus_tag LOCUS_24100 10165 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 11083 10283 gene locus_tag LOCUS_24110 gene ribD 11083 10283 CDS product riboflavin biosynthesis protein RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124281.1 protein_id gnl|my_center|LOCUS_24110 11373 11897 gene locus_tag LOCUS_24120 11373 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058114.1 protein_id gnl|my_center|LOCUS_24120 13652 11940 gene locus_tag LOCUS_24130 13652 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 19878 14182 gene locus_tag LOCUS_24140 19878 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 20058 20948 gene locus_tag LOCUS_24150 20058 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 20975 21916 gene locus_tag LOCUS_24160 20975 21916 CDS product peptidase U61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_24160 21944 22561 gene locus_tag LOCUS_24170 21944 22561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 23983 22592 gene locus_tag LOCUS_24180 gene thiC 23983 22592 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLZ2 protein_id gnl|my_center|LOCUS_24180 24534 25643 gene locus_tag LOCUS_24190 24534 25643 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971276.1 protein_id gnl|my_center|LOCUS_24190 25731 26339 gene locus_tag LOCUS_24200 25731 26339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 26416 27447 gene locus_tag LOCUS_24210 26416 27447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 27502 28464 gene locus_tag LOCUS_24220 gene menA 27502 28464 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW6 protein_id gnl|my_center|LOCUS_24220 28471 29043 gene locus_tag LOCUS_24230 28471 29043 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143855.1 protein_id gnl|my_center|LOCUS_24230 29071 30162 gene locus_tag LOCUS_24240 29071 30162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 30559 31386 gene locus_tag LOCUS_24250 30559 31386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 31437 33263 gene locus_tag LOCUS_24260 31437 33263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 33434 33515 gene locus_tag LOCUS_t00300 33434 33515 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 33563 33635 gene locus_tag LOCUS_t00310 33563 33635 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 33775 33859 gene locus_tag LOCUS_t00320 33775 33859 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 33911 33982 gene locus_tag LOCUS_t00330 33911 33982 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 34204 34950 gene locus_tag LOCUS_24270 34204 34950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 35134 36132 gene locus_tag LOCUS_24280 35134 36132 CDS product pyridoxal-5'-phosphate-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104000.1 protein_id gnl|my_center|LOCUS_24280 39198 36187 gene locus_tag LOCUS_24290 gene uvrA 39198 36187 CDS product UvrABC system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9F2 protein_id gnl|my_center|LOCUS_24290 40148 39393 gene locus_tag LOCUS_24300 40148 39393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 41392 40343 gene locus_tag LOCUS_24310 41392 40343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_24310 41741 42085 gene locus_tag LOCUS_24320 41741 42085 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272414.1 protein_id gnl|my_center|LOCUS_24320 41982 42431 gene locus_tag LOCUS_24330 41982 42431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 43191 42565 gene locus_tag LOCUS_24340 43191 42565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_24340 44613 43249 gene locus_tag LOCUS_24350 44613 43249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 46098 44722 gene locus_tag LOCUS_24360 46098 44722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 47895 46120 gene locus_tag LOCUS_24370 47895 46120 CDS product sodium:sulfate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327432.1 protein_id gnl|my_center|LOCUS_24370 49559 47931 gene locus_tag LOCUS_24380 49559 47931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 50109 49759 gene locus_tag LOCUS_24390 gene rpsF 50109 49759 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJE6 protein_id gnl|my_center|LOCUS_24390 50712 50218 gene locus_tag LOCUS_24400 50712 50218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 protein_id gnl|my_center|LOCUS_24400 51332 50790 gene locus_tag LOCUS_24410 51332 50790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 52605 51337 gene locus_tag LOCUS_24420 52605 51337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 53933 52602 gene locus_tag LOCUS_24430 53933 52602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 54049 54612 gene locus_tag LOCUS_24440 54049 54612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_24440 55433 54627 gene locus_tag LOCUS_24450 55433 54627 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082921.1 protein_id gnl|my_center|LOCUS_24450 56304 55513 gene locus_tag LOCUS_24460 56304 55513 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531127.1 protein_id gnl|my_center|LOCUS_24460 57488 56451 gene locus_tag LOCUS_24470 57488 56451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_24470 58609 57623 gene locus_tag LOCUS_24480 gene miaA 58609 57623 CDS product tRNA dimethylallyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM5 protein_id gnl|my_center|LOCUS_24480 59371 58643 gene locus_tag LOCUS_24490 59371 58643 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056089.1 protein_id gnl|my_center|LOCUS_24490 60374 60688 gene locus_tag LOCUS_24500 60374 60688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 protein_id gnl|my_center|LOCUS_24500 64109 60813 gene locus_tag LOCUS_24510 64109 60813 CDS product UPF0182 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJM9 protein_id gnl|my_center|LOCUS_24510 65634 64222 gene locus_tag LOCUS_24520 gene dnaA 65634 64222 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL93 protein_id gnl|my_center|LOCUS_24520 66126 66935 gene locus_tag LOCUS_24530 66126 66935 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_24530 67423 66956 gene locus_tag LOCUS_24540 67423 66956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 67702 68370 gene locus_tag LOCUS_24550 67702 68370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 70020 68449 gene locus_tag LOCUS_24560 70020 68449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 72481 70103 gene locus_tag LOCUS_24570 72481 70103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence22 177 1952 gene locus_tag LOCUS_24580 177 1952 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087537.1 protein_id gnl|my_center|LOCUS_24580 2025 3752 gene locus_tag LOCUS_24590 2025 3752 CDS product adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087537.1 protein_id gnl|my_center|LOCUS_24590 4510 3788 gene locus_tag LOCUS_24600 gene trmH 4510 3788 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A6H0K0 protein_id gnl|my_center|LOCUS_24600 4712 5593 gene locus_tag LOCUS_24610 4712 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_24610 5624 6268 gene locus_tag LOCUS_24620 gene cobH 5624 6268 CDS product cobalt-precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056028.1 protein_id gnl|my_center|LOCUS_24620 6723 6265 gene locus_tag LOCUS_24630 6723 6265 CDS product aspartyl-tRNA amidotransferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_24630 6765 7391 gene locus_tag LOCUS_24640 6765 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143381.1 protein_id gnl|my_center|LOCUS_24640 7570 7842 gene locus_tag LOCUS_24650 7570 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 7943 11686 gene locus_tag LOCUS_24660 gene oplaH 7943 11686 CDS product 5-oxoprolinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063869.1 protein_id gnl|my_center|LOCUS_24660 12461 11739 gene locus_tag LOCUS_24670 12461 11739 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533626.1 protein_id gnl|my_center|LOCUS_24670 13669 12494 gene locus_tag LOCUS_24680 13669 12494 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787406.1 protein_id gnl|my_center|LOCUS_24680 15698 13779 gene locus_tag LOCUS_24690 15698 13779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 17743 15986 gene locus_tag LOCUS_24700 17743 15986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 20652 18097 gene locus_tag LOCUS_24710 gene gyrA 20652 18097 CDS product DNA topoisomerase (ATP-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIY2 protein_id gnl|my_center|LOCUS_24710 20746 21147 gene locus_tag LOCUS_24720 20746 21147 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390954.1 protein_id gnl|my_center|LOCUS_24720 22137 21250 gene locus_tag LOCUS_24730 22137 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_24730 25317 22225 gene locus_tag LOCUS_24740 25317 22225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 26646 25507 gene locus_tag LOCUS_24750 26646 25507 CDS product glutamine--scyllo-inositol aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_24750 27749 26712 gene locus_tag LOCUS_24760 gene rlmN 27749 26712 CDS product putative dual-specificity RNA methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG98 protein_id gnl|my_center|LOCUS_24760 28136 30283 gene locus_tag LOCUS_24770 28136 30283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 30715 30443 gene locus_tag LOCUS_24780 30715 30443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 31939 31073 gene locus_tag LOCUS_24790 31939 31073 CDS product TIGR00268 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057083.1 protein_id gnl|my_center|LOCUS_24790 32227 31994 gene locus_tag LOCUS_24800 32227 31994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 32998 32405 gene locus_tag LOCUS_24810 32998 32405 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_24810 33425 33249 gene locus_tag LOCUS_24820 gene rpmF 33425 33249 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBW1 protein_id gnl|my_center|LOCUS_24820 35140 33503 gene locus_tag LOCUS_24830 35140 33503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 36953 35199 gene locus_tag LOCUS_24840 36953 35199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 37862 37008 gene locus_tag LOCUS_24850 37862 37008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_24850 38107 39021 gene locus_tag LOCUS_24860 38107 39021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 39505 40467 gene locus_tag LOCUS_24870 39505 40467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 40930 41754 gene locus_tag LOCUS_24880 40930 41754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 42082 43158 gene locus_tag LOCUS_24890 gene plsX 42082 43158 CDS product phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL5 protein_id gnl|my_center|LOCUS_24890 43158 44168 gene locus_tag LOCUS_24900 gene fabH 43158 44168 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKL4 protein_id gnl|my_center|LOCUS_24900 44555 44205 gene locus_tag LOCUS_24910 44555 44205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 47625 44629 gene locus_tag LOCUS_24920 47625 44629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 47893 48447 gene locus_tag LOCUS_24930 47893 48447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 48685 49530 gene locus_tag LOCUS_24940 48685 49530 CDS product molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903268.1 protein_id gnl|my_center|LOCUS_24940 49561 50010 gene locus_tag LOCUS_24950 49561 50010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_24950 50601 50017 gene locus_tag LOCUS_24960 50601 50017 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM4 protein_id gnl|my_center|LOCUS_24960 51312 50758 gene locus_tag LOCUS_24970 51312 50758 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056761.1 protein_id gnl|my_center|LOCUS_24970 51868 52143 gene locus_tag LOCUS_24980 gene hopD 51868 52143 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004392663.1 protein_id gnl|my_center|LOCUS_24980 52399 52689 gene locus_tag LOCUS_24990 52399 52689 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481749.1 protein_id gnl|my_center|LOCUS_24990 54567 52861 gene locus_tag LOCUS_25000 54567 52861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 55882 54707 gene locus_tag LOCUS_25010 55882 54707 CDS product UDP-N-acetyl glucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_25010 56105 57727 gene locus_tag LOCUS_25020 56105 57727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 58527 57871 gene locus_tag LOCUS_25030 58527 57871 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140651.1 protein_id gnl|my_center|LOCUS_25030 58946 59527 gene locus_tag LOCUS_25040 gene clpP1 58946 59527 CDS product ATP-dependent Clp protease proteolytic subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLI2 protein_id gnl|my_center|LOCUS_25040 60176 59676 gene locus_tag LOCUS_25050 gene apcD 60176 59676 CDS product allophycocyanin-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057391.1 protein_id gnl|my_center|LOCUS_25050 60473 61351 gene locus_tag LOCUS_25060 60473 61351 CDS product phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 protein_id gnl|my_center|LOCUS_25060 62070 61381 gene locus_tag LOCUS_25070 62070 61381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 62335 65088 gene locus_tag LOCUS_25080 62335 65088 CDS product B12-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_25080 65540 66148 gene locus_tag LOCUS_25090 65540 66148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 67380 66184 gene locus_tag LOCUS_25100 gene recA 67380 66184 CDS product protein RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9V8 protein_id gnl|my_center|LOCUS_25100 67975 67550 gene locus_tag LOCUS_25110 67975 67550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 68041 68922 gene locus_tag LOCUS_25120 gene folD 68041 68922 CDS product bifunctional protein FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMU0 protein_id gnl|my_center|LOCUS_25120 69455 68985 gene locus_tag LOCUS_25130 69455 68985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 69723 70655 gene locus_tag LOCUS_25140 gene crtE 69723 70655 CDS product farnesyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_25140 >Feature sequence23 1239 532 gene locus_tag LOCUS_25150 1239 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1543 2553 gene locus_tag LOCUS_25160 1543 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 3010 2651 gene locus_tag LOCUS_25170 3010 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 3873 3016 gene locus_tag LOCUS_25180 gene map 3873 3016 CDS product methionine aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLQ4 protein_id gnl|my_center|LOCUS_25180 5318 6271 gene locus_tag LOCUS_25190 5318 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 6313 7308 gene locus_tag LOCUS_25200 6313 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 7371 7910 gene locus_tag LOCUS_25210 7371 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_25210 8116 8868 gene locus_tag LOCUS_25220 8116 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 9940 8948 gene locus_tag LOCUS_25230 9940 8948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 10973 9963 gene locus_tag LOCUS_25240 gene ldhA 10973 9963 CDS product lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122039.1 protein_id gnl|my_center|LOCUS_25240 11589 12929 gene locus_tag LOCUS_25250 gene purA 11589 12929 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG2 protein_id gnl|my_center|LOCUS_25250 13218 13511 gene locus_tag LOCUS_25260 gene rplY 13218 13511 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG3 protein_id gnl|my_center|LOCUS_25260 16810 13721 gene locus_tag LOCUS_25270 16810 13721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 17663 17196 gene locus_tag LOCUS_25280 17663 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 17908 19071 gene locus_tag LOCUS_25290 17908 19071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_25290 19781 21100 gene locus_tag LOCUS_25300 19781 21100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 22049 26356 gene locus_tag LOCUS_25310 22049 26356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 26465 31735 gene locus_tag LOCUS_25320 26465 31735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 31877 31722 gene locus_tag LOCUS_25330 31877 31722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 31892 35038 gene locus_tag LOCUS_25340 31892 35038 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056416.1 protein_id gnl|my_center|LOCUS_25340 35532 36437 gene locus_tag LOCUS_25350 35532 36437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 36637 40158 gene locus_tag LOCUS_25360 36637 40158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 43118 40191 gene locus_tag LOCUS_25370 43118 40191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 43916 43152 gene locus_tag LOCUS_25380 43916 43152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057555.1 protein_id gnl|my_center|LOCUS_25380 47000 44172 gene locus_tag LOCUS_25390 47000 44172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 48421 47108 gene locus_tag LOCUS_25400 48421 47108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 48879 48673 gene locus_tag LOCUS_25410 48879 48673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 52023 48898 gene locus_tag LOCUS_25420 52023 48898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 52281 53804 gene locus_tag LOCUS_25430 gene ycf46 52281 53804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_25430 53978 54604 gene locus_tag LOCUS_25440 53978 54604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 57071 54723 gene locus_tag LOCUS_25450 57071 54723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 58625 57546 gene locus_tag LOCUS_25460 58625 57546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887046.1 protein_id gnl|my_center|LOCUS_25460 58947 58876 gene locus_tag LOCUS_t00340 58947 58876 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 59758 59027 gene locus_tag LOCUS_25470 59758 59027 CDS product UPF0758 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI83 protein_id gnl|my_center|LOCUS_25470 60050 61219 gene locus_tag LOCUS_25480 60050 61219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 61376 62326 gene locus_tag LOCUS_25490 gene dusA 61376 62326 CDS product tRNA-dihydrouridine(20/20a) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5E844 protein_id gnl|my_center|LOCUS_25490 64420 62468 gene locus_tag LOCUS_25500 64420 62468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 65787 65323 gene locus_tag LOCUS_25510 65787 65323 CDS product putative tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM1 protein_id gnl|my_center|LOCUS_25510 67294 66143 gene locus_tag LOCUS_25520 67294 66143 CDS product putative glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_25520 68456 67539 gene locus_tag LOCUS_25530 68456 67539 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141618.1 protein_id gnl|my_center|LOCUS_25530 68558 69076 gene locus_tag LOCUS_25540 68558 69076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 69110 69553 gene locus_tag LOCUS_25550 69110 69553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence24 1924 794 gene locus_tag LOCUS_25560 1924 794 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_25560 2045 2509 gene locus_tag LOCUS_25570 2045 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142941.1 protein_id gnl|my_center|LOCUS_25570 3444 2512 gene locus_tag LOCUS_25580 3444 2512 CDS product 2-hydroxy-6-oxohepta-2,4-dienoate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_25580 5347 3533 gene locus_tag LOCUS_25590 5347 3533 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706407.1 protein_id gnl|my_center|LOCUS_25590 5544 6155 gene locus_tag LOCUS_25600 5544 6155 CDS product cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939156.1 protein_id gnl|my_center|LOCUS_25600 8240 6162 gene locus_tag LOCUS_25610 8240 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 8528 8601 gene locus_tag LOCUS_t00350 8528 8601 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9231 10799 gene locus_tag LOCUS_25620 9231 10799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 11912 10872 gene locus_tag LOCUS_25630 gene pyrC 11912 10872 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H2WJJ9 protein_id gnl|my_center|LOCUS_25630 12479 11967 gene locus_tag LOCUS_25640 gene ruvC 12479 11967 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NG73 protein_id gnl|my_center|LOCUS_25640 12612 12980 gene locus_tag LOCUS_25650 gene ssb 12612 12980 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIU1 protein_id gnl|my_center|LOCUS_25650 13765 12977 gene locus_tag LOCUS_25660 13765 12977 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_25660 14849 13920 gene locus_tag LOCUS_25670 14849 13920 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389749.1 protein_id gnl|my_center|LOCUS_25670 15932 15009 gene locus_tag LOCUS_25680 15932 15009 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057302.1 protein_id gnl|my_center|LOCUS_25680 17192 16098 gene locus_tag LOCUS_25690 gene ychF 17192 16098 CDS product ribosome-binding ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIJ8 protein_id gnl|my_center|LOCUS_25690 18255 17332 gene locus_tag LOCUS_25700 18255 17332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 18651 21194 gene locus_tag LOCUS_25710 18651 21194 CDS product cation transporter E1-E2 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056008.1 protein_id gnl|my_center|LOCUS_25710 21784 21191 gene locus_tag LOCUS_25720 21784 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 23932 21806 gene locus_tag LOCUS_25730 23932 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 26611 24014 gene locus_tag LOCUS_25740 26611 24014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 26844 26704 gene locus_tag LOCUS_25750 26844 26704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 27327 27016 gene locus_tag LOCUS_25760 27327 27016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 27803 28915 gene locus_tag LOCUS_25770 27803 28915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 29078 29977 gene locus_tag LOCUS_25780 29078 29977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 30072 30770 gene locus_tag LOCUS_25790 gene menG 30072 30770 CDS product 2-phytyl-1,4-naphtoquinone methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NPC8 protein_id gnl|my_center|LOCUS_25790 30903 32108 gene locus_tag LOCUS_25800 30903 32108 CDS product UPF0754 membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM9 protein_id gnl|my_center|LOCUS_25800 32228 33004 gene locus_tag LOCUS_25810 32228 33004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_25810 33327 34835 gene locus_tag LOCUS_25820 33327 34835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 34924 36060 gene locus_tag LOCUS_25830 34924 36060 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_25830 36320 37564 gene locus_tag LOCUS_25840 36320 37564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 38743 37643 gene locus_tag LOCUS_25850 38743 37643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 39265 38768 gene locus_tag LOCUS_25860 39265 38768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 41060 39456 gene locus_tag LOCUS_25870 41060 39456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 41328 41065 gene locus_tag LOCUS_25880 41328 41065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 41216 42337 gene locus_tag LOCUS_25890 gene mnmA 41216 42337 CDS product tRNA-specific 2-thiouridylase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8CWM0 protein_id gnl|my_center|LOCUS_25890 42804 42643 gene locus_tag LOCUS_25900 42804 42643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 44369 44169 gene locus_tag LOCUS_25910 44369 44169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 45364 44432 gene locus_tag LOCUS_25920 45364 44432 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055913.1 protein_id gnl|my_center|LOCUS_25920 46424 45519 gene locus_tag LOCUS_25930 46424 45519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 47243 46581 gene locus_tag LOCUS_25940 47243 46581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 48638 47499 gene locus_tag LOCUS_25950 48638 47499 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055927.1 protein_id gnl|my_center|LOCUS_25950 48817 49803 gene locus_tag LOCUS_25960 gene cysM 48817 49803 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058144.1 protein_id gnl|my_center|LOCUS_25960 49855 50799 gene locus_tag LOCUS_25970 49855 50799 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729119.1 protein_id gnl|my_center|LOCUS_25970 52489 50879 gene locus_tag LOCUS_25980 gene pgi 52489 50879 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY2 protein_id gnl|my_center|LOCUS_25980 52992 54359 gene locus_tag LOCUS_25990 52992 54359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 54512 55624 gene locus_tag LOCUS_26000 54512 55624 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057159.1 protein_id gnl|my_center|LOCUS_26000 55799 56806 gene locus_tag LOCUS_26010 55799 56806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 56973 57152 gene locus_tag LOCUS_26020 56973 57152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 57224 57403 gene locus_tag LOCUS_26030 57224 57403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 58369 57614 gene locus_tag LOCUS_26040 58369 57614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 58569 60443 gene locus_tag LOCUS_26050 58569 60443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 60691 60506 gene locus_tag LOCUS_26060 60691 60506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 60614 62626 gene locus_tag LOCUS_26070 60614 62626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 63422 62640 gene locus_tag LOCUS_26080 63422 62640 CDS product CAAX protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_26080 63676 64236 gene locus_tag LOCUS_26090 gene def 63676 64236 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIB4 protein_id gnl|my_center|LOCUS_26090 64217 64537 gene locus_tag LOCUS_26100 64217 64537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 65848 64598 gene locus_tag LOCUS_26110 65848 64598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 67263 66319 gene locus_tag LOCUS_26120 67263 66319 CDS product peptide ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_26120 67275 67889 gene locus_tag LOCUS_26130 gene aroK 67275 67889 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKH7 protein_id gnl|my_center|LOCUS_26130 67933 68820 gene locus_tag LOCUS_26140 gene argB 67933 68820 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59303 protein_id gnl|my_center|LOCUS_26140 >Feature sequence25 128 307 gene locus_tag LOCUS_26150 128 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 942 343 gene locus_tag LOCUS_26160 942 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1095 1691 gene locus_tag LOCUS_26170 1095 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 3537 1696 gene locus_tag LOCUS_26180 3537 1696 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099121.1 protein_id gnl|my_center|LOCUS_26180 4355 3555 gene locus_tag LOCUS_26190 gene comB 4355 3555 CDS product putative 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLS5 protein_id gnl|my_center|LOCUS_26190 4579 5262 gene locus_tag LOCUS_26200 4579 5262 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056348.1 protein_id gnl|my_center|LOCUS_26200 5359 7179 gene locus_tag LOCUS_26210 5359 7179 CDS product peptidase M61 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057589.1 protein_id gnl|my_center|LOCUS_26210 7892 7224 gene locus_tag LOCUS_26220 7892 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 8670 8065 gene locus_tag LOCUS_26230 8670 8065 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226509.1 protein_id gnl|my_center|LOCUS_26230 10302 8761 gene locus_tag LOCUS_26240 10302 8761 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_26240 10536 11888 gene locus_tag LOCUS_26250 10536 11888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 13007 12009 gene locus_tag LOCUS_26260 13007 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 13345 12989 gene locus_tag LOCUS_26270 13345 12989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 13491 15074 gene locus_tag LOCUS_26280 13491 15074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_26280 15414 15223 gene locus_tag LOCUS_26290 15414 15223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 15668 16375 gene locus_tag LOCUS_26300 gene ycf29 15668 16375 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_26300 16492 17331 gene locus_tag LOCUS_26310 gene sfsA 16492 17331 CDS product sugar fermentation stimulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI93 protein_id gnl|my_center|LOCUS_26310 18722 17352 gene locus_tag LOCUS_26320 gene accC 18722 17352 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_26320 19895 18864 gene locus_tag LOCUS_26330 19895 18864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 20068 19859 gene locus_tag LOCUS_26340 20068 19859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 20566 20189 gene locus_tag LOCUS_26350 20566 20189 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124399.1 protein_id gnl|my_center|LOCUS_26350 22203 20860 gene locus_tag LOCUS_26360 22203 20860 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083716.1 protein_id gnl|my_center|LOCUS_26360 24304 22241 gene locus_tag LOCUS_26370 24304 22241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 27057 24547 gene locus_tag LOCUS_26380 27057 24547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 27705 29672 gene locus_tag LOCUS_26390 27705 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 29728 30486 gene locus_tag LOCUS_26400 29728 30486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 32243 30483 gene locus_tag LOCUS_26410 gene menD 32243 30483 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMI6 protein_id gnl|my_center|LOCUS_26410 32816 32385 gene locus_tag LOCUS_26420 32816 32385 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057352.1 protein_id gnl|my_center|LOCUS_26420 36107 33510 gene locus_tag LOCUS_26430 36107 33510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 36566 36168 gene locus_tag LOCUS_26440 36566 36168 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141461.1 protein_id gnl|my_center|LOCUS_26440 38389 36794 gene locus_tag LOCUS_26450 38389 36794 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_26450 40545 38911 gene locus_tag LOCUS_26460 40545 38911 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057543.1 protein_id gnl|my_center|LOCUS_26460 42928 40859 gene locus_tag LOCUS_26470 42928 40859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_26470 43425 43694 gene locus_tag LOCUS_26480 43425 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 44374 43739 gene locus_tag LOCUS_26490 44374 43739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 46107 44845 gene locus_tag LOCUS_26500 46107 44845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 46782 46192 gene locus_tag LOCUS_26510 46782 46192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 48047 47154 gene locus_tag LOCUS_26520 48047 47154 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKZ2 protein_id gnl|my_center|LOCUS_26520 49187 48249 gene locus_tag LOCUS_26530 49187 48249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 protein_id gnl|my_center|LOCUS_26530 49828 49325 gene locus_tag LOCUS_26540 49828 49325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 50403 49873 gene locus_tag LOCUS_26550 50403 49873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P64686 protein_id gnl|my_center|LOCUS_26550 51388 50492 gene locus_tag LOCUS_26560 gene trpC 51388 50492 CDS product indole-3-glycerol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL01 protein_id gnl|my_center|LOCUS_26560 51669 53918 gene locus_tag LOCUS_26570 51669 53918 CDS product sulfate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939285.1 protein_id gnl|my_center|LOCUS_26570 54167 56104 gene locus_tag LOCUS_26580 gene gyrB 54167 56104 CDS product DNA gyrase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL50 protein_id gnl|my_center|LOCUS_26580 56300 56602 gene locus_tag LOCUS_26590 56300 56602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 56662 57453 gene locus_tag LOCUS_26600 gene rnc 56662 57453 CDS product ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NH89 protein_id gnl|my_center|LOCUS_26600 57604 59496 gene locus_tag LOCUS_26610 57604 59496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 60327 59503 gene locus_tag LOCUS_26620 60327 59503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 61833 60370 gene locus_tag LOCUS_26630 gene gatA 61833 60370 CDS product glutamyl-tRNA(Gln) amidotransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK65 protein_id gnl|my_center|LOCUS_26630 62603 61935 gene locus_tag LOCUS_26640 gene hisG 62603 61935 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD9 protein_id gnl|my_center|LOCUS_26640 62745 63113 gene locus_tag LOCUS_26650 62745 63113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26650 >Feature sequence26 2459 1071 gene locus_tag LOCUS_26660 2459 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26660 2609 4036 gene locus_tag LOCUS_26670 gene aspA 2609 4036 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141457.1 protein_id gnl|my_center|LOCUS_26670 4176 5663 gene locus_tag LOCUS_26680 4176 5663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_26680 6553 5660 gene locus_tag LOCUS_26690 6553 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 7668 6745 gene locus_tag LOCUS_26700 7668 6745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 7740 8735 gene locus_tag LOCUS_26710 7740 8735 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_26710 12291 8746 gene locus_tag LOCUS_26720 12291 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_26720 12480 14702 gene locus_tag LOCUS_26730 12480 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 15303 14845 gene locus_tag LOCUS_26740 15303 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 15831 15469 gene locus_tag LOCUS_26750 15831 15469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 15998 17764 gene locus_tag LOCUS_26760 15998 17764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 19024 18143 gene locus_tag LOCUS_26770 19024 18143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 19296 19991 gene locus_tag LOCUS_26780 19296 19991 CDS product cupin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478128.1 protein_id gnl|my_center|LOCUS_26780 21961 19988 gene locus_tag LOCUS_26790 21961 19988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_26790 22280 24241 gene locus_tag LOCUS_26800 gene recN 22280 24241 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NNY7 protein_id gnl|my_center|LOCUS_26800 24809 27577 gene locus_tag LOCUS_26810 24809 27577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 29063 27741 gene locus_tag LOCUS_26820 gene opcA 29063 27741 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_26820 30730 29201 gene locus_tag LOCUS_26830 gene zwf 30730 29201 CDS product glucose-6-phosphate 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF3 protein_id gnl|my_center|LOCUS_26830 32188 31154 gene locus_tag LOCUS_26840 gene fbp 32188 31154 CDS product fructose-1,6-bisphosphatase class 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLF2 protein_id gnl|my_center|LOCUS_26840 33660 32644 gene locus_tag LOCUS_26850 gene sigB 33660 32644 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056675.1 protein_id gnl|my_center|LOCUS_26850 35924 34713 gene locus_tag LOCUS_26860 35924 34713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 37317 36115 gene locus_tag LOCUS_26870 37317 36115 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_26870 37568 37960 gene locus_tag LOCUS_26880 37568 37960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 37976 38848 gene locus_tag LOCUS_26890 gene rsmI 37976 38848 CDS product ribosomal RNA small subunit methyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIR7 protein_id gnl|my_center|LOCUS_26890 39419 38892 gene locus_tag LOCUS_26900 39419 38892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 40619 39675 gene locus_tag LOCUS_26910 40619 39675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 41674 40853 gene locus_tag LOCUS_26920 41674 40853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_26920 42202 41744 gene locus_tag LOCUS_26930 gene aroQ 42202 41744 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ7 protein_id gnl|my_center|LOCUS_26930 42475 42338 gene locus_tag LOCUS_26940 42475 42338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 42897 43193 gene locus_tag LOCUS_26950 42897 43193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125345.1 protein_id gnl|my_center|LOCUS_26950 43390 44712 gene locus_tag LOCUS_26960 43390 44712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 46018 44741 gene locus_tag LOCUS_26970 46018 44741 CDS product carbon dioxide concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_26970 46712 46011 gene locus_tag LOCUS_26980 gene ribC 46712 46011 CDS product riboflavin synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_26980 49147 46754 gene locus_tag LOCUS_26990 49147 46754 CDS product GTP pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056432.1 protein_id gnl|my_center|LOCUS_26990 49714 50133 gene locus_tag LOCUS_27000 49714 50133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 51213 50137 gene locus_tag LOCUS_27010 51213 50137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 51608 52453 gene locus_tag LOCUS_27020 51608 52453 CDS product primosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_27020 53610 52507 gene locus_tag LOCUS_27030 53610 52507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 54783 53701 gene locus_tag LOCUS_27040 54783 53701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 55419 54955 gene locus_tag LOCUS_27050 55419 54955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143216.1 protein_id gnl|my_center|LOCUS_27050 55579 56112 gene locus_tag LOCUS_27060 55579 56112 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083430.1 protein_id gnl|my_center|LOCUS_27060 56350 57222 gene locus_tag LOCUS_27070 56350 57222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 57578 58585 gene locus_tag LOCUS_27080 gene fmt 57578 58585 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHS1 protein_id gnl|my_center|LOCUS_27080 59334 58600 gene locus_tag LOCUS_27090 gene modB 59334 58600 CDS product molybdenum ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888685.1 protein_id gnl|my_center|LOCUS_27090 60041 59430 gene locus_tag LOCUS_27100 60041 59430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 60218 60823 gene locus_tag LOCUS_27110 60218 60823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 61501 60890 gene locus_tag LOCUS_27120 61501 60890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 >Feature sequence27 1078 188 gene locus_tag LOCUS_27130 1078 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 1831 1199 gene locus_tag LOCUS_27140 1831 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 5698 1982 gene locus_tag LOCUS_27150 5698 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 6225 7319 gene locus_tag LOCUS_27160 6225 7319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 7410 8438 gene locus_tag LOCUS_27170 7410 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 8439 9995 gene locus_tag LOCUS_27180 8439 9995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 10158 10865 gene locus_tag LOCUS_27190 10158 10865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 11197 12507 gene locus_tag LOCUS_27200 gene hisS 11197 12507 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHP7 protein_id gnl|my_center|LOCUS_27200 12598 14169 gene locus_tag LOCUS_27210 12598 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 14365 15819 gene locus_tag LOCUS_27220 14365 15819 CDS product cytidine(C)-cytidine(C)-adenosine (A)]-adding enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_27220 16826 15828 gene locus_tag LOCUS_27230 16826 15828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 17227 17075 gene locus_tag LOCUS_27240 17227 17075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 18109 17312 gene locus_tag LOCUS_27250 18109 17312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 19665 18472 gene locus_tag LOCUS_27260 19665 18472 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_27260 19846 19919 gene locus_tag LOCUS_t00360 19846 19919 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 20001 20074 gene locus_tag LOCUS_t00370 20001 20074 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 20364 21647 gene locus_tag LOCUS_27270 gene glyA 20364 21647 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DH33 protein_id gnl|my_center|LOCUS_27270 22011 23336 gene locus_tag LOCUS_27280 22011 23336 CDS product glucosylglycerol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124948.1 protein_id gnl|my_center|LOCUS_27280 23458 23766 gene locus_tag LOCUS_27290 23458 23766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 23882 26221 gene locus_tag LOCUS_27300 gene purL 23882 26221 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA7 protein_id gnl|my_center|LOCUS_27300 26492 26340 gene locus_tag LOCUS_27310 26492 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 26479 27993 gene locus_tag LOCUS_27320 gene purF 26479 27993 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NIR8 protein_id gnl|my_center|LOCUS_27320 28844 28104 gene locus_tag LOCUS_27330 gene ung 28844 28104 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q92LU5 protein_id gnl|my_center|LOCUS_27330 31475 28926 gene locus_tag LOCUS_27340 31475 28926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 31804 31526 gene locus_tag LOCUS_27350 31804 31526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 31703 32068 gene locus_tag LOCUS_27360 31703 32068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 33175 32150 gene locus_tag LOCUS_27370 33175 32150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 33809 35167 gene locus_tag LOCUS_27380 33809 35167 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058123.1 protein_id gnl|my_center|LOCUS_27380 35365 37836 gene locus_tag LOCUS_27390 35365 37836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 38092 38631 gene locus_tag LOCUS_27400 38092 38631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 38780 38971 gene locus_tag LOCUS_27410 38780 38971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 41737 38987 gene locus_tag LOCUS_27420 41737 38987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 41986 41774 gene locus_tag LOCUS_27430 41986 41774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 43196 42645 gene locus_tag LOCUS_27440 43196 42645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 44670 43228 gene locus_tag LOCUS_27450 44670 43228 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_27450 46345 44822 gene locus_tag LOCUS_27460 46345 44822 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057178.1 protein_id gnl|my_center|LOCUS_27460 46753 47586 gene locus_tag LOCUS_27470 46753 47586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_27470 49354 47738 gene locus_tag LOCUS_27480 gene gpmI 49354 47738 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59177 protein_id gnl|my_center|LOCUS_27480 51154 49436 gene locus_tag LOCUS_27490 51154 49436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_27490 51405 51489 gene locus_tag LOCUS_t00380 51405 51489 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51696 52277 gene locus_tag LOCUS_27500 51696 52277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_27500 52875 52309 gene locus_tag LOCUS_27510 52875 52309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 53293 54639 gene locus_tag LOCUS_27520 gene aroA 53293 54639 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY3 protein_id gnl|my_center|LOCUS_27520 54777 55277 gene locus_tag LOCUS_27530 54777 55277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 55652 56287 gene locus_tag LOCUS_27540 55652 56287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 56521 57804 gene locus_tag LOCUS_27550 56521 57804 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_27550 57969 58295 gene locus_tag LOCUS_27560 57969 58295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 58585 59184 gene locus_tag LOCUS_27570 58585 59184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 60236 59181 gene locus_tag LOCUS_27580 gene nifS 60236 59181 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_27580 60557 61108 gene locus_tag LOCUS_27590 60557 61108 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223770.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence28 205 2640 gene locus_tag LOCUS_27600 205 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 2784 3254 gene locus_tag LOCUS_27610 2784 3254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056934.1 protein_id gnl|my_center|LOCUS_27610 3366 3815 gene locus_tag LOCUS_27620 3366 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 3853 4953 gene locus_tag LOCUS_27630 3853 4953 CDS product threonine-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_27630 5077 7191 gene locus_tag LOCUS_27640 5077 7191 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_27640 7621 8490 gene locus_tag LOCUS_27650 7621 8490 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_27650 9504 8575 gene locus_tag LOCUS_27660 gene wcaG 9504 8575 CDS product mRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_27660 9732 11882 gene locus_tag LOCUS_27670 9732 11882 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_27670 12493 12104 gene locus_tag LOCUS_27680 12493 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27680 13270 12572 gene locus_tag LOCUS_27690 gene yfcG 13270 12572 CDS product thiol:disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_27690 13425 13787 gene locus_tag LOCUS_27700 13425 13787 CDS product HxlR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122372.1 protein_id gnl|my_center|LOCUS_27700 13886 14332 gene locus_tag LOCUS_27710 13886 14332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 15288 14524 gene locus_tag LOCUS_27720 gene cpcG2 15288 14524 CDS product phycobilisome rod-core linker polypeptide CpcG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50040 protein_id gnl|my_center|LOCUS_27720 16263 15622 gene locus_tag LOCUS_27730 gene ycf58 16263 15622 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLD5 protein_id gnl|my_center|LOCUS_27730 17123 16992 gene locus_tag LOCUS_27740 17123 16992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 17204 17554 gene locus_tag LOCUS_27750 17204 17554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 17650 17720 gene locus_tag LOCUS_t00390 17650 17720 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 17818 19206 gene locus_tag LOCUS_27760 17818 19206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_27760 19264 20091 gene locus_tag LOCUS_27770 19264 20091 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_27770 20597 21418 gene locus_tag LOCUS_27780 20597 21418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057260.1 protein_id gnl|my_center|LOCUS_27780 21502 22110 gene locus_tag LOCUS_27790 21502 22110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 22165 22980 gene locus_tag LOCUS_27800 22165 22980 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057258.1 protein_id gnl|my_center|LOCUS_27800 25318 23177 gene locus_tag LOCUS_27810 gene pnp 25318 23177 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGW9 protein_id gnl|my_center|LOCUS_27810 25884 25453 gene locus_tag LOCUS_27820 25884 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 26086 26394 gene locus_tag LOCUS_27830 gene ccmK 26086 26394 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_27830 27154 26411 gene locus_tag LOCUS_27840 27154 26411 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_27840 27835 27218 gene locus_tag LOCUS_27850 27835 27218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_27850 30568 27848 gene locus_tag LOCUS_27860 30568 27848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 31193 30561 gene locus_tag LOCUS_27870 31193 30561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 31670 31239 gene locus_tag LOCUS_27880 31670 31239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 31846 33801 gene locus_tag LOCUS_27890 gene glmS 31846 33801 CDS product glutamine--fructose-6-phosphate aminotransferase [isomerizing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJI6 protein_id gnl|my_center|LOCUS_27890 34017 34586 gene locus_tag LOCUS_27900 34017 34586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 34813 35460 gene locus_tag LOCUS_27910 34813 35460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 35592 36143 gene locus_tag LOCUS_27920 35592 36143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 36198 37244 gene locus_tag LOCUS_27930 36198 37244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 38357 37209 gene locus_tag LOCUS_27940 38357 37209 CDS product carbon dioxide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_27940 39898 38414 gene locus_tag LOCUS_27950 gene ndhD 39898 38414 CDS product NAD(P)H-quinone oxidoreductase subunit D4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 protein_id gnl|my_center|LOCUS_27950 41912 40014 gene locus_tag LOCUS_27960 gene ndhF4 41912 40014 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_27960 42758 43066 gene locus_tag LOCUS_27970 42758 43066 CDS product carbon dioxide-concentrating protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_27970 43689 44009 gene locus_tag LOCUS_27980 gene ccmL 43689 44009 CDS product carbon dioxide concentrating mechanism protein CcmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_27980 44025 46112 gene locus_tag LOCUS_27990 gene ccmM 44025 46112 CDS product carbon dioxide concentrating mechanism protein CcmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142091.1 protein_id gnl|my_center|LOCUS_27990 46361 47077 gene locus_tag LOCUS_28000 gene ccmN 46361 47077 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056787.1 protein_id gnl|my_center|LOCUS_28000 48180 47086 gene locus_tag LOCUS_28010 48180 47086 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_28010 49556 48216 gene locus_tag LOCUS_28020 gene pyrC 49556 48216 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057373.1 protein_id gnl|my_center|LOCUS_28020 51011 49605 gene locus_tag LOCUS_28030 51011 49605 CDS product phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_28030 51593 51099 gene locus_tag LOCUS_28040 51593 51099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 52181 52924 gene locus_tag LOCUS_28050 52181 52924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 54566 53088 gene locus_tag LOCUS_28060 54566 53088 CDS product competence protein ComE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_28060 54729 54641 gene locus_tag LOCUS_t00400 54729 54641 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57539 54849 gene locus_tag LOCUS_28070 gene comE 57539 54849 CDS product competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_28070 58077 57586 gene locus_tag LOCUS_28080 58077 57586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 58708 60279 gene locus_tag LOCUS_28090 58708 60279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 60428 60195 gene locus_tag LOCUS_28100 60428 60195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 >Feature sequence29 95 430 gene locus_tag LOCUS_28110 95 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 615 1667 gene locus_tag LOCUS_28120 gene lpxD 615 1667 CDS product UDP-3-O-acylglucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VC79 protein_id gnl|my_center|LOCUS_28120 2018 1698 gene locus_tag LOCUS_28130 2018 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_28130 2823 2071 gene locus_tag LOCUS_28140 gene pth 2823 2071 CDS product peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN75 protein_id gnl|my_center|LOCUS_28140 4247 2853 gene locus_tag LOCUS_28150 gene mnmE 4247 2853 CDS product tRNA modification GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8P1 protein_id gnl|my_center|LOCUS_28150 4702 4253 gene locus_tag LOCUS_28160 4702 4253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 5385 4822 gene locus_tag LOCUS_28170 5385 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 6229 5450 gene locus_tag LOCUS_28180 6229 5450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 6965 6567 gene locus_tag LOCUS_28190 gene cytM 6965 6567 CDS product cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058261.1 protein_id gnl|my_center|LOCUS_28190 8300 7668 gene locus_tag LOCUS_28200 gene ruvA 8300 7668 CDS product Holliday junction ATP-dependent DNA helicase RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG1 protein_id gnl|my_center|LOCUS_28200 8911 8297 gene locus_tag LOCUS_28210 8911 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 8976 9605 gene locus_tag LOCUS_28220 8976 9605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 11681 9609 gene locus_tag LOCUS_28230 11681 9609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 13332 11806 gene locus_tag LOCUS_28240 13332 11806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 14427 13639 gene locus_tag LOCUS_28250 14427 13639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 14777 14532 gene locus_tag LOCUS_28260 14777 14532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 15378 14740 gene locus_tag LOCUS_28270 15378 14740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 16527 15559 gene locus_tag LOCUS_28280 16527 15559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227777.1 protein_id gnl|my_center|LOCUS_28280 16621 16965 gene locus_tag LOCUS_28290 gene ycf49 16621 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_28290 17055 17687 gene locus_tag LOCUS_28300 gene trpG 17055 17687 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_28300 17818 18606 gene locus_tag LOCUS_28310 17818 18606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057312.1 protein_id gnl|my_center|LOCUS_28310 18638 19990 gene locus_tag LOCUS_28320 18638 19990 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_28320 20552 20100 gene locus_tag LOCUS_28330 gene hspA 20552 20100 CDS product molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_28330 21447 20803 gene locus_tag LOCUS_28340 21447 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 21719 22108 gene locus_tag LOCUS_28350 gene queF 21719 22108 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMA3 protein_id gnl|my_center|LOCUS_28350 22623 22150 gene locus_tag LOCUS_28360 22623 22150 CDS product phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644009.1 protein_id gnl|my_center|LOCUS_28360 23879 22665 gene locus_tag LOCUS_28370 23879 22665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057332.1 protein_id gnl|my_center|LOCUS_28370 23993 24370 gene locus_tag LOCUS_28380 23993 24370 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_28380 24855 28841 gene locus_tag LOCUS_28390 24855 28841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 29336 30586 gene locus_tag LOCUS_28400 29336 30586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 30773 31423 gene locus_tag LOCUS_28410 30773 31423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 36487 31502 gene locus_tag LOCUS_28420 36487 31502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 37191 36508 gene locus_tag LOCUS_28430 37191 36508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 39347 37494 gene locus_tag LOCUS_28440 39347 37494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 40453 39386 gene locus_tag LOCUS_28450 40453 39386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 41167 40469 gene locus_tag LOCUS_28460 41167 40469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 42718 42008 gene locus_tag LOCUS_28470 42718 42008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 44094 43381 gene locus_tag LOCUS_28480 44094 43381 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582912.1 protein_id gnl|my_center|LOCUS_28480 44332 44886 gene locus_tag LOCUS_28490 44332 44886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 44891 48076 gene locus_tag LOCUS_28500 44891 48076 CDS product cation efflux system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142029.1 protein_id gnl|my_center|LOCUS_28500 48587 51757 gene locus_tag LOCUS_28510 48587 51757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058185.1 protein_id gnl|my_center|LOCUS_28510 51902 52768 gene locus_tag LOCUS_28520 51902 52768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 53023 52814 gene locus_tag LOCUS_28530 53023 52814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 53723 56611 gene locus_tag LOCUS_28540 53723 56611 CDS product peptidase M16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055906.1 protein_id gnl|my_center|LOCUS_28540 56817 57155 gene locus_tag LOCUS_28550 56817 57155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence30 2372 363 gene locus_tag LOCUS_28560 2372 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4392 2677 gene locus_tag LOCUS_28570 4392 2677 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_28570 5211 4648 gene locus_tag LOCUS_28580 5211 4648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 5450 7147 gene locus_tag LOCUS_28590 5450 7147 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_28590 7430 7717 gene locus_tag LOCUS_28600 7430 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 7998 9029 gene locus_tag LOCUS_28610 7998 9029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_28610 10002 9049 gene locus_tag LOCUS_28620 gene wcaA 10002 9049 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_28620 10203 11429 gene locus_tag LOCUS_28630 gene hisZ 10203 11429 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD8 protein_id gnl|my_center|LOCUS_28630 12193 11453 gene locus_tag LOCUS_28640 12193 11453 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_28640 14106 12460 gene locus_tag LOCUS_28650 14106 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 14566 15537 gene locus_tag LOCUS_28660 14566 15537 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957837.1 protein_id gnl|my_center|LOCUS_28660 15639 17381 gene locus_tag LOCUS_28670 gene mutL 15639 17381 CDS product DNA mismatch repair protein MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058297.1 protein_id gnl|my_center|LOCUS_28670 18236 17397 gene locus_tag LOCUS_28680 gene ykuE 18236 17397 CDS product putative metallophosphoesterase YkuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34870 protein_id gnl|my_center|LOCUS_28680 18848 18426 gene locus_tag LOCUS_28690 18848 18426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 18849 19067 gene locus_tag LOCUS_28700 18849 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 19138 19335 gene locus_tag LOCUS_28710 19138 19335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 20180 19311 gene locus_tag LOCUS_28720 gene ykuE 20180 19311 CDS product putative metallophosphoesterase YkuE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34870 protein_id gnl|my_center|LOCUS_28720 21028 20180 gene locus_tag LOCUS_28730 21028 20180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28730 21901 21080 gene locus_tag LOCUS_28740 gene potB 21901 21080 CDS product spermidine/putrescine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_28740 23178 22078 gene locus_tag LOCUS_28750 gene potD 23178 22078 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_28750 24443 23316 gene locus_tag LOCUS_28760 gene potA 24443 23316 CDS product spermidine/putrescine import ATP-binding protein PotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A9WBU2 protein_id gnl|my_center|LOCUS_28760 24659 25321 gene locus_tag LOCUS_28770 24659 25321 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768246.1 protein_id gnl|my_center|LOCUS_28770 26876 25836 gene locus_tag LOCUS_28780 26876 25836 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_28780 27458 28756 gene locus_tag LOCUS_28790 27458 28756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 30113 28920 gene locus_tag LOCUS_28800 gene wecE 30113 28920 CDS product aminotransferase DegT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_28800 30372 31265 gene locus_tag LOCUS_28810 30372 31265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 31538 33397 gene locus_tag LOCUS_28820 31538 33397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 33587 36193 gene locus_tag LOCUS_28830 33587 36193 CDS product aconitate hydratase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL06 protein_id gnl|my_center|LOCUS_28830 36329 37210 gene locus_tag LOCUS_28840 36329 37210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 37223 37414 gene locus_tag LOCUS_28850 37223 37414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 37414 37770 gene locus_tag LOCUS_28860 37414 37770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_28860 37760 38107 gene locus_tag LOCUS_28870 37760 38107 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074358.1 protein_id gnl|my_center|LOCUS_28870 38165 38698 gene locus_tag LOCUS_28880 38165 38698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 39668 38739 gene locus_tag LOCUS_28890 39668 38739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28890 39803 40624 gene locus_tag LOCUS_28900 39803 40624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_28900 41032 40631 gene locus_tag LOCUS_28910 41032 40631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 41841 41257 gene locus_tag LOCUS_28920 41841 41257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 42219 43130 gene locus_tag LOCUS_28930 42219 43130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 44348 43215 gene locus_tag LOCUS_28940 gene dnaN 44348 43215 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NGD9 protein_id gnl|my_center|LOCUS_28940 45151 46941 gene locus_tag LOCUS_28950 45151 46941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 47087 47798 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccattaattcaggatttgagaagcctcaaag 48972 48016 gene locus_tag LOCUS_28960 48972 48016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022102.1 protein_id gnl|my_center|LOCUS_28960 49220 50926 gene locus_tag LOCUS_28970 49220 50926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 51522 50941 gene locus_tag LOCUS_28980 51522 50941 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086720.1 protein_id gnl|my_center|LOCUS_28980 51705 52313 gene locus_tag LOCUS_28990 51705 52313 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969753.1 protein_id gnl|my_center|LOCUS_28990 52407 53009 gene locus_tag LOCUS_29000 52407 53009 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090559.1 protein_id gnl|my_center|LOCUS_29000 54134 53022 gene locus_tag LOCUS_29010 54134 53022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 54964 54299 gene locus_tag LOCUS_29020 54964 54299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 >Feature sequence31 237 716 gene locus_tag LOCUS_29030 237 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 943 740 gene locus_tag LOCUS_29040 943 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 984 2720 gene locus_tag LOCUS_29050 gene groL2 984 2720 CDS product 60 kDa chaperonin 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB4 protein_id gnl|my_center|LOCUS_29050 2833 3363 gene locus_tag LOCUS_29060 2833 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_29060 4193 3393 gene locus_tag LOCUS_29070 4193 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 4832 4302 gene locus_tag LOCUS_29080 4832 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 5398 5589 gene locus_tag LOCUS_29090 5398 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 6935 5661 gene locus_tag LOCUS_29100 6935 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 8293 6932 gene locus_tag LOCUS_29110 8293 6932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 8875 8378 gene locus_tag LOCUS_29120 8875 8378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 10105 8888 gene locus_tag LOCUS_29130 10105 8888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_29130 10890 10114 gene locus_tag LOCUS_29140 gene purC 10890 10114 CDS product phosphoribosylaminoimidazole-succinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIT5 protein_id gnl|my_center|LOCUS_29140 11079 12527 gene locus_tag LOCUS_29150 gene tig 11079 12527 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDP0 protein_id gnl|my_center|LOCUS_29150 12979 14337 gene locus_tag LOCUS_29160 gene clpX 12979 14337 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NDN9 protein_id gnl|my_center|LOCUS_29160 14350 15300 gene locus_tag LOCUS_29170 14350 15300 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_29170 15533 16048 gene locus_tag LOCUS_29180 15533 16048 CDS product lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK42 protein_id gnl|my_center|LOCUS_29180 16659 17420 gene locus_tag LOCUS_29190 16659 17420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 17575 18534 gene locus_tag LOCUS_29200 17575 18534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 19535 18600 gene locus_tag LOCUS_29210 gene menH 19535 18600 CDS product putative 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8KBE3 protein_id gnl|my_center|LOCUS_29210 19677 21563 gene locus_tag LOCUS_29220 19677 21563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 22397 21612 gene locus_tag LOCUS_29230 gene panB 22397 21612 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM44 protein_id gnl|my_center|LOCUS_29230 22929 24353 gene locus_tag LOCUS_29240 gene cbbL 22929 24353 CDS product ribulose bisphosphate carboxylase large chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIS5 protein_id gnl|my_center|LOCUS_29240 24503 24901 gene locus_tag LOCUS_29250 gene rbcX 24503 24901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_29250 24961 25296 gene locus_tag LOCUS_29260 gene rbcS 24961 25296 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_29260 27677 25431 gene locus_tag LOCUS_29270 27677 25431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 28880 28566 gene locus_tag LOCUS_29280 28880 28566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 30635 29052 gene locus_tag LOCUS_29290 30635 29052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_29290 30753 31538 gene locus_tag LOCUS_29300 30753 31538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 32886 31597 gene locus_tag LOCUS_29310 32886 31597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 33737 33126 gene locus_tag LOCUS_29320 33737 33126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057912.1 protein_id gnl|my_center|LOCUS_29320 35163 33931 gene locus_tag LOCUS_29330 gene pslH 35163 33931 CDS product biofilm formation protein PslH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113721.1 protein_id gnl|my_center|LOCUS_29330 37530 35281 gene locus_tag LOCUS_29340 37530 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 37891 41802 gene locus_tag LOCUS_29350 37891 41802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 41940 43181 gene locus_tag LOCUS_29360 gene ispG 41940 43181 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase (ferredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK70 protein_id gnl|my_center|LOCUS_29360 44345 43287 gene locus_tag LOCUS_29370 gene argC 44345 43287 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59312 protein_id gnl|my_center|LOCUS_29370 44413 44604 gene locus_tag LOCUS_29380 44413 44604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 44618 45028 gene locus_tag LOCUS_29390 44618 45028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 45243 49607 gene locus_tag LOCUS_29400 45243 49607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 50631 49621 gene locus_tag LOCUS_29410 50631 49621 CDS product fructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140505.1 protein_id gnl|my_center|LOCUS_29410 51778 50846 gene locus_tag LOCUS_29420 51778 50846 CDS product cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLN1 protein_id gnl|my_center|LOCUS_29420 53102 51900 gene locus_tag LOCUS_29430 53102 51900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 53912 53292 gene locus_tag LOCUS_29440 gene recR 53912 53292 CDS product recombination protein RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGV8 protein_id gnl|my_center|LOCUS_29440 54000 55043 gene locus_tag LOCUS_29450 54000 55043 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058231.1 protein_id gnl|my_center|LOCUS_29450 >Feature sequence32 1693 452 gene locus_tag LOCUS_29460 1693 452 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_29460 3101 2226 gene locus_tag LOCUS_29470 gene rfbB 3101 2226 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_29470 5072 3465 gene locus_tag LOCUS_29480 5072 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 5894 5256 gene locus_tag LOCUS_29490 gene tsf 5894 5256 CDS product elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VCB5 protein_id gnl|my_center|LOCUS_29490 6846 6046 gene locus_tag LOCUS_29500 gene rpsB 6846 6046 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIA2 protein_id gnl|my_center|LOCUS_29500 7159 7572 gene locus_tag LOCUS_29510 7159 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 7679 7936 gene locus_tag LOCUS_29520 7679 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 8028 8411 gene locus_tag LOCUS_29530 8028 8411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 8471 9511 gene locus_tag LOCUS_29540 8471 9511 CDS product phosphate starvation protein PhoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_29540 10060 9518 gene locus_tag LOCUS_29550 10060 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057148.1 protein_id gnl|my_center|LOCUS_29550 10537 11616 gene locus_tag LOCUS_29560 gene acsF1 10537 11616 CDS product magnesium-protoporphyrin IX monomethyl ester [oxidative] cyclase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ05 protein_id gnl|my_center|LOCUS_29560 11789 12340 gene locus_tag LOCUS_29570 11789 12340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064306.1 protein_id gnl|my_center|LOCUS_29570 12375 13238 gene locus_tag LOCUS_29580 12375 13238 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_29580 13275 14186 gene locus_tag LOCUS_29590 13275 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_29590 16601 14217 gene locus_tag LOCUS_29600 16601 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 17429 16974 gene locus_tag LOCUS_29610 17429 16974 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_29610 19707 17542 gene locus_tag LOCUS_29620 19707 17542 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_29620 20344 20766 gene locus_tag LOCUS_29630 20344 20766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120826.1 protein_id gnl|my_center|LOCUS_29630 21102 21278 gene locus_tag LOCUS_29640 21102 21278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 21569 21375 gene locus_tag LOCUS_29650 gene tatA 21569 21375 CDS product Sec-independent protein translocase protein TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ4 protein_id gnl|my_center|LOCUS_29650 22074 23762 gene locus_tag LOCUS_29660 22074 23762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_29660 23783 24481 gene locus_tag LOCUS_29670 gene nanE 23783 24481 CDS product putative N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGQ5 protein_id gnl|my_center|LOCUS_29670 24789 24478 gene locus_tag LOCUS_29680 24789 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 25234 25082 gene locus_tag LOCUS_29690 25234 25082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29690 25233 27335 gene locus_tag LOCUS_29700 25233 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_29700 28002 27352 gene locus_tag LOCUS_29710 28002 27352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 30607 28055 gene locus_tag LOCUS_29720 30607 28055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 30995 30639 gene locus_tag LOCUS_29730 30995 30639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 31062 31937 gene locus_tag LOCUS_29740 31062 31937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108099.1 protein_id gnl|my_center|LOCUS_29740 32396 31974 gene locus_tag LOCUS_29750 32396 31974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142172.1 protein_id gnl|my_center|LOCUS_29750 32757 34820 gene locus_tag LOCUS_29760 32757 34820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_29760 35240 34830 gene locus_tag LOCUS_29770 35240 34830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 36147 35407 gene locus_tag LOCUS_29780 gene rsmG 36147 35407 CDS product ribosomal RNA small subunit methyltransferase G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NMQ7 protein_id gnl|my_center|LOCUS_29780 37202 36213 gene locus_tag LOCUS_29790 37202 36213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 37801 37316 gene locus_tag LOCUS_29800 37801 37316 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_29800 37982 39121 gene locus_tag LOCUS_29810 gene aroC 37982 39121 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLM1 protein_id gnl|my_center|LOCUS_29810 39751 40392 gene locus_tag LOCUS_29820 39751 40392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 41088 40483 gene locus_tag LOCUS_29830 41088 40483 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055910.1 protein_id gnl|my_center|LOCUS_29830 41775 41104 gene locus_tag LOCUS_29840 41775 41104 CDS product biopolymer transport ExbB like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056171.1 protein_id gnl|my_center|LOCUS_29840 42097 45948 gene locus_tag LOCUS_29850 gene cobN 42097 45948 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_29850 46109 46876 gene locus_tag LOCUS_29860 gene sodA 46109 46876 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q838I4 protein_id gnl|my_center|LOCUS_29860 47221 48177 gene locus_tag LOCUS_29870 47221 48177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 48345 48524 gene locus_tag LOCUS_29880 48345 48524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29880 48570 48830 gene locus_tag LOCUS_29890 48570 48830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 49132 51843 gene locus_tag LOCUS_29900 49132 51843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence33 300 1238 gene locus_tag LOCUS_29910 gene queE 300 1238 CDS product 7-carboxy-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKG4 protein_id gnl|my_center|LOCUS_29910 1927 1268 gene locus_tag LOCUS_29920 1927 1268 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_29920 2659 2525 gene locus_tag LOCUS_29930 gene psbF 2659 2525 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIN9 protein_id gnl|my_center|LOCUS_29930 2941 2690 gene locus_tag LOCUS_29940 gene psbE 2941 2690 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIP0 protein_id gnl|my_center|LOCUS_29940 4409 3339 gene locus_tag LOCUS_29950 4409 3339 CDS product Ycf48-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI95 protein_id gnl|my_center|LOCUS_29950 4992 4495 gene locus_tag LOCUS_29960 4992 4495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 5322 5684 gene locus_tag LOCUS_29970 gene ndhC 5322 5684 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ02 protein_id gnl|my_center|LOCUS_29970 5675 6397 gene locus_tag LOCUS_29980 gene ndhK 5675 6397 CDS product NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKZ4 protein_id gnl|my_center|LOCUS_29980 6399 6929 gene locus_tag LOCUS_29990 gene ndhJ 6399 6929 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ01 protein_id gnl|my_center|LOCUS_29990 7702 6926 gene locus_tag LOCUS_30000 7702 6926 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031846.1 protein_id gnl|my_center|LOCUS_30000 9564 7774 gene locus_tag LOCUS_30010 gene dnaK2 9564 7774 CDS product chaperone protein dnaK2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI58 protein_id gnl|my_center|LOCUS_30010 10137 9769 gene locus_tag LOCUS_30020 gene ycf57 10137 9769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056711.1 protein_id gnl|my_center|LOCUS_30020 11421 10189 gene locus_tag LOCUS_30030 11421 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_30030 11561 12397 gene locus_tag LOCUS_30040 gene desC1 11561 12397 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058212.1 protein_id gnl|my_center|LOCUS_30040 13209 12550 gene locus_tag LOCUS_30050 gene lipB 13209 12550 CDS product octanoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKM7 protein_id gnl|my_center|LOCUS_30050 13472 14062 gene locus_tag LOCUS_30060 gene lrtA 13472 14062 CDS product ribosomal subunit interface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_30060 14685 17510 gene locus_tag LOCUS_30070 14685 17510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 17846 18364 gene locus_tag LOCUS_30080 gene cpcB 17846 18364 CDS product C-phycocyanin beta chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50033 protein_id gnl|my_center|LOCUS_30080 18431 18919 gene locus_tag LOCUS_30090 gene cpcA 18431 18919 CDS product C-phycocyanin alpha chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50032 protein_id gnl|my_center|LOCUS_30090 19062 19919 gene locus_tag LOCUS_30100 gene cpcE 19062 19919 CDS product phycocyanobilin lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50037 protein_id gnl|my_center|LOCUS_30100 20495 19956 gene locus_tag LOCUS_30110 20495 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 21661 20609 gene locus_tag LOCUS_30120 21661 20609 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055865.1 protein_id gnl|my_center|LOCUS_30120 21921 22829 gene locus_tag LOCUS_30130 21921 22829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 23005 26394 gene locus_tag LOCUS_30140 23005 26394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 27827 26415 gene locus_tag LOCUS_30150 27827 26415 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431680.1 protein_id gnl|my_center|LOCUS_30150 28025 28690 gene locus_tag LOCUS_30160 gene fabG 28025 28690 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124862.1 protein_id gnl|my_center|LOCUS_30160 28891 29268 gene locus_tag LOCUS_30170 28891 29268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 30511 29489 gene locus_tag LOCUS_30180 30511 29489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 32468 30684 gene locus_tag LOCUS_30190 32468 30684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 34126 33170 gene locus_tag LOCUS_30200 34126 33170 CDS product porphyromonas-type peptidyl-arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:YP_001701340.1 protein_id gnl|my_center|LOCUS_30200 36438 34363 gene locus_tag LOCUS_30210 36438 34363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 36640 37200 gene locus_tag LOCUS_30220 36640 37200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 37433 37206 gene locus_tag LOCUS_30230 37433 37206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 37351 37869 gene locus_tag LOCUS_30240 37351 37869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 39969 37885 gene locus_tag LOCUS_30250 39969 37885 CDS product prolyl endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_30250 40525 40016 gene locus_tag LOCUS_30260 40525 40016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 41259 40681 gene locus_tag LOCUS_30270 gene cpcS 41259 40681 CDS product chromophore lyase CpcS/CpeS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLU5 protein_id gnl|my_center|LOCUS_30270 41365 41201 gene locus_tag LOCUS_30280 41365 41201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 41496 42284 gene locus_tag LOCUS_30290 41496 42284 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_30290 43522 42503 gene locus_tag LOCUS_30300 43522 42503 CDS product dimethylhistidine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088459.1 protein_id gnl|my_center|LOCUS_30300 44069 44920 gene locus_tag LOCUS_30310 44069 44920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_30310 48072 45688 gene locus_tag LOCUS_30320 48072 45688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence34 2365 158 gene locus_tag LOCUS_30330 gene dnaG 2365 158 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJB0 protein_id gnl|my_center|LOCUS_30330 2973 2518 gene locus_tag LOCUS_30340 2973 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 4057 4260 gene locus_tag LOCUS_30350 4057 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 4394 4570 gene locus_tag LOCUS_30360 4394 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 4941 6410 gene locus_tag LOCUS_30370 4941 6410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 6403 7164 gene locus_tag LOCUS_30380 gene pspA 6403 7164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_30380 7344 8117 gene locus_tag LOCUS_30390 7344 8117 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_30390 8481 9794 gene locus_tag LOCUS_30400 8481 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 10520 9852 gene locus_tag LOCUS_30410 10520 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30410 12235 10655 gene locus_tag LOCUS_30420 12235 10655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_30420 13659 12694 gene locus_tag LOCUS_30430 13659 12694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 14753 13911 gene locus_tag LOCUS_30440 14753 13911 CDS product segregation and condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124329.1 protein_id gnl|my_center|LOCUS_30440 16182 15007 gene locus_tag LOCUS_30450 16182 15007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 16809 17873 gene locus_tag LOCUS_30460 gene hemE 16809 17873 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VBL3 protein_id gnl|my_center|LOCUS_30460 18676 18002 gene locus_tag LOCUS_30470 18676 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 19564 18917 gene locus_tag LOCUS_30480 19564 18917 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_30480 19770 19561 gene locus_tag LOCUS_30490 19770 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 20279 19857 gene locus_tag LOCUS_30500 20279 19857 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_30500 21273 20377 gene locus_tag LOCUS_30510 21273 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 21447 23579 gene locus_tag LOCUS_30520 gene ligA 21447 23579 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKK2 protein_id gnl|my_center|LOCUS_30520 23582 24577 gene locus_tag LOCUS_30530 23582 24577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 25626 26366 gene locus_tag LOCUS_30540 25626 26366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 26725 27915 gene locus_tag LOCUS_30550 26725 27915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 28375 29133 gene locus_tag LOCUS_30560 28375 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 31214 29184 gene locus_tag LOCUS_30570 gene narB 31214 29184 CDS product nitrate reductase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057195.1 protein_id gnl|my_center|LOCUS_30570 32618 31776 gene locus_tag LOCUS_30580 gene cmpD 32618 31776 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057838.1 protein_id gnl|my_center|LOCUS_30580 34789 32753 gene locus_tag LOCUS_30590 gene cmpC 34789 32753 CDS product bacitracin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142087.1 protein_id gnl|my_center|LOCUS_30590 36342 34945 gene locus_tag LOCUS_30600 36342 34945 CDS product nitrate transporter NrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143944.1 protein_id gnl|my_center|LOCUS_30600 37480 36614 gene locus_tag LOCUS_30610 gene nrtB 37480 36614 CDS product nitrate ABC transporter, permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057191.1 protein_id gnl|my_center|LOCUS_30610 38475 39863 gene locus_tag LOCUS_30620 38475 39863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 39860 40099 gene locus_tag LOCUS_30630 39860 40099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 40819 41094 gene locus_tag LOCUS_30640 40819 41094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence35 606 370 gene locus_tag LOCUS_30650 gene rpmB 606 370 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG62 protein_id gnl|my_center|LOCUS_30650 1655 927 gene locus_tag LOCUS_30660 1655 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30660 3029 1914 gene locus_tag LOCUS_30670 gene pdxA 3029 1914 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NLZ9 protein_id gnl|my_center|LOCUS_30670 4006 3608 gene locus_tag LOCUS_30680 gene crcB 4006 3608 CDS product putative fluoride ion transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q5SLF8 protein_id gnl|my_center|LOCUS_30680 4344 6260 gene locus_tag LOCUS_30690 4344 6260 CDS product sodium/hydrogen antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057278.1 protein_id gnl|my_center|LOCUS_30690 6436 8025 gene locus_tag LOCUS_30700 6436 8025 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_30700 8124 8588 gene locus_tag LOCUS_30710 8124 8588 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_30710 8606 12088 gene locus_tag LOCUS_30720 8606 12088 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_30720 13055 12102 gene locus_tag LOCUS_30730 13055 12102 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056905.1 protein_id gnl|my_center|LOCUS_30730 13669 13157 gene locus_tag LOCUS_30740 gene ycf36 13669 13157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_30740 14203 13694 gene locus_tag LOCUS_30750 14203 13694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 14650 15048 gene locus_tag LOCUS_30760 14650 15048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056707.1 protein_id gnl|my_center|LOCUS_30760 15211 15666 gene locus_tag LOCUS_30770 15211 15666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_30770 15735 16226 gene locus_tag LOCUS_30780 15735 16226 CDS product UPF0234 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKR4 protein_id gnl|my_center|LOCUS_30780 16311 17699 gene locus_tag LOCUS_30790 gene trmFO 16311 17699 CDS product methylenetetrahydrofolate--tRNA-(uracil-5-)-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59109 protein_id gnl|my_center|LOCUS_30790 18922 17696 gene locus_tag LOCUS_30800 18922 17696 CDS product saccharopine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087741.1 protein_id gnl|my_center|LOCUS_30800 19237 18935 gene locus_tag LOCUS_30810 19237 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 19282 19716 gene locus_tag LOCUS_30820 19282 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 19758 23360 gene locus_tag LOCUS_30830 19758 23360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 23382 23651 gene locus_tag LOCUS_30840 23382 23651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 23853 23611 gene locus_tag LOCUS_30850 23853 23611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 28257 23899 gene locus_tag LOCUS_30860 28257 23899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 29613 31535 gene locus_tag LOCUS_30870 29613 31535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 31854 32744 gene locus_tag LOCUS_30880 31854 32744 CDS product phosphonates-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016927.1 protein_id gnl|my_center|LOCUS_30880 33480 35381 gene locus_tag LOCUS_30890 33480 35381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 35766 37514 gene locus_tag LOCUS_30900 35766 37514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 39625 37634 gene locus_tag LOCUS_30910 gene htpG 39625 37634 CDS product chaperone protein HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN1 protein_id gnl|my_center|LOCUS_30910 40074 39757 gene locus_tag LOCUS_30920 40074 39757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 40900 40193 gene locus_tag LOCUS_30930 40900 40193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 41202 41276 gene locus_tag LOCUS_t00410 41202 41276 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 41607 41825 gene locus_tag LOCUS_30940 41607 41825 CDS product antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_30940 >Feature sequence36 588 76 gene locus_tag LOCUS_30950 588 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 2135 723 gene locus_tag LOCUS_30960 gene mgtE 2135 723 CDS product magnesium transporter MgtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7V9N7 protein_id gnl|my_center|LOCUS_30960 3768 2386 gene locus_tag LOCUS_30970 3768 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 5125 4364 gene locus_tag LOCUS_30980 5125 4364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_30980 5468 5223 gene locus_tag LOCUS_30990 gene secG 5468 5223 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_30990 5804 5577 gene locus_tag LOCUS_31000 5804 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 5752 6753 gene locus_tag LOCUS_31010 gene era 5752 6753 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMQ5 protein_id gnl|my_center|LOCUS_31010 6863 7453 gene locus_tag LOCUS_31020 6863 7453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_31020 7469 8530 gene locus_tag LOCUS_31030 7469 8530 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK75 protein_id gnl|my_center|LOCUS_31030 8903 8610 gene locus_tag LOCUS_31040 8903 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 9373 10374 gene locus_tag LOCUS_31050 9373 10374 CDS product delta fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031400.1 protein_id gnl|my_center|LOCUS_31050 10686 10441 gene locus_tag LOCUS_31060 10686 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 10857 11660 gene locus_tag LOCUS_31070 10857 11660 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_31070 12607 11711 gene locus_tag LOCUS_31080 12607 11711 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_31080 13370 12681 gene locus_tag LOCUS_31090 13370 12681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 14820 13831 gene locus_tag LOCUS_31100 14820 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 15417 15118 gene locus_tag LOCUS_31110 15417 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 16459 15569 gene locus_tag LOCUS_31120 16459 15569 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056762.1 protein_id gnl|my_center|LOCUS_31120 16921 17811 gene locus_tag LOCUS_31130 16921 17811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 18124 20751 gene locus_tag LOCUS_31140 18124 20751 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143682.1 protein_id gnl|my_center|LOCUS_31140 21042 21824 gene locus_tag LOCUS_31150 gene tesA 21042 21824 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_31150 22809 21841 gene locus_tag LOCUS_31160 gene por 22809 21841 CDS product protochlorophyllide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_31160 23112 23690 gene locus_tag LOCUS_31170 23112 23690 CDS product TIGR04376 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140547.1 protein_id gnl|my_center|LOCUS_31170 23801 25030 gene locus_tag LOCUS_31180 23801 25030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057110.1 protein_id gnl|my_center|LOCUS_31180 25472 29866 gene locus_tag LOCUS_31190 25472 29866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 30048 31037 gene locus_tag LOCUS_31200 30048 31037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 32105 31131 gene locus_tag LOCUS_31210 gene trpS 32105 31131 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHG3 protein_id gnl|my_center|LOCUS_31210 32562 32867 gene locus_tag LOCUS_31220 32562 32867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 33531 32941 gene locus_tag LOCUS_31230 33531 32941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 34255 33560 gene locus_tag LOCUS_31240 34255 33560 CDS product DNA-binding response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_31240 35575 34526 gene locus_tag LOCUS_31250 35575 34526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 35999 35814 gene locus_tag LOCUS_31260 35999 35814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 36261 36437 gene locus_tag LOCUS_31270 36261 36437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 37267 36446 gene locus_tag LOCUS_31280 37267 36446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 >Feature sequence37 650 153 gene locus_tag LOCUS_31290 650 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1255 845 gene locus_tag LOCUS_31300 gene atpC 1255 845 CDS product ATP synthase epsilon chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG7 protein_id gnl|my_center|LOCUS_31300 2857 1403 gene locus_tag LOCUS_31310 gene atpD 2857 1403 CDS product ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLG8 protein_id gnl|my_center|LOCUS_31310 3473 3895 gene locus_tag LOCUS_31320 3473 3895 CDS product mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142135.1 protein_id gnl|my_center|LOCUS_31320 4078 4413 gene locus_tag LOCUS_31330 gene ycf57 4078 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_31330 4576 4950 gene locus_tag LOCUS_31340 gene rpsL 4576 4950 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59168 protein_id gnl|my_center|LOCUS_31340 5310 5780 gene locus_tag LOCUS_31350 gene rpsG 5310 5780 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI44 protein_id gnl|my_center|LOCUS_31350 6006 8084 gene locus_tag LOCUS_31360 gene fusA 6006 8084 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI43 protein_id gnl|my_center|LOCUS_31360 8110 9342 gene locus_tag LOCUS_31370 gene tufA 8110 9342 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P50064 protein_id gnl|my_center|LOCUS_31370 9591 9908 gene locus_tag LOCUS_31380 gene rpsJ 9591 9908 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VA06 protein_id gnl|my_center|LOCUS_31380 10480 10013 gene locus_tag LOCUS_31390 10480 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143485.1 protein_id gnl|my_center|LOCUS_31390 10609 11874 gene locus_tag LOCUS_31400 gene argD 10609 11874 CDS product acetylornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59322 protein_id gnl|my_center|LOCUS_31400 12099 14018 gene locus_tag LOCUS_31410 12099 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 14777 14097 gene locus_tag LOCUS_31420 14777 14097 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_31420 15168 14851 gene locus_tag LOCUS_31430 15168 14851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_31430 15458 15838 gene locus_tag LOCUS_31440 15458 15838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_31440 16499 16747 gene locus_tag LOCUS_31450 16499 16747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 17776 16856 gene locus_tag LOCUS_31460 gene ycf38 17776 16856 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJA3 protein_id gnl|my_center|LOCUS_31460 18458 17883 gene locus_tag LOCUS_31470 18458 17883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 19021 19851 gene locus_tag LOCUS_31480 19021 19851 CDS product transport permease protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:B5YGJ0 protein_id gnl|my_center|LOCUS_31480 20841 19870 gene locus_tag LOCUS_31490 20841 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 22455 21247 gene locus_tag LOCUS_31500 22455 21247 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057854.1 protein_id gnl|my_center|LOCUS_31500 23594 22527 gene locus_tag LOCUS_31510 23594 22527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_31510 23973 23569 gene locus_tag LOCUS_31520 23973 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 23891 25177 gene locus_tag LOCUS_31530 23891 25177 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_31530 25244 28273 gene locus_tag LOCUS_31540 25244 28273 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392406.1 protein_id gnl|my_center|LOCUS_31540 28299 29498 gene locus_tag LOCUS_31550 gene recF 28299 29498 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DG79 protein_id gnl|my_center|LOCUS_31550 30067 29510 gene locus_tag LOCUS_31560 30067 29510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_31560 30217 31581 gene locus_tag LOCUS_31570 30217 31581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence38 860 1141 gene locus_tag LOCUS_31580 860 1141 CDS product putative pterin-4-alpha-carbinolamine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHW8 protein_id gnl|my_center|LOCUS_31580 1291 1584 gene locus_tag LOCUS_31590 gene rpsT 1291 1584 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN4 protein_id gnl|my_center|LOCUS_31590 1704 2552 gene locus_tag LOCUS_31600 gene tatD 1704 2552 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJN5 protein_id gnl|my_center|LOCUS_31600 2733 6053 gene locus_tag LOCUS_31610 gene rpoB 2733 6053 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL55 protein_id gnl|my_center|LOCUS_31610 6148 8220 gene locus_tag LOCUS_31620 gene rpoC1 6148 8220 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL56 protein_id gnl|my_center|LOCUS_31620 8345 12388 gene locus_tag LOCUS_31630 gene rpoC2 8345 12388 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL57 protein_id gnl|my_center|LOCUS_31630 13399 12629 gene locus_tag LOCUS_31640 13399 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 13468 13731 gene locus_tag LOCUS_31650 13468 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 14494 14054 gene locus_tag LOCUS_31660 14494 14054 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_31660 16011 14551 gene locus_tag LOCUS_31670 gene crtQ 16011 14551 CDS product Zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLY9 protein_id gnl|my_center|LOCUS_31670 16664 16098 gene locus_tag LOCUS_31680 16664 16098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 17895 16639 gene locus_tag LOCUS_31690 17895 16639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 18435 18722 gene locus_tag LOCUS_31700 18435 18722 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142008.1 protein_id gnl|my_center|LOCUS_31700 18775 19404 gene locus_tag LOCUS_31710 18775 19404 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140820.1 protein_id gnl|my_center|LOCUS_31710 20431 19505 gene locus_tag LOCUS_31720 20431 19505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 22267 20870 gene locus_tag LOCUS_31730 22267 20870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_31730 23129 22458 gene locus_tag LOCUS_31740 gene ntcA 23129 22458 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057487.1 protein_id gnl|my_center|LOCUS_31740 23415 24191 gene locus_tag LOCUS_31750 23415 24191 CDS product enoyl-[acyl-carrier-protein] reductase [NADH] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI97 protein_id gnl|my_center|LOCUS_31750 25482 24307 gene locus_tag LOCUS_31760 25482 24307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 25820 27250 gene locus_tag LOCUS_31770 gene murF 25820 27250 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DIM9 protein_id gnl|my_center|LOCUS_31770 27612 27238 gene locus_tag LOCUS_31780 27612 27238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 29003 27819 gene locus_tag LOCUS_31790 gene fni 29003 27819 CDS product isopentenyl-diphosphate delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJ26 protein_id gnl|my_center|LOCUS_31790 29604 33104 gene locus_tag LOCUS_31800 29604 33104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 33253 33783 gene locus_tag LOCUS_31810 33253 33783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence39 399 647 gene locus_tag LOCUS_31820 399 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 2011 797 gene locus_tag LOCUS_31830 gene lpxB 2011 797 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_31830 2912 2022 gene locus_tag LOCUS_31840 gene lpxA 2912 2022 CDS product acyl-[acyl-carrier-protein]--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI00 protein_id gnl|my_center|LOCUS_31840 3598 2969 gene locus_tag LOCUS_31850 3598 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 4704 3820 gene locus_tag LOCUS_31860 gene lpxC 4704 3820 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI02 protein_id gnl|my_center|LOCUS_31860 7912 4838 gene locus_tag LOCUS_31870 7912 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 7981 8187 gene locus_tag LOCUS_31880 7981 8187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 10461 8158 gene locus_tag LOCUS_31890 10461 8158 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_31890 13868 10725 gene locus_tag LOCUS_31900 13868 10725 CDS product multidrug transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_31900 16162 14009 gene locus_tag LOCUS_31910 16162 14009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 17598 16369 gene locus_tag LOCUS_31920 17598 16369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 18911 17706 gene locus_tag LOCUS_31930 gene argG 18911 17706 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKY7 protein_id gnl|my_center|LOCUS_31930 19209 21806 gene locus_tag LOCUS_31940 19209 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 22979 21834 gene locus_tag LOCUS_31950 22979 21834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121691.1 protein_id gnl|my_center|LOCUS_31950 24927 23317 gene locus_tag LOCUS_31960 gene guaA 24927 23317 CDS product GMP synthase [glutamine-hydrolyzing] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA5 protein_id gnl|my_center|LOCUS_31960 26353 25316 gene locus_tag LOCUS_31970 gene moaA 26353 25316 CDS product GTP 3',8-cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NCF5 protein_id gnl|my_center|LOCUS_31970 26674 26805 gene locus_tag LOCUS_31980 26674 26805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 27601 26912 gene locus_tag LOCUS_31990 27601 26912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 30173 28350 gene locus_tag LOCUS_32000 gene metE 30173 28350 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A0A0H3C4V6 protein_id gnl|my_center|LOCUS_32000 >Feature sequence40 560 745 gene locus_tag LOCUS_32010 560 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 1084 1338 gene locus_tag LOCUS_32020 1084 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056709.1 protein_id gnl|my_center|LOCUS_32020 2289 1333 gene locus_tag LOCUS_32030 gene truB 2289 1333 CDS product tRNA pseudouridine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7MBB8 protein_id gnl|my_center|LOCUS_32030 4110 2302 gene locus_tag LOCUS_32040 gene aspS 4110 2302 CDS product aspartate--tRNA(Asp/Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DJS8 protein_id gnl|my_center|LOCUS_32040 4424 5164 gene locus_tag LOCUS_32050 gene ubiX 4424 5164 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DK39 protein_id gnl|my_center|LOCUS_32050 6217 5264 gene locus_tag LOCUS_32060 6217 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 8592 6448 gene locus_tag LOCUS_32070 8592 6448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 9447 8890 gene locus_tag LOCUS_32080 9447 8890 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228051.1 protein_id gnl|my_center|LOCUS_32080 10496 9492 gene locus_tag LOCUS_32090 10496 9492 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_32090 10875 11615 gene locus_tag LOCUS_32100 10875 11615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 11789 12943 gene locus_tag LOCUS_32110 gene metB 11789 12943 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120920.1 protein_id gnl|my_center|LOCUS_32110 13764 13138 gene locus_tag LOCUS_32120 13764 13138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 14727 14251 gene locus_tag LOCUS_32130 14727 14251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 16192 14960 gene locus_tag LOCUS_32140 16192 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 16362 17339 gene locus_tag LOCUS_32150 gene ispE 16362 17339 CDS product 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLJ1 protein_id gnl|my_center|LOCUS_32150 17391 18074 gene locus_tag LOCUS_32160 gene queC 17391 18074 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI59 protein_id gnl|my_center|LOCUS_32160 18723 19094 gene locus_tag LOCUS_32170 18723 19094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 24733 19109 gene locus_tag LOCUS_32180 24733 19109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 24953 24630 gene locus_tag LOCUS_32190 24953 24630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 25395 26123 gene locus_tag LOCUS_32200 gene rph 25395 26123 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLA4 protein_id gnl|my_center|LOCUS_32200 26142 26282 gene locus_tag LOCUS_32210 26142 26282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence41 519 1616 gene locus_tag LOCUS_32220 gene leuB 519 1616 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P59029 protein_id gnl|my_center|LOCUS_32220 1756 2265 gene locus_tag LOCUS_32230 1756 2265 CDS product thermonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_32230 3011 2337 gene locus_tag LOCUS_32240 3011 2337 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_32240 3692 4615 gene locus_tag LOCUS_32250 3692 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022329.1 protein_id gnl|my_center|LOCUS_32250 4970 5164 gene locus_tag LOCUS_32260 4970 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 5342 8974 gene locus_tag LOCUS_32270 gene metH 5342 8974 CDS product 5-methyltetrahydrofolate--homocysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056870.1 protein_id gnl|my_center|LOCUS_32270 9222 10370 gene locus_tag LOCUS_32280 gene sasA 9222 10370 CDS product adaptive-response sensory-kinase SasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMT2 protein_id gnl|my_center|LOCUS_32280 10412 11710 gene locus_tag LOCUS_32290 10412 11710 CDS product molybdopterin molybdenumtransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_32290 12024 12563 gene locus_tag LOCUS_32300 12024 12563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 14080 12584 gene locus_tag LOCUS_32310 14080 12584 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_32310 14602 14471 gene locus_tag LOCUS_32320 14602 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 14879 15244 gene locus_tag LOCUS_32330 14879 15244 CDS product Fe-S cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_32330 15452 15721 gene locus_tag LOCUS_32340 15452 15721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 15766 16368 gene locus_tag LOCUS_32350 15766 16368 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100063.1 protein_id gnl|my_center|LOCUS_32350 16409 17260 gene locus_tag LOCUS_32360 16409 17260 CDS product type 4 prepilin-like proteins leader peptide-processing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLL0 protein_id gnl|my_center|LOCUS_32360 17365 17538 gene locus_tag LOCUS_32370 17365 17538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 17676 18188 gene locus_tag LOCUS_32380 17676 18188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 19802 18225 gene locus_tag LOCUS_32390 19802 18225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 20775 20044 gene locus_tag LOCUS_32400 20775 20044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 21782 21024 gene locus_tag LOCUS_32410 21782 21024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941153.1 protein_id gnl|my_center|LOCUS_32410 22365 21802 gene locus_tag LOCUS_32420 gene tag 22365 21802 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941230.1 protein_id gnl|my_center|LOCUS_32420 24764 22392 gene locus_tag LOCUS_32430 24764 22392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 24949 25521 gene locus_tag LOCUS_32440 24949 25521 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_32440 25647 26198 gene locus_tag LOCUS_32450 gene pyrR 25647 26198 CDS product bifunctional protein PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ7 protein_id gnl|my_center|LOCUS_32450 26443 26195 gene locus_tag LOCUS_32460 26443 26195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence42 4019 162 gene locus_tag LOCUS_32470 4019 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 6334 4097 gene locus_tag LOCUS_32480 6334 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 6632 8053 gene locus_tag LOCUS_32490 6632 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 8388 9194 gene locus_tag LOCUS_32500 8388 9194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 11577 9175 gene locus_tag LOCUS_32510 11577 9175 CDS product DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DM14 protein_id gnl|my_center|LOCUS_32510 11726 12178 gene locus_tag LOCUS_32520 11726 12178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 13347 12202 gene locus_tag LOCUS_32530 13347 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056632.1 protein_id gnl|my_center|LOCUS_32530 14448 13408 gene locus_tag LOCUS_32540 gene dnaJ 14448 13408 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_32540 14537 14722 gene locus_tag LOCUS_32550 14537 14722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 14757 14849 gene locus_tag LOCUS_t00420 14757 14849 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15141 16439 gene locus_tag LOCUS_32560 15141 16439 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_32560 16557 16633 gene locus_tag LOCUS_t00430 16557 16633 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16784 16860 gene locus_tag LOCUS_t00440 16784 16860 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17022 18008 gene locus_tag LOCUS_32570 17022 18008 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_32570 18940 18026 gene locus_tag LOCUS_32580 18940 18026 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_32580 19727 19029 gene locus_tag LOCUS_32590 19727 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 20904 19948 gene locus_tag LOCUS_32600 gene sigD 20904 19948 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_32600 22896 21259 gene locus_tag LOCUS_32610 gene groL 22896 21259 CDS product 60 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMD4 protein_id gnl|my_center|LOCUS_32610 23341 23030 gene locus_tag LOCUS_32620 gene groS 23341 23030 CDS product 10 kDa chaperonin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7TV92 protein_id gnl|my_center|LOCUS_32620 24800 23790 gene locus_tag LOCUS_32630 24800 23790 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_32630 >Feature sequence43 2233 3237 gene locus_tag LOCUS_32640 2233 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 3327 4403 gene locus_tag LOCUS_32650 3327 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 4526 4882 gene locus_tag LOCUS_32660 4526 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 4882 5124 gene locus_tag LOCUS_32670 4882 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 6152 5121 gene locus_tag LOCUS_32680 6152 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 6535 6176 gene locus_tag LOCUS_32690 6535 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 6693 7610 gene locus_tag LOCUS_32700 6693 7610 CDS product short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727261.1 protein_id gnl|my_center|LOCUS_32700 7764 8258 gene locus_tag LOCUS_32710 7764 8258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 8291 9892 gene locus_tag LOCUS_32720 8291 9892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 10104 10586 gene locus_tag LOCUS_32730 10104 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 11166 10636 gene locus_tag LOCUS_32740 11166 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 11375 11175 gene locus_tag LOCUS_32750 11375 11175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 13274 11664 gene locus_tag LOCUS_32760 13274 11664 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_32760 13637 13861 gene locus_tag LOCUS_32770 13637 13861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 13896 15896 gene locus_tag LOCUS_32780 13896 15896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 17734 15854 gene locus_tag LOCUS_32790 17734 15854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 18023 18736 gene locus_tag LOCUS_32800 gene rpe 18023 18736 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGE8 protein_id gnl|my_center|LOCUS_32800 18995 20323 gene locus_tag LOCUS_32810 18995 20323 CDS product chloride channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_32810 20589 20320 gene locus_tag LOCUS_32820 20589 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 21135 22343 gene locus_tag LOCUS_32830 21135 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 22387 23127 gene locus_tag LOCUS_32840 22387 23127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 23610 23185 gene locus_tag LOCUS_32850 23610 23185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 >Feature sequence44 290 505 gene locus_tag LOCUS_32860 290 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142236.1 protein_id gnl|my_center|LOCUS_32860 554 1117 gene locus_tag LOCUS_32870 gene cysC 554 1117 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NN99 protein_id gnl|my_center|LOCUS_32870 1541 6310 gene locus_tag LOCUS_32880 1541 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 6307 7458 gene locus_tag LOCUS_32890 6307 7458 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_32890 7642 9450 gene locus_tag LOCUS_32900 7642 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 9526 10812 gene locus_tag LOCUS_32910 gene cfa 9526 10812 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964195.1 protein_id gnl|my_center|LOCUS_32910 12167 10818 gene locus_tag LOCUS_32920 gene ctpA 12167 10818 CDS product carboxyl-terminal processing protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_32920 12553 13200 gene locus_tag LOCUS_32930 gene petB 12553 13200 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:P0C8M7 protein_id gnl|my_center|LOCUS_32930 13576 14058 gene locus_tag LOCUS_32940 gene petD 13576 14058 CDS product cytochrome b6-f complex subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7VDK8 protein_id gnl|my_center|LOCUS_32940 15946 14207 gene locus_tag LOCUS_32950 15946 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_32950 16050 17543 gene locus_tag LOCUS_32960 gene sun 16050 17543 CDS product ribosomal RNA small subunit methyltransferase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMB2 protein_id gnl|my_center|LOCUS_32960 17540 18127 gene locus_tag LOCUS_32970 gene cpcT4 17540 18127 CDS product chromophore lyase CpcT/CpeT 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NKE0 protein_id gnl|my_center|LOCUS_32970 18557 18156 gene locus_tag LOCUS_32980 18557 18156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 18671 18943 gene locus_tag LOCUS_32990 18671 18943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 20098 19079 gene locus_tag LOCUS_33000 gene hemF 20098 19079 CDS product oxygen-dependent coproporphyrinogen-III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DL15 protein_id gnl|my_center|LOCUS_33000 20450 21559 gene locus_tag LOCUS_33010 20450 21559 CDS product iron-sulfur cluster carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGA4 protein_id gnl|my_center|LOCUS_33010 21602 22855 gene locus_tag LOCUS_33020 21602 22855 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141486.1 protein_id gnl|my_center|LOCUS_33020 23677 22886 gene locus_tag LOCUS_33030 23677 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 >Feature sequence45 597 746 gene locus_tag LOCUS_33040 597 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3912 892 gene locus_tag LOCUS_33050 3912 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 5412 4084 gene locus_tag LOCUS_33060 5412 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 6842 5961 gene locus_tag LOCUS_33070 6842 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 8437 7109 gene locus_tag LOCUS_33080 gene pilT 8437 7109 CDS product twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_33080 9251 10900 gene locus_tag LOCUS_33090 9251 10900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_33090 11988 10948 gene locus_tag LOCUS_33100 11988 10948 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_33100 12858 13847 gene locus_tag LOCUS_33110 12858 13847 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123698.1 protein_id gnl|my_center|LOCUS_33110 14085 15239 gene locus_tag LOCUS_33120 14085 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 16041 15826 gene locus_tag LOCUS_33130 16041 15826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 16125 17189 gene locus_tag LOCUS_33140 gene ddl 16125 17189 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DLH0 protein_id gnl|my_center|LOCUS_33140 17457 20303 gene locus_tag LOCUS_33150 17457 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 20634 20960 gene locus_tag LOCUS_33160 20634 20960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 >Feature sequence46 1142 123 gene locus_tag LOCUS_33170 1142 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 1474 1139 gene locus_tag LOCUS_33180 1474 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 1948 1478 gene locus_tag LOCUS_33190 1948 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2904 2635 gene locus_tag LOCUS_33200 2904 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 3378 3163 gene locus_tag LOCUS_33210 3378 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 3693 3382 gene locus_tag LOCUS_33220 3693 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 3942 3727 gene locus_tag LOCUS_33230 3942 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 4263 3946 gene locus_tag LOCUS_33240 4263 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 4844 4572 gene locus_tag LOCUS_33250 4844 4572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 5338 6354 gene locus_tag LOCUS_33260 5338 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 6357 6641 gene locus_tag LOCUS_33270 6357 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 6712 7011 gene locus_tag LOCUS_33280 6712 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 7016 7243 gene locus_tag LOCUS_33290 7016 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 7301 7642 gene locus_tag LOCUS_33300 7301 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 7639 8271 gene locus_tag LOCUS_33310 7639 8271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 8271 8786 gene locus_tag LOCUS_33320 8271 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 8955 10187 gene locus_tag LOCUS_33330 8955 10187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 10456 11877 gene locus_tag LOCUS_33340 10456 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 11887 12465 gene locus_tag LOCUS_33350 11887 12465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 12371 12703 gene locus_tag LOCUS_33360 12371 12703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 13604 15619 gene locus_tag LOCUS_33370 13604 15619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 15619 16977 gene locus_tag LOCUS_33380 15619 16977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 17097 17597 gene locus_tag LOCUS_33390 17097 17597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 17687 18139 gene locus_tag LOCUS_33400 17687 18139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 18267 18566 gene locus_tag LOCUS_33410 18267 18566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33410 19008 18571 gene locus_tag LOCUS_33420 19008 18571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 19232 19579 gene locus_tag LOCUS_33430 19232 19579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33430 >Feature sequence47 1481 555 gene locus_tag LOCUS_33440 1481 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 2297 1836 gene locus_tag LOCUS_33450 2297 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_33450 3103 2627 gene locus_tag LOCUS_33460 3103 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_33460 3431 4807 gene locus_tag LOCUS_33470 gene glgA 3431 4807 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKU2 protein_id gnl|my_center|LOCUS_33470 7131 4861 gene locus_tag LOCUS_33480 7131 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 8585 7164 gene locus_tag LOCUS_33490 8585 7164 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_33490 8800 10629 gene locus_tag LOCUS_33500 gene recQ 8800 10629 CDS product ATP-dependent DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142623.1 protein_id gnl|my_center|LOCUS_33500 10713 11078 gene locus_tag LOCUS_33510 10713 11078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 12112 11681 gene locus_tag LOCUS_33520 12112 11681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057567.1 protein_id gnl|my_center|LOCUS_33520 12987 12406 gene locus_tag LOCUS_33530 gene cobU 12987 12406 CDS product adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_33530 13954 13016 gene locus_tag LOCUS_33540 13954 13016 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144233.1 protein_id gnl|my_center|LOCUS_33540 14210 14031 gene locus_tag LOCUS_33550 14210 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 16299 14152 gene locus_tag LOCUS_33560 16299 14152 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140059.1 protein_id gnl|my_center|LOCUS_33560 17605 16274 gene locus_tag LOCUS_33570 gene purD 17605 16274 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DHV4 protein_id gnl|my_center|LOCUS_33570 >Feature sequence48 3344 1923 gene locus_tag LOCUS_33580 3344 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 4817 3393 gene locus_tag LOCUS_33590 gene opuE 4817 3393 CDS product sodium:proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_33590 7552 4958 gene locus_tag LOCUS_33600 7552 4958 CDS product polynucleotide kinase-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530161.1 protein_id gnl|my_center|LOCUS_33600 8967 7555 gene locus_tag LOCUS_33610 8967 7555 CDS product 3' terminal RNA ribose 2'-O-methyltransferase Hen1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030574.1 protein_id gnl|my_center|LOCUS_33610 11324 9015 gene locus_tag LOCUS_33620 11324 9015 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_33620 13080 11458 gene locus_tag LOCUS_33630 13080 11458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_33630 14202 13165 gene locus_tag LOCUS_33640 14202 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 14899 14261 gene locus_tag LOCUS_33650 14899 14261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057957.1 protein_id gnl|my_center|LOCUS_33650 15735 15073 gene locus_tag LOCUS_33660 gene purN 15735 15073 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGJ1 protein_id gnl|my_center|LOCUS_33660 15924 16643 gene locus_tag LOCUS_33670 15924 16643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence49 489 5825 gene locus_tag LOCUS_33680 489 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 5988 6749 gene locus_tag LOCUS_33690 5988 6749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056526.1 protein_id gnl|my_center|LOCUS_33690 6740 7909 gene locus_tag LOCUS_33700 6740 7909 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056527.1 protein_id gnl|my_center|LOCUS_33700 8696 7917 gene locus_tag LOCUS_33710 8696 7917 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_33710 8942 9487 gene locus_tag LOCUS_33720 8942 9487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_33720 9548 10294 gene locus_tag LOCUS_33730 9548 10294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 10872 10348 gene locus_tag LOCUS_33740 10872 10348 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_33740 12217 11090 gene locus_tag LOCUS_33750 12217 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_33750 12873 12328 gene locus_tag LOCUS_33760 12873 12328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_33760 14903 13089 gene locus_tag LOCUS_33770 14903 13089 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057611.1 protein_id gnl|my_center|LOCUS_33770 15725 16285 gene locus_tag LOCUS_33780 15725 16285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence50 894 3914 gene locus_tag LOCUS_33790 894 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 4142 6910 gene locus_tag LOCUS_33800 4142 6910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 7327 8856 gene locus_tag LOCUS_33810 7327 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056293.1 protein_id gnl|my_center|LOCUS_33810 8957 11533 gene locus_tag LOCUS_33820 8957 11533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 12013 12447 gene locus_tag LOCUS_33830 12013 12447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 12474 13007 gene locus_tag LOCUS_33840 12474 13007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 13104 15935 gene locus_tag LOCUS_33850 13104 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence51 552 76 gene locus_tag LOCUS_33860 552 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 719 1618 gene locus_tag LOCUS_33870 gene metR 719 1618 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035570.1 protein_id gnl|my_center|LOCUS_33870 1865 2434 gene locus_tag LOCUS_33880 1865 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 2813 4105 gene locus_tag LOCUS_33890 2813 4105 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_33890 5979 4075 gene locus_tag LOCUS_33900 5979 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 7745 6321 gene locus_tag LOCUS_33910 7745 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 8375 7953 gene locus_tag LOCUS_33920 8375 7953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 8688 9329 gene locus_tag LOCUS_33930 8688 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 10315 9476 gene locus_tag LOCUS_33940 10315 9476 CDS product lactose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_33940 11402 10365 gene locus_tag LOCUS_33950 gene cobW 11402 10365 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_33950 12080 11433 gene locus_tag LOCUS_33960 12080 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 12688 12176 gene locus_tag LOCUS_33970 12688 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 13312 12965 gene locus_tag LOCUS_33980 13312 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence52 533 736 gene locus_tag LOCUS_33990 533 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 1092 841 gene locus_tag LOCUS_34000 1092 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 2190 1150 gene locus_tag LOCUS_34010 2190 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 3043 2399 gene locus_tag LOCUS_34020 3043 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 4368 3190 gene locus_tag LOCUS_34030 4368 3190 CDS product alanine--glyoxylate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125189.1 protein_id gnl|my_center|LOCUS_34030 4542 5192 gene locus_tag LOCUS_34040 4542 5192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_34040 5254 5898 gene locus_tag LOCUS_34050 5254 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_34050 6847 5993 gene locus_tag LOCUS_34060 gene thiG 6847 5993 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DMP6 protein_id gnl|my_center|LOCUS_34060 7117 7896 gene locus_tag LOCUS_34070 gene bioD 7117 7896 CDS product ATP-dependent dethiobiotin synthetase BioD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NFL5 protein_id gnl|my_center|LOCUS_34070 7965 8234 gene locus_tag LOCUS_34080 7965 8234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_34080 8385 8984 gene locus_tag LOCUS_34090 gene cobL 8385 8984 CDS product precorrin-6B methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_34090 9117 10091 gene locus_tag LOCUS_34100 gene cdsA 9117 10091 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_34100 10476 10715 gene locus_tag LOCUS_34110 10476 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 11601 10975 gene locus_tag LOCUS_34120 11601 10975 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140132.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence53 34 439 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgttaattcaggattggagattggtcagag 894 823 gene locus_tag LOCUS_t00450 894 823 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1068 2141 gene locus_tag LOCUS_34130 gene trpD 1068 2141 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DI76 protein_id gnl|my_center|LOCUS_34130 2154 2903 gene locus_tag LOCUS_34140 2154 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 2954 3562 gene locus_tag LOCUS_34150 2954 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 3608 4111 gene locus_tag LOCUS_34160 3608 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34160 4124 4423 gene locus_tag LOCUS_34170 4124 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34170 5748 4585 gene locus_tag LOCUS_34180 5748 4585 CDS product glycine amidinotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228026.1 protein_id gnl|my_center|LOCUS_34180 6688 7140 gene locus_tag LOCUS_34190 6688 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 7370 7059 gene locus_tag LOCUS_34200 7370 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 7567 7370 gene locus_tag LOCUS_34210 7567 7370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 7904 8350 gene locus_tag LOCUS_34220 7904 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 9859 8324 gene locus_tag LOCUS_34230 9859 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_34230 10357 10178 gene locus_tag LOCUS_34240 10357 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 10606 10842 gene locus_tag LOCUS_34250 10606 10842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence54 368 2320 gene locus_tag LOCUS_34260 368 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 3247 2492 gene locus_tag LOCUS_34270 3247 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 5068 4025 gene locus_tag LOCUS_34280 5068 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 5449 6795 gene locus_tag LOCUS_34290 gene ahcY 5449 6795 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGC8 protein_id gnl|my_center|LOCUS_34290 7798 8340 gene locus_tag LOCUS_34300 7798 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 8506 9105 gene locus_tag LOCUS_34310 8506 9105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 9680 9225 gene locus_tag LOCUS_34320 9680 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 9790 10443 gene locus_tag LOCUS_34330 9790 10443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 11254 10487 gene locus_tag LOCUS_34340 11254 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 >Feature sequence55 511 1107 gene locus_tag LOCUS_34350 511 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144275.1 protein_id gnl|my_center|LOCUS_34350 1957 1328 gene locus_tag LOCUS_34360 gene wcaF 1957 1328 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_34360 2954 2001 gene locus_tag LOCUS_34370 2954 2001 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_34370 4306 3122 gene locus_tag LOCUS_34380 4306 3122 CDS product cysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_34380 5741 4293 gene locus_tag LOCUS_34390 5741 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_34390 6470 6943 gene locus_tag LOCUS_34400 gene bfrB 6470 6943 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q9HY79 protein_id gnl|my_center|LOCUS_34400 7011 7490 gene locus_tag LOCUS_34410 7011 7490 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q889U4 protein_id gnl|my_center|LOCUS_34410 7661 9175 gene locus_tag LOCUS_34420 7661 9175 CDS product RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_34420 10650 9199 gene locus_tag LOCUS_34430 10650 9199 CDS product multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:NP_600173.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence56 1610 399 gene locus_tag LOCUS_34440 1610 399 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021301.1 protein_id gnl|my_center|LOCUS_34440 1695 3440 gene locus_tag LOCUS_34450 1695 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3644 4483 gene locus_tag LOCUS_34460 3644 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 5124 4594 gene locus_tag LOCUS_34470 5124 4594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 6273 5167 gene locus_tag LOCUS_34480 gene gcvT 6273 5167 CDS product aminomethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKV6 protein_id gnl|my_center|LOCUS_34480 6917 6444 gene locus_tag LOCUS_34490 6917 6444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_34490 7110 7724 gene locus_tag LOCUS_34500 7110 7724 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967875.1 protein_id gnl|my_center|LOCUS_34500 7905 7732 gene locus_tag LOCUS_34510 7905 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 8066 10009 gene locus_tag LOCUS_34520 8066 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 >Feature sequence57 3311 2646 gene locus_tag LOCUS_34530 3311 2646 CDS product threonylcarbamoyl-AMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_34530 3462 4883 gene locus_tag LOCUS_34540 3462 4883 CDS product UPF0272 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DGM0 protein_id gnl|my_center|LOCUS_34540 4924 5892 gene locus_tag LOCUS_34550 gene gshB 4924 5892 CDS product glutathione synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q8DKF1 protein_id gnl|my_center|LOCUS_34550 6199 7356 gene locus_tag LOCUS_34560 6199 7356 CDS product NAD-dependent dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_34560 7542 8348 gene locus_tag LOCUS_34570 gene spnIM 7542 8348 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:A3CPJ4 protein_id gnl|my_center|LOCUS_34570 8417 9550 gene locus_tag LOCUS_34580 8417 9550 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_34580 >Feature sequence58 639 1589 gene locus_tag LOCUS_34590 gene ytcB 639 1589 CDS product putative UDP-glucose epimerase YtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:O34886 protein_id gnl|my_center|LOCUS_34590 1621 1992 gene locus_tag LOCUS_34600 1621 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 2862 2026 gene locus_tag LOCUS_34610 2862 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 4622 2925 gene locus_tag LOCUS_34620 4622 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 4998 5303 gene locus_tag LOCUS_34630 gene fdx 4998 5303 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_34630 6497 5457 gene locus_tag LOCUS_34640 6497 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 6681 7559 gene locus_tag LOCUS_34650 6681 7559 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence59 729 121 gene locus_tag LOCUS_34660 729 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1886 1068 gene locus_tag LOCUS_34670 gene ycf43 1886 1068 CDS product Sec-independent protein translocase protein TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:Q7NJC0 protein_id gnl|my_center|LOCUS_34670 2146 3213 gene locus_tag LOCUS_34680 2146 3213 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_34680 3331 3906 gene locus_tag LOCUS_34690 3331 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 4073 4158 gene locus_tag LOCUS_t00460 4073 4158 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4448 4948 gene locus_tag LOCUS_34700 gene ycf21 4448 4948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057402.1 protein_id gnl|my_center|LOCUS_34700 5836 5057 gene locus_tag LOCUS_34710 5836 5057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 7649 6015 gene locus_tag LOCUS_34720 7649 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 >Feature sequence60 474 271 gene locus_tag LOCUS_34730 474 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 2537 549 gene locus_tag LOCUS_34740 2537 549 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_34740 3724 2600 gene locus_tag LOCUS_34750 3724 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 4376 3792 gene locus_tag LOCUS_34760 4376 3792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 5240 6487 gene locus_tag LOCUS_34770 5240 6487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_34770 6598 7095 gene locus_tag LOCUS_34780 6598 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 7080 7664 gene locus_tag LOCUS_34790 7080 7664 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404744.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence61 3264 106 gene locus_tag LOCUS_34800 3264 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 3595 3780 gene locus_tag LOCUS_34810 3595 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 5796 3886 gene locus_tag LOCUS_34820 5796 3886 CDS product ATPase AAA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109168.1 protein_id gnl|my_center|LOCUS_34820 6074 5826 gene locus_tag LOCUS_34830 6074 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 >Feature sequence62 186 497 gene locus_tag LOCUS_34840 186 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1186 593 gene locus_tag LOCUS_34850 1186 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_34850 1376 2017 gene locus_tag LOCUS_34860 1376 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 2442 2170 gene locus_tag LOCUS_34870 2442 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2717 2580 gene locus_tag LOCUS_34880 2717 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 >Feature sequence63 50 493 gene locus_tag LOCUS_34890 50 493 CDS product IS200/IS605 family transposase ISMac7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020315.1 protein_id gnl|my_center|LOCUS_34890 784 485 gene locus_tag LOCUS_34900 784 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 851 1441 gene locus_tag LOCUS_34910 851 1441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_34910 1537 2781 gene locus_tag LOCUS_34920 1537 2781 CDS product cytosine-specific methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniProtKB:F9Y936 protein_id gnl|my_center|LOCUS_34920 >Feature sequence64 641 252 gene locus_tag LOCUS_34930 641 252 CDS product pilus biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_34930 927 628 gene locus_tag LOCUS_34940 927 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1262 954 gene locus_tag LOCUS_34950 1262 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34950 1625 1275 gene locus_tag LOCUS_34960 1625 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34960 >Feature sequence65 635 796 gene locus_tag LOCUS_34970 635 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 796 1056 gene locus_tag LOCUS_34980 796 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 1105 1344 gene locus_tag LOCUS_34990 1105 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 >Feature sequence66 962 72 gene locus_tag LOCUS_35000 962 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 1294 1479 gene locus_tag LOCUS_35010 1294 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010